|
|
||||||||
1 Molecular Medicine and Renal
Units, The cellular and
subcellular localizations of the AE2 anion exchanger in
rat kidney have remained elusive despite detection of moderately
abundant AE2 mRNA and AE2 polypeptide in all kidney regions. In this
report a simple epitope unmasking technique has allowed the
immunolocalization of AE2 antigenic sites in basolateral membranes of
several rat kidney tubular epithelial cells. AE2 immunostaining was
faint or absent in the glomerulus and proximal tubule, present in
descending and ascending thin limbs, and stronger in the medullary
thick ascending limb (MTAL). A lower staining intensity was found in
cortical thick ascending limbs and even less in the distal
convoluted tubule. In contrast, there was an enhanced staining in the
macula densa. In principal cells (PC) of the connecting segment, AE2
was undetectable but gradually increased in intensity along the
collecting duct, with strongest staining in inner medullary collecting
duct (IMCD) PC. A sodium dodecyl sulfate-sensitive AE2-related Golgi
epitope was also detected in some interstitial and endothelial cells of
the inner medulla and in epithelial cells of IMCD and MTAL. Colchicine
treatment of the intact animal altered the distribution of this
Golgi-associated epitope but left plasmalemmal AE2 undisturbed. Reverse
transcription-polymerase chain reaction detected AE2a, AE2b, and AE2c2
but not AE2c1 transcripts in rat kidney mRNA. The results suggest a
widespread occurrence of the AE2 protein in several renal epithelial
cell types.
chloride/bicarbonate exchange; immunomicroscopy; macula densa; thin
limbs of Henle; thick limb of Henle; collecting duct; epitope
unmasking
PLASMALEMMAL
Cl Cl An NH2-terminally truncated AE1
polypeptide (9) has been localized in the kidney of many species,
including rat (4) and mouse (8), to the basolateral surface of
type A intercalated cells (IC) of both medullary collecting duct and
cortical collecting duct (CCD) and of connecting segments
(CNT). The source of this immunostaining pattern as AE1
has been more recently confirmed by documentation of its absence in
type A IC of mice null for expression of the entire AE1 gene (30).
Molecular identification of the polypeptides responsible for
Cl AE1 has been localized to basolateral membranes of type A IC in many
species, consistent with the amply documented presence of
Cl The AE2 polypeptide has been detected by immunoblot in rat and mouse
kidney, with higher levels per milligram of protein in medulla than in
cortex (10). Antipeptide antibodies recognizing four distinct epitopes
of AE2 have localized AE2 polypeptide by immunocytochemical techniques
in transiently transfected cultured cells and in semithin sections of
choroid plexus epithelial cells (6) and gastric parietal cells (35),
the sites of greatest abundance of AE2 mRNA. Immunohistochemical
detection of AE2 in stomach and choroid plexus correlated with AE2
polypeptide abundance on immunoblot in these tissues (6, 10, 35).
However, immunolocalization of AE2 in kidney using the same methods and
antibody reagents proved unsuccessful.
In recent years, epitope unmasking techniques have been introduced to
enhance the sensitivity of antigen immunodetection in microscopic
tissue sections and in fixed cells on coverslips. Recently, we reported
a new addition to the repertoire of epitope unmasking techniques, that
is, brief pretreatment with sodium dodecyl sulfate (SDS) of
aldehyde-fixed tissue sections on slides. This procedure was useful for
antibodies raised against numerous proteins and in several cases proved
to be a requirement for immunocytochemical competence of the antibody.
SDS pretreatment of fixed cells was also found greatly to enhance
detection of basolateral AE2 anion exchanger in Madin-Darby canine
kidney (MDCK) cells grown on cellulose nitrate supports (13).
We have now used the SDS epitope unmasking technique to detect the AE2
polypeptide in cryosections of rat kidney. AE2 was shown to be
localized in basolateral membranes of tubular epithelial cells in all
nephron segments beyond the proximal tubule. An additional AE2-related
epitope was present in the Golgi apparatus of multiple cell types, most
notably in epithelial cells of IMCD and MTAL.
Tissue preparation. Adult male or
postpartum female Sprague-Dawley rats were maintained on a
standard diet and had free access to water. Where noted, two animals
were injected intraperitoneally with colchicine (0.5 mg/100 g body wt)
6 h before death as previously described (19). Animals anesthetized
with Nembutal (65 mg/kg ip) were perfused via the left ventricle with
Hanks' balanced solution, with drainage from the severed inferior vena
cava, until the kidneys were thoroughly blanched. The rats were then
perfusion-fixed with 2% paraformaldehyde/75 mM lysine/10 mM sodium
periodate (PLP) as previously described (4, 19). Some rats were
perfusion-fixed with 3% paraformaldehyde in 140 mM NaCl, 20 mM sodium
phosphate, pH 7.4 [phosphate-buffered saline (PBS)].
PLP-perfused and paraformaldehyde-perfused kidneys were excised, cut
into blocks of cortex, medullary outer stripe and inner stripe, or into
larger coronal blocks, and further fixed in PLP overnight at 4°C.
Fixed tissue blocks were washed four times with PBS, then stored at
4°C in PBS containing 0.02% sodium azide until further use.
Antibodies. Affinity-purified rabbit
polyclonal anti-AE2 amino acids (aa) 1224-1237, directed against
the COOH terminus of AE2, and affinity-purified rabbit polyclonal
anti-AE2 aa 961-974 and 424-440 have been previously
described (6, 35). Crude rabbit antiserum raised against mouse AE1
aa 917-929, directed against the COOH terminus of
AE1, was prepared by the same methods and has been previously described
as an immunoprecipitating
reagent1
(15). Mouse monoclonal antibody (MAb) to immunoglobulin G1 (IgG1), MAb
12B11, was raised against rat red blood cell ghosts stripped with 0.1 N NaOH and characterized as competent in
immunoprecipitation and immunoblot assays using red cell AE1 and in
immunocytochemical assays using red blood cells and (as shown here)
type A renal IC. Secondary antibodies were Cy3-coupled donkey
anti-rabbit Ig, and fluorescein-coupled or
dichlorotriazinylamino-fluorescein-coupled goat anti-rabbit and goat
anti-mouse Ig (Jackson Immunoresearch, West Grove, PA).
Immunofluorescence microscopy. Fixed
tissue blocks were infiltrated with 30% sucrose in PBS, frozen in
liquid nitrogen, and sectioned at 5-7 µm thickness on a
Reichert-Jung Frigocut model 2300N cryostat. Some tissue blocks were
sequentially infiltrated with 1.6 M and 2.3 M sucrose, prior to
sectioning at 1-µm thickness on a Reichert-Jung Ultracut
ultracryotome. Sections were placed on Superfrost/Plus Microscope
Slides (Fisher) and stored in PBS/azide at 4°C until use or
alternatively stored at Indirect immunofluorescence was performed as previously described (4,
6, 32, 35). Sections were preincubated at room temperature in PBS for
10 min, in 1% bovine serum albumin in PBS for 15 min, then incubated
at room temperature for 1-2 h with primary antibody as indicated.
Some sections were subjected to a double-incubation procedure. Epitope
unmasking with SDS was performed as previously reported (13).
Cryosections of fixed tissue on slides were brought to room
temperature, rehydrated in PBS for 5 min, then exposed to 1% SDS in
PBS for 15 min, followed by three 5-min washes with PBS prior to
incubation with primary antibody for 1 h. (SDS exposure for 10 or for 5 min was equally effective.) Peptide antigens were included in the
incubation mix at 12 µg/ml unless otherwise noted. Irrelevant
peptides were included at 12 µg/ml in all incubations designed to
localize antigen. In some cases, consecutive sections were incubated
with and without SDS treatment, to compare results on the same tubule
segments.
Sections were then incubated for 1 h with fluorophore-conjugated
secondary antibodies (10-15 µg/ml), again washed for three 5-min washes in PBS, and mounted in 50% glycerol in PBS, pH 7.5, containing 2% n-propyl-gallate as an
antiquenching agent. Sections were examined and photographed with
a Olympus BH-2 or a Nikon FXA epifluorescence photomicroscope,
using Kodak TMAX 400 film push-processed to 1600 ASA.
Immunoperoxidase electron microscopy.
PLP-fixed tissue was cryoprotected in 10% dimethyl sulfoxide for 1 h,
then frozen in liquid N2, and
30-µm cryosections were cut. Sections were incubated at 4°C for
10 min in PBS containing 0.05% saponin, then incubated overnight at
4°C with affinity-purified anti-AE2 aa 1224-1237 diluted 1:400
in PBS saponin. After six 10-min rinses in PBS saponin, sections were
further incubated 6 h in biotin-coupled goat anti-rabbit IgG (Jackson)
diluted 1:100. After six additional 10-min rinses in PBS saponin,
sections were incubated overnight in PBS saponin containing
avidin-biotin-horseradish peroxidase complex reagent (ABC, Vector
Laboratories), then rinsed again for six 10-min rinses in PBS saponin
and three 10-min rinses in PBS alone. The peroxidase reaction was
initiated by addition of 6 µl of 30%
H2O2
to 10 ml diaminobenzidine (DAB, 1 mg/ml). After 3 min, the reaction was stopped by removal of DAB solution, and the tissue was washed in PBS
three times for 5 min each time, then fixed in 1% glutaraldehyde in
PBS for 30 min. Tissues were then washed in PBS, postfixed 1 h in 1%
osmium tetroxide, dehydrated in graded ethanol solutions, and embedded
in LX-112 resin (Ladd Industries, Burlington, VT). Thin sections were
cut and examined on a Philips CM10 electron microscope after heavy
metal staining with uranyl acetate and lead citrate.
RT-PCR. Total RNA was prepared from
freshly dissected rat kidney and rat stomach using the Qiagen RNeasy
kit. RT was performed with the First Strand cDNA synthesis kit from
Ambion. PCR was performed by the hot start procedure, using
Taq DNA polymerase (Promega) in the
supplier's recommended buffer. The forward (5') AE2a primer
[nucleotide (nt) PCR mixes lacking only primers were preincubated at 82°C for 1 min,
then primers were injected into the mix through oil. The complete
reaction mixes were denatured for 2 min at 95°C, and then subjected
to these cycle conditions: denaturation for 45 s at 94°C, annealing
for 2 min at 60°C, and elongation for 2 min at 72°C. Final
extension of 10 min at 72°C was terminated by rapid cooling to
4°C after 35 cycles (AE2) or 25 cycles
[glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and
DNA transferred to nitrocellulose was hybridized to a
32P-labeled internal
oligonucleotide of sequence 5' CAGCACCTCCGTCGTCACCT 3' (nt
646-627) from a region present in all AE2 isoforms (38). Identity
of PCR products was verified by DNA sequencing on an ABI 371 sequencer.
Immunostaining without epitope unmasking
procedures. AE2 localization in rat kidney was examined
by immunofluorescence microscopy using four different polyclonal
antibodies and one MAb. None of the polyclonal affinity-purified
antibodies directed against peptides encoding mouse AE2 aa
961-974, 835-846, 625-639, 424-440, 355-368, or 109-122 detected specific immunostaining on rat kidney
cryosections, regardless of the fixation methods chosen (see
METHODS). This was despite previous
successful immunocytochemical localization of AE2 in gastric parietal
cells and in choroid plexus the antibodies to aa 961-974,
424-440 (6, 35), and 109-122 (unpublished results).
Similarly, although affinity-purified rabbit polyclonal anti-AE2 aa
1224-1237 successfully immunolocalized AE2 in these same tissues
(6, 35), the reagent immunostained in perfused kidney only the
cross-reactive AE1 present in the basolateral membranes of type A IC
and the few retained red blood cells (32). Among the epitope unmasking
techniques tried that did not elicit AE2 immunostaining with polyclonal
anti-AE2 aa 1224-1237 were those of on-slide trypsinization of the
fixed section, microwaving of the section, and treatment of the section
with 10 mM NaOH or with a range of chaotropic agents and
nondenaturing detergents.
However, one epitope unmasking technique greatly enhanced AE2
immunostaining in MDCK cells grown on permeable supports: treatment of
the mounted, fixed cell monolayer with 1% SDS for 5-15 min (13).
Similar on-slide treatment of thick cryosections of PLP-fixed rat
kidney "unmasked" a remarkably enhanced immunostaining in various
kidney cell types, as described below. Several control experiments, to
be described below, demonstrated that this SDS-dependent immunostaining
resulted from recognition of AE2 rather than of AE1.
AE2 in cortex. Figure
1 compares AE1 and AE2 localization in an
SDS-treated section of rat kidney cortex. Figure
1a shows AE1 immunostaining in type
A IC (arrows) of the CCD, as detected with the monoclonal
anti-AE1 antibody, MAb 12B11. In Fig.
1b, polyclonal anti-AE2 1224-1237
detected in the same section not only AE1 in the same type A cells
(arrows) but, in addition, moderate AE2 staining in principal cells
(PC) and/or type B IC. Brighter AE2 immunostaining of variable
intensity was present in the some but not all of the epithelial cells
of the cortical thick ascending limb (CTAL). Staining of distal
convoluted tubule (DCT) cells and CNT cells was weak or absent
(not shown). S1/S2 proximal tubule autofluorescence (Fig.
1b, transverse tubular sections
above CCD) often obscured a faint, diffuse AE2 immunostaining pattern,
which could be competed by specific peptide (not shown). The
SDS-elicited AE2 immunostaining shown in Fig.
1b and in subsequent figures was obtained in the presence of irrelevant peptide and,
with the exception of PT, was completely (24 µg/ml) or nearly (12 µg/ml) abolished in the presence of peptide antigen (see below).
![]()
ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
/
exchange activity contributes to regulation of intracellular pH
(pHi) and cell volume and to
generation and maintenance of the transmembrane
Cl
gradient regulation in a
wide variety of cell types. Polarized expression of
Cl
/
exchange activity in epithelial cells is thought to contribute to
transepithelial transport of acid/base and volume equivalents (2).
/
exchange activity has been measured throughout the length of the
nephron, and different segments and cell types have been shown to
express activity at the basolateral, apical, or both poles of the cell.
mRNA transcripts of all three characterized AE anion exchanger genes,
AE1, AE2, and AE3, are expressed in mammalian kidney (5, 9, 10). Among
these mammalian transcripts, mRNAs encoding AE2 (3, 27) and AE1 (1, 9,
27) are the more abundant on Northern blots, whereas AE3 mRNA (5, 27)
is detectable by reverse transcription-polymerase chain reaction
(RT-PCR) but not easily by Northern blot.
/
exchanger activities of other renal cells in situ, including that of
the apical exchanger(s) of type B IC, has remained uncertain (1, 2, 4).
Even the standard classification of IC as type A and type B may need
revision to accommodate the growing evidence of increased heterogeneity
displayed both in histochemical studies (4, 11, 32) and in ion
transport studies of single cells (17, 39). AE1, AE2, and AE3 each
mediate Cl
/
exchange, and their anion specificities appear to be similar. However,
anion transport by recombinant AE2 is regulated differently than that
mediated by AE1, as described in distinct expression systems using
different functional assays (21-23, 40). Thus it is likely that
regulation of
Cl
/
exchange in different renal cell types will differ. RT-PCR analysis has
already suggested that levels of AE1 and AE2 mRNA respond differently
to identical stimuli in the intact animal (18). Immunolocalization of
distinct AE anion exchanger isoforms in the kidney will contribute to
the correlation of molecular structure with in vivo and in vitro
function.
/
exchange in these cells (1, 17, 39). However,
Cl
/
exchange activity has also been measured in isolated perfused tubules
from most nephron segments, as well as in primary cell cultures derived
from many segments. In addition to participating in acid secretion by
type A IC,
Cl
/
exchange participates in base secretion by type B IC (1, 17, 39), in
volume regulation by cells of the medullary thick ascending limb (MTAL)
(20), and in Cl
secretion
(26) and acid secretion (33) by the inner medullary collecting duct
(IMCD). In addition,
Cl
/
exchange is present in nearly every renal epithelial cell in culture as
part of the cellular "housekeeping function" of
pHi regulation (2).
![]()
METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
20°C for longer periods.
18 through +8, rat numbering; Ref. 27], designed to be used for either rat or mouse, was of sequence 5' [AAGtGaTcA]GATTTGGCCATGAGCAG 3'.
(Nucleotides within brackets consist of a three nucleotide spacer
followed by a hexameric restriction site; lowercase letters indicate
mismatches with the rat sequence introduced to create the restriction
site.) The forward AE2b primer (nt 42-62; Ref. 38) was of sequence
5' CACTCCCGCAGGATGACTCAG 3'. The forward AE2c primer (nt
186-210; Ref. 38) was of sequence 5'
CTGCAGTTTCAGAGTTCATTTCCAG 3'. The reverse (3') primer
common to all AE2 isoforms (nt 1007-982; Ref. 27) was of sequence
5' [TGAGaaTtC]TGGTTTTTGTCCAACAG 3'. The
resultant PCR fragments were of the following predicted lengths: AE2a,
1025 bp; AE2b, 977 bp; AE2c1, 451 bp; and AE2c2, 781 bp.
-actin].
![]()
RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

View larger version (95K):
[in a new window]
Fig. 1.
Comparison of AE1 and AE2 distribution in SDS-pretreated 6-µm
cryosection of deep cortex of rat kidney.
a: Monoclonal anti-AE1 antibody stains
the basolateral membranes of type A intercalated cells (IC) in cortical
collecting duct (CCD, arrows) but not type B IC and principal cells
(PC). b: In the same section, anti-AE2
aa 1224-1237 reveals staining of basolateral membranes of
epithelial cells of the cortical thick ascending limb (CTAL, asterisk).
Although AE1 is still evident in basolateral membranes of type A IC
(arrows), SDS pretreatment has revealed AE2 in the basolateral membrane
of some adjacent CCD cells of other types. Diffuse proximal tubule
staining was not competed by peptide antigen (not shown). Bar = 25 µm.
Brief SDS treatment of cryosections on slides was required for detection of the plasmalemmal AE2 COOH-terminal epitope by polyclonal anti-AE2 aa 1224-1237 (Fig. 1b). SDS pretreatment also enhanced AE1 immunostaining by anti-AE1 MAb 12B11 and by anti-AE1 aa 917-929 (not shown) but did not allow the anti-AE1 antibodies to detect AE2 in kidney (see below). Therefore, further AE2 immunolocalization studies in other sections of the kidney were carried out only with polyclonal anti-AE2 aa 1224-1237.2
The epithelial cells of the macula densa uniformly expressed AE2 in their basolateral membranes at higher levels than seen in the adjacent CTAL cells (Fig. 2). Within the glomeruli, there was also evident weaker but specific AE2 immunostaining, likely in mesangial cells and endothelial cells. Figure 2e shows (to the left of the macula densa) endothelial AE2 in an afferent arteriole. AE2 immunostaining beyond the macula densa decreased in the short terminal portion of CTAL and the DCT (not shown).
|
AE2 in outer stripe of outer medulla.
In this kidney region, SDS pretreatment revealed basolateral
localization of AE2 in MTAL cells with intensity stronger than in CTAL
(Fig. 3A,
note "
"). AE2 was also present in PC of the outer medullary
collecting duct (OMCD) (not shown). At the frontier between the outer
stripe and the inner stripe (Fig.
3A), S3 proximal tubules showed
little or no AE2 staining (Fig. 3, note "~"), whereas the
descending thin limb (DTL) (Fig. 3, note asterisk)
displayed an abrupt increase in staining in the basolateral membrane.
|
AE2 in inner stripe of outer medulla. Figure 4 shows double immunostaining for AE1 and AE2 in a thick cryosection of outer medullary inner stripe subjected to the SDS epitope unmasking treatment. As shown in Fig. 4A, the AE1-specific MAb immunostained the basolateral membranes of type A IC (arrows) but not PC (arrowheads). AE1 was also detected in red blood cells retained in the perfused kidney without staining the thick ascending limb. This immunostaining in both cell types was abolished by preincubation of the MAb in the presence of rat red blood cell ghosts (not shown).
|
|
|
|
|
|
|
|
-actin
or GAPDH mRNA in each RNA sample further confirmed its integrity (not
shown). Thus the data allow for the possibility that AE2a, AE2b,
and/or AE2c2 might encode AE2 polypeptides alternatively
targeted, selectively or preferentially, to plasma membrane and to
Golgi apparatus in rat kidney.
|
| |
DISCUSSION |
|---|
|
|
|---|
Specificity of the immunolocalization of the unmasked AE2 epitope. The three anti-AE2 antipeptide antibodies competent to immunolocalize AE2 in rat choroid plexus (6) and in rat stomach (35) did not detect AE2 in rat kidney processed by the same methods used for the earlier studies. However, application of a recent epitope-unmasking protocol, using SDS treatment of fixed cryosections prior to antibody incubation (13), allowed detection in rat kidney of a single AE2 epitope, the COOH-terminal aa 1224-1237. Other available AE2 peptide epitopes were not similarly "unmasked" in cryosections by SDS treatment.
Because the anti-AE2 antibody to the COOH-terminal aa 1224-1237 cross-reacted with the AE1 COOH-terminal epitope, it was necessary to document that the unmasked immunostaining observed in the kidney derived from AE2, and not from AE1. This was achieved by comparison of unmasked AE2 staining patterns with staining patterns of the anti-AE1 monoclonal antibody, MAb 12B11, that does not recognize AE2. In addition, to discriminate more precisely between the related COOH-terminal epitopes of AE1 and AE2, the immunostaining patterns and peptide competition specificities of antibodies directed against the respective COOH-terminal peptides of AE1 and AE2 were compared (Fig. 8). Thus it was shown that antibodies to two SDS-enhanced AE1 epitopes (this work), as well as two additional antibodies (4), revealed an immunostaining pattern restricted to type A IC basolateral membranes and to erythrocytes. In contrast, the immunostaining pattern of the unmasked AE2 epitope was competed completely by AE2 peptide antigen but only minimally by the related AE1 peptide. The minimal competition of AE2 immunostaining produced by the AE1 peptide was consistent with similar minimal competition of AE2 immunostaining in gastric parietal cells produced by the AE1 peptide (Fig. 7).
Rat kidney AE2 has been immunolocalized by detection of only a single epitope, albeit with multiple controls for immunospecificity. Therefore, this localization has been demonstrated less conclusively than the multi-epitope localizations of AE1 in rat kidney (4) and of AE2 in rat stomach (35) and rat choroid plexus (6). Nonetheless, four criteria of specificity support the validity of the localization of AE2 in rat kidney as reported above. First is the contrast in localization with multiple epitopes of AE1. Second is the isoform specificity of COOH-terminal peptide competition of the AE2 immunocytochemical signal. Third is the correlation between this isoform specificity of COOH-terminal peptide competition and that of the AE2 polypeptide detected on immunoblot analysis of rat kidney microsomes (10). Fourth is the general coincidence between the unmasked epitope and the localization of rat kidney AE2 mRNA in microdissected nephron segments subjected to RT-PCR (10). Moreover, the expression of AE2 in PC is consistent with the RT-PCR findings in immunodissected rabbit CCD cells by Fejes-Toth et al. (18). Figure 13 summarizes the immunocytochemically defined localization of AE2 polypeptide along the rat kidney nephron.
|
Implications of the need for "unmasking" for visualization of the AE2 COOH-terminal epitope. Several epitopes of AE2 in gastric parietal cells and in choroid plexus are detectable by standard immunofluorescence methods, but visualization in kidney of even the most robust of these epitopes requires epitope unmasking.
Why might this be so? Some of this difference likely resides in simple variations in abundance: thus AE2 is more abundant in parietal cells and choroid plexus epithelium than in renal tubular cells by the criteria of immunoblot and mRNA level. A more speculative but attractive possibility is that the COOH-terminal amino acids of AE2 might be held in a different conformation or be "masked" in a tissue-specific manner. Such tissue-specific altered conformation could be achieved by interaction of AE2 with different sets of polypeptides or by differential covalent modification of AE2. Epitope-unmasking has been previously observed with the COOH-terminal epitope of the insulin-responsive glucose transporter, GLUT-4, in isolated adipocytes treated with insulin (34). More recently, in transgenic animals overexpressing GLUT-4 in skeletal muscle, "epitope unmasking" by acute insulin treatment of the animal prior to tissue fixation dramatically increased GLUT-4 detection by immunofluorescence microscopy in skeletal muscle, in parallel with increased glucose transport in T-tubules, whereas GLUT-4 detected by immunoblot remained constant (37).
Epitope masking has been suggested as an explanation for the absence of
AE1 staining in apical membranes of type B IC in the rabbit CCD and in
support of the proposal that AE1 serves as the apical
Cl
/
exchanger in these cells (1). The proposal is based on filter-lift
membrane fractionation studies of polarized, functional CCD cells grown
on permeable supports after enrichment for peanut lectin binding, as
well as on considerations of variable lipid environments of apical and
basolateral plasma membrane domains (1). However, none of the anti-AE1
or anti-AE2 antibodies tested on SDS-pretreated semithin sections of
rat kidney revealed an apical pattern of immunostaining. Thus this
particular form of epitope unmasking does not provide support for the
hypothesis that AE1 mediates apical
Cl
/
exchange in type B IC or in any other renal tubular epithelial cell
type.
Functional implications of the intrarenal distribution
of plasmalemmal AE2: inner and outer medulla. The
localization of AE2 to the basolateral membrane of IMCD epithelial
cells supports the hypothesis, previously based on studies of
immortalized IMCD cells in culture, that IMCD plays an important role
in terminal urinary acidification (33). In addition,
Cl
/
exchange has been implicated in the recently reported
Cl
secretory function of
the IMCD in at least one cultured cell model (26). AE2 is ideally
suited to these functions in this region of the nephron. The extremes
of luminal and interstitial acidification to which the IMCD epithelial
cells can be subjected, especially during antidiuresis (25), should
inhibit or abolish AE2-mediated anion exchange (40). However, two
distinct regulatory properties of AE2 should allow continued function
in the IMCD: stimulation of transport activity by elevated tonicity
(22) and by elevated NH+4 concentration (21).
The basolateral localization of abundant AE2 in the epithelial cells of the MTAL corresponds to the increased mRNA expression in this nephron segment (10) and to the presence of vacuolar H+-ATPase in the apical membrane of MTAL. AE2 is similarly well suited to functioning in the MTAL, not only because of the elevated tonicity and NH+4 concentration to which this segment can also be exposed but also because AE2, in contrast to AE1, is capable of participating in the regulatory volume increase (23) thought to be required of MTAL cells to adapt to the fluctuating osmolar environment of the medulla (20).
Functional implications of the intrarenal distribution
of plasmalemmal AE2: macula densa. The discovery of AE2
in the basolateral membrane of epithelial cells of the macula densa at
higher levels than in cells of the surrounding CTAL suggests for it a
possible role in tubuloglomerular feedback. The proposed mechanisms by which the macula densa transmits a signal to the juxtaglomerular mesangium reflecting the NaCl load in the lumen have all reflected the
ability of luminal bumetanide to inhibit that signaling. Thus, in
addition to provoking synthesis and release of first and second messenger molecules, the transepithelial delivery of chloride itself to
the juxtaglomerular mesangium has been proposed as a signal. In the
context of this proposal, basolateral AE2 could contribute to the
regulation of pHi,
Cl
concentration, and
volume in the macula densa cell. On a much more speculative note,
basolateral AE2 is strategically situated to mediate possible chloride
reuptake from the juxtaglomerular mesangium as part of modulation or
termination of the hypothesized extracellular chloride signal of the
extraglomerular mesangium.
Implications of AE2 epitope in the Golgi apparatus. The COOH-terminal epitope of AE2 is present not only in the plasma membrane of some cells but also in the Golgi apparatus of a range of cell types. However, unlike the plasmalemmal AE2 COOH-terminal epitope that is unmasked by SDS, the Golgi epitope is evident in untreated sections and is destroyed by SDS.3 The Golgi epitope further distinguishes itself in being competed equally effectively by either AE2 COOH-terminal peptide or AE1 COOH-terminal peptide, at concentrations that display isoform specificity for their respective plasmalemmal epitopes. However, none of the tested antibodies raised against AE1 epitopes produced this pattern of Golgi staining. This difference in COOH-terminal epitope reactivity associated with subcellular distribution is reminiscent of that displayed by GLUT-4 in intracellular organelles and in plasmalemma in two distinct tissues (34, 37).
The AE2 Golgi epitope differs from the colchicine-resistant plasmalemmal epitope also in the susceptibility of its localization to 6 h in vivo exposure to colchicine. The Golgi apparatus in many cell types is disrupted by microtubule disruption, leading often to dispersal of fragmented Golgi cisternae throughout the cytoplasm (28). Yet another difference between the two epitopes is the ability to detect the Golgi epitope in glutaraldehyde-fixed tissue, allowing ultrastructural localization not yet achieved in kidney for the plasmalemmal AE2 epitope.
It is possible that a novel or a previously discovered isoform of AE2
or of AE1 contributes either to chloride or sulfate transport across
the Golgi apparatus. It is also possible that such an AE isoform might
contribute to anchoring the lipid bilayer of the organelle to elements
of the organellar cytoskeleton. Recently, a novel isoform of
-spectrin has been localized to the Golgi in skeletal muscle and in
kidney (7, 16). In addition, one or more ankyrin isoforms may fulfill a
connecting function between the proposed spectrin/actin cytoskeleton
and integral proteins of the organellar lipid bilayer (31). Anti-AE2 aa
1224-1237 has also detected a Golgi distribution of
immunofluorescent staining in cell lines derived from a normal and
cystic human biliary epithelium (29) and from normal rat parotid duct
(A. K. Stuart-Tilley, D. M. Jefferson, S. P. Soltoff, and
S. L. Alper; unpublished results). In addition,
the same antibody to mouse AE1 COOH-terminal aa 917-929 that immunostained Golgi-like structures in ROS osteosarcoma cells (24)
also stains Golgi-like structures in immortalized epithelial cells (36)
derived from mouse MTAL (Alper, unpublished results). Identification of the AE2-related protein of the Golgi apparatus will
require additional experiments.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-43495 and DK-51059 (to S. L. Alper), DK-42956 (to D. Brown), and DK-34854 to the Harvard Digestive Diseases Center. S. L. Alper is an Established Investigator of the American Heart Association.
| |
FOOTNOTES |
|---|
Portions of this work were presented in preliminary form at the 28th Annual Meeting of the American Society of Nephrology (J. Am. Soc. Nephrol. 6: 371, 1995).
1 The AE1 COOH-terminal peptide antigen was the 13 COOH-terminal amino acids of AE1, with an added NH2-terminal cysteine through which the peptide was coupled to its carrier, keyhole limpet hemocyanin. The AE2 COOH-terminal peptide antigen was the 14 COOH-terminal amino acids of AE2, of which the furthest NH2-terminal amino acid was the natural Cys residue.
2 Antibodies to a range of protein epitopes have exhibited the full range of enhanced, unchanged, decreased, or abolished immunostaining following SDS pretreatment of aldehyde-fixed tissue sections of fixed tissue culture cells (13).
3 SDS lability also distinguishes the Golgi epitope from plasmalemmal AE1, whose immunoreactivity with anti-AE2 aa 1124-1237 is also enhanced by SDS.
Address for reprint requests: S. L. Alper, Molecular Medicine Unit RW763 East Campus, Beth Israel Deaconess Medical Center, 330 Brookline Ave., Boston, MA 02215.
Received 15 April 1997; accepted in final form 18 June 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Al-Awqati, Q.
Plasticity in epithelial polarity of renal intercalated cells: targeting of the H+-ATPase and band 3.
Am. J. Physiol.
270 (Cell Physiol. 39):
C1571-C1580,
1996
2.
Alper, S. L.
The band 3-related AE anion exchanger gene family.
Cell. Physiol. Biochem.
4:
265-281,
1994.
3.
Alper, S. L.,
R. R. Kopito,
S. M. Libresco,
and
H. F. Lodish.
Cloning and characterization of a murine band 3-related cDNA from kidney and from a lymphoid cell line.
J. Biol. Chem.
263:
17092-17099,
1988
4.
Alper, S. L.,
J. Natale,
S. Gluck,
H. F. Lodish,
and
D. Brown.
Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+-ATPase.
Proc. Natl. Acad. Sci. USA
86:
5429-5433,
1989
5.
Alper, S. L.,
and
B. E. Shmukler.
Tissue-specific alternative splicing of the AE3 anion exchanger gene predicts a novel AE3 polypeptide in rat kidney (Abstract).
J. Am. Soc. Nephrol.
6:
303,
1995[Medline].
6.
Alper, S. L.,
A. Stuart-Tilley,
C. F. Simmons,
D. Brown,
and
D. Drenckhahn.
The fodrin-ankyrin cytoskeleton of choroid plexus preferentially colocalizes with apical Na+,K+-ATPase rather than with basolateral anion exchanger AE2.
J. Clin. Invest.
93:
1430-1438,
1994.
7.
Beck, K. A.,
J. A. Buchanan,
V. Malhotra,
and
W. J. Nelson.
Golgi spectrin: identification of an erythroid
-spectrin homolog associated with the Golgi complex.
J. Cell Biol.
127:
707-723,
1994
8.
Breton, S.,
S. L. Alper,
S. Gluck,
W. S. Sly,
J. E. Barker,
and
D. Brown.
Depletion of intercalated cells from collecting ducts of carbonic anhydrase II deficient (CAR2 null) mice.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F761-F774,
1995
9.
Brosius, F. C.,
S. L. Alper,
A. M. Garcia,
and
H. F. Lodish.
The major kidney band 3 gene transcript predicts an amino-terminal truncated band 3 polypeptide.
J. Biol. Chem.
264:
7784-7787,
1989
10.
Brosius, F. C.,
K. Nguyen,
A. K. Stuart-Tilley,
C. Haller,
J. P. Briggs,
and
S. L. Alper.
Regional and segmental localization of AE2 anion exchanger mRNA and protein in rat kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 39):
F461-F468,
1995
11.
Brown, D.,
and
S. Breton.
Mitochondria-rich, proton-secreting epithelial cells.
J. Exp. Biol.
199:
2345-2358,
1996[Abstract].
12.
Brown, D.,
S. Hirsch,
and
S. Gluck.
Localization of a proton-pumping ATPase in rat kidney.
J. Clin. Invest.
82:
2114-2126,
1988.
13.
Brown, D.,
J. Lydon,
M. McLaughlin,
A. Stuart-Tilley,
R. Tyszkowski,
and
S. L. Alper.
Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate.
Histochem. Cell Biol.
105:
261-267,
1996[Medline].
14.
Brown, D.,
I. Saboli
,
and
S. Gluck.
Colchicine-induced redistribution of proton pumps in kidney epithelial cells.
Kidney Int., Suppl.
33:
S79-S83,
1991[Medline].
15.
Chernova, M. N.,
B. D. Humphreys,
D. H. Robinson,
A.-M. Garcia,
F. C. Brosius,
and
S. L. Alper.
Functional consequences of mutations in the transmembrane domain and the carboxy-terminus of the murine AE1 anion exchanger.
Biochim. Biophys. Acta
1329:
111-123,
1997[Medline].
16.
Devarajan, P.,
P. R. Stabach,
A. S. Mann,
T. Ardito,
M. Kashgarian,
and
J. S. Morrow.
Identification of a small cytoplasmic ankyrin (AnkG119) in the kidney and muscle that binds beta I sigma spectrin and associates with the Golgi apparatus.
J. Cell Biol.
133:
819-830,
1996
17.
Emmons, C.,
and
I. Kurtz.
Functional characterization of three intercalated cell subtypes in the rabbit outer cortical collecting duct.
J. Clin. Invest.
93:
417-423,
1994.
18.
Fejes-Toth, G.,
W. R. Chen,
E. Rusvai,
T. Moser,
and
A. Naray-Fejes-Toth.
Differential expression of AE1 in renal bicarbonate-secreting and -reabsorbing intercalated cells.
J. Biol. Chem.
269:
26717-26721,
1994
19.
Gutmann, E. J.,
J. L. Niles,
R. T. McCluskey,
and
D. Brown.
Colchicine-induced redistribution of an apical membrane glycoprotein (gp330) in proximal tubules.
Am. J. Physiol.
257 (Cell Physiol. 26):
C397-C407,
1989
20.
Hebert, S. C.
Hypertonic cell volume regulation in mouse thick limbs II. Na+-H+ and Cl
-
exchange in basolateral membranes.
Am. J. Physiol.
268 (Cell Physiol. 37):
C920-C931,
1986.
21.
Humphreys, B. D.,
M. N. Chernova,
L. Jiang,
Y. Zhang,
and
S. L. Alper.
NH4Cl activates AE2 anion exchanger in Xenopus oocytes at acidic pHi.
Am. J. Physiol.
272 (Cell Physiol. 41):
C1232-C1240,
1997
22.
Humphreys, B. D.,
L. Jiang,
M. Chernova,
and
S. L. Alper.
Hypertonic activation of AE2 anion exchanger in Xenopus oocytes via NHE-mediated intracellular alkalinization.
Am. J. Physiol.
268 (Cell Physiol. 37):
C201-C209,
1995
23.
Jiang, L.,
M. N. Chernova,
and
S. L. Alper.
Secondary regulatory volume increase in Xenopus oocytes conferred by expression of heterologous AE2 anion exchanger.
Am. J. Physiol.
272 (Cell Physiol. 41):
C191-C202,
1997
24.
Kellokumpu, S.,
L. Neff,
S. Jamsa-Kellokumpu,
R. Kopito,
and
R. Baron.
A 115 kD polypeptide immunologically related to erythrocyte band 3 is present in Golgi membranes.
Science
242:
1308-1311,
1988
25.
Kersting, U.,
D. W. Dantzler,
H. Oberleithner,
and
S. Silbernagl.
Evidence for an acid pH in rat renal inner medulla: paired measurements with liquid ion-exchange microelectrodes on collecting ducts and vasa recta.
Pflügers Arch.
426:
354-356,
1994[Medline].
26.
Kizer, N. L.,
B. Lewis,
and
B. A. Stanton.
Electrogenic sodium absorption and chloride secretion by an inner medullary collecting duct cell line (mIMCD-K2).
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F347-F355,
1995
27.
Kudrycki, K. E.,
P. R. Newman,
and
G. E. Shull.
cDNA cloning and tissue distribution of mRNAs for two proteins that are related to the band 3 Cl
/
exchanger.
J. Biol. Chem.
265:
462-471,
1990
28.
Patzelt, C.,
D. Brown,
and
B. Jeanrenaud.
Inhibitory effect of colchicine on amylase secretion by rat parotid glands. Possible localization in the Golgi area.
J. Cell Biol.
73:
578-593,
1977
29.
Perrone, R. D.,
S. A. Grubman,
D. W. Lee,
C. Johns,
E. Moy,
S. L. Alper,
and
D. M. Jefferson.
Altered anion exchange in continuous epithelial cell lines from ADPKD liver cysts.
Am. J. Physiol.
272 (Cell Physiol. 41):
C1748-C1756,
1997
30.
Peters, L. L.,
R. A. Shivdasani,
S.-C. Liu,
M. Hanspal,
K. M. John,
J. Gonzalez,
C. Brugnara,
B. Gwynn,
N. Mohandas,
S. L. Alper,
S. H. Orkin,
and
S. E. Lux.
AE1 (Band 3) is required to prevent erythrocyte membrane surface loss but not to form the membrane skeleton.
Cell
86:
917-929,
1996[Medline].
31.
Piepenhagen, P. A.,
L. L Peters,
S. E. Lux,
and
W. J. Nelson.
Differential expression of Na+,K+-ATPase, ankyrin, fodrin, and E-cadherin along the kidney nephron.
Am. J. Physiol.
269 (Cell Physiol. 38):
C1417-C1432,
1995
32.
Saboli
, I.,
S. Gluck,
D. Brown,
and
S. L. Alper.
Regulation of AE1 anion exchanger and H+-ATPase in rat kidney cortex by acute metabolic acidosis and alkalosis.
Kidney Int.
51:
125-137,
1997[Medline].
33.
Schwartz, J. H.
Renal acid-base transport: the regulatory role of the inner medullary collecting duct.
Kidney Int.
47:
333-341,
1995[Medline].
34.
Smith, R. M.,
M. J. Charron,
N. Shah,
H. F. Lodish,
and
L. Jarett.
Immunoelectron microscopic demonstration of insulin-stimulated translocation of glucose transporters to the plasma membrane of isolated rat adipocytes and masking of the carboxyl-terminal epitope of intracellular GLUT4.
Proc. Natl. Acad. Sci. USA
88:
6893-6897,
1991
35.
Stuart-Tilley, A.,
C. Sardet,
J. Pouyssegur,
M. A. Schwartz,
D. Brown,
and
S. L. Alper.
Immunolocalization of anion exchanger AE2 and cation exchanger NHE1 in distinct adjacent cells of gastric mucosa.
Am. J. Physiol.
266 (Cell Physiol. 35):
C559-C568,
1994
36.
Valentich, J. D.,
and
M. F. Stokols.
An established cell line from mouse kidney medullary thick ascending limb. I. Cell culture techniques, morphology, and antigenic expression.
Am. J. Physiol.
251 (Cell Physiol. 20):
C299-C311,
1986
37.
Wang, W.,
P. A. Hansen,
B. A. Marshall,
J. O. Holloszy,
and
M. Mueckler.
Insulin unmasks a COOH-terminal Glut4 epitope and increases glucose transport across T-tubules in skeletal muscle.
J. Cell Biol.
135:
415-430,
1996
38.
Wang, Z.,
P. J. Schultheis,
and
G. E. Shull.
Three N-terminal variants of the AE2 Cl
/
exchanger are encoded by mRNAs transcribed from alternative promoters.
J. Biol. Chem.
271:
7835-7843,
1996
39.
Weiner, I. D.,
A. E. Weill,
and
A. R. New.
Distribution of Cl
/
exchange and intercalated cells in rabbit cortical collecting duct.
Am. J. Physiol.
267 (Renal Fluid Electrolyte Physiol. 36):
F952-F964,
1994
40.
Zhang, Y.,
M. N. Chernova,
A. K. Stuart-Tilley, A. K.,
L. Jiang,
and
S. L. Alper.
The cytoplasmic and transmembrane domains of AE2 both contribute to regulation of anion exchange by pH.
J. Biol. Chem.
271:
5741-5749,
1996
This article has been cited by other articles:
![]() |
J. R. Schelling and B. G. Abu Jawdeh Regulation of cell survival by Na+/H+ exchanger-1 Am J Physiol Renal Physiol, September 1, 2008; 295(3): F625 - F632. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. I. Levy, S. Wanderling, D. Biemesderfer, and S. A. N. Goldstein MiRP3 acts as an accessory subunit with the BK potassium channel Am J Physiol Renal Physiol, August 1, 2008; 295(2): F380 - F387. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Kurschat, B. E. Shmukler, L. Jiang, S. Hevi, E. H. Kim, A. K. Stewart, and S. L. Alper Mouse strain-specific coding polymorphism in the Slc4a2/Ae2 gene encodes Ae2c2 variants differing in isoform-specific dominant negative activity Exp Physiol, April 1, 2008; 93(4): 458 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Dudas, S. Mentone, C. F. Greineder, D. Biemesderfer, and P. S. Aronson Immunolocalization of anion transporter Slc26a7 in mouse kidney Am J Physiol Renal Physiol, April 1, 2006; 290(4): F937 - F945. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pushkin and I. Kurtz SLC4 base (HCO3-, CO32-) transporters: classification, function, structure, genetic diseases, and knockout models Am J Physiol Renal Physiol, March 1, 2006; 290(3): F580 - F599. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Good, T. George, and B. A. Watts III Nongenomic regulation by aldosterone of the epithelial NHE3 Na+/H+ exchanger Am J Physiol Cell Physiol, March 1, 2006; 290(3): C757 - C763. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. McCulloch, R. Chambrey, D. Eladari, and J. Peti-Peterdi Localization of connexin 30 in the luminal membrane of cells in the distal nephron Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1304 - F1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Weinstein A mathematical model of rat distal convoluted tubule. I. Cotransporter function in early DCT Am J Physiol Renal Physiol, October 1, 2005; 289(4): F699 - F720. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Abdulnour-Nakhoul, N. L. Nakhoul, S. A. Wheeler, P. Wang, E. R. Swenson, and R. C. Orlando HCO3- secretion in the esophageal submucosal glands Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G736 - G744. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Komlosi, S. Frische, A. L. Fuson, A. Fintha, A. Zsembery, J. Peti-Peterdi, and P. D. Bell Characterization of basolateral chloride/bicarbonate exchange in macula densa cells Am J Physiol Renal Physiol, February 1, 2005; 288(2): F380 - F386. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Good, B. A. Watts III, T. George, J. W. Meyer, and G. E. Shull Transepithelial HCO3- absorption is defective in renal thick ascending limbs from Na+/H+ exchanger NHE1 null mutant mice Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1244 - F1249. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wagner, K. E. Finberg, S. Breton, V. Marshansky, D. Brown, and J. P. Geibel Renal Vacuolar H+-ATPase Physiol Rev, October 1, 2004; 84(4): 1263 - 1314. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Wallace, G. Reif, A.-M. Hedge, J. B. Thrasher, and P. Pietrow Adrenergic regulation of salt and fluid secretion in human medullary collecting duct cells Am J Physiol Renal Physiol, October 1, 2004; 287(4): F639 - F648. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Watts III and D. W. Good An apical K+-dependent HCO3- transport pathway opposes transepithelial HCO3- absorption in rat medullary thick ascending limb Am J Physiol Renal Physiol, July 1, 2004; 287(1): F57 - F63. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Frische, A. S. Zolotarev, Y.-H. Kim, J. Praetorius, S. Alper, S. Nielsen, and S. M. Wall AE2 isoforms in rat kidney: immunohistochemical localization and regulation in response to chronic NH4Cl loading Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1163 - F1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Kim, T.-H. Kwon, B. M. Christensen, J. Nielsen, S. M. Wall, K. M. Madsen, J. Frokiaer, and S. Nielsen Altered expression of renal acid-base transporters in rats with lithium-induced NDI Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1244 - F1257. [Abstract] [Full Text] |
||||
![]() |
M. N. Chernova, A. K. Stewart, L. Jiang, D. J. Friedman, Y. Z. Kunes, and S. L. Alper Structure-function relationships of AE2 regulation by Ca2+i-sensitive stimulators NH+4 and hypertonicity Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1235 - C1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Wu, S. Khan, S. Lakhe-Reddy, L. Wang, G. Jarad, R. T. Miller, M. Konieczkowski, A. M. Brown, J. R. Sedor, and J. R. Schelling Renal tubular epithelial cell apoptosis is associated with caspase cleavage of the NHE1 Na+/H+ exchanger Am J Physiol Renal Physiol, April 1, 2003; 284(4): F829 - F839. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Wallace, M. Christensen, G. Reif, F. Belibi, B. Thrasher, D. Herrell, and J. J. Grantham Electrolyte and fluid secretion by cultured human inner medullary collecting duct cells Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1337 - F1350. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Kraut, K. G. Helander, H. F. Helander, N. D. Iroezi, E. A. Marcus, and G. Sachs Detection and localization of H+-K+-ATPase isoforms in human kidney Am J Physiol Renal Physiol, October 1, 2001; 281(4): F763 - F768. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pastor-Soler, C. Bagnis, I. Sabolic, R. Tyszkowski, M. McKee, A. Van Hoek, S. Breton, and D. Brown Aquaporin 9 Expression along the Male Reproductive Tract Biol Reprod, August 1, 2001; 65(2): 384 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. KARUMANCHI, L. JIANG, B. KNEBELMANN, A. K. STUART-TILLEY, S. L. ALPER, and V. P. SUKHATME VHL tumor suppressor regulates Cl-/HCO3- exchange and Na+/H+ exchange activities in renal carcinoma cells Physiol Genomics, April 2, 2001; 5(3): 119 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Holappa, M. Suokas, P. Soininen, and S. Kellokumpu Identification of the Full-length AE2 (AE2a) Isoform as the Golgi-associated Anion Exchanger in Fibroblasts J. Histochem. Cytochem., February 1, 2001; 49(2): 259 - 270. [Abstract] [Full Text] |
||||
![]() |
J. Loffing, B. D. Moyer, D. Reynolds, B. E. Shmukler, S. L. Alper, and B. A. Stanton Functional and molecular characterization of an anion exchanger in airway serous epithelial cells Am J Physiol Cell Physiol, October 1, 2000; 279(4): C1016 - C1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Karbach, J. Kricke, F. Meyer-Wentrup, V. Gorboulev, C. Volk, D. Loffing-Cueni, B. Kaissling, S. Bachmann, and H. Koepsell Localization of organic cation transporters OCT1 and OCT2 in rat kidney Am J Physiol Renal Physiol, October 1, 2000; 279(4): F679 - F687. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Silver, S. Breton, and D. Brown Potassium depletion increases proton pump (H+-ATPase) activity in intercalated cells of cortical collecting duct Am J Physiol Renal Physiol, July 1, 2000; 279(1): F195 - F202. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Schwartz, A. M. Kittelberger, D. A. Barnhart, and S. Vijayakumar Carbonic anhydrase IV is expressed in H+-secreting cells of rabbit kidney Am J Physiol Renal Physiol, June 1, 2000; 278(6): F894 - F904. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Roussa, M. F. Romero, B. M. Schmitt, W. F. Boron, S. L. Alper, and F. Thevenod Immunolocalization of anion exchanger AE2 and Na+-HCO-3 cotransporter in rat parotid and submandibular glands Am J Physiol Gastrointest Liver Physiol, December 1, 1999; 277(6): G1288 - G1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Melvin, K. Park, L. Richardson, P. J. Schultheis, and G. E. Shull Mouse Down-regulated in Adenoma (DRA) Is an Intestinal Cl-/HCO3- Exchanger and Is Up-regulated in Colon of Mice Lacking the NHE3 Na+/H+ Exchanger J. Biol. Chem., August 6, 1999; 274(32): 22855 - 22861. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Alper, H. Rossmann, S. Wilhelm, A. K. Stuart-Tilley, B. E. Shmukler, and U. Seidler Expression of AE2 anion exchanger in mouse intestine Am J Physiol Gastrointest Liver Physiol, August 1, 1999; 277(2): G321 - G332. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Dudeja, N. Hafez, S. Tyagi, C. A. Gailey, M. Toofanfard, W. A. Alrefai, T. M. Nazir, K. Ramaswamy, and F. J. Al-Bazzaz Expression of the Na+/H+ and Cl-/HCO-3 exchanger isoforms in proximal and distal human airways Am J Physiol Lung Cell Mol Physiol, June 1, 1999; 276(6): L971 - L978. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Emmons Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct beta -cells Am J Physiol Renal Physiol, April 1, 1999; 276(4): F635 - F643. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. KIM, Y.-H. KIM, J.-H. CHA, C. C. TISHER, and K. M. MADSEN Intercalated Cell Subtypes in Connecting Tubule and Cortical Collecting Duct of Rat and Mouse J. Am. Soc. Nephrol., January 1, 1999; 10(1): 1 - 12. [Abstract] [Full Text] |
||||
![]() |
C. Spirli, A. Granato, A. Zsembery, F. Anglani, L. Okolicsanyi, N. F. LaRusso, G. Crepaldi, and M. Strazzabosco Functional polarity of Na+/H+ and Cl-/HCO-3 exchangers in a rat cholangiocyte cell line Am J Physiol Gastrointest Liver Physiol, December 1, 1998; 275(6): G1236 - G1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. SULLIVAN, D. P. WALLACE, and J. J. GRANTHAM Epithelial Transport in Polycystic Kidney Disease Physiol Rev, October 1, 1998; 78(4): 1165 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Eladari, A. Blanchard, F. Leviel, M. Paillard, A. K. Stuart-Tilley, S. L. Alper, and R.-A. Podevin Functional and molecular characterization of luminal and basolateral Cl-/HCO-3 exchangers of rat thick limbs Am J Physiol Renal Physiol, September 1, 1998; 275(3): F334 - F342. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Al-Awqati, S. Vijayakumar, C. Hikita, J. Chen, and J. Takito Phenotypic plasticity in the intercalated cell: the hensin pathway Am J Physiol Renal Physiol, August 1, 1998; 275(2): F183 - F190. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Breton, T. Wiederhold, V. Marshansky, N. N. Nsumu, V. Ramesh, and D. Brown The B1 Subunit of the H+ATPase Is a PDZ Domain-binding Protein. COLOCALIZATION WITH NHE-RF IN RENAL B-INTERCALATED CELLS J. Biol. Chem., June 9, 2000; 275(24): 18219 - 18224. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Breton, T. Inoue, M. A. Knepper, and D. Brown Antigen retrieval reveals widespread basolateral expression of syntaxin 3 in renal epithelia Am J Physiol Renal Physiol, March 1, 2002; 282(3): F523 - F529. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |