|
|
||||||||
Departments of Pediatrics and Internal Medicine, University of Virginia Health Sciences Center, Charlottesville, Virginia 22908
| |
ABSTRACT |
|---|
|
|
|---|
Renal juxtaglomerular (JG) cells are specialized myoepithelioid cells located in the afferent arteriole at the entrance to the glomerulus. Their main function and distinctive feature is the synthesis and release of renin, the key hormone-enzyme of the renin-angiotensin system that regulates arterial blood pressure. Despite their relevance to health and disease, not much is known about factors that confer and/or maintain JG cell identity. To identify genes uniquely expressed in JG cells, we used a cell culture model and RNA differential display. JG cells cultured for 2 days express renin and renin mRNA, but after 10 days in culture they no longer contain or release renin and renin mRNA is reduced 700-fold. We report one cDNA differentially expressed in the 2-day JG cell culture that detects a 2.6-kb mRNA expressed at higher levels in newborn than adult kidney. Screening a 2-day culture JG cell cDNA library yielded clones representing differentially spliced transcripts. These cDNAs encode one unique protein (Zis) containing zinc fingers and domains characteristic of splicing factors and RNA binding proteins. Northern blot analysis confirmed Zis mRNA expression in differentiated JG cells, and identified an additional unique 1.5-kb transcript. The Zis transcripts are developmentally regulated in kidney and a number of other organs. The features of the Zis protein and its organ distribution suggest a possible role in regulation of transcription and/or splicing, both important steps for controlling developmentally expressed genes.
kidney; renin; zinc finger; splicing; ribonucleic acid binding protein
| |
INTRODUCTION |
|---|
|
|
|---|
RENAL juxtaglomerular (JG) cells are a highly specialized group of myoepithelioid cells located in the afferent arteriole at the entrance to the glomerulus. JG cells possess granules containing renin and in addition contain peroxisomes, electron-dense vesicles, myofilaments, and few mitochondria. They communicate with other cells (smooth muscle cells, endothelial cells) and each other via gap and myoendothelial junctions and other processes. The main function and distinctive feature of these cells is their ability to synthesize and release renin (18), the key hormone-enzyme of the renin-angiotensin system that regulates arterial blood pressure, renal hemodynamics, and fluid-electrolyte homeostasis. Although the JG cells have been well characterized morphologically, the presence of renin is the only reliable marker that allows identification of this cell as distinct from other cell types. Despite their important role in health and disease, not much is known about the factors that confer and/or maintain JG cell identity.
The development and maintenance of cell identity depends at a minimum on the repertoire of genes expressed by a given cell type. None of the molecular mechanisms or regulatory genes that potentially control JG cell identity are known. The present study was designed to isolate and characterize genes involved in JG cell specification.
We adapted a method for JG cell purification that allows us to obtain a more than 95% pure population of JG cells (29). When purified JG cells are cultured for 24-72 h, the cells retain their ability to synthesize and release renin. However, as the time in culture increases, they eventually dedifferentiate and lose their capacity to synthesize renin. We took advantage of this paradigm and the recently developed technique of mRNA differential display (26, 27) to identify genes potentially involved in JG cell differentiation. In this study we describe the identification of Zis, a developmentally regulated gene expressed in JG cells.
| |
METHODS |
|---|
|
|
|---|
Isolation and Culture of JG Cells
An enriched population of JG cells was isolated from kidneys of male Sprague-Dawley rats (100 g) by centrifugation in a Percoll density gradient as previously described (6). The enriched JG cell fraction was placed into cell culture using conditions described by Kurtz et al. (24) and maintained with daily changes of medium.Immunostaining
Immunostaining for renin in cultured JG cells using anti-rat renin antibody was done as previously described (17).Assay for Renin Activity
Renin enzymatic activity is reported as nanograms angiotensin I (ANG I) generated per milligram protein per hour measured by radioimmunoassay for ANG I as previously described (20, 34).RNA Isolation
Total RNA was isolated from JG cells cultured for 2 and 10 days and from various organs of newborn and adult rats by the single-step RNA isolation method of Chomczynski (7) using Tri-Reagent (Molecular Research Center, Cincinnati, OH). Poly(A)+ mRNA was prepared according to the standard protocol of Okayama et al. (30) using oligo(dT) cellulose spin columns (5 Prime
3 Prime, Boulder,
CO).
Northern Hybridization
For Northern blot analysis, 15 µg total RNA or 2.5 µg of poly(A)+ mRNA was electrophoresed in a 1.2% agarose-formaldehyde gel and transferred to positively charged nylon membranes (Zeta-Probe; Bio-Rad Laboratories, Hercules, CA) as previously described (16, 17). Probes were labeled with [
-32P]dCTP by the
random primer method (13) using a commercially available kit (DECAprime
II; Ambion, Austin, TX). Probe specific activity ranged from 0.4 to 1.4 × 109
counts · min
1 · µg
1.
Northern blots were hybridized by the method of Church and Gilbert (8)
as previously described (15, 16).
Cloning and Analysis of cDNAs
Cloning and propagation of cDNAs in plasmid or phage vectors and restriction enzyme digestion and analysis followed standard molecular biology techniques (32) and manufacturers' protocols supplied with the various kits used.Renin mRNA Quantitative Reverse Transcription-Polymerase Chain Reaction
Construction of competitive template. The 1,433-bp renin cDNA (4) was digested with EcoR I to remove a 246-bp fragment. The EcoR I ends were blunted by filling in using Klenow DNA polymerase (32). A 322-bp Rsa I-Pvu II fragment isolated from pBluescript (Stratagene, La Jolla, CA) was ligated into the deleted renin cDNA to create a 322-bp insertion of heterologous DNA. cRNA was transcribed from the mutant renin cDNA using SP6 RNA polymerase according to the manufacturer's protocols (Boehringer Mannheim, Indianapolis, IN). cRNA was quantitated by measuring its absorbance at 260 nm. Primers for polymerase chain reaction (PCR) were designed to flank the insertion (5' upstream primer, 5' ATGCCTCTCTGGGCACTCTT; 3' downstream primer, 5' GTCAAACTTGGCCAGCATGA). PCR amplification with these primers yields a 551-bp product from native renin and a 627-bp product from the competitive template (CT).Quantitative reverse
transcription-PCR. Total RNA (200, 400, and 2,000 ng)
from JG cells after 2, 6, and 10 days in culture was reverse
transcribed with a known amount of mutant CT. Reaction conditions were
as follows: 50 mM KCl, 10 mM tris(hydroxymethyl)aminomethane (Tris)
hydrochloride, pH 9.0, 0.1% Triton X-100, 5 mM
MgCl2, 1.25 mM each dNTP, 5 mM
dithiothreitol (DTT), 15 U RNasin (Boehringer Mannheim), 0.75 µM
downstream primer, and 200 U Moloney murine leukemia virus (MMLV)
reverse transcriptase, in a total volume of 20 µl. The
reverse-transcribed renin cDNA [5 µl of the reverse transcription (RT) reaction] was amplified by PCR in the presence of [
-32P]dCTP. PCR
reaction conditions were as follows: 43.75 mM KCl, 8.75 mM
Tris · HCl, pH 9.0, 0.09% Triton X-100, 5 mM
MgCl2, 8.75 mM DTT, 0.75 µM
upstream primer, 0.56 µM downstream primer, 0.94 mM dNTP, 1 µCi
[
-32P]dCTP, 5 U
Taq DNA polymerase (Promega, Madison,
WI) in a total volume of 20 µl; cycling parameters were 94°C for
1 min, 55°C for 1 min, and 72°C for 1 min, for 30 cycles.
Native product (551 bp) and CT product (627 bp) were separated on a 2%
agarose gel. Bands were excised, and
[
-32P]dCTP
incorporation was quantitated by liquid scintillation counting. For
each PCR reaction, the percentage (P, in %) of all counts incorporated
in native product was calculated according to the following formula: P = Xnative/[(XCT/1.1) + Xnative] and plotted vs.
log CT (in fg), where Xnative is
the counts per minute (cpm) of native product,
XCT is the cpm of CT, and the
value 1.1 is the correction coefficient for renin CT, reflecting the
dCTP ratio of native product to CT. The point when 50% of
all counts are found in the native PCR product is equal to the starting
amount of renin mRNA. Using this method, we can readily detect as
little as 15 fg renin mRNA per microgram of total RNA.
mRNA Differential Display
Total RNA (50 µg) extracted from JG cells after 2 and 10 days in culture was treated with 10 U of deoxyribonuclease I according to the manufacturer's protocol (MessageClean kit; GenHunter, Brookline, MA) to remove contaminating genomic DNA. The RNA was reverse transcribed with an oligo(dT) primer anchored to the beginning of the poly(A)+ tail of the mRNAs [oligo(dT) primer T12MG where M represents a degenerate base (see Ref. 27)] using the RNAmap Kit (GenHunter). The RT reaction contained 20 µM dNTP, 0.01 µg/µl total RNA, 1 µM T12MN primer, 100 U MMLV reverse transcriptase in RT buffer (RT buffer contained 25 mM Tris-Cl, pH 8.3, 37.6 mM KCl, 1.5 mM MgCl2, and 5 mM DTT) in a total volume of 20 µl and was performed as follows: 65°C, 5 min; 37°C, 60 min; 95°C, 5 min. PCR amplification used the same oligo(dT) primer downstream and one of five arbitrary primers upstream (AP-1, 5' AGCCAGCGAA; AP-2, 5' GACCGCTTGT; AP-3, 5' AGGTGACCGT; AP-4, 5' GGTACTCCAC; AP-5, 5' GTTGCGATCC). The PCR reactions contained 2 µM dNTP, 0.2 µM AP-primer, 1 µM T12MN primer, 4 µl of RT mixture, 0.5 µM [
-35S]dATP (1,200 Ci/mmol; New England Nuclear, Boston, MA), and 1 U of
AmpliTaq DNA polymerase
(Perkin-Elmer, Branchburg, NJ) in PCR buffer (PCR buffer contained 10 mM Tris-Cl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, and 0.001% gelatin) in a
total volume of 20 µl. Amplification was as follows: 94°C, 30 s;
40°C, 2 min; 72°C, 30 s for 40 cycles; 72°C, 5 min. The
amplified cDNAs were separated in a 5% polyacrylamide-urea sequencing
gel. The gel was placed on blotting paper, dried under vacuum and
exposed to BioMax film (Kodak, Rochester, NY) to visualize the labeled
cDNAs. To minimize errors in the PCR procedure, several replicates of
amplified cDNA (from the same RT reaction or a totally independent RT
reaction) were separated in adjacent lanes of the same gel and only
bands differentially expressed in several reactions were selected.
Bands of interest (located by aligning the autoradiograph
with the gel) were excised with a razor blade, and cDNA was extracted
by boiling gel slices in 100 µl
H2O for 15 min. Eluted cDNAs were
reamplified with the corresponding primer set using the same conditions
and cycle times as the original PCR with the exception that the
nucleotide concentration was reduced from 20 µM to 2 µM and no
radioactive nucleotides were included. The reamplified cDNA
fragments were electrophoresed in 1.2% agarose gels, the
cDNA-containing bands were excised from the gel and DNA recovered using
the Qiaex kit (Qiagen, Chatsworth, CA). Purified cDNA fragments were
cloned into pNoTA, a vector designed for cloning of PCR products
(31), following protocols supplied with the cloning kit (5 Prime
3 Prime).
DNA Sequencing
Cloned cDNA fragments were sequenced by the dideoxy chain-termination method (33) using the Sequenase version 2.0 kit (Amersham Life Science, Arlington Heights, IL) and [
-35S]dATP
(1,000-1,500 Ci/mmol; DuPont-NEN). Nested 5' and 3'
deletions were generated (35) from cDNAs obtained from screening our JG cell cDNA library (see below) using exonuclease III (Life Technologies, Grand Island, NY). Both strands of each reported cDNA were completely sequenced.
Construction of a JG Cell cDNA Library
Poly(A)+ mRNA was isolated from JG cells after 2 days in culture, and the integrity and size range (0.5-10 kb with majority at 2.5-3.5 kb) was determined by electrophoresis in a 1.2% agarose-formaldehyde gel. To synthesize first and second cDNA strands and to ligate adapters, the ZAP-cDNA Synthesis kit from Stratagene was used. The cDNA was fractionated, sized on a nondenaturing polyacrylamide gel, and ligated into the Uni-ZAP XR vector (Stratagene). The library was packaged in Gigapack II packaging extract and plated on Escherichia coli XL1-Blue-MRF' (Stratagene). The primary library was subjected to one round of amplification (final titer, 1010 plaque-forming units/ml).cDNA Library Screening
The amplified library (106 plaques) was screened with [
-32P]dCTP-labeled
differential display-originated probes using protocols recommended by
the library kit manufacturer (Stratagene). Positive plaques were
excised in vivo to yield cDNAs in the more manageable pBluescript
vector (Stratagene). Restriction enzyme digests were electrophoresed
and blotted onto Zetaprobe membrane (Bio-Rad Laboratories), and the
blots were hybridized with the probe used to screen the library to
confirm that the clones contained cDNA homologous to the original
probe. Sequences derived from selected clones were analyzed using the
Wisconsin GCG sequence analysis software package available through the
University of Virginia (14a)
| |
RESULTS |
|---|
|
|
|---|
Expression of Renin in Cultured JG Cells
Renin immunostaining of JG cells in culture is shown in Fig. 1. Virtually all JG cells that have been cultured for 2 days are positive for renin (Fig. 1A). However, after 10 days in culture, none of the cells contained immunoreactive renin (Fig. 1B). Renin enzymatic activity parallels the immunostaining, decreasing from 1,500 ng ANG I · mg
1 · h
1
at 2 days in culture to 24 ng ANG
I · mg
1 · h
1
after 10 days in culture. The quantitative RT-PCR assay for renin mRNA
showed that the decrease in renin protein during culture is paralleled
by a marked decrease in renin mRNA (Table
1). The amount of renin mRNA in JG cells
decreases 100-fold during the first 5 days of culture. By the 10th day
of culture, the reduction is more than 700-fold. The protein and mRNA
data show that the JG cells dedifferentiate in culture and lose their
characteristic function of expressing renin.
|
|
mRNA Differential Display
To identify mRNAs that are expressed uniquely or in different abundance in differentiated versus undifferentiated JG cells, we analyzed RNA from JG cells cultured 2 days (differentiated) or 10 days (undifferentiated) by the method of mRNA differential display (26, 27). RNA was reverse transcribed to cDNA and then subjected to amplification using PCR and five different primer sets (see METHODS). Figure 2 shows a portion of a differential display gel autoradiogram. The cDNA fragments expressed in 2-day cultures but not in 10-day cultures and vice versa are numbered. In all, we found 27 cDNAs expressed only in 2-day cultures and 10 cDNAs only in 10-day cultures (only a fraction is shown). There were also a number of cDNAs whose abundance changed with culture duration but were not unique to the differentiated or undifferentiated state. Differentially expressed cDNA fragments were reamplified, and the purified fragments were used to probe Northern blots to confirm differential expression. For the initial screening, Northern blots of total RNA from newborn and adult rat kidneys were used. There are more renin-expressing cells in the newborn kidney than in the adult, thus providing a greater proportion of mRNA from renin-expressing cells in newborn RNA samples (39). This screening paradigm was used, since RNA from staged cultured JG cells is scarce in comparison to that from whole kidneys. Six of seven cDNAs expressed in 2-day culture were differentially expressed in newborn kidneys and one of three cDNAs from 10-day culture was differentially expressed in adult kidneys. The remaining three cDNAs were either not differentially expressed or no transcript was detected.
|
Analysis and Cloning of cDNA Fragment 4
We report here cDNA fragment 4 (Fig. 2), which was differentially expressed in 2-day JG cell cultures. In the initial screening, cDNA fragment 4 detected a 2.6-kb transcript present in newborn kidney total RNA. A transcript of the same size was barely detectable in adult kidney RNA. cDNA fragment 4 is therefore developmentally regulated and expressed more abundantly at the stage with a greater abundance of renin-expressing cells.cDNA fragment 4, which represents the 3' end of the corresponding mRNA, was used to screen the cDNA library we prepared from JG cells cultured for 2 days. Three of the 21 positive plaques identified on the primary screen were purified and subjected to sequence analysis. The organization of these three clones is shown in Fig. 3. They share a common sequence which yields an uninterrupted 996-bp open-reading frame (ORF, open box) but differ in the lengths of their 5'- and 3'-untranslated regions. Clone 1511 has a 265-bp 5'-untranslated region, whereas clone 152 has 47 bp and clone 182 only 17 bp. The 3'-untranslated regions of 1511 and 152 are of similar length (152 and 149 bp to the poly-A sequence, respectively), whereas clone 182 has 1,633 bp at the 3' end. The common ORF in clone 152 is interrupted by 1,247 bp of DNA. This clone may represent a cDNA from an incompletely processed mRNA, since the interrupting DNA has characteristics of an intron as revealed by exon-intron border analysis (37). A composite of the three sequences, shown in the bottom of Fig. 3, would produce a 4-kb mRNA.
|
Since each of the cDNAs analyzed had such different organization, we examined some of the other positive primary plaques to determine whether there were other forms and whether the original forms were repeated. Five additional cDNAs were purified and analyzed by restriction enzyme digestion and hybridization with probe a (Fig. 3). Three of the clones were the same as clone 182, and two were the same as clone 1511. The recovery of replicates of two of the original cDNAs indicates that they indeed represent alternate forms of the mRNA and are not cloning artifacts. No additional forms were found, suggesting that we had identified all the types present in the library.
The combined sequence of these three clones with the amino acid sequence of the coding regions in single letter code is shown in Fig. 4. The first methionine codon common to all sequences was chosen as the translation start codon (22). The ORF yields a 332-amino acid protein. Analysis of this amino acid sequence (Fig. 5) revealed several features. There are two putative zinc finger motifs (characteristic of transcription factors and RNA/DNA binding proteins), a short stretch of basic residues (RKKKKYRGK) that corresponds to the consensus sequence for a nuclear localization signal (NLS) (38), and a 70-residue serine-arginine (SR)-rich region (characteristic of splicing factors). Because of the presence of these elements, we named this gene Zis (from "zinc finger, splicing").
|
|
Comparison of the Zis nucleotide sequence with sequences in the GenBank and EMBL databases (14a) did not reveal significant overall homology to any known sequence. Part of the sequence (as underscored on Fig. 4) has 83% nucleotide identity to an internal sequence of a X. laevis mRNA containing a zinc finger (GenBank accession no. X70647; data not published). The deduced amino acid sequence was also compared with the protein databases. The 70-residue SR-rich region shared 20-50% identity with various splicing factors (41) and other proteins with SR domains such as vitellogenin (40), natural killer (NK)-tumor recognition protein (1), and E2 human papilloma virus protein (12). The two zinc finger motifs in the NH2 terminus of the protein share 60% amino acid identity to a region of the human Ewing's sarcoma (EWS) RNA-binding protein (11) and human RNA-binding protein TLS (from "translocated in liposarcoma") (10). This is the same region which shares high nucleotide identity with the X. laevis zinc finger mRNA noted above. There is a low degree of homology with other RNA-binding proteins such as human RNA-binding protein (2) and Drosophila RNA-binding protein (19). Outside the zinc finger domain and the SR-rich region, no similarity to any known proteins was found.
Differential Expression and Developmental Regulation of Zis
To confirm that the cDNA clones reflect the developmental regulation seen in the initial screening of cDNA fragment 4, we hybridized an Xho I-EcoR I fragment (2,116 bp) containing the common sequence of all the clones and the potential intron (probe a, Fig. 3) to mRNA from newborn and adult rat kidney (Fig. 6a). The same 2.6-kb transcript found in the screening of total RNA was found in the poly(A)+ mRNA, as well as two other transcripts of 4 kb and 7 kb. All three transcripts were more abundant in newborn kidney mRNA than in the adult. The 2.6-kb transcript corresponds in size to clone 182, and the 4-kb transcript corresponds in size to the combined sequence of the three clones (Fig. 3). The 4-kb and 7-kb transcripts may represent partially spliced mRNAs. The membrane was also hybridized with a glyceraldehyde-3-phosphate dehydrogenase (housekeeping) probe which showed that equal amounts of RNA had been loaded in each lane (data not shown). Hybridization to mRNA from JG cells after 2 days in culture shows two transcripts, i.e., the same 2.6-kb transcript as found in the whole kidney as well as a 1.5-kb transcript unique to JG cells (Fig. 6b). This 1.5-kb transcript corresponds in size to cDNA clone 1511. There was no hybridization to 10-day mRNA (Fig. 6b). Thus the cloned cDNAs are differentially expressed in JG cells cultured for 2 days (confirming their original selection criterion) and are developmentally regulated in the kidney as indicated by the original screening of the differential display cDNA fragment 4.
|
To determine how widely expressed this gene is in various tissues, mRNA from different newborn and adult rat organs was analyzed by Northern blot hybridization with a 619-bp Sal I-Pvu I fragment (probe b, Fig. 3) from the 5' part of the common ORF sequence. The three transcripts (2.6, 4, and 7 kb) seen in kidney were also detected in all the other tissues examined (lung, liver, heart, brain) (Fig. 7). The 1.5-kb transcript found in 2-day JG cell mRNA was not seen in any other tissue and appears to be unique to the JG cell. In all tissues, the 2.6-kb transcript is the most abundant species. Brain has a higher level of expression than kidney, whereas heart and lung have levels similar to the kidney. Liver expresses very little of these mRNAs. Similar to the kidney, the heart displays an increased expression of these mRNAs in the newborn. The brain also follows this pattern, but the difference is less marked. Both lung and liver show the opposite developmental regulation, having higher levels of the 2.6-kb transcript in the adult than in the newborn. The abundance of the two larger transcripts also appears to be developmentally regulated but not always in the same way with respect to the major transcript or themselves. For example, the 7-kb transcript in brain is more abundant in newborn, whereas the 4-kb transcript is more abundant in adult.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study we describe the isolation, structure, and expression of Zis, a novel gene expressed in JG cells. We isolated a pure preparation of JG cells that expresses a high level of renin protein and mRNA for up to 48 h in culture. However, after 10 days in culture, the JG cells dedifferentiate and lose their capacity to synthesize and release renin. We took advantage of this characteristic to identify genes potentially involved in JG cell differentiation.
The deduced amino acid sequence of Zis yields a 332-amino acid, ~40-kDa protein that contains several interesting motifs which implicate it in protein-nucleic acid interactions, e.g., two zinc fingers, an NLS, a glutamic acid-rich region and an SR-rich domain. The sequence of the first 137 amino acids (including the zinc finger region and NLS) is virtually identical (124/127 matches) to that of C4SR, an RNA binding protein from X. laevis containing zinc fingers (GenBank accession no. X70647; data not published). This protein also has a glutamic acid-rich region and an SR region, but in these the identity with Zis is less pronounced. The carboxy- terminal parts of Zis and C4SR share no identity. The Xenopus sequence was identified by virtue of its RNA binding capacity; however, a specific function is unknown. The Zis zinc finger region matches a sequence in the carboxy-terminal portion of two other RNA binding proteins, EWS and TLS (10, 11), but distal to their RNA binding domains. The functions of EWS and TLS are also not known. An NLS sequence is just distal to the potential nucleic acid binding region. This organization is typical of many DNA or RNA binding proteins (25) most of which interact with their substrates in the nucleus. The glutamic acid-rich region is found particularly in hnRNP ("heterogeneous nuclear ribonucleoprotein particles") C-type proteins. These proteins have been shown to bind to sites on pre-mRNAs that are critical for the formation of mature and functional mRNA (3). The distinctive SR domain is a characteristic element of splicing factors (14). RNA binding proteins are modular proteins that are built of several elements that vary with the final function of the protein (3). For example, the domain organization of an RNA-binding element followed by an SR-rich region is commonly found in splicing factors (14, 41). In addition, it has been shown that the proximity of an RNA binding region to an NLS may influence its functional regulation (25) as found in the adenovirus E1a oncoprotein (38). Taking together all the motifs found in Zis, it seems most likely that Zis is an RNA binding protein involved in RNA splicing.
The results of Northern hybridization show that Zis is expressed in
kidney, heart, brain, lung, and liver in a developmentally regulated
fashion (Fig. 7). The major transcript in all organs is 2.6 kb, and the
1.5-kb transcript is expressed only in JG cells. The brain has the
greatest abundance of the 2.6-kb Zis transcript, followed by kidney and
heart. In these organs, the expression of Zis is higher in the newborn
than in the adult. Lung and liver have lower levels of Zis, and the
developmental regulation is different, i.e., more in the adult than in
the newborn. Transcripts of 4 and 7 kb are also present in all organs
surveyed. As suggested by our analysis of the cDNA clones, the 4-kb
transcript may be an incompletely processed mRNA. In the same way, we
think the 7-kb transcript represents an even less completely processed
species for which we did not detect a cDNA in our library. It is
interesting to note that in the brain the levels of these two
transcripts are also developmentally regulated, i.e., the 4-kb
transcript is more abundant in the adult, whereas the 7-kb transcript
is more abundant in the newborn. The presence of multiple transcripts, some of which are incompletely processed mRNAs and therefore
untranslatable, has been observed with other developmentally important
genes such as some of the homeobox genes (9). It has been suggested
that the generation of such regulated, untranslatable transcripts may be a way to modulate the amount of translatable mRNA available at any
particular time in development. Analysis of the 5'-untranslated regions of Zis cDNAs also suggests that controlling the translatability of Zis mRNA is important. From our JG cell cDNA library, two classes of
translatable cDNAs were recovered representing the major 2.6-kb transcript (clone 182) and the
1.5-kb JG cell-specific transcript (clone
1511). All the clones have the same sequence around
the ATG initiation codon. This sequence
(TCC
AAG
T)
differs from the consensus (GCC A/GCC
G) by having a T in the +4 position
instead of the usual G and differing in three other positions (20).
This results in an unfavorable context for initiation and may result in
inefficient translation. This situation is found in mRNAs for some
potent regulatory proteins (such as growth factors and cytokines),
suggesting that it might be necessary to control the yield of protein
that could be harmful if overproduced (21, 23). The two classes of
cDNAs differ in the lengths of their 5'-untranslated regions.
Analysis of the 5' sequences suggests that the different
transcripts could be translated with different efficiencies. The
5'-untranslated region of clone
1511 is very GC-rich and can assume an extensive
secondary structure that might create a barrier to effective
translation. The presence of such sequences is common for critical
regulatory genes and suggests that production of the corresponding
proteins is regulated at the level of translation (23). It is
interesting to note that this structure is found in the cell-specific
transcript. The common transcript cDNA clones lack this GC-rich region
and thus should be more readily translated. Although the role of the cell-specific transcript is as yet unknown, it is present at levels similar to that of the major transcript in JG cells and thus may require special regulation.
The results from analysis of the DNA structure, predicted amino acid sequence, and transcript patterns of Zis all point to it being a regulatory protein that interacts with RNA, probably as a regulated splicing factor. The expression of untranslatable transcripts and the unfavorable context for translation of the translatable ones all point to the importance of controlling the level of Zis protein. A number of genes involved in the early determination as well as maintenance of the differentiated state (such as the sex determination loci in Drosophila) are splicing factors that autoregulate their own expression levels and influence splice site selection in downstream genes in their pathway (36). Zis has the features of being such a developmentally regulated, and self-regulating, splicing factor. The regulation of the levels of SR proteins themselves in different cells has been shown to have a role in cell-specific splice site selection (28, 36, 41). A number of mRNAs that can be alternatively spliced in a tissue-specific or developmentally controlled manner have been identified (36) and could be candidate targets for regulation by Zis.
JG cells are specialized myoendothelial cells whose major identifying characteristic is the synthesis, storage and secretion of renin. During development of the fetal kidney, renin-expressing cells are present along much of the kidney vasculature, extending from afferent arterioles to the major branches of the renal artery. As development proceeds, the vascular location of renin-expressing cells is restricted, so that in the newborn there is expression along only part of the afferent arteriole, and in the adult, renin-expressing cells are found normally only at the entrance to the glomerulus (17). Various pharmacological and physiological manipulations that modulate renin levels in the whole animal result in expression of renin in cells along the afferent arteriole (15) in a pattern similar to that found in the fetus. It appears that there is plasticity in the cells of the vasculature such that adult cells that were not expressing renin, but probably did at an earlier stage in development, can regain their capacity to do so in response to certain stimuli. This plasticity in renin expression admits a wide range of potential regulatory levels. In this survey of mRNAs characteristic of renin-expressing cells, we identified Zis, a potential regulated splicing factor. Zis could affect renin expression directly by regulating the processing of renin pre-mRNA and thus influencing the amount of translatable mRNA or indirectly by regulating the expression of other proteins that modulate renin.
| |
ACKNOWLEDGEMENTS |
|---|
We thank V. Blinov for assistance with structural analysis, B. McGrath for culturing JG cells, and J. Gilrain for help with the quantitative RT-PCR.
| |
FOOTNOTES |
|---|
Facilities of the Child Health Research Center Molecular Biology Core Laboratory of the Department of Pediatrics (National Institutes of Health Grant P30-HD-28810) were used for the cloning and library screening. This research was supported by National Institutes of Health Grant P50-DK-44765 (to R. A. Gomez).
Address for reprint requests: R. A. Gomez, Pediatric Nephrology Division, Dept. of Pediatrics, Univ. of Virginia Health Sciences Center, 300 Lane Road, Bldg. MR4, Rm. 2001, Charlottesville, VA 22908.
Received 20 March 1997; accepted in final form 26 June 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Anderson, S. K.,
S. Gallinger,
J. Roder,
J. Frey,
H. A. Young,
and
J. R. Ortaldo.
A cyclophilin-related protein involved in the function of natural killer cells.
Proc. Natl. Acad. Sci. USA
90:
542-546,
1993
2.
Badolato, J.,
E. Gardiner,
N. Morrison,
and
J. Eisman.
Identification and characterization of a novel human RNA-binding protein.
Gene
166:
323-327,
1995[Medline].
3.
Bandziulis, R. J.,
M. S. Swanson,
and
G. Dreyfuss.
RNA-binding proteins as developmental regulators.
Genes Dev.
3:
431-437,
1989
4.
Burnham, C. E.,
C. L. Hawelu-Johnson,
B. M. Frank,
and
K. R. Lynch.
Molecular cloning of rat renin cDNA and its gene.
Proc. Natl. Acad. Sci. USA
84:
5605-5609,
1987
6.
Carey, R. M.,
K. M. Geary,
M. K. Hunt,
S. P. Ramos,
M. S. Forbes,
T. Inagami,
M. J. Peach,
and
D. A. Leong.
Identification of individual renocortical cells that secrete renin.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F649-F659,
1990
7.
Chomczynski, P.
A reagent for the single-step simultaneous isolation of RNA, DNA and protein from cell and tissue samples.
Biotechniques
15:
532-537,
1993[Medline].
8.
Church, G. M.,
and
W. Gilbert.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:
1991-1995,
1984
9.
Condie, B. G.,
A. H. Brivanlou,
and
R. M. Harland.
Most of the homeobox-containing Xhox36 transcripts in early Xenopus embryos cannot encode a homeodomain protein.
Mol. Cell. Biol.
10:
3376-3385,
1990
10.
Crozat, A.,
P. Aman,
N. Mandahl,
and
D. Ron.
Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma.
Nature
363:
640-644,
1993[Medline].
11.
Delattre, O.,
J. Zucman,
B. Plougastel,
C. Desmaze,
T. Melot,
M. Peter,
H. Kovar,
I. Joubert,
P. D. Jong,
G. Rouleau,
A. Aurias,
and
G. Thomas.
Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours.
Nature
359:
162-165,
1992[Medline].
12.
Delius, H.,
and
B. Hofmann.
Primer-directed sequencing of human papillomavirus types.
Curr. Top. Microbiol. Immunol.
186:
13-31,
1994[Medline].
13.
Feinberg, A. P.,
and
B. Vogelstein.
A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:
6-13,
1983[Medline].
14.
Fukami-Kobayashi, K.,
S. Tomada,
and
M. Go.
Evolutionary clustering and functional similarity of RNA-binding proteins.
FEBS Lett.
2:
289-293,
1993.
14a.
Genetics Computer Group. Program Manual for the
Wisconsin Package (version 8). Madison, WI: Genetics Computer
Group, 1994.
15.
Gomez, R. A.,
R. L. Chevalier,
A. D. Everett,
J. P. Elwood,
M. J. Peach,
K. R. Lynch,
and
R. M. Carey.
Recruitment of renin gene-expressing cells in adult rat kidneys.
Am. J. Physiol.
259 (Renal Fluid Electrolyte Physiol. 28):
F660-F665,
1990
16.
Gomez, R. A.,
K. R. Lynch,
R. L. Chevalier,
A. D. Everett,
D. W. Johns,
N. Wilfong,
M. J. Peach,
and
R. M. Carey.
Renin and angiotensinogen gene expression and intrarenal renin distribution during ACE inhibition.
Am. J. Physiol.
254 (Renal Fluid Electrolyte Physiol. 23):
F900-F906,
1988
17.
Gomez, R. A.,
K. R. Lynch,
B. C. Sturgill,
J. P. Elwood,
R. L. Chevalier,
R. M. Carey,
and
M. J. Peach.
Distribution of renin mRNA and its protein in the developing kidney.
Am. J. Physiol.
257 (Renal Fluid Electrolyte Physiol. 26):
F850-F858,
1989
18.
Hsueh, W. A.,
and
J. D. Baxter.
Human prorenin.
Hypertension
17:
469-479,
1991
19.
Immanuel, D.,
H. Zinszner,
and
D. Ron.
Association of SARFH (sarcoma-associated RNA-binding fly homolog) with regions of chromatin transcribed by RNA polymerase II.
Mol. Cell. Biol.
15:
4562-4571,
1995[Abstract].
20.
Johns, D. W.,
R. M. Carey,
R. A. Gomez,
K. R. Lynch,
T. Inagami,
J. Saye,
K. Geary,
D. E. Farnsworth,
and
M. J. Peach.
Isolation of renin-rich rat kidney cells.
Hypertension
10:
488-496,
1987
21.
Kimura, H.,
W. H. Fischer,
and
D. Schubert.
Structure, expression and function of a schwannoma-derived growth factor.
Nature
348:
257-260,
1990[Medline].
22.
Kozak, M.
Compilation and analysis of sequences upstream from the translational start in eukaryotic mRNAs.
Nucleic Acids Res.
12:
857-872,
1984
23.
Kozak, M.
An analysis of vertebrate mRNA sequences: Intimations of translational control.
J. Cell Biol.
115:
889-903,
1991.
24.
Kurtz, A.,
R. D. Bruna,
J. Pfeilschifter,
R. Taugner,
and
C. Bauer.
Atrial natriuretic peptide inhibits renin release from juxtaglomerular cells by a cGMP-mediated process.
Proc. Natl. Acad. Sci. USA
83:
4769-4773,
1986
25.
Lacasse, J.,
M. Ballak,
C. Mercure,
J. Gutkowska,
C. Chapeau,
S. Foote,
J. Menard,
P. Corvol,
M. Cantin,
and
J. Genest.
Immunocytochemical localization of renin in juxtaglomerular cells.
J. Histochem. Cytochem.
33:
323-332,
1985[Abstract].
26.
Liang, P.,
L. Averboukh,
and
A. B. Pardee.
Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization.
Nucleic Acids Res.
21:
3269-3275,
1993
27.
Liang, P.,
and
A. B. Pardee.
Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science
257:
967-971,
1992
28.
Mayeda, A.,
A. M. Zahler,
A. R. Krainer,
and
M. B. Roth.
Two members of a conserved family of nuclear phosphoproteins are involved in general and alternative pre-mRNA splicing.
Proc. Natl. Acad. Sci. USA
89:
1301-1304,
1992
29.
McGrath, E. M.,
H. A. Dagli,
R. A. Gomez,
P. Q. Barrett,
and
R. M. Carey.
Cyclic stretch inhibits renin release from cultured JG cells (Abstract).
J. Am. Soc. Nephrol.
5:
545,
1994.
30.
Okayama, H.,
M. Kawaichi,
M. Brownstein,
F. Lee,
T. Yokota,
and
K. Arai.
High efficiency cloning of full-length cDNA: construction and screening of cDNA expression libraries for mammalian cells.
Methods Enzymol.
154:
2-28,
1987.
31.
Oste, C.
Polymerase chain reaction.
Biotechniques
6:
162-167,
1988[Medline].
32.
Sambrook, J.,
E. F. Fritsch,
and
T. Maniatis.
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
33.
Sanger, F.,
S. Niklen,
and
A. R. Coulsen.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:
5463-5467,
1977
34.
Sealey, J. E.,
and
J. H. Laragh.
How to do a plasma renin assay.
Cardiovasc. Med.
2:
1079-1092,
1977.
35.
Slatko, B.,
P. Heunrich,
B. T. Nixton,
and
D. Voytas.
Constructing nested deletions for use in DNA sequencing.
In: Current Protocols in Molecular Biology, edited by F. M. Ausubel,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith,
and K. Struhl. Cambridge: Wiley, 1991, p. 7.2.1-7.2.20.
36.
Smith, C. W. J.,
J. G. Patton,
and
B. Nadal-Ginard.
Alternative splicing in the control of gene expression.
Annu. Rev. Genet.
23:
527-577,
1989[Medline].
37.
Staden, R.
Computer methods to locate signals in nucleic acid sequences.
Nucleic Acids Res.
12:
505-519,
1984.
38.
Standiford, D. M.,
and
J. D. Richter.
Analysis of developmentally regulated nuclear localization signal in Xenopus.
J. Cell Biol.
118:
991-1002,
1992
39.
Tufro-McReddie, A.,
D. W. Johns,
K. M. Geary,
H. Dagli,
A. D. Everett,
R. L. Chevalier,
R. M. Carey,
and
R. A. Gomez.
Angiotensin II type 1 receptor: role in renal growth and gene expression during normal development.
Am. J. Physiol.
266 (Renal Fluid Electrolyte Physiol. 35):
F911-F918,
1994
40.
Van het Schip, F. D.,
J. Samallo,
J. Broos,
J. Ophius,
M. Mojet,
M. Gruber,
and
G. Ab.
Nucleotide sequence of a chicken vitellogenin gene derived amino acid sequence of encoded yolk precursor protein.
J. Mol. Biol.
196:
245-260,
1987[Medline].
41.
Zahler, A. M.,
W. S. Lane,
J. A. Stolk,
and
M. B. Roth.
SR proteins: a conserved family of pre-mRNA splicing factors.
Genes Dev.
6:
837-847,
1992
This article has been cited by other articles:
![]() |
R. A. Gomez, E. S. Pentz, X. Jin, M. Cordaillat, and M. L. S. Sequeira Lopez CBP and p300 are essential for renin cell identity and morphological integrity of the kidney Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1255 - H1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Pentz, M. L. S. Sequeira Lopez, M. Cordaillat, and R. A. Gomez Identity of the renin cell is mediated by cAMP and chromatin remodeling: an in vitro model for studying cell recruitment and plasticity Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H699 - H707. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Pentz, M. A. Moyano, B. A. Thornhill, M. L. S. Sequeira Lopez, and R. A. Gomez Ablation of renin-expressing juxtaglomerular cells results in a distinct kidney phenotype Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2004; 286(3): R474 - R483. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. S. Sequeira Lopez, E. S. Pentz, B. Robert, D. R. Abrahamson, and R. A. Gomez Embryonic origin and lineage of juxtaglomerular cells Am J Physiol Renal Physiol, August 1, 2001; 281(2): F345 - F356. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Hilgers, R. Veelken, D. N. Muller, H. Kohler, A. Hartner, S. R. Botkin, C. Stumpf, R. E. Schmieder, and R. A. Gomez Renin Uptake by the Endothelium Mediates Vascular Angiotensin Formation Hypertension, August 1, 2001; 38(2): 243 - 248. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Adams, L. van der Weyden, A. Mayeda, S. Stamm, B. J. Morris, and J. E.J. Rasko ZNF265--a novel spliceosomal protein able to induce alternative splicing J. Cell Biol., July 9, 2001; 154(1): 25 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. PENTZ, M. L. S. S. LOPEZ, H.-S. KIM, O. CARRETERO, O. SMITHIES, and R. A. GOMEZ Ren1d and Ren2 cooperate to preserve homeostasis: evidence from mice expressing GFP in place of Ren1d Physiol Genomics, June 6, 2001; 6(1): 45 - 55. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |