|
|
||||||||
-subunit in
rabbit kidney
1 Department of Physiology, We have identified
in rabbit renal cells two alternatively spliced transcripts of the
potassium channels; cloning; calcium; potassium transport
LARGE CONDUCTANCE (maxi)
Ca2+-activated
K+ channels are expressed in
several nephron segments (10, 15, 20, 21, 23, 24). Although the exact
function of these channels in most renal epithelia is unclear, they
provide cells with a pathway for large movements of
K+. For example,
Ca2+-activated K+ channels are
activated during hypotonic stress in cultured medullary thick
ascending limb (MTAL) cells via an increase of intracellular Ca2+ concentration
([Ca2+]i)
(3, 22, 28). The increase in
[Ca2+]i
is through a dihydropyridine-sensitive
Ca2+ influx mechanism (17, 22).
The activation of Ca2+-activated
K+ channels following hypotonic
stress provides cells with a mechanism to quickly lose
K+ during regulatory volume
decrease (22, 23, 25, 28).
Because of the relatively high concentrations of
Ca2+ required to activate the
channels, they probably are not active under basal conditions. However,
the modulation of maxi K+ channel
activity by protein kinase A, protein kinase G, and inhibition of
dephosphorylation is well documented in other tissues (2, 13, 29),
suggesting that phosphorylation of channel protein is important in
regulating channel activity. We have shown in cultured kidney cells
that forskolin and antidiuretic hormone can activate
Ca2+-activated
K+ channels, probably via
phosphorylation of the channel protein (9). This suggests that, under
some stimulated conditions, Ca2+-activated
K+ channels may indeed play a role
in transcellular transport.
Two subunits of maxi K+ channel
have been cloned (5, 11). The Although several groups using electrophysiological techniques have
shown that maxi K+ channels exist
in several nephron segments (10, 15, 20, 21, 24), the distribution and
the abundance of these channels in each cell type at molecular level
have not been reported. To evaluate these channels at the molecular
level, we have cloned the rabbit maxi
K+ channel Reverse transcriptase (RT)-PCR
analysis. Total RNA was prepared from rabbit MTAL cells
(3). cDNA was synthesized from 1 µg of total RNA using Superscript
Reverse Transcriptase (Life Technologies), according to the
manufacturer's instructions. PCR amplification was performed with
degenerate primers, based on the published sequences of
dslo and
mslo (1, 5), sense primer (5'
GTIACCATGTCCACIGTIG 3') and antisense primer [5'
CAIGACTGGGCGAT(G/A)AAIC 3'] with 40 cycles of denaturation
(94°C, 1 min), annealing (50°C, 1 min), and extension
(72°C, 1 min). The PCR product was ligated into PCRscript
(Stratagene) according to the manufacturer's instructions and
sequenced using the Sequenase 2.0 kit (Amersham).
To study the expression of alternatively spliced isoforms of
rbslo, PCR primers were selected from
either the additional exon or regions flanking the deleted exons (Fig.
1). Total RNA was isolated
from various tissues. One microgram of each total RNA was treated with
deoxyribonuclease I (1 U/µl) at 37°C for 15 min and inactivated
at 94°C for 15 min. cDNA was synthesized as described above and
amplified with the sense primer (5' GTTACGGGGACGTTTATGC 3')
and antisense primer (5' CCAACTTCAGCTCTGCAAG 3') with 35 cycles of denaturation (94°C, 1 min), annealing (58°C, 1 min),
and extension (72°C, 1 min). PCR amplification of the A spliced
site was performed using a specific sense primer (5'
CAAGATGTCCATCTACAAG 3') and an antisense primer (5'
GGAAACGGGTGCAGCAATC 3') with 40 cycles of denaturing (94°C, 1 min), annealing (55°C, 1 min), and extension (72°C, 1 min). The
B spliced site was amplified with the sense strand primer (5'
GTGCCAGCAACTTCCATTAC 3') and antisense primer (5'
GGAGAGGATCTGTCCATTC 3') with 40 cycles of denaturation (94°C, 1 min), annealing (57°C, 1 min), and extension (72°C, 1 min)
(Fig. 4).
![]()
ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References
-subunit rbslo1 and
rbslo2.
Rbslo1 has a novel "in-frame"
174-bp insertion immediately after the predicted S8 transmembrane
segment, whereas rbslo2 has a 104-bp deletion between S9 and S10, creating a frameshift and a premature termination codon. Amino acid identity between mouse maxi
K+ channel
-subunit
(mslo) and
rbslo1 was 99%. Two transcript sizes of 4.2 and 7.5 kb were detected in brain, kidney, stomach, testis, and
lung. Rbslo is expressed in glomeruli,
thin limbs of Henle's loop, medullary and cortical thick ascending
limbs of Henle's loop, and cortical, outer, and inner medullary
collecting ducts; however, it was rarely detected in proximal
convoluted tubules. Rbslo1 is most
abundant in inner medulla. Expressed in
Xenopus oocytes,
rbslo1 generates
depolarization-activated, outwardly rectifying
K+ currents.
Rbslo1 expressed in Chinese hamster
ovary cells could be activated by depolarization and
Ca2+. These data suggest that
rbslo transcripts are expressed in
multiple nephron segments and that the magnitude of mRNA expression
varies among different nephron segments.
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
-subunit is the functional unit which
is inhibited by iberiotoxin (IBTX). The
-subunit does not produce
any current when it is expressed in
Xenopus oocytes. However, coexpression
of the
- and
-subunits in
Xenopus oocytes produces currents with
increased Ca2+ and voltage
sensitivity, compared with the current produced by expression of
-subunit alone (19).
-subunit from MTAL
cells using polymerase chain reaction (PCR) cloning strategy based on
the amino acid sequences of Drosophila and mouse brain maxi K+ channels
and examined the tissue distribution of the mRNA in rabbit kidney.
![]()
MATERIAL AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

View larger version (22K):
[in a new window]
Fig. 1.
Schematic presentation of clones of
rbslo. Total length of
rbslo1 cDNA from overlapping fragments
is 4,114 bp. Method used to get each fragment is underlined
(left). Sites of restriction enzymes
used to make composite clones are indicated by bold lines. Inserted or
deleted exons at splice junction sites are depicted by cross hatches.
(A)n, polyadenylation tails. Sites of primers used in Fig. 4 are
indicated by arrows and designated in parentheses
(top) 5' RACE, 5' rapid
amplification of cDNA ends; PCR, polymerase chain reaction.
Products were electrophoresed on 1% agarose gels and blotted onto
nylon membranes (Hybond N+,
Amersham). 32P random-labeled
probes of the amplified rbslo regions
or 32P 5' end-labeled PCR
primers were hybridized in QuikHybe (Stratagene) and washed in 40 mM
Na2HPO4
(pH 7.2) at room temperature and then in 40 mM
Na2HPO4
with 5% sodium dodecyl sulfate (SDS) (pH 7.2) at 65°C for 20 min.
The blot was wrapped in Saran Wrap (Dow Brands) and exposed to
autoradiography film at
80°C.
Library screening and cDNA sequencing.
A cDNA library was constructed in
ZAP (Stratagene) using
size-fractionated mRNA from MTAL cells, based on work previously done
(16). The cDNA library was screened with a
32P 5' end-labeled
oligonucleotide probe (5' GTGACCATGAGCACTGTTGGTTACGGGGACGTTTATGC 3') hybridized in 6× standard sodium citrate (SSC),
1× Denhardt's solution, 0.05% sodium pyrophosphate, and 100 µg/ml yeast tRNA at 42°C overnight after prehybridization in
6× SSC, 5× Denhardt's solution, 0.05% sodium
pyrophosphate, 0.5% SDS, and 100 µg/ml salmon sperm DNA at 42°C
for 3 h. The filters were washed once in 2× SSC, 0.1% SDS at
room temperature and once in 0.1× SSC, 0.1% SDS at 52°C.
Bacteriophage clones were excised in vivo to pBluescript following the manufacturer's protocol. Nested deletions of the pBluescript clones were constructed using the Exo III/Mung Bean Nuclease Deletion Kit (Stratagene), according to the manufacturer's instructions. The nested deletion clones were sequenced with the Sequenase 2.0 kit (Amersham).
5' Rapid amplification of cDNA ends PCR. Single-stranded cDNAs were synthesized using either of the antisense primers (5' GACACATTCCCAGTACGTG 3' or 5' GTTGGACGAATCTATGAAG 3'). An anchor oligonucleotide (5' CCTCTGAAGGTTCCAGAATCGATAG 3') was ligated to the single-stranded cDNAs using T4 RNA ligase and then amplified using either a combination of Klentaq (Ab Peptides) and Pfu polymerase (Stratagene) or Pfu polymerase alone. The PCR products were cloned and sequenced, as described above, and subcloned into clones from the cDNA library using unique restriction sites (Nco I, EcoR V; Fig. 1).
Northern blotting. Polyadenylated mRNA
was prepared from various tissues. Two micrograms of
poly(A)+ mRNA were electrophoresed
on a formamide-formaldehyde denaturing agarose gel and blotted onto a
nylon membrane (Hybond N+,
Amersham). The rbslo cDNA was random
labeled with
[
-32P]dCTP (NEN,
3,000 mCi/mmol) and used as a probe. Blots were hybridized overnight at
65°C in 0.5 M
Na2HPO4
(pH 7.2), 7% SDS, 2 mM EDTA, and 100 µg/ml salmon sperm DNA, washed
twice with 40 mM
Na2HPO4, 5% SDS at the same temperature, and then autoradiographed.
RT-PCR analysis of microdissected nephron segments. Microdissection of nephron segments and reverse transcription of mRNA were performed as previously described with minor modifications (31). In brief, 1 mm of each nephron segment was microdissected and permeabilized. cDNA was synthesized with a specific primer (5' CAGGACTGGGCGATGAAAC 3'). PCR amplification consisted of two nested rounds. The first round was performed with a sense primer (5' GTTACGGGGACGTTTATGC 3') and antisense primer (5' CAGGACTGGGCGATGAAC 3') with 40 cycles of denaturation (94°C, 1 min), annealing (56°C, 1 min), and extension (72°C, 1 min). One-tenth of the first-round product was amplified using the sense primer (5' GTTACGGGGACGTTTATGC 3') and antisense primer (5' CCAACTTCAGCTCTGCAAG 3') with 40 cycles of denaturation (94°C, 1 min), annealing (58°C, 1 min), and extension (72°C, 1 min).
Ribonuclease protection assay (RPA).
The PCR product corresponding to rbslo
nucleotide sequences 2599 through 2797 was subcloned into PCRscript
SK(+). Riboprobe was prepared from linearized plasmid by in vitro
transcription (Ambion) and incorporated
[
-32P]UTP (NEN, 800 mCi/mmol). Total RNA samples were prepared from resected kidneys using
the cesium chloride ultracentrifugation method. Total RNA (40 µg) was
hybridized with the labeled riboprobe (1 × 105 counts/min) for 24 h. The
samples were digested with a mixture a ribonuclease A and ribonuclease
T1 (Ambion), then analyzed on an 8 M urea-5% polyacrylamide gel, and
autoradiographed. The exposed film was analyzed using ImageQuant
software (Molecular Dynamics). An internal control of 18S ribosomal RNA
was also quantified using RPA
(pT718S, Ambion).
Expression in Xenopus oocytes. The
composite cDNA clones were constructed in pBluescript SK(+),
linealized, and in vitro transcribed to capped cRNA using T7 RNA
polymerase. The cRNA was diluted to 50 ng/µl in diethyl
pyrocarbonate-treated water, and 50 nl of the individual
cRNA were injected into Xenopus
oocytes prepared as described previously (16). The detail protocol for
oocyte current recording was followed as previously described (16). In
brief, two electrode voltage-clamp recordings were performed in ND96
solution [96 mM NaCl, 2 mM KCl, 1 mM
CaCl2, 1 mM
MgCl2, and 5 mM
N-2hydroxyethylpiperazine-N'-2-ethanesulfonic
acid (HEPES), pH 7.4]. Niflumic acid (150 µM) was always
added into the bath solution to prevent endogenous
Ca2+-activated
Cl
current. Command
protocols were generated, and currents were acquired by using an
Axoclamp-2A amplifier (Axon Instruments) interfaced to a
IBM-AT-compatible 486 microcomputer (Gateway 2000) via pCLAMP version
6.02 software (Axon Instruments).
To determine ion selectivity of the expressed currents, the following
protocol was used. The solutions used were 76 mM NaCl, 20 mM
XCl
(X = Na, K, Rb, or
NH4), 1 mM
CaCl2, 1 mM
MgCl2, and 5 mM HEPES (pH 7.4),
and they were serially replaced by perfusion. The oocytes were voltage
clamped at
80 mV. Immediately after depolarization to +30 mV for
200 ms, the membrane potential was changed to the commanded voltage,
from
80 mV to +40 mV.
Expression in Chinese hamster ovary
cells. The Sal
I-Nde I fragments of
rbslo cDNA were treated with T4 DNA
polymerase and blunt-end ligated into
Sal I and
Xba I-digested pGFP-N1 (Clontech). With these restriction enzymes, a fragment of cDNA coding GFP protein
was cut out, and only rbslo cDNA
remained in the constructs. The plasmid DNA was prepared separately
with cesium trifluoroacetate centrifugation method. Chinese hamster
ovary-K1 cells (CHO cells) were obtained from American Type Culture
Collection (Rockville, MD) and grown on glass coverslips (Belleco
Glass) in the following culture medium: 90% Ham's F-12 medium
(Mediatech) and 10% fetal bovine serum (Hyclone). Calcium
phosphate precipitation method was employed to transfect plasmids into
CHO cells. To identify cells transiently transfected, an expression
construct containing the murine T lymphocyte-specific surface protein,
CD4, was used (12). Cells expressing CD4 were identified by attachment
of CD4 antibody-coated beads (Dynail). On the 2nd and 3rd days after transfection only, cells with attached beads were chosen for whole cell
and single-channel patch-clamp recordings (8). Command protocols were
generated, and currents were acquired by using a List EPC-7 patch-clamp
amplifier (Medical System) interfaced to a IBM-AT-compatible 486 microcomputer (Gateway 2000) via pCLAMP version 6.0.2 software (Axon
Instruments). Data from single-channel recordings were low-pass
filtered at 3 kHz and digitized at 12.5 kHz. For whole cell recordings,
the pipette solution contained (in mM) 145 KCl, 5 NaCl, 1 MgCl2, 10 HEPES, 118 CaCl2, and 1 ethylene glycol-bis(
-aminoethyl
ether)-N,N,N',N'-tetraacetic
acid (pH 7.4) [free Ca2+ is
10
8 M calculated using the
program obtained from Dr. Marshall H. Montrose (Department of Medicine,
The Johns Hopkins University)]. The bath solution contained (in
mM) 145 KCl, 5 NaCl, 1 MgCl2, 10 HEPES, and 1 CaCl2 (pH 7.4) unless
stated otherwise. For single-channel recordings (inside-out
configuration), 150 mM KCl was used both in the pipette and bath
solutions instead of a combination of 145 mM KCl and 5 mM NaCl. Free
Ca2+ concentration in the bath
solution was changed for checking
Ca2+ sensitivity according to the
program described above.
| |
RESULTS |
|---|
|
|
|---|
Primary structure of rbslo. Screening of MTAL cell cDNA library resulted in isolation of two sizes of cDNA fragments. Because both cDNA fragments did not contain 5' end of cDNA, rapid amplification of cDNA ends-PCR was performed, and PCR products were ligated to the cDNA (Fig. 1). Nucleotide sequence comparison indicated that two cDNA fragments are quite homologous with each other; however, some differences were observed. The longer clone (rbslo1), encoding 1,215 amino acids, has a novel "in-frame" 174-bp insertion, which is located after the S8 transmembrane segment (splice site A). The shorter clone (rbslo2) encoding 796 amino acids has a 104-bp deletion between the predicted S9 and S10 segments (splice site B), creating a frame shift that introduced a premature termination codon at the 45 bp downstream of the deletion site. Only 16 amino acids encoded by rbslo2 cDNA are different from rbslo1 (amino acid similarity is 97.9%). The deduced amino acid sequences are shown in Fig. 2.
|
Rbslo1 has one potential adenosine 3',5'-cyclic monophosphate/guanosine 3',5'-cyclic monophosphate (cAMP/cGMP)-dependent protein kinase phosphorylation site, 15 protein kinase C phosphorylation sites, and 14 potential casein kinase II phosphorylation sites. Rbslo2 has no cAMP/cGMP-dependent protein kinase phosphorylation site in the putative intracellular region but 10 potential protein kinase C phosphorylation sites and eight casein kinase II phosphorylation sites.
Tissue distribution of rbslo. Northern blot analysis revealed that rbslo mRNA is expressed in various rabbit tissues including MTAL cells, cerebrum, lung, stomach, rectum, and testis. Two different transcript sizes were detected (4.2 and 7.5 kb, Fig. 3). The signal in kidney is quite faint, suggesting a lower level of expression. RT-PCR was employed to distinguish the expression of isoforms as described in MATERIAL AND METHODS. Because the genomic sequence of this gene was not known, to eliminate the possibility of amplification of the genomic DNA, three sets of primers were used for RT-PCR. The primers were chosen empirically, such that the amplification from genomic DNA would result in different sizes of products from the amplification from cDNA. Control experiments also showed that no bands were observed in the absence of reverse transcriptase (data not shown).
|
Both PCR products amplified from rbslo1 cDNA and rbslo2 cDNA were detected in several tissues (Fig. 4; 646 bp bands for rbslo1 and rbslo2, 165 bp or 343 bp bands for rbslo1, 236 bp bands for rbslo2), indicating that both isoforms are expressed widely throughout the body. In the kidney, both isoforms are expressed in cortex, outer medulla, and inner medulla (Fig. 4B). RT-PCR of microdissected nephron segments produced positive PCR products corresponding to rbslo1 and rbslo2 (646 bp) in glomeruli, thin limbs of Henle's loop, cortical and medullary ascending limbs of Henle's loop, cortical collecting tubules, and outer and inner medullary collecting ducts. Importantly, the predicted sizes of PCR products were hardly detected in proximal convoluted tubules (0 positive in n = 7) and proximal straight tubules (1 positive in n = 8) (Fig. 4C).
|
RPA indicated that the protected bands corresponding to rbslo1 mRNA (199 bp) were observed in all regions of kidney, and the sequence of the abundance of rbslo1 mRNA was as follows: inner medulla > cortex > outer medulla (Fig. 5). The predicted size of the protected bands (62 bp) for rbslo2 were not consistently detected in the RPA.
|
Functional expression of rbslo in Xenopus oocyte and
CHO-K1 cells. The individual cRNAs were prepared and
injected into Xenopus oocytes
separately as described in MATERIAL AND
METHODS. Depolarization-activated outward currents were
detected from rbslo1 cRNA injected
oocytes on the 2nd day after injection but not from
rbslo2 cRNA-injected oocytes. The
rbslo1 currents expressed in
Xenopus oocytes are slightly
inactivated with time and outwardly rectifying. Currents reach a 1 µA
amplitude on the 2nd day, but, after the 3rd day, the oocytes could not
be clamped to the command voltages because the expressed currents are
too large. The amplitude of the expressed currents decreased following
application to the bath of either Ba2+ (5 mM), tetraethylammonium
(TEA) (5 mM), or of IBTX (20 nM), a specific blocker of maxi
K+ channels (6) (Fig.
6). The ion selectivity of the expressed oocyte currents was measured by deactivation tail current experiments as described in MATERIAL AND METHODS.
The reversal potential shifted from
29.7 ± 4.0 to
35.8 ± 7.4,
39.5 ± 9.6, and
52.2 ± 12.7 mV after 20 mM K+ in the bath
solution was replaced by Rb+,
NH+4, and
Na+, respectively
(n = 7). These results suggested that
the sequence of ion selectivity was
K+ > Rb+ > NH+4 > Na+.
|
On the 2nd-3rd days after rbslo1 cDNA were
transfected into CHO cells, currents were detected in both whole cell
and inside-out single-channel configurations. Transfected CHO cells
expressed large conductance,
K+-selective channels with
properties characteristic of maxi
K+ channels (8, 15, 20, 21, 24),
whereas nontransfected CHO cells and those transfected with vector
alone did not show similar currents under the same experimental
conditions. In the whole cell configuration, outward currents were
observed with step depolarizations >0 mV. Ionomycin (1 µM), which
increases intracellular Ca2+,
induced currents that are threefold at 100 mV (from 1,446 ± 272 to
5,010 ± 773 pA, n = 10) (Fig.
7A).
Rbslo1 currents showed little or no
inactivation during the 350-ms voltage protocols. When the
K+ concentration
([K+]o)
was changed in the extracellular solution, the extrapolated zero-current potential shifted from 0.1 ± 0.6 mV for 140 mM
[K+]o
to
24.3 ± 1.8 mV for 50 mM
[K+]o,
34.2 ± 2.0 mV for 24.3 mM
[K+]o,
and
51.5 ± 1.6 mV for 10 mM
[K+]o.
During changes in the extracellular solution,
[K+]i
was kept 140 mM, resulting in an
Na+-to-K+
permeability ratio = 0.04 (Fig. 7B).
Rbslo1 currents were blocked by
external TEA (5 mM) and IBTX (20 nM) (data not shown). Single-channel amplitude varied linearly with voltage in symmetrical
K+ concentrations
([K+] = 150 mM) with a
slope conductance of 245.3 ± 2.6 pS and a reversal potential of
0.03 ± 0.80 mV (n = 7, Fig.
8A).
Open channel probability increased when the intracellular side of a
single patch was exposed to 0.1 µM
Ca2+ and voltage was changed over
the range of
70 mV to +70 mV (Fig. 8A). The probability of the channel
being open at a given voltage was dependent on the
[Ca2+]i
(Fig. 8, B and
C). Thus
rbslo1 channel is both voltage and Ca2+ dependent.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Primary structure of maxi
K+ channels and
functional expression. We have cloned two alternative
transcripts, rbslo1 and
rbslo2, of the maxi
K+ channel with novel sequences.
Rbslo1 has a novel insert of 59 novel
amino acids at splice site A.
Rbslo2 has a portion missing at splice
site B, which creates a frame shift,
causing truncation of the COOH terminus (Fig. 2). The overall amino
acid identity of rbslo1 to mouse,
mslo, and to
Drosophila
(dslo)
-subunits is very high
(Fig. 1). Also, between the mammalian
rbslo clones, amino acid sequences are
well conserved, including the alternative splicing
site A. On the other hand, the splice
site B in
rbslo2 is novel (Fig. 2). Several
alternate transcripts of maxi K+
channel
-subunits have been reported from different species (14,
32). For example, four splice variants were reported in the human
-subunit (hslo) derived from
human brain cDNA library (32). These variants occur at splice
site 2 of
hslo that corresponds to splice
site A of
rbslo1. However, none of the
hslo variants includes an insertion of
a novel exon. At splice site B of
rbslo2, there have been no previous
reports concerning splice variants of the
-subunit that create a
frame shift and a truncation of the COOH terminus.
Electrophysiological characterization of rbslo1 and
rbslo2. We have used two expression systems
(Xenopus oocytes and CHO cells) to
characterize the channels. Voltage-activated, iberiotoxin-sensitive, Ca2+-sensitive, outward
K+ currents were detected only
from the oocytes or CHO cells in which
rbslo1 cRNA was expressed (Fig. 6). No
currents were observed from rbslo2
expressed in Xenopus oocytes.
Rbslo1 channel could be characterized
as a maxi Ca2+-activated
K+ channel by the following
characteristics: 1) single-channel
conductance of 245 pS in symmetrical 150 mM KCl solutions,
2)
high-K+ selectivity over
Na+
(Na+-to-K+
permeability ratio = 0.04) and ion selectivity sequence of
K+ > Rb+ > NH+4 > Na+,
3) left shift of the voltage-open
probability relationship of the expressed channels at increasing
intracellular calcium concentration, 4) outwardly rectifying
voltage-dependent currents with little or no inactivation in voltage
clamping and whole cell current recording, and
5) the expressed currents are
sensitive to iberiotoxin. Some of these characteristics were common
among the expressed channels previously reported as
slo maxi
K+ channel
-subunits (1, 5, 18,
32).
The unique feature of rbslo1 is
greatly enhanced Ca2+ and voltage
sensitivities compared with previously cloned
-subunits. For
example, the membrane potential to achieve a half-maximal conductance
(V1/2) for
rbslo1 expressed in CHO cells is 61 mV
at 0.1 µM Ca2+ and
33 mV
at 1 µM Ca2+ at symmetrical 150 mM [K+]. In
comparison, for the hslo channel
(hbr5), V1/2 at
2.4 µM
[Ca2+]i
with symmetrical 110 mM
[K+] is ~0 mV (32),
much more positive than what we observed for the
rbslo1 channel. For the
mslo channel (mbr5), the
V1/2 at 10 µM
[Ca2+]i
with symmetrical 156 mM
[K+] is +23.4 mV (5).
The mslo channel (mbr5) has a very low
open probability at voltages more negative than +60 mV when
[Ca2+]i
was 1 µM, whereas, for rbslo1, the
open probability is very high at the same conditions. Thus
rbslo1 is at least an order of
magnitude more sensitive.
Coexpression studies of the
-subunit of
Ca2+-activated
K+ channels with the
-subunit
produces maxi K+ channels with
greater Ca2+ and voltage
sensitivities than when the
-subunit is expressed alone (11, 19).
Thus the
-subunit seems to act as a modulator of channel activity.
In our studies, we observed that a unique feature of
rbslo1 is a relatively high
Ca2+ sensitivity when expressed in
CHO cells in the absence of the
-subunit. One possibility is that
CHO express the
-subunit endogenously. However, others have provided
evidence (18) implying that the
-subunit is not expressed
endogenously in CHO cells. To test this directly, we used degenerate
PCR primers that could successfully amplify rabbit maxi
K+ channel
-subunit but could
not observe the predicted size of PCR product for maxi
K+ channel
-subunit in the cDNA
from CHO cells (data not shown). Thus enhanced sensitivity is most
likely an intrinsic property of rbslo1
independent of the
-subunit.
In the Drosophila
-subunit, three
variable splicing regions after S6 segment were found to be responsible
for the functional differences, such as
Ca2+ sensitivity, unit
conductance, and gating kinetics (14). Given the high homology of
rbslo1 to
dslo, except for the novel
rbslo1 sequence at
site A, it is likely that this novel
exon might be responsible for the different
Ca2+ sensitivity of
rbslo1 maxi
K+ channels. However, further
mutagenesis studies will be needed to prove this point conclusively.
Although we could not detect voltage-activated outward currents from the oocytes in which rbslo2 cRNA was injected, this transcript might be involved in the modification of Ca2+-activated K+ current through coassembly with other spliced variants or the regulation of mRNA through splicing mechanisms (14). Coexpression of rbslo1 cRNA and rbslo2 cRNA in Xenopus oocytes indicated a decrease of current amplitude compared with the expression of rbslo1 cRNA alone (data not shown).
Wei et al. (33) showed that the second half (from splice
site A to COOH terminus) of maxi
K+ channel
-subunit is
essential for its calcium and voltage sensitivity. Considering that
channel activity was not observed in
rbslo2-injected Xenopus oocytes, it may be possible
that the region after S9 segment is necessary to function as a
Ca2+-activated
K+ channel. Further study
including detection of protein expression is required to answer this
question.
Intrarenal distribution of maxi
K+ channel
-subunit. Maxi
K+ channel activity assessed by
the patch-clamp technique has been detected throughout the kidney in
mesangial (24), proximal tubule (10, 20), medullary and cortical thick
ascending limb (8, 21), and principal (15) and intercalated cells (23)
in the cortical collecting duct. Our experiments have detected
rbslo transcripts in the same nephron
segments where maxi K+ channel
activity was detected by electrophysiological methods. This confirms
conclusively that maxi K+ channels
are expressed in multiple nephron segments of rabbit kidney.
Interestingly, it is difficult to detect expression in proximal tubules, especially in the convoluted segment. Among all of the previous electrophysiological studies, there is no report that directly demonstrates the existence of channels with properties identical to maxi K+ channels in intact mammalian proximal tubules. Zweifach et al. (34) detected large-conductance K+ channels by fusing the apical membrane of membrane vesicles from proximal to planar lipid bilayers. However, the single-channel conductance and voltage dependence of the channels were substantially different from those of maxi K+ channels detected using apical membranes of distal nephron. Likewise, Tauc et al. (30) found that the sensitivity of maxi K+ channels to iberiotoxin in primary cultured proximal collecting tubule cells was much lower than that of the maxi K+ channels present in smooth muscle cells (30). Iberiotoxin is thought to inhibit maxi K+ channels by blocking their channel pores from the extracellular side (6). Thus a different iberiotoxin sensitivity of maxi K+ channels in proximal cells from intact tubules combined with our inability to detect the predicted bands amplified from rbslo by RT-PCR in freshly dissected tubules may suggest that different functional maxi K+ channel subunits are expressed in proximal tubule segments. It should be mentioned that, Kawahara et al. (10) did demonstrate that hypotonicity (218 mosmol/kgH2O) activated typical maxi-type K+ channels in rabbit PCT primary cultured cells. However, it is possible that cells in culture may have a different pattern of channel expression than intact tubule cells, as was reported for delayed-rectifier, voltage-gated K+ channels (7). Another type of Ca2+-activated K+ channel, which has a single transmembrane domain, is expressed abundantly in proximal tubules (4, 26, 27). This channel, which is activated both by hypotonicity and depolarization produces a slowly activating current when the cRNA is injected Xenopus oocytes. It is possible that this channel is responsible for Ca2+-activated K+ currents in the native proximal tubule.
Our RPA indicated that the order of rbslo1 mRNA abundance is inner medulla > cortex > outer medulla. We could not consistently detect protected bands corresponding to rbslo2 mRNA by RPA, probably because of low abundance of rbslo2 mRNA. The expected size of PCR products for rbslo2 mRNA was detected by RT-PCR (Fig. 4). In addition to the two splice variants of rbslo isolated from MTAL cells, it is still possible that other splice variants may exist in the kidney, which were not identified in this study. Rare isoforms might not be amplified sufficiently to be detected.
In conclusion, maxi K+ channels are thought to play an important role in regulatory volume decrease. Our data show that rbslo maxi K+ channels are expressed most abundantly in inner medulla. Given that the inner medulla is subjected to large changes in osmolality during different diuretic states, it is possible that Ca2+-activated K+ channels may have a role in volume regulation in this portion of the kidney.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Min Li (Dept. of Physiology, The Johns Hopkins University) for kindly providing CD4 plasmid.
| |
FOOTNOTES |
|---|
This work was funded by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-32753.
Address for reprint requests: W. B. Guggino, Dept. of Physiology, School of Medicine, The Johns Hopkins Univ., 725 N. Wolfe St., Baltimore, MD 21205.
Received 29 January 1997; accepted in final form 15 May 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adelman, J. P.,
K. Shen,
M. P. Kavanaugh,
R. A. Warren,
Y. Wu,
A. Lagrutta,
C. T. Bond,
and
R. A. North.
Calcium-activated potassium channels expressed from cloned complementary DNAs.
Neuron
9:
209-216,
1992[Medline].
2.
Alioua, A.,
J. P. Huggins,
and
E. Rousseau.
PKG-I
phosphorylates the
-subunit and upregulates reconstituted GKCa channels from tracheal smooth muscle.
Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12):
L1057-L1063,
1995
3.
Berg, M.,
N. Green,
S. R. Steel,
and
J. Handler.
Differentiated function in cultured epithelia derived from thick ascending limbs.
Am. J. Physiol.
242 (Cell Physiol. 11):
C229-C233,
1982
4.
Busch, A. E.,
and
F. Lang.
Effect of [Ca2+]i and temperature on min K channels expressed in Xenopus oocytes.
FEBS Lett.
334:
221-224,
1993[Medline].
5.
Butler, A.,
S. Tsunoda,
D. P. McCobb,
A. Wei,
and
L. Sarkoff.
Mslo, a complex mouse gene encoding "maxi" calcium-activated potassium channels.
Science
261:
221-224,
1993
6.
Candia, S.,
M. L. Garcia,
and
R. Latorre.
Mode of action of iberiotoxin, a potent blocker of the large conductance Ca2+-activated K+ channel.
Biophys. J.
63:
583-590,
1992[Medline].
7.
Doerner, D.,
T. A. Pitler,
and
B. E. Alger.
Protein kinase C activators block specific calcium and potassium current components in isolated hippocampal neurons.
J. Neurosci.
8:
4069-4078,
1988[Abstract].
8.
Guggino, S. E.,
W. B. Guggino,
N. Green,
and
B. Sacktor.
Ca2+-activated K+ channels in cultured medullary thick ascending limb cells.
Am. J. Physiol.
252 (Renal Fluid Electrolyte Physiol. 21):
C121-C127,
1987
9.
Guggino, S. E.,
W. B. Guggino,
and
B. Sacktor.
Forskolin and antidiuretic hormone stimulate a Ca2+-activated K+ channel in cultured kidney cells.
Am. J. Physiol.
249 (Renal Fluid Electrolyte Physiol. 18):
F448-F455,
1985.
10.
Kawahara, K.,
A. Ogawa,
and
M. Suzuki.
Hypotonic activation of Ca-activated K channels in cultured rabbit kidney proximal tubular cells.
Am. J. Physiol.
260 (Renal Fluid Electrolyte Physiol. 29):
F27-F33,
1991
11.
Knaus, H. G.,
K. Folander,
M. Garcia-Calvo,
M. L. Garcia,
G. J. Kaczorowski,
M. Smith,
and
R. Swanson.
Primary sequence and immunological characterization of
-subunit of high conductance Ca2+-activated K+ channel from smooth muscle.
J. Biol. Chem.
269:
17274-17278,
1994
12.
Krapivinsky, G.,
E. A. Gordon,
K. Wickman,
B. Velimirovic,
L. Krapivinsky,
and
D. E. Clapham.
The G-protein-gated atrial K+ channel IKACh is a heteromultimer of two inwardly rectifying K+-channel proteins.
Nature
374:
135-141,
1995[Medline].
13.
Kume, H.,
A. Takai,
H. Tokuno,
and
T. Tomita.
Regulation of Ca2+-dependent K+ channel activity in tracheal myocytes by phosphorylation.
Nature
341:
152-154,
1989[Medline].
14.
Lagrutta, A.,
K. Shen,
A. North,
and
J. P. Adelman.
Functional differences among alternatively spliced variants of slopoke, a Drosophila calcium-activated potassium channel.
J. Biol. Chem.
269:
20347-20351,
1994
15.
Ling, B. N.,
C. F. Hinton,
and
D. C. Eaton.
Potassium permeable channels in primary culture of rabbit cortical collecting tubule.
Kidney Int.
40:
441-452,
1991[Medline].
16.
Lu, L.,
C. Montrose-Rafizadeh,
and
W. B. Guggino.
Ca2+-activated K+ channels from rabbit kidney medullary thick ascending limb cells expressed in Xenopus oocytes.
J. Biol. Chem.
265:
16190-16194,
1990
17.
McCarty, N. A.,
and
R. G. O'Neil.
Calcium-dependent control of volume regulation in renal proximal tubule cells. II. Roles of dihydropyridine-sensitive and -insensitive Ca2+ entry pathway.
J. Membr. Biol.
123:
161-170,
1991[Medline].
18.
McCobb, D. P.,
N. L. Fowler,
T. Featherstone,
C. J. Lingle,
M. Saito,
J. E. Krause,
and
L. Salkoff.
A human calcium-activated potassium channel gene expressed in vascular smooth muscle.
Am. J. Physiol.
269 (Heart Circ. Physiol. 38):
H767-H777,
1995
19.
McManus, D. B.,
L. M. H. Heins,
L. Pallanck,
B. Ganetzky,
R. Swanson,
and
R. J. Leonard.
Functional role of the
-subunit of high conductance calcium-activated potassium channels.
Neuron
14:
645-650,
1995[Medline].
20.
Merot, J.,
M. Bidet,
S. L. Maout,
M. Tauc,
and
P. Pojeol.
Two type of K+ channels in the apical membrane of rabbit proximal tubule in primary culture.
Biochim. Biophys. Acta
978:
134-144,
1989[Medline].
21.
Merot, J.,
V. Poncet,
M. Bidet,
M. Tauc,
and
P. Poujeol.
Apical membrane ionic channels in the rabbit cortical thick ascending limb in primary culture.
Biochim. Biophys. Acta
1070:
387-400,
1991[Medline].
22.
Montrose-Rafizadeh, C.,
and
W. B. Guggino.
Role of intracellular calcium in volume regulation by medullary thick asecending limb cells.
Am. J. Physiol.
260 (Renal Fluid Electrolyte Physiol. 29):
F402-F409,
1991
23.
Pacha, J.,
G. Frindt,
H. Sackin,
and
L. G. Parmer.
Apical maxi K channels in intercalated cells in CCT.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F696-F705,
1991
24.
Stockand, J. D.,
and
S. C. Sansom.
Large Ca2+-activated K+ channels responsive to angiotensin II in cultured human mesangial cells.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1080-C1086,
1994
25.
Stoner, L. C.,
and
G. E. Morley.
Effect of basolateral or apical hyposmolarity on apical maxi K channels of everted rat collecting tubule.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F569-F580,
1995
26.
Sugimoto, T.,
Y. Tanabe,
R. Shigemoto,
M. Iwai,
T. Takumi,
H. Ohkubo,
and
S. Nakanishi.
Immunological study of a rat membrane protein which induces a selective potassium permeation: its localization in the apical membrane portion of epithelial cells.
J. Membr. Biol.
113:
39-47,
1990[Medline].
27.
Takumi, T.,
H. Ohkubo,
and
S. Nakanishi.
Cloning of a membrane protein that induces a slow voltage-gated potassium current.
Science
242:
1042-1045,
1988
28.
Taniguchi, J.,
and
W. B. Guggino.
Membrane stretch: a physiological stimulator of Ca2+-activated K+ channels in thick ascending limb.
Am. J. Physiol.
257 (Renal Fluid Electrolyte Physiol. 26):
F347-F352,
1989
29.
Taniguchi, J.,
K. Furukawa,
and
M. Shigekawa.
Maxi K+ channels are stimulated by cyclic guanosine monophosphate-dependent protein kinase in canine coronary artery smooth muscle cells.
Pflügers Arch.
423:
167-172,
1993[Medline].
30.
Tauc, M.,
P. Congar,
V. Poncet,
J. Merot,
C. Vita,
and
P. Poujeol.
Toxin pharmacology of the large-conductance Ca2+- activated K+ channel in the apical membrane of rabbit proximal convoluted tubule in primary culture.
Pflügers Arch.
425:
126-133,
1993[Medline].
31.
Terada, Y.,
T. Moriyama,
B. M. Martin,
M. A. Knepper,
and
A. Garcia-Perez.
RT-PCR microlocalization of mRNA for guanylyl cyclase-coupled ANF receptor in rat kidney.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F1080-F1087,
1991
32.
Tseng-Crank, J.,
C. D. Foster,
J. D. Kraus,
R. Metz,
N. Godict,
T. J. Dichiara,
and
P. H. Reinhart.
Cloning, expression, and distribution of functionally distinct Ca2+-activated K+ channel isoforms from human brain.
Neuron
13:
1315-1330,
1994[Medline].
33.
Wei, A.,
C. Solaro,
C. Lingle,
and
L. Sarkoff.
Calcium sensitivity of BK-type KCa channels determined by a separable domain.
Neuron
13:
671-681,
1994[Medline].
34.
Zweifach, A.,
G. V. Desir,
P. S. Aronson,
and
G. H. Giebisch.
A Ca-activated K channel from rabbit renal brush-border membrane vesicles in planar lipid bilayers.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F187-F196,
1991
This article has been cited by other articles:
![]() |
G. Estilo, W. Liu, N. Pastor-Soler, P. Mitchell, M. D. Carattino, T. R. Kleyman, and L. M. Satlin Effect of aldosterone on BK channel expression in mammalian cortical collecting duct Am J Physiol Renal Physiol, September 1, 2008; 295(3): F780 - F788. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Heitzmann and R. Warth Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia Physiol Rev, July 1, 2008; 88(3): 1119 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wright, M. M. Morales, J. Sousa-Menzes, D. Ornellas, J. Sipes, Y. Cui, I. Cui, P. Hulamm, V. Cebotaru, L. Cebotaru, et al. Transcriptional adaptation to Clcn5 knockout in proximal tubules of mouse kidney Physiol Genomics, May 1, 2008; 33(3): 341 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Grimm, R. M. Foutz, R. Brenner, and S. C. Sansom Identification and localization of BK-beta subunits in the distal nephron of the mouse kidney Am J Physiol Renal Physiol, July 1, 2007; 293(1): F350 - F359. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Satlin, M. D. Carattino, W. Liu, and T. R. Kleyman Regulation of cation transport in the distal nephron by mechanical forces Am J Physiol Renal Physiol, November 1, 2006; 291(5): F923 - F931. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pluznick and S. C. Sansom BK channels in the kidney: role in K+ secretion and localization of molecular components Am J Physiol Renal Physiol, September 1, 2006; 291(3): F517 - F529. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Najjar, H. Zhou, T. Morimoto, J. B. Bruns, H.-S. Li, W. Liu, T. R. Kleyman, and L. M. Satlin Dietary K+ regulates apical membrane expression of maxi-K channels in rabbit cortical collecting duct Am J Physiol Renal Physiol, October 1, 2005; 289(4): F922 - F932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pluznick, P. Wei, P. R. Grimm, and S. C. Sansom BK-{beta}1 subunit: immunolocalization in the mammalian connecting tubule and its role in the kaliuretic response to volume expansion Am J Physiol Renal Physiol, April 1, 2005; 288(4): F846 - F854. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Hebert, G. Desir, G. Giebisch, and W. Wang Molecular Diversity and Regulation of Renal Potassium Channels Physiol Rev, January 1, 2005; 85(1): 319 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Woda, N. Miyawaki, S. Ramalakshmi, M. Ramkumar, R. Rojas, B. Zavilowitz, T. R. Kleyman, and L. M. Satlin Ontogeny of flow-stimulated potassium secretion in rabbit cortical collecting duct: functional and molecular aspects Am J Physiol Renal Physiol, October 1, 2003; 285(4): F629 - F639. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-X. Wang, M. Ikeda, and W. B. Guggino The Cytoplasmic Tail of Large Conductance, Voltage- and Ca2+-activated K+ (MaxiK) Channel Is Necessary for Its Cell Surface Expression J. Biol. Chem., January 17, 2003; 278(4): 2713 - 2722. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lin, H. Sterling, K. M. Lerea, G. Giebisch, and W.-H. Wang Protein Kinase C (PKC)-induced Phosphorylation of ROMK1 Is Essential for the Surface Expression of ROMK1 Channels J. Biol. Chem., November 8, 2002; 277(46): 44278 - 44284. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kunzelmann and M. Mall Electrolyte Transport in the Mammalian Colon: Mechanisms and Implications for Disease Physiol Rev, January 1, 2002; 82(1): 245 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Woda, A. Bragin, T. R. Kleyman, and L. M. Satlin Flow-dependent K+ secretion in the cortical collecting duct is mediated by a maxi-K channel Am J Physiol Renal Physiol, May 1, 2001; 280(5): F786 - F793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Muto Potassium Transport in the Mammalian Collecting Duct Physiol Rev, January 1, 2001; 81(1): 85 - 116. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |