|
|
||||||||
1 Division of Nephrology, Vanderbilt University Medical Center, Nashville, Tennessee 37232; 2 Department of Physiology, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5; and 3 Department of Cell Biology and Molecular Biology, Upjohn Laboratories, Kalamazoo, Michigan 49007
| |
ABSTRACT |
|---|
|
|
|---|
The ATP-sensitive, inwardly rectifying K+ channel, ROMK, has been suggested to be the low-conductance ATP-sensitive K+ channel identified in apical membranes of mammalian renal thick ascending limb (TAL) and cortical collecting duct (CCD). Mutations in the human ROMK gene (KIR1.2) have been identified in kindreds with neonatal Bartter's syndrome. In the present study, we generated polyclonal antibodies raised against both a COOH-terminal (amino acids 252-391) ROMK-maltose binding protein (MBP) fusion protein and an NH2-terminal (amino acids 34-49) ROMK peptide. Affinity-purified anti-ROMK COOH-terminal antibody detected the 45-kDa ROMK protein in kidney tissues and HEK-293 cells transfected with ROMK1 cDNA. The antibody also recognized 85- to 90-kDa proteins in kidney tissue; these higher molecular weight proteins were abolished by immunoabsorption with ROMK-MBP fusion protein and were also detected on Western blots using anti-ROMK NH2-terminal antibody. Immunofluorescence studies using anti-ROMK COOH-terminal antibody showed intense apical staining along the loop of Henle and distal nephron; staining with preimmune and immunoabsorbed serum was negative. When colocalized with distal nephron markers [the thiazide-sensitive cotransporter (rTSC1), the bumetanide-sensitive cotransporter (rBSC1), the vacuolar type H+-ATPase, and neuronal nitric oxide synthase (NOS I)], the ROMK protein was found primarily at the apical border of cells in the TAL, macula densa, distal convoluted tubule, and connecting tubule. Within the CCD, the ROMK protein was expressed in principal cells and was absent from intercalated cells. The tubule localization and polarity of ROMK staining are consistent with the distribution of ROMK mRNA and provide more support for ROMK being the low-conductance K+ secretory channel in the rat distal nephron.
thick ascending limb; potassium channel; immunofluorescence; Bartter's syndrome
| |
INTRODUCTION |
|---|
|
|
|---|
ATP-SENSITIVE K+ channels (KATP) have been identified in several renal epithelial cells, where they play a critical role in K+ secretion (17). These secretory KATP channels are characterized by weak inward rectification, exquisite pH sensitivity, and inhibition by increases in cytosolic ATP. A low-conductance (25-35 pS) KATP channel has been identified in apical membranes within the distal nephron (7). In the cortical collecting duct (CCD), low-conductance KATP channels are believed to mediate K+ secretion across apical membranes (7, 17), whereas in the apical membranes of thick ascending limb (TAL) cells low-conductance KATP channels work in concert with moderate-conductance 70-pS KATP channels (3, 28) to recycle K+ for efficient function of the Na-K-2Cl cotransporter (8). Apical K+ channels in the TAL also contribute to the generation of a lumen-positive membrane potential, driving reabsorption of several cations via the paracellular pathway (8, 23).
A cDNA encoding an inwardly rectifying, ATP-regulated K+ channel, ROMK1 (KIR1.1), was initially isolated by expression cloning from the outer medulla of rat kidney (9). ROMK1, along with other subsequently identified K+ channels, defines a new family of inwardly rectifying K+ channels (KIR family; for review, see Ref. 24). The membrane topology of KIR channels differs from the voltage- and cyclic nucleotide-gated K+ channels in having only two potential membrane-spanning segments, retaining an H5-like "pore-forming" region (9, 19).
Alternative splicing of 5' exons has recently been shown to alter the NH2 terminus of ROMK channel proteins. These alternatively spliced isoforms, denoted ROMK1-3, are differentially expressed along the distal nephron, from the medullary TAL (MTAL) to the outer medullary collecting duct (OMCD) (4). This localization of ROMK mRNA, together with the observed electrophysiological and regulatory properties of ROMK channels (16, 31), suggests that ROMK forms the low-conductance secretory KATP channels identified in apical membranes of distal nephron segments. More recently, two studies have suggested that some forms of Bartter's syndrome, characterized by salt wasting and hypokalemic alkalosis, are associated with mutations in the human ROMK gene (11, 22). The phenotype of patients with homozygous mutations in ROMK provides strong genetic evidence that this channel is critical for function of the TAL. We assessed these issues further in the present study by determining the tubular distribution and polarity of expression of the ROMK protein using a purified ROMK-specific antibody.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation of ROMK Polyclonal Antibodies
ROMK COOH-terminal domain polyclonal antibody. A ROMK-maltose binding protein (MBP) fusion protein construct was generated by subcloning a 722-bp fragment encoding the COOH-terminal 140 amino acids of the ROMK protein (252-391) into the Sal I-BamH I sites of the pMal2c vector. Fusion protein was produced as described previously (12), followed by further purification by anion exchange chromatography. The anti-ROMK polyclonal antibody to intact fusion protein was produced at Hazelton Research Products. Primary immunizations (intradermal, 0.25 mg of the fusion protein) of rabbit (New Zealand White) were performed in complete Freund adjuvant, with subsequent immunizations (sc) with 0.125 mg of the fusion protein in incomplete Freund adjuvant were performed every 4 wk for 12 wk. Hyperimmune serum was collected 2 wk after each injection; serum from the final production bleed was used for the present studies.ROMK NH2-terminal domain polyclonal antibody. A synthetic 16-mer peptide from the NH2-terminal region of the ROMK protein (GRSRQRARLVSKEGRC, amino acids 34-49 on ROMK1) was produced by Research Genetics. Polyclonal antibody to the NH2-terminal ROMK peptide was produced in rabbits at Hazelton Research Products as described above. Although ROMK isoforms differ in their initial NH2-terminal region, the peptide was to a region common to all ROMK splice variants.
Affinity purification of anti-ROMK antibodies and immunoabsorption. Purification of anti-ROMK antibodies was performed according to a protocol provided by Research Genetics. Briefly, 10 ml of carboxy-activated support (Bio-Rad Laboratories) was washed and activated with 50 ml of dry dimethyl sulfoxide (DMSO) using vacuum filtration on a glass-fritted funnel. Five milligrams of the ROMK-MBP fusion protein or the synthetic peptide were dissolved in 20 ml of dry DMSO and added to the washed, activated support. A volume of 100 µl of dry triethylamine was added to the suspension and incubated overnight at room temperature on a rocking shaker. Ethanolamine, 500 µl, was then added to the suspension and incubated 1 h at room temperature to block remaining activated carboxylates. The unreacted fusion protein (or synthetic peptide) and excess DMSO were removed by vacuum filtration, and the support was washed three times with 50 ml of DMSO. The support was then washed several times with 1 N acetic acid and distilled water. The resulting support was poured into a column and equilibrated with 5× concentrated phosphate-buffered saline (PBS). Three milliliters of antiserum were diluted 1:1 with 10× PBS and passed over the affinity column three times. The column was then washed with 30 ml of 5× PBS. Purified antiserum was eluted from the column with 3 ml of 100 mM sodium citrate, pH 2.5, and was neutralized immediately with 1.5 ml of 1 M tris(hydroxymethyl)aminomethane hydrochloride, pH 8.5. Finally, purified antibody was dialyzed against 1× PBS at 4°C for 24 h and concentrated to a final volume of 500-700 µl. To generate immunoabsorbed serum, purified anti-ROMK antibody was incubated overnight with ROMK-MBP-support at 4°C. We titrated each preparation affinity-purified antibody to the range of 2-6 µg/ml before performing immunofluorescence or Western blotting experiments.Immunofluorescence and Western Blotting
Male Sprague-Dawley rats weighing 175-200 g (Charles River) were anesthetized with pentobarbital, and kidneys were perfusion fixed via the lower aorta, with 4% paraformaldehyde followed by 750 mosmol/kg of PBS-sucrose solution. Kidneys were sagittally sliced and infused with 30% sucrose in PBS overnight at 4°C. The tissue was embedded in optimal cutting temperature compound (OCT; Miles, Elkhart, IN) and frozen in isopentane cooled on dry ice. Frozen sections of 2 µm were cut with a Leica CM3000 cryostat and thaw mounted on Superfrost-Plus Slides (Fisher Scientific, Pittsburgh, PA). For immunofluorescence, sections were permeabilized using 0.2% Triton X-100 for 5 min and blocked with 4% Seablock (Searun Holdings, Arundel, ME) in 1% bovine serum albumin (BSA)/PBS for 1 h. Primary antibodies were applied to sections overnight at 4°C at the following dilutions in 1% BSA/PBS: purified anti-ROMK antibody, 1:80; anti-H+-adenosinetriphosphatase (anti-H+-ATPase) monoclonal clone E11 supernatant (kindly provided by Dr. S. Gluck), 1:4; antibody to nitric oxide synthase I (anti-NOS I; Calbiochem, La Jolla, CA), 1:200; antibody to the thiazide-sensitive cotransporter (anti-rTSC1), 1:600; and antibody to the bumetanide-sensitive cotransporter (anti-rBSC1), 1:600. Secondary antibodies were diluted with 1% BSA/PBS and applied to sections for 1 h at the following dilutions: Texas Red-conjugated anti-rabbit immunoglobulin G (IgG), 1:100 (Jackson Immunochemicals, West Grove, PA); Rhodamine Red-X-conjugated Fab fragment anti-rabbit IgG, 1:200 (Jackson Immunochemicals); fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG, 1:50 (Vector Laboratories, Burlingame, CA), for anti-NOS I, anti-rTSC, and anti-rBSC; FITC-conjugated anti-mouse IgG, 1:50 (Vector) for H+-ATPase. Sections were washed in high-salt PBS and PBS as described previously (18). Dual-stained sections were incubated with AffiniPure Fab fragment goat anti-rabbit, 1:200 (Jackson Immunochemicals), for 1 h at room temperature before continuing with the second primary antibody. Slides were examined and photographed with a Nikon Eclipse 800 research microscope using Kodak Elite 400 and T-max 400 films. Western blotting was performed as described previously (31), using purified anti-ROMK antibody at a dilution of 1:40.In Vitro Translation and Transient Transfection of ROMK cDNA
ROMK cDNA constructs (ROMK1/pSPORT or ROMK2/pSPORT) were translated in vitro using the TNT-coupled Reticulocyte Lysate System (Promega). Reactions were incubated at 30°C for 120 min after the addition of either [35S]methionine or nonradioactive methionine. HEK-293 cells were transiently transfected with ROMK1/pSVL constructs using LipofectAMINE, as described previously (34). Mock transfections (untransfected cells) underwent each of the transfection steps, using vectors without insert. Reverse transcription-polymerase chain reaction (RT-PCR) was performed with an ROMK1-specific sense primer (bp 38-57, 5' CAATGCAAGTAAATGTCATT 3') paired with an antisense primer (bp 592-611, 5' GGCGCACTGTTCTGTCACAA 3') within the exon common to all of the splice variants (4). Crude membranes (plasma and cytosolic membranes) from transfected cells and kidney sections (inner medulla, outer medulla, and cortex) were isolated according to previous study (31).| |
RESULTS |
|---|
|
|
|---|
Specificity of Antibody
The specificity of the ROMK antibody was initially established by Western blotting of in vitro translated proteins (Fig. 1, A and B). As shown in Fig. 1B, the anti-ROMK COOH-terminal antibody detected 43- and 42-kDa proteins, the expected apparent molecular mass of ROMK 1 and 2, in the absence of canine pancreatic microsomes. The 45- and 43-kDa bands observed in the presence of membranes represent glycosylated ROMK proteins (9). The molecular weights of these major bands agree with that of [35S]methionine-labeled ROMK proteins (Fig. 1A) and previous publications (4, 9, 19, 31). Multiple bands other than those attributed to ROMK1 (R1) and ROMK2 (R2) are detected by the purified anti-ROMK COOH-terminal antibody in the in vitro translation products (Fig. 1, A and B); these likely reflect nonspecific interaction with the reticulocyte-lysate, since these proteins are detected in both ROMK and H2O control samples.
|
A Western blot of protein extract from kidney outer medulla using the anti-ROMK COOH-terminal antibody is shown in Fig. 1C. A band of ~45 kDa and several bands between 85 and 90 kDa are detected. Preabsorption of immune serum with the ROMK-MBP fusion protein, but not with MBP alone, resulted in loss of the major 45-kDa band, as well as the 85- to 90-kDa bands, in this Western blot. The 45-kDa band is consistent with ROMK monomer, whereas the higher 85- to 90-kDa bands may represent ROMK complexed with itself or other proteins that are not dissociated under the present conditions used for Western blotting.
Western blots of protein extracts from distinct regions of the kidney using the anti-ROMK COOH-terminal antibody are shown in Fig. 1D. The strong 45-kDa band, as well as the 85- to 90-kDa bands, are detected in the blots of outer medulla and cortex. Very faint bands of 45 kDa and ~85 kDa are detected in inner medulla. The latter is consistent with the presence of ROMK mRNA in the initial portion of the inner medullary collecting duct (IMCD) (14). To verify that the bands seen between 85 and 90 kDa are specific for ROMK, we performed Western blotting of kidney outer medulla membrane proteins using the anti-ROMK NH2-terminal antibody (Fig. 1E). This anti-ROMK NH2-terminal antibody also detected the 45-kDa ROMK protein and the bands between 85 and 90 kDa, indicating that the 85- to 90-kDa bands also contain specific ROMK epitopes.
Finally, the anti-ROMK COOH-terminal antibody detected a strong 45-kDa band in HEK-293 cells transfected with ROMK1 cDNA (Fig. 1F), from which RT-PCR also amplified the expected DNA fragment of 574 bp using ROMK-specific PCR primers. Interestingly, the 85- to 90-kDa bands were not observed in the ROMK1-transfected HEK-293 cells. When taken together, the results presented in Fig. 1 establish that the purified anti-ROMK COOH-terminal antibody specifically recognizes the ROMK protein in kidney.
Immunofluorescence in Kidney
Immunofluorescence of rat kidney with the anti-ROMK COOH-terminal antibody demonstrated intense labeling of tubules in medullary rays as well as in groups of tubules scattered throughout the cortex (Fig. 2A). No immunofluorescence was detected in cortical sections stained with the immune serum immunoabsorbed with the ROMK-MBP fusion protein (Fig. 2B). In outer medulla, intense immunofluorescence was detected in most larger tubule profiles (Fig. 2C), consistent with localization in the MTAL and OMCD. Figure 2D shows that ROMK staining ends just past the outer-inner medullary boundary where the initial portion of the IMCD (IMCD1) is stained. Thus the overall distribution of ROMK protein in the kidney is similar to that previously detected for ROMK transcripts (4, 14).
|
To define the specific cell localization and polarity of the ROMK protein along the nephron, we performed double antibody staining using the ROMK COOH-terminal antibody together with each of a series of kidney cell type-specific antibodies. Initial experiments were performed with antibody to rBSC1, the bumetanide-sensitive Na-K-2Cl cotransporter, which we have previously shown to label cotransporter on apical surfaces of the macula densa, cortical TAL (CTAL), and MTAL (12). Figure 3, A and B, shows representative images of the same rat CTAL stained with antibodies against rBSC1 (FITC; Fig. 3A) and ROMK (rhodamine; Fig. 3B). Most CTAL cells showing apical rBSC1 staining are also positive for ROMK along the apical cell borders. However, note that although the BSC1 antibody labels essentially all CTAL cells (Fig. 3A), ROMK staining is more heterogeneous (Fig. 3B). The latter is vividly shown in the CTAL tubule cross sections shown in the Fig. 3C where ROMK-positive cells adjoin some ROMK-negative cells.
|
A low-conductance inwardly rectifying K+ channel has also been identified in principal cells of the CCD, where it is thought to mediate K+ secretion. To examine whether ROMK was present in apical surface of principal cells, we utilized a monoclonal antibody against the vacuolar type H+-ATPase found in intercalated cells, both to identify CCD tubule profiles and to distinguish principal from intercalated cells in these tubule segments (5). Figure 3D shows a high-power fluorescence image of a cortical medullary ray depicting the distributions of H+-ATPase (FITC) and ROMK (Texas Red) in a collecting duct and TAL. In the CCD, ROMK antibody predominantly stains the apical border of principal (Fig. 3D) cells, whereas no clear fluorescence could be found in the H+-ATPase-positive intercalated cells (Fig. 3D). A light staining was also detected along the basolateral border of some principal cells. We also performed a number of control experiments using Rhodamine Red-X-conjugated Fab fragment anti-rabbit IgG (secondary antibody) alone to stain those cells/segments having the heaviest ROMK antibody labeling. Results showed that no immunofluorescence above background level was detected in the MTAL and collecting ducts (data not shown).
We next assessed whether the ROMK protein is also expressed in the macula densa, since both the Na-K-2Cl cotransporter (12) and inwardly rectifying K+ channels have been identified in this cell type (10). Macula densa cells were distinguished from surrounding TAL cells by staining with a polyclonal antibody specific for neuronal NOS I (neuronal NOS isoform, Calbiochem), which does not exhibit any cross-reactivity with NOS II or NOS III (inducible and endothelial NOS isoforms, respectively). NOS I is expressed only in macula densa, but not the surrounding TAL, in several species (2, 25, 30). Representative double-labeling images using anti-ROMK and anti-NOS I antibodies are shown in Fig. 3, E and F, each showing a glomerulus with adjacent CTAL and macula densa in either cross section (Fig. 3E) or axial section (Fig. 3F). Macula densa cells are clearly identified by intense fluorescence with NOS I (FITC), whereas the surrounding CTAL cells exhibit heterogeneous staining for ROMK with no staining for NOS I (Fig. 3F). The NOS I-positive macula densa cells also exhibit ROMK fluorescence at the apical border (rhodamine; Fig. 3, E and F).
Since we had previously found ROMK transcripts expressed in the distal convoluted tubule (DCT) (4), we next examined the specific distribution of the ROMK protein in DCT and connecting tubule (CNT) segments. To define the specific distribution of the ROMK protein in the distal tubule, we used antibodies specific for rTSC1 and the vacuolar H+-ATPase. The thiazide-sensitive Na-Cl cotransporter (rTSC1) is expressed along the distal nephron starting in the initial DCT, terminating within the early CNT (18). Vacuolar H+-ATPase is found in intercalated cells that increase in number from DCT to late CNT, where they represent about one-third of cells (5, 6). We had previously used these antibodies to distinguish DCT, the DCT-CNT transition zone, and CNT in the rat (18). Figure 4, A and B, shows fluorescence images of the same section showing DCT profiles stained with anti-TSC antibody (Fig. 4A; FITC staining) and anti-ROMK antibody (Fig. 4B; rhodamine staining). DCT profiles showing intense linear apical staining for TSC (Fig. 4A) also exhibit a speckled apical staining pattern for ROMK (Fig. 4B). DCT-CNT transition zone tubule profiles also show apical fluorescence for ROMK. Mid-to-late CNT profiles showing no TSC fluorescence, however, do exhibit ROMK staining at the apical border. Figure 4C is a fluorescence image of rat renal distal tubule profiles double-stained with anti-H+-ATPase and anti-ROMK antibodies. In these distal tubule profiles ROMK staining is restricted to DCT and CNT cells, and intercalated cells are negative for ROMK. Thus ROMK protein is present at the apical cell border of DCT and CNT cells.
|
We also assessed localization of ROMK in kidney outer medullary nephron segments. Figure 4, D and E, shows fluorescence images from the same section of outer medulla stained with both anti-BSC1 antibody (Fig. 4D; FITC) and anti-ROMK antibody (Fig. 4E; Texas Red). First, tubule cross sections positive for BSC1 (MTAL segments) are also positive for ROMK along the apical border. In addition, as in the CTAL, BSC antibody uniformly stained MTAL cells, whereas ROMK antibody stained most but not all of these BSC-positive cells, i.e., ROMK staining was heterogeneous in MTAL. Also note that light ROMK fluorescence is seen in some larger tubule profiles that are BSC negative (Fig. 4E), apparently representing OMCD segments. ROMK staining in OMCD was confirmed by double staining rat outer medullary sections with both anti-H+-ATPase (FITC stained) and anti-ROMK (Texas Red stained) antibodies as shown in Fig. 4F. OMCD profiles with H+-ATPase-positive FITC staining of intercalated cells show ROMK staining in principal cells along the apical cell borders (Fig. 4F). Moreover, light basolateral staining was observed in some OMCD cells (Fig. 4F).
| |
DISCUSSION |
|---|
|
|
|---|
By means of electrophysiological techniques, researchers have identified a variety of KATP channels in the apical membranes of rat TAL and CCD, where they appear to provide the major pathway for K+ secretion into the tubule (7, 17, 29). Two lines of evidence suggest that the cloned ROMK channels form (or provide a pore-forming component of) KATP channels in the apical membrane of these nephron segments. First, ROMK channels expressed in X. laevis oocytes exhibit electrophysiological and regulatory characteristics remarkably similar to those of renal secretory KATP channels (Mg2+-dependent inward rectification, high K+:Na+ selectivity, high open probability, involvement of phosphorylation-dephosphorylation processes in channel regulation, ATP and pH sensitivity, inhibition by arachidonic acid; see Refs. 9 and 16). In addition, using a variety of methods, we have localized ROMK mRNA to MTAL, CTAL, DCT, CNT, CCD, and OMCD of rat kidney (4, 14). We now report the generation of a specific antibody against an ROMK COOH-terminal fusion protein, as well as the tubular distribution and membrane localization of the ROMK channel protein in rat kidney. It is worth noting that the anti-ROMK antibody used in the fluorescence studies was raised against the COOH-terminal common region of the ROMK protein, so that it cannot differentiate among specific alternatively spliced forms of ROMK. Our results with this ROMK-specific antibody show the localization of the ROMK protein predominantly to apical surfaces of TAL, macula densa, DCT, CNT, CCD, and OMCD cells in rat kidney, and thus are consistent with important roles for ROMK channels in K+ secretory/recycling processes.
The 41- to 45-kDa bands observed on Western blots using the purified anti-ROMK COOH-terminal antibody clearly represent core and glycosylated channel proteins encoded by the ROMK1 and ROMK2 cDNAs (9, 19). Less clear is the significance of the 85- to 90-kDa proteins of similar abundance identified in outer medulla and cortex. It seems unlikely that these bands represent nonspecific proteins, since they were abolished by immunoabsorption with ROMK-MBP fusion protein (Fig. 1C), and more importantly, the two bands were also identified on Western blots using anti-ROMK NH2-terminal antibody (Fig. 1E). It has been suggested that ROMK channels are tetrameric, with four pore-forming fragments coming together to form a K+-selective pore (15, 24). Thus the 85- to 90-kDa protein bands, approximately double the size of the ROMK monomer, could represent homodimeric and/or heterodimeric complexes formed by ROMK isoforms. The absence of the 85- to 90-kDa bands in HEK-293 cells transfected with ROMK1 suggests that an ROMK1 homodimer is not formed in these cells, making more likely the possibility that the ROMK heterodimers are responsible for the 85- to 90-kDa bands. We also cannot exclude the possibility that the 85- to 90-kDa bands represent heterodimeric complexes formed by ROMK monomer and other proteins that remained associated under the present conditions used for Western blotting. Unfortunately, we have been unable to use the ROMK antibodies for immunoprecipitation, so that further identification of the larger molecular mass ROMK protein/protein complexes is not possible at this time. Western blotting (Fig. 1E) identified a faint band of similar molecular mass to ROMK in untransfected HEK-293 cells. A recent study reported isolation of a human homolog of ROMK1 (KIR1.1) and four alternatively spliced isoforms from humans (20). In addition, two human kidney inward-rectifier K+ channel homologs (KIR1.2 and KIR1.3) have been identified with predicted amino acid sequences remarkably similar to KIR1.1 (21). Therefore, this faint band is likely the result of endogenous expression of one or more human KIR1.x isoforms in HEK-293 cells. Given the significant quantitative difference in expression level between transfected and untransfected cells, the identity of this channel was not pursued in the present study.
The predominant localization of ROMK protein at the apical surface of distal nephron segments is consistent with the distribution of secretory KATP channels observed in many of these nephron segments (7, 13, 17). Given the strong and somewhat thick apical surface staining of TAL cells for ROMK (Fig. 3, B and C) compared with that for rBSC1 (Fig. 3A), we cannot exclude the possibility that some of the ROMK staining may represent a subapical pool of channel. Moreover, the heterogeneous staining observed in CTAL (Fig. 3, C-F) and MTAL (Fig. 4, E and F) cells is not likely the result of artifact, because BSC1 staining in these same sections is uniform [Figs. 3A (CTAL) and 4D (MTAL)], as we have shown previously (12). This implies that apical K+ recycling via ROMK channels is not present in all TAL cells, i.e., there is a minority TAL cell population without ROMK channels. This could represent different functional states of a single TAL population or two distinct TAL cell types. In this regard, one group has recently identified differences in apical membrane K+ conductance among TAL cells (26). Thus it is possible that TAL cells lacking ROMK expression have little-to-no apical K+ conductance. In addition, two TAL morphological types have been identified, with the majority as smooth surface, S cells, and the minority as rough surface, R cells (1).
ROMK localization to apical membranes of TAL cells (Figs. 3, A-D, and 4, D and E) supports the pathophysiological implications of ROMK mutations in some families with Bartter's syndrome (11, 22), where the major functional defect is in the TAL. The localization and genetic studies clearly demonstrate that ROMK channels must play the dominant role in apical recycling of K+ in TAL, permitting sustained Na-K-2Cl (BSC1) cotransport activity. The most straightforward conclusion based on the known biophysical properties of ROMK is that it forms the low-conductance K+ channels found in rat TAL. However, the intermediate conductance (70 pS) K+ channel in rat TAL has been suggested to predominate, contributing ~80% of the apical K+ conductance (28). If the human TAL also expresses a dominant 70-pS inwardly rectifying K+ channel, then ROMK mutations would not be expected to result in a major reduction in TAL salt transport (8), unless ROMK also forms a critical part of the 70-pS K+ channel. This speculation must await studies of human TAL or a mouse ROMK gene knockout.
The present study also clearly shows apical expression of ROMK in macula densa cells (Fig. 3, E and F), indicating that ROMK may participate in formation of the apical K+ channel in these cells. Recently, a low-conductance (41 pS), apical K+ channel (MDK) was identified in macula densa cells (10). The basic characteristics of MDK, insensitivity to Na-ATP and sensitivity to Ca2+, suggested to these workers that MDK and ROMK are separate inward-rectifying K+ channels. However, ROMK is sensitive to Mg-ATP and relatively insensitive to Na-ATP (16), so that the apparent lack of Na-ATP sensitivity of MDK channels cannot be taken as lack of support for a role for ROMK in forming these channels. Localization of ROMK in macula densa supports the same general mechanism for ion transport in macula densa as that proposed for TAL cells (13). If apical K+ channels serve a key modulatory role in the transmission of tubuloglomerular feedback signals, then ROMK channels could participate in this process.
Double-staining experiments (Fig. 4,
A-C)
with anti-rTSC1 antibody demonstrated the localization of ROMK in the
DCT and CNT (Fig. 4,
A-C).
Although the rate of K+ secretion
by the early DCT is much lower than that in late DCT and
CCD, this segment shows the greatest sensitivity to
changes in luminal Na+,
Cl
, and thiazide diuretics.
It is reported that increased K+
secretion in the early DCT is stimulated by raising
Na+ concentration in the presence
of low luminal Cl
, an
effect which is blocked by thiazide diuretics (27). Thus expression of
ROMK in the DCT and DCT-CNT transition zone may be important in
regulating urinary secretion of
K+, although the precise role of
KATP channels in the DCT has not been directly examined. ROMK is expressed in TSC-negative CNT cells
(Fig. 4B), and ROMK channels could
also contribute to K+ secretion in
this nephron segment.
The finding of hypokalemia and significant K+ excretion in Bartter's patients with the ROMK mutations (11, 22) has brought into question the role of ROMK in K+ secretion by principal cells. However, identification of the ROMK protein at the apical surface of principal cells in the present study (Figs. 3D and 4F) provides further evidence that ROMK is the small-conductance KATP channel found at the apical membrane of rat CCD principal cells. This suggests that an alternative pathway must exist in these Bartter's patients for K+ secretion. Finally, the light basolateral staining in the principal cells of CCD (Figs. 3D and 4F) is of less clear significance. It may be related to protein trafficking or to a role for ROMK in some of the K+ channels expressed in the basolateral membranes of these cells.
| |
ACKNOWLEDGEMENTS |
|---|
We thank David Mount for valuable discussions.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Research Grant DK-37605 (to S. C. Hebert) and by a postdoctoral fellowship from Medical Research Council of Canada (to J. Z. Xu).
Address for reprint requests: S. C. Hebert, Division of Nephrology, Vanderbilt Univ. Medical Center, 21st Ave. South and Garland, S-3223 Medical Center North, Nashville, TN 37232-2372.
Received 18 February 1997; accepted in final form 9 July 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Allen, F.,
and
C. C. Tisher.
Morphology of the ascending thick limb of Henle.
Kidney Int.
9:
8-22,
1976[Medline].
2.
Bachmann, S.,
H. M. Bosse,
and
P. Mundel.
Topography of nitric oxide synthesis by localizing constitutive NO synthases in mammalian kidney.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F885-F898,
1995
3.
Bleich, M.,
E. Schlatter,
and
R. Greger.
The luminal K channel of the thick ascending limb of Henle's loop.
Pflügers Arch.
415:
449-560,
1990[Medline].
4.
Boim, M. A.,
K. Ho,
M. E. Shuck,
M. J. Bienkowski,
J. H. Block,
J. L. Slightom,
Y. Yang,
B. M. Brenner,
and
S. C. Hebert.
ROMK inwardly rectifying ATP-sensitive K+ channel. II. Cloning and distribution of alternative forms.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F1132-F1140,
1995
5.
Brown, D.,
S. Hirsch,
and
S. Gluck.
Localization of a proton-pumping ATPase in rat kidney.
J. Clin. Invest.
82:
2114-2126,
1988.
6.
Dorup, J.
Ultrastructure of distal nephron cells in rat renal cortex.
J. Ultrastruct. Res.
92:
101-118,
1985[Medline].
7.
Frindt, G.,
and
L. G. Palmer.
Low-conductance K channels in apical membrane of rat cortical collecting tubule.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F143-F151,
1989
8.
Hebert, S. C.,
and
T. E. Andreoli.
Control of NaCl transport in the thick ascending limb.
Am. J. Physiol.
246 (Renal Fluid Electrolyte Physiol. 15):
F745-F756,
1984
9.
Ho, K.,
C. G. Nichols,
W. J. Lederer,
J. Lytton,
P. M. Vassilev,
M. V. Kanazirska,
and
S. C. Hebert.
Cloning and expression of an inwardly rectifying ATP-regulated potassium channel.
Nature
362:
31-38,
1993[Medline].
10.
Hurst, A. M.,
J. Y. Lapointe,
A. Laamarti,
and
P. D. Bell.
Basic properties and potential regulators of the apical K+ channel in macula densa cells.
J. Gen. Physiol.
103:
1055-1070,
1994
11.
International Collaboration Study Group for Bartter-like Syndromes.
Mutations in the gene encoding the inwardly-rectifying renal potassium channel, ROMK, cause the antenatal variant of Bartter syndrome: evidence for genetic heterogeneity.
Hum. Mol. Genet.
6:
17-26,
1997
12.
Kaplan, M. R.,
M. D. Plotkin,
W. Lee,
Z.-C. Xu,
J. Lytton,
and
S. C. Hebert.
Apical localization of the Na-K-Cl cotransporter, rBSC1, on rat thick ascending limbs.
Kidney Int.
49:
40-47,
1996[Medline].
13.
Lapointe, J. Y.,
P. D. Bell,
and
J. Cardinal.
Basolateral ionic permeabilities of macula densa cells.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F1466-F1469,
1990
14.
Lee, W. S.,
and
S. C. Hebert.
ROMK inwardly rectifying ATP-sensitive K+ channel. I. Expression in rat distal nephron segments.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F1124-F1131,
1995
15.
Mackinnon, R.
Pore loops: an emerging theme in ion channel structure.
Neuron
14:
889-892,
1995[Medline].
16.
McNicholas, C. M.,
W. Wang,
K. Ho,
and
S. C. Hebert.
Regulation of ROMK1 K+ channel activity involves phosphorylation processes.
Proc. Natl. Acad. Sci. USA
91:
8077-8081,
1994
17.
Misler, S.,
and
G. Giebisch.
ATP-sensitive potassium channels in physiology, pathophysiology, and pharmacology.
Curr. Opin. Nephrol. Hypertens.
1:
21-33,
1992[Medline].
18.
Plotkin, M. D.,
M. R. Kaplan,
J. W. Verlander,
W. Lee,
D. Brown,
E. Poch,
S. R. Gullans,
and
S. C. Hebert.
Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1, in the rat kidney.
Kidney Int.
50:
174-183,
1996[Medline].
19.
Schwalbe, R. A.,
Z. Wang,
B. A. Wible,
and
A. M. Brown.
Potassium channel structure and function as reported by a single glycosylation sequon.
J. Biol. Chem.
270:
15336-15340,
1995
20.
Shuck, M. E.,
J. H. Bock,
C. W. Benjamin,
T.-D. Tsai,
K. S. Lee,
J. L. Slightom,
and
M. J. Bienkowski.
Cloning and characterization of multiple forms of the human kidney ROM-K potassium channel.
J. Biol. Chem.
269:
24261-24270,
1994
21.
Shuck, M. E.,
T. M. Piser,
J. H. Bock,
J. L. Slightom,
K. S. Lee,
and
M. J. Bienkowski.
Cloning and characterization of two K+ inward rectifier (KIR) 1.1 potassium channel homologs from human kidney (KIR1.2 and KIR1.3).
J. Biol. Chem.
272:
586-593,
1997
22.
Simon, D. B.,
F. E. Karet,
J. Rodriguez-Soriano,
J. H. Hamdan,
A. DiPietro,
H. Trachtman,
S. A. Sanjad,
and
R. P. Lifton.
Genetic heterogeneity of Bartter's syndrome revealed by mutations in the K+ channel, ROMK.
Nat. Genet.
14:
152-156,
1996[Medline].
23.
Sun, A.,
E. B. Grossman,
M. Lombardi,
and
S. C. Hebert.
Vasopressin alters the mechanism of apical Cl
entry from Na+: Cl
to Na+: K+: 2Cl
cotransport in mouse medullary thick ascending limb.
J. Membr. Biol.
120:
83-94,
1991[Medline].
24.
Tinker, A.,
Y. N. Jan,
and
L. Y. Jan.
Regions responsible for the assembly of inwardly rectifying potassium channels.
Cell
87:
857-868,
1996[Medline].
25.
Tojo, A.,
S. S. Gross,
L. Zhang,
C. C. Tischer,
H. H. W. Schmidt,
C. S. Wilcox,
and
K. M. Madsen.
Immunocytochemical localization of distinct isoforms of nitric oxide synthase in the juxtaglomerular apparatus of normal rat kidney.
J. Am. Soc. Nephrol.
4:
1438-1447,
1994[Abstract].
26.
Tsuruoka, S.,
C. Koseki,
S. Muto,
K. Tabei,
and
M. Imai.
Axial heterogeneity of potassium transport across hamster thick ascending limb of Henle's loop.
Am. J. Physiol.
267 (Renal Fluid Electrolyte Physiol. 36):
F121-F129,
1994
27.
Velázquez, H.,
D. H. Ellison,
and
F. S. Wright.
Luminal influences on potassium secretion: chloride, sodium, and thiazide diuretics.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F1076-F1092,
1992
28.
Wang, W.
Two types of K+ channel in thick ascending limb of rat kidney.
Am. J. Physiol.
267 (Renal Fluid Electrolyte Physiol. 36):
F599-F605,
1994
29.
Wang, W.,
S. White,
J. Geibel,
and
G. Giebisch.
A potassium channel in the apical membrane of rabbit thick ascending limb of Henle's loop.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F244-F253,
1990
30.
Wilcox, C. S.,
W. J. Welsh,
F. Murad,
S. S. Gross,
G. Taylor,
R. Levi,
and
H. H. W. Schmidt.
Nitric oxide synthase in macula densa regulates glomerular capillary pressure.
Proc. Natl. Acad. Sci. USA
89:
11993-11997,
1993
31.
Xu, Z. C.,
Y. Yang,
and
S. C. Hebert.
Phosphorylation of the ATP-sensitive, inwardly rectifying K+ channel, ROMK, by cyclic AMP-dependent protein kinase.
J. Biol. Chem.
271:
9313-9319,
1996
This article has been cited by other articles:
![]() |
P. A. Welling and K. Ho A comprehensive guide to the ROMK potassium channel: form and function in health and disease Am J Physiol Renal Physiol, October 1, 2009; 297(4): F849 - F863. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gamba The thiazide-sensitive Na+-Cl- cotransporter: molecular biology, functional properties, and regulation by WNKs Am J Physiol Renal Physiol, October 1, 2009; 297(4): F838 - F848. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Frindt, A. Shah, J. Edvinsson, and L. G. Palmer Dietary K regulates ROMK channels in connecting tubule and cortical collecting duct of rat kidney Am J Physiol Renal Physiol, February 1, 2009; 296(2): F347 - F354. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Spector, Q. Yang, L. Klopouh, J. Deng, E. J. Weinman, D. A. Steplock, R. Biswas, M. F. Brazie, J. Liu, and J. B. Wade The ROMK potassium channel is present in mammalian urinary tract epithelia and muscle Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1658 - F1665. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Fenton and M. A. Knepper Mouse Models and the Urinary Concentrating Mechanism in the New Millennium Physiol Rev, October 1, 2007; 87(4): 1083 - 1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Eng, S. Mukhopadhyay, C. P. Vio, P. L. Pedraza, S. Hao, S. Battula, P. B. Sehgal, J. C. McGiff, and N. R. Ferreri Characterization of a long-term rat mTAL cell line Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1413 - F1422. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Angelow, R. El-Husseini, S. A. Kanzawa, and A. S. L. Yu Renal localization and function of the tight junction protein, claudin-19 Am J Physiol Renal Physiol, July 1, 2007; 293(1): F166 - F177. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pluznick and S. C. Sansom BK channels in the kidney: role in K+ secretion and localization of molecular components Am J Physiol Renal Physiol, September 1, 2006; 291(3): F517 - F529. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mercado, N. Vazquez, L. Song, R. Cortes, A. H. Enck, R. Welch, E. Delpire, G. Gamba, and D. B. Mount NH2-terminal heterogeneity in the KCC3 K+-Cl- cotransporter Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1246 - F1261. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gamba Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters Physiol Rev, April 1, 2005; 85(2): 423 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Gray, G. Frindt, Y.-Y. Zhang, and L. G. Palmer Basolateral K+ conductance in principal cells of rat CCD Am J Physiol Renal Physiol, March 1, 2005; 288(3): F493 - F504. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vallon, P. Wulff, D. Y. Huang, J. Loffing, H. Volkl, D. Kuhl, and F. Lang Role of Sgk1 in salt and potassium homeostasis Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R4 - R10. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Hebert, G. Desir, G. Giebisch, and W. Wang Molecular Diversity and Regulation of Renal Potassium Channels Physiol Rev, January 1, 2005; 85(1): 319 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanemoto, T. Abe, T. Onogawa, and S. Ito PDZ binding motif-dependent localization of K+ channel on the basolateral side in distal tubules Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1148 - F1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Frindt and L. G. Palmer Apical potassium channels in the rat connecting tubule Am J Physiol Renal Physiol, November 1, 2004; 287(5): F1030 - F1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Lin, H. Sterling, B. Yang, S. C. Hebert, G. Giebisch, and W.-H. Wang Protein tyrosine kinase is expressed and regulates ROMK1 location in the cortical collecting duct Am J Physiol Renal Physiol, May 1, 2004; 286(5): F881 - F892. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-Y. Chu, R. Quigley, V. Babich, and C.-L. Huang Dietary potassium restriction stimulates endocytosis of ROMK channel in rat cortical collecting duct Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1179 - F1187. [Abstract] [Full Text] |
||||
![]() |
M. Gallazzini, A. Attmane-Elakeb, D. B. Mount, S. C. Hebert, and M. Bichara Regulation by glucocorticoids and osmolality of expression of ROMK (Kir 1.1), the apical K channel of thick ascending limb Am J Physiol Renal Physiol, May 1, 2003; 284(5): F977 - F986. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sterling, D.-H. Lin, Y. Wei, and W.-H. Wang Tetanus toxin abolishes exocytosis of ROMK1 induced by inhibition of protein tyrosine kinase Am J Physiol Renal Physiol, March 1, 2003; 284(3): F510 - F517. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lu, G. G. MacGregor, W. Wang, and G. Giebisch Extracellular Atp Inhibits the Small-Conductance K Channel on the Apical Membrane of the Cortical Collecting Duct from Mouse Kidney J. Gen. Physiol., August 1, 2000; 116(2): 299 - 310. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |