AJP - Renal AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F757-F767, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barasch, J.
Right arrow Articles by Herzlinger, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barasch, J.
Right arrow Articles by Herzlinger, D.
Vol. 273, Issue 5, F757-F767, November 1997

Ureteric bud cells secrete multiple factors, including bFGF, which rescue renal progenitors from apoptosis

Jonathan Barasch, Jizeng Qiao, Glenn McWilliams, De Chen, Juan A. Oliver, and Doris Herzlinger

Columbia College of Physicians and Surgeons, Department of Medicine, Cornell Medical School, Department of Physiology, New York, New York 10028

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Kidney development requires reciprocal interactions between the ureteric bud and the metanephrogenic mesenchyme. Whereas survival of mesenchyme and development of nephrons from mesenchymal cells depends on signals from the invading ureteric bud, growth of the ureteric bud depends on signals from the mesenchyme. This codependency makes it difficult to identify molecules expressed by the ureteric bud that regulate mesenchymal growth. To determine how the ureteric bud signals the mesenchyme, we previously isolated ureteric bud cell lines (UB cells). These cells secrete soluble factors which rescue the mesenchyme from apoptosis. We now report that four heparin binding factors mediate this growth activity. One of these is basic fibroblast growth factor (bFGF), which is synthesized by the ureteric bud when penetrating the mesenchyme. bFGF rescues three types of progenitors found in the mesenchyme: precursors of tubular epithelia, precursors of capillaries, and cells that regulate growth of the ureteric bud. These data suggest that the ureteric bud regulates the number of epithelia and vascular precursors that generate nephrons by secreting bFGF and other soluble factors.

metanephrogenic mesenchyme; heparin binding factors; basic fibroblast growth factor; fibroblast growth factor-9; apoptosis

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

KIDNEY DEVELOPMENT STARTS when an epithelial tubule called the ureteric bud invades a mass of loosely associated mesenchymal cells called the metanephrogenic mesenchyme. The ureteric bud "induces" mesenchymal cells to proliferate and convert to epithelia. Although it has long been known that rescue from apoptosis (7, 23) and epithelialization (47) of the metanephrogenic mesenchyme requires signaling by the ureteric bud, the signaling molecules remain to be identified. Attempts to identify them by screening growth factors has yielded either inactive molecules [transforming growth factors (TGFs), insulin-like growth factors, platelet-derived growth factors, and retinoic acid; see Ref. 55] or factors that are mitogenic but have not been shown to be expressed by the ureteric bud during its invasion of the mesenchyme [epidermal growth factor, fibroblast growth factor (FGF), Wnt-1, hepatocyte growth factor; Refs. 1, 16, 55, 57].

To identify the molecular mechanisms by which the ureteric bud induces the metanephrogenic mesenchyme, we isolated ureteric bud cell lines (UB cells) from embryonic mice transgenic for SV40 T-antigen (1). We found that these cells act as appropriate surrogates for the ureteric bud, since they induce the mesenchyme to grow and differentiate into epithelia that form tubules. We also found that mesenchymal "induction" can be separated in two steps. In one step, soluble molecules secreted by UB cells rescue the mesenchyme from apoptosis and stimulate it to proliferate without inducing epithelialization. In the other step, UB cells induce mesenchymal-epithelial conversion and tubulogenesis by directly contacting the mesenchyme (1). These data imply that induction of the metanephrogenic mesenchyme by the ureteric bud in vivo is divisible into a step of obligatory rescue from apoptosis and growth, mediated by diffusible growth factors, and a step of mesenchymal-epithelial conversion, signaled by contact-dependent mechanisms.

To identify the diffusible molecules secreted by UB cells that rescue the metanephrogenic mesenchyme from apoptosis and cause it to proliferate, we have begun an analysis of media conditioned by UB cells. As an initial analytical step, we have used heparin-Sepharose chromatography, since many growth factors bind this ligand. We found that UB cells secrete at least four heparin binding factors that rescue the metanephric mesenchyme from apoptosis. We have identified one of these factors as basic FGF (bFGF). We have also found that native ureteric bud, like UB cells, synthesizes bFGF. bFGF rescues nephron and vascular precursors from apoptosis, as well as the metanephrogenic mesenchymal cells that in turn signal the ureter to grow and branch.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

UB Cells

UB cells were generated from mice transgenic for SV40 T-antigen (20). The cells express molecules typical of the ureteric bud in vivo. These include epithelial proteins (that are not expressed by the mesenchyme), as well as Dolichos biflorus binding sites and ret and c-met. The consistent expression of ret during serial passage of the UB cells was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) (upstream 5' CTCCGTGCCGACATTGTT; downstream 5' CTTTCAGACGGAAGGCTGTG; generating a 488-bp product). The authenticity of this product was confirmed by sequencing.

Media Conditioned by UB Cells

UB cells were grown in minimal essential media (MEM; GIBCO, Grand Island, NY) with 10% fetal calf serum (FCS; Hyclone, Logan, UT) supplemented with gamma -interferon (10 U/ml; Genzyme, Cambridge, MA). At 80% confluence, the cells were rinsed with MEM, and the medium was then replaced with MEM without FCS or gamma -interferon. After 24 h, the media was again changed to fresh MEM. Cells were then incubated for 3 days to generate conditioned media. After the medium was collected, UB cells were split 1:5, and this was cycle repeated.

Conditioned media was centrifuged (100 g, 10 min) to remove cellular debris, filtered through 0.22-µm filters, and concentrated on YM-10 membranes (Amicon, Bedford, MA). Concentrates were stored in liquid nitrogen.

Fractionation of Conditioned Media by Heparin Sepharose Chromatography

Conditioned media (30 mg) was equilibrated with 20 mM sodium phosphate (pH 7.0) by Sephadex G-25 columns (Pharmacia, Piscataway, NJ) and fractionated using heparin-Sepharose columns (5 ml, Pharmacia). Elution was done with a step gradient of NaCl in 20 mM sodium phosphate, pH 7.0.

In addition to the heparin binding fractions, we generated a non-heparin binding fraction that was essentially free of heparin binding proteins. Desalted conditioned media was introduced into two heparin-Sepharose columns placed in series, and the flowthrough was collected. We monitored contamination of the flowthrough with heparin binding proteins by assaying for bFGF with immunoblots (see below). We found that two heparin-Sepharose columns in series were required to deplete bFGF to less than 1-2 ng/100 µg protein (the limit of detection of the immunoblots). This concentration of bFGF is insufficient to rescue metanephrogenic mesenchyme from apoptosis.

Assay of Mesenchymal Growth Activity

Each fraction eluted from the heparin-Sepharose column was concentrated by centrifugation in a Microcon-10 (Amicon) and washed once with phosphate-buffered saline (PBS). To assay the activity of the fractions, 100 µg of proteins of each was resuspended in 2 ml MEM with 10% "defined" FCS (Hyclone) and sterilized by 0.2-µm filters. We used this FCS to assay column fractions, because it has no heparin binding proteins and did not support the viability of the mesenchyme.

Metanephric mesenchymes were dissected from embryonic day 13 (E13) rat kidney (vaginal plug = day 0). At this stage, the ureteric bud has entered the mesenchymal mass and initiated its first dichotomous branching. Mesenchymes were isolated from the ureteric bud using trypsin (1 mg/ml) and deoxyribonuclease I (ribonuclease free, 10 U/ml; Boehringer Mannheim, Indianapolis, IN) digestion (20 min, 37°C) in L-15 media (GIBCO), followed by mechanical separation with steel needles. Trypsin was then inactivated with soybean trypsin inhibitor (50 µg/ml; Sigma) for 1 h at room temperature in L-15 media. Ninety-eight percent of the isolated mesenchymes were free of ureteric contamination, as assessed by routine surveillance of the isolated mesenchymes by staining with D. biflorus (Vector Labs, Burlingame, CA), a lectin specific for the ureteric bud.

Four to five mesenchymes were plated on a collagen-coated Transwell (3425 filters; Costar, Acton, MA), and the filter was suspended in the MEM containing 10% defined FCS plus the fractionated proteins. Care was taken to maintain each mesenchyme at an air-fluid interphase. Mesenchymes plated in MEM with defined FCS, without UB proteins served as controls.

Mesenchymal growth activity was analyzed microscopically at 12-h intervals. In addition, mesenchymal proliferation was assayed with a thymidine incorporation assay. [3H]thymidine (10 µCi; 6.7 Ci/mmol; New England Nuclear, Boston, MA) was added 12 h after the initiation of the culture. This is a convenient time point to begin labeling the mesenchymes, because controls rapidly die after an initial 6 h in culture (48). At 48 h of culture, mesenchymes were photographed and then removed from the Transwell filters. Mesenchymes isolated from each culture were washed in MEM with 10% FCS (4°C) for 20 min three times, solubilized in 10 µl of 10% sodium dodecyl sulfate and counted in Ready Protein (Amersham, Arlington Heights, IL). This [3H]thymidine incorporation procedure is sensitive to less than 1 ng of bFGF. Similar results were obtained after precipitating the DNA by the addition of trichloroacetic acid (10%) and washing the pellet with a mixture of ethanol and ether (3:1).

FGF Expression by UB Cells and by Ureteric Bud

Fractions from the heparin-Sepharose column were assayed for bFGF by immunoblot using an anti-bFGF neutralizing antibody (R&D Systems, Minneapolis, MN). Recombinant human bFGF (R&D Systems) served as a positive control for the detection of bFGF. In addition, we assayed media conditioned by UB cells that had been grown in defined FCS (which is depleted of heparin binding proteins).

Proteins (50-100 µg) were separated on 10-25% gradient gels (Bio-Rad, Hercules, CA) and transferred to nitrocellulose filters. Membranes were first blocked in 10% nonfat milk in 0.1 M tris(hydroxymethyl)aminomethane (Tris), 0.9% NaCl, pH 7, washed with 0.1% Tween and anti-bFGF (2 µg/ml) applied in 1% milk. After extensive washing, the primary antibody was detected with anti-rabbit antibodies (1:10,000; Jackson Immunoresearch Labs, West Grove, PA) and enhanced chemiluminescence (ECL, Amersham). Intensity of the immunodetection was measured by laser densitometry.

Poly-A RNA was prepared from UB cell monolayers, from 500 ureteric buds, and from 200 isolated mesenchymes using RNAzol B (Tel-Test), followed by selection of poly-A RNA with oligo(dT) beads (Oligo-Tex; Qiagen, Santa Clarita, CA). For each RT-PCR assay, 0.3 µg of poly-A RNA was first reverse transcribed and then amplified with the GeneAmp kit (Perkin-Elmer, Foster City, CA) in HotStart tubes (Mbeta P) for 35 cycles. Two primer sets, designed with the Prime (GCG) program, were used to assay each FGF family member. We chose primer pairs that were least homologous to other FGF species by comparing their sequences to every other FGF cDNA using the BestFit (GCG) program. To amplify FGF sequences from rat mesenchyme or ureteric bud, we used the PCR primers shown in Table 1. To amplify FGF sequences from mouse UB cells, we used the PCR primers shown in Table 2.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   PCR primers for amplification of rat mesenchyme or ureteric buds

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   PCR primers for amplification of mouse UB cells

Authenticity of the products amplified from isolated ureteric buds was confirmed by sequencing the PCR products after isolation (Qiaex II, Qiagen). The authenticity of bFGF amplified from UB cells with the third and fourth primer sets was confirmed by digestion with either Dde I or Rsa I. Digestion of products amplified by the third primer set yielded the predicted fragments of 217 and 151 bp after Dde I digestion and 180 and 188 bp after Rsa I digestion. Digestion of products amplified by the fourth primer set yielded the predicted fragments of 193 and 107 bp after Dde I digestion and 156 and 144 bp after Rsa I digestion. Control PCR reactions were performed without initial reverse transcription of RNA and were reported as -RT.

Rescue of Renal Progenitors with bFGF

Mesenchymes were treated with bFGF (R&D Systems) in increasing doses, and the incorporation of [3H]thymidine was measured, as described above. In some experiments, anti-bFGF neutralizing antibodies (1-30 µg; R&D Systems) were used to block FGF signaling. The morphology of these mesenchymes was assessed by fixation in 4% glutaraldehyde, 0.1 M phosphate buffer (pH 7.2), postfixation with 1% OsO4, and embedding in Epon-812.

Mesenchymes rescued from apoptosis with bFGF (100 ng) were assayed for capillary precursors by fixation in 4% paraformaldehyde in PBS followed by extensive washing in PBS with 50 mM NH4Cl. Mesenchymes were then permeabilized in 0.1% Triton X-100 in PBS for 10 min, rinsed with 0.05% Tween 20 for 10 min, and stained with either antibodies to von Willebrand factor (vWF, 1:50; Dakopatts, Carpinteria, CA) or to flt (1:100; Santa Cruz Biochemical, Santa Cruz, CA) in PBS with 0.05% Tween 20 and 1% bovine serum albumin for 1 h. Subsequently, the mesenchymes were washed in PBS with additional NaCl (2.7%) and with 0.05% Tween 20 and then stained with anti-rabbit antibodies coupled to fluorescein (1:200, Jackson Immunoresearch Labs) in PBS containing 5% rat serum.

Mesenchymes maintained in culture with bFGF for 4 days were also assayed for the survival of epithelial precursors. To visualize these cells, fragments of spinal cord (a heterologous inducer) obtained from E13 rat embryos were cultured next to the rescued mesenchymes. After an additional 4 days, the tissues were fixed and embedded in Epon-812 as above. This bioassay is necessary because reliable lineage markers of preepithelial cells are not available, and histological evidence of mature epithelia is required. Mesenchymes were also assayed for the expression of uvomorulin by immunocytochemistry (Sigma) after fixation in 100% methanol (-20°C) for 5 min.

To assay whether bFGF rescues mesenchymal cells that permit survival and branching of the ureteric bud, nine rat mesenchymes were cultured in three adjacent clusters on Transwell filters in the presence or absence of bFGF (100 ng) for 4 days. Ureteric buds were then obtained either from E11.5 mice, transgenic for beta -galactosidase (Rosa JR2073 animals; Jackson Labs, Bar Harbor, ME), or from E13 rat kidney. Eight ureteric buds from Rosa mice or else single rat ureteric buds were placed on the mesenchymal clusters, then cultured for an additional 4-7 days. In some experiments, bFGF was withdrawn at the time the exogenous ureteric buds were applied. Cultures were fixed in 2% paraformaldehyde and processed for beta -galactosidase histochemistry (15) or for D. biflorus lectin staining. In the latter case, the tissues were washed in 0.1% saponin in PBS at 37°C and then stained with the lectin (50 µg/ml; Vector Labs) in 0.1% saponin in PBS for 30 min.

Poly-A RNA was isolated from freshly dissected mesenchymes and from mesenchymes rescued from apoptosis with bFGF (100 ng/ml) as above. Glial cell line-derived neurotrophic factor (GDNF) was amplified using two different primer sets obtained with the Prime (GCG) program: primer 1, upstream 5' AAGCCACCATCAAAAGAC and downstream 5' TCAGATACATCCACACCG, yielding a 431-bp product; and primer 2, upstream 5' CGGGACTCTAAGATGAAGTT and downstream 5'CCAGGGTCAGATACATCCAC, yielding the predicted 654-bp product (6).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

UB Cells Secrete Many Metanephrogenic Mesenchymal Growth Factors

The metanephrogenic mesenchyme can be separated from the ureteric bud at day E13, the time when the bud invades the mesenchyme and branches. In contrast to the E13 kidney anlage which grows well in vitro, isolated E13 mesenchymes die by apoptosis within 48 h. Thus in vitro cultures of isolated mesenchyme were used to detect molecules that rescue it from apoptosis.

We have previously shown that medium conditioned by UB cells induces the growth of isolated metanephrogenic mesenchymes (1). As an initial step to identify the responsible molecules, serum-free medium conditioned by UB cells was fractionated by heparin-Sepharose chromatography. The fraction of proteins that did not bind to heparin-Sepharose had inconsistent mesenchymal growth activity, indicating that most of the activity bound to heparin.

The heparin binding proteins comprised 35 ± 7% of the proteins present in conditioned media. By using a shallow NaCl gradient for elution, we found four distinct fractions capable of rescuing the isolated metanephric mesenchyme from apoptosis (eluting at 0.3, 0.5, 0.7, and 1.5 M). All mesenchymes cultured with these fractions enlarged over a 48-h period of observation, whereas all mesenchymes cultured in basal media and all mesenchymes incubated with inactive column fractions involuted over the same period. The dying mesenchymes were nearly entirely replaced by apoptotic bodies (see Fig. 4D), whereas mesenchymes treated with active fractions were densely cellular (see Fig. 4C). In agreement with these visual observations, mesenchymes treated with the active fractions incorporated [3H]thymidine up to 400% in excess of mesenchymes incubated in basal media (Fig. 1, A and B). Fractionation of growth activity into distinct peaks was reproducible using many separate collections of conditioned media, obtained over many months (n = 12). Moreover, the peaks of activity are likely due to different proteins secreted by UB cells, since they also could be easily separated by both anion exchange and by hydrophobic interaction chromatography (not shown).


View larger version (22K):
[in this window]
[in a new window]
 


View larger version (110K):
[in this window]
[in a new window]
 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   Fractionation of media conditioned by ureteric bud cells (UB cells, 30 mg) by heparin-Sepharose chromatography. A: chromatogram of proteins eluted with a gradient of NaCl (broken line). Protein concentration in the eluant was measured by absorbance at 280 nm (solid, spiky trace). Activity of each pooled fraction (100 µg) of eluant was measured by [3H]thymidine incorporation in 4-5 metanephrogenic mesenchymes cultured for 48 h (solid line, open circle ). Mesenchymal growth activity was measured in 12 separate fractionations of conditioned media, and a representative curve is reported as a percentage of the [3H]thymidine incorporated by mesenchymes incubated in basal media. Fractions 1-11 contain non-heparin binding proteins. Four distinct peaks of activity are found: fractions 21-22 eluting at 0.3 M NaCl, fractions 33-34 eluting at 0.5 M NaCl, fractions 43-44 eluting at 0.7 M NaCl, and fractions 49-55 eluting at 1.5 M NaCl. B: photomicrographs of representative mesenchymes incubated with fractions from the heparin-Sepharose column for 48 h. Four distinct peaks of mesenchymal growth activity are found corresponding to the peaks of [3H]thymidine incorporation. Ascending numbers correspond to the fractionation shown in Fig. 2A; mesenchyme in control (C) is incubated in basal media. Clear zones around each mesenchyme are media above the collagen-coated filter; magnification, ×55. C: representative immunoblot for basic fibroblast growth factor (bFGF) of proteins eluting from the heparin-Sepharose column. Fraction numbers corresponds to the fractionation shown in A. The 18 × 103 Mr form of bFGF elutes from the heparin-Sepharose column at 1.5 M NaCl. bFGF standards (2.5-25 ng) are also shown.

Histological analysis of metanephrogenic mesenchymes incubated with the active fractions for up to 5 days showed that none of these growth factors induce formation of epithelia. Sections of the mesenchymes showed a homogeneous organization with no evidence of aggregation or alignment of cells typical of the earliest nephron (renal vesicles). In addition, none of the active fractions activated the expression of uvomorulin (not shown), an adhesion protein expressed by mesenchymal cell undergoing mesenchymal-epithelial transition.

These data demonstrate that UB cells secrete multiple factors that can rescue the metanephric mesenchyme from apoptosis without inducing the transition of mesenchyme to epithelia. Because screening of large panels of known growth factors has failed to identify mesenchymal mitogens that are also expressed by the ureteric bud (55), our results suggest that UB cells secrete unidentified metanephrogenic growth factors.

UB Cells Secrete bFGF

In addition to the three active fractions eluting from the heparin-Sepharose column at low salt concentration, there was an active fraction eluting at 1.5 M NaCl. Since this condition is typical of bFGF, we analyzed the fraction by immunoblot with anti-bFGF antibodies. As shown in Fig. 1C, bFGF was present in the fraction eluting at 1.5 M NaCl. bFGF was not present in the earlier fractions (limit of detection 1 ng/lane), confirming that they contain distinct growth factors.

Unfractionated media conditioned by UB cells contained 3.4 ± 0.8 ng bFGF/100 µg protein (or 1-2 ng/ml; n = 12). RT-PCR confirmed that UB cells express bFGF; identity was demonstrated by four sets of primers and by restriction digestion of two of the amplified products with two different enzymes (Fig. 2).


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of bFGF in UB cells demonstrated with reverse transcription-polymerase chain reaction (RT-PCR). Two different primer sets were used, primers 3 and 4, as indicated in MATERIALS AND METHODS. Authenticity of the products was confirmed by restriction digestion of each with either Rsa I or Dde I. The product of primer set 3 is 368 bp, and digestion with Rsa I yields 180- and 188-bp fragments. Digestion with Dde I yields 217- and 151-bp fragments. The product of primer set 4 is 300 bp, and digestion with Dde I yielded fragments of 193 and 107 bp. Digestion with Rsa I yielded fragments of 156 and 144 bp. Positive control is 308 bp.

Native UB Expresses bFGF

The secretion of bFGF from UB cells suggests that native ureteric buds should also synthesize this molecule. However, UB cells are grown in vitro and are immortalized with T-antigen, conditions which may alter the expression of growth factors including bFGF (58).

To determine whether native UB synthesizes bFGF when the metanephrogenic mesenchyme starts proliferating at E13, we isolated poly-A RNA from 500 E13 rat ureteric buds. RT-PCR with two different primer sets showed that the ureteric bud expresses bFGF (Fig. 3). Authenticity of the PCR products was confirmed by sequencing (not shown).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of FGF family members by freshly isolated ureteric buds (left) and metanephrogenic mesenchymes (right). RT-PCR was performed with two different primer sets for each assay, and the products of one set of primers (denoted primer 1 in MATERIALS AND METHODS) are shown. The ureteric bud expresses bFGF and FGF9, whereas the mesenchyme expresses acidic FGF and weakly bFGF and FGF5. Products amplified from the isolated ureteric buds were authenticated by sequencing. Positive control is 308 bp. -RT, control PCR reactions without initial reverse transcription.

To rule out the possibility that expression of bFGF in the ureteric bud preparation was due to contamination with mesenchymal cells, we determined whether E13 metanephrogenic mesenchyme expresses bFGF. As shown in Fig. 3, we found only trace amplification of bFGF by RT-PCR with 200 dissected mesenchymes (perhaps due to contamination by a few UB cells). To obtain additional evidence that the bFGF originated from ureteric cells in the ureteric bud preparation, we used RT-PCR to determine whether the expression pattern of several members of the FGF family differed in ureteric buds and mesenchymes (Fig. 3). Whereas ureteric buds expressed bFGF and FGF9, the mesenchymes expressed acidic FGF, trace bFGF and FGF5, and no FGF9. The different patterns of expression of FGFs indicate that there was little if any mesenchymal contamination in the UB preparation. This, together with the weak mesenchymal expression of bFGF, indicates that ureteric bud in vivo synthesizes bFGF.

bFGF Rescues the Mesenchyme From Apoptosis

Since bFGF is secreted by UB cells, is synthesized in vivo by the ureteric bud, and is present in a fraction eluting from the heparin-Sepharose column that rescues the mesenchyme from apoptosis (Fig. 1C), we examined whether pure bFGF is also active. Indeed, we found that mesenchymes treated with as little as 1 ng bFGF/2 ml culture demonstrated enhanced [3H]thymidine incorporation (Fig. 4A) and that at higher doses (2.5-5 ng/2 ml culture) the mesenchymes enlarged (Fig. 4B). These tissues were highly cellular, whereas mesenchymes cultured in basal media showed an abundance of fragmented nuclei and apoptotic bodies (Fig. 4, C and D). The growth-promoting effect of bFGF was inhibited by an anti-bFGF neutralizing antibody, where greater than 5 µg of antibody abolished the activity of 5 ng bFGF per 2 ml of culture media. (Fig. 4, A and B).


View larger version (21K):
[in this window]
[in a new window]
 


View larger version (36K):
[in this window]
[in a new window]
 


View larger version (68K):
[in this window]
[in a new window]
 


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 4.   bFGF has mesenchymal growth activity and rescues the metanephrogenic mesenchyme from apoptosis. A: dose response to purified bFGF and the effect of coaddition of bFGF neutralizing antibodies. Neutralizing antibodies, at 1, 5, 10, and 30 µg, were added with 5 ng bFGF/2 ml of culture media. Mesenchymal growth activity is quantitated by [3H]thymidine incorporation. Values are means ± SE; n = 5. B: photomicrographs depicting dose response to bFGF and the effect of coaddition of bFGF neutralizing antibodies. a, No addition of bFGF; b, 1 ng bFGF/culture; c, 2.5 ng bFGF/culture; d, 5 ng bFGF/culture; e, 5 ng bFGF/culture and 5 µg neutralizing antibody. Bar = 125 µm. C and D: section of mesenchyme treated with 5 ng bFGF for 24 h (C) or cultured in basal media (D). Note abundant apoptotic bodies found in mesenchyme incubated in basal media compared with the mesenchyme rescued from apoptosis with bFGF. Bars = 25 µm.

To determine the class of receptor that bFGF activates in the metanephric mesenchyme, we examined the activity of several FGF family members. Mesenchymes were rescued from apoptosis by FGF4 but had little response to acidic FGF and no response to FGF5, FGF6, and FGF7 (100 ng; n = 4-6). These data indicate that bFGF rescues the mesenchyme by activating the beta -isoform of the flg receptor (FGFR1, IIIC; see Refs. 27, 45, 56). This receptor is highly expressed in embryonic mesenchyme (22).

We conclude that bFGF is a potent mesenchymal survival factor and mitogen expressed by UB cell lines and by ureteric bud in vivo. We suggest that this factor is secreted by the invading ureteric bud in vivo, rescuing the mesenchyme from apoptosis by the activation of the flg IIIc receptor. Our results are in agreement with recent studies showing that bFGF is able to rescue mesenchyme from apoptosis (21, 37) and contrast with prior failures to detect its mesenchymal growth activity (5, 55, 38).

Characterization of the Cell Types Rescued From Apoptosis by bFGF

Several cell types are present in E13 metanephrogenic mesenchyme. These include the precursors of tubular epithelia and precursors of endothelial cells (34) and stromal cells (14, 46). In addition, the mesenchyme contains cells that provide an essential signal for kidney development; these as yet unidentified cells trigger the invasion and branching of the ureteric bud. We examined whether these cell types survive in metanephrogenic mesenchymes treated with bFGF.

Rescue of nephron precursors. Mesenchymes treated with bFGF appear homogeneous, without histological evidence of mesenchymal-epithelial transition (formation of aggregates, renal vesicles or S-shaped bodies; Fig. 4C). Thus, to assay whether nephron precursors have been rescued from apoptosis by bFGF, we determined whether bFGF-treated mesenchymes were competent to produce tubules. We did this by first treating mesenchymes for four days with bFGF (mesenchymes cultured without bFGF involuted by 2 days in culture) and then introducing fragments of embryonic spinal cord to serve as a heterologous "inducer." We found that the mesenchymes rescued by bFGF were capable of generating tubules upon contact with the spinal cord (in 80%, n = 10; Fig. 5, A and B). These data unequivocally demonstrate that bFGF rescues epithelial progenitors. In addition, the data reveal that bFGF does not prevent the expression of the mature epithelial phenotype, as it does in some cells (2, 19, 35).


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5.   Nephron precursors are rescued from apoptosis by bFGF. Metanephrogenic mesenchymes were maintained in culture for 4 days with bFGF (100 ng) and then challenged with fragments of spinal cord (A, bottom left) placed adjacent to the mesenchyme. Rescued mesenchyme generates tubules, demonstrating that epithelial precursors had been rescued by bFGF. Cultures were fixed and sectioned (B) 4 days after the addition of spinal cord. Bars: A = 120 µm, B = 55 µm.

Rescue of capillary precursors. At an early stage of metanephrogenic development (E13), endothelial cells are already present. The cells are identified by the expression of vWF (34) or vascular endothelial growth factor receptors, flk (17, 18, 24, 33, 42, 43) and flt (10, 39). As expected, in isolated E13 metanephrogenic mesenchymes we found cells expressing vWF and flt. To determine whether these vascular precursors were rescued by bFGF, we assayed these endothelial cell markers in mesenchymes treated for 4 days with bFGF. Whereas mesenchymes cultured without bFGF involuted and lost the vWF- and flt-positive cells present at the time of isolation, mesenchymes treated with bFGF had abundant positive cells. The cells were arrayed end to end, forming a reticulum (Fig. 6). This demonstrates survival of capillary precursors and perhaps initiation of a capillary plexus as a result of treatment with bFGF.


View larger version (127K):
[in this window]
[in a new window]
 
Fig. 6.   Endothelial cells are rescued from apoptosis by bFGF. von Willebrand-positive cells survive for 4 days in cultures of E13 mesenchymes supplemented with bFGF (100 ng). Note that mesenchymes incubated in basal media involute after 2 days ex vivo; magnification, ×330.

Rescue of mesenchymal cells capable of inducing the ureteric bud to branch. Although the ureteric bud is essential for the metanephrogenic mesenchyme to grow, a fundamental function of metanephrogenic mesenchyme is, in turn, to induce growth and branching of the ureteric bud (47).

To determine whether bFGF rescued metanephrogenic mesenchymal cells that could support the growth and branching of the ureteric bud, we cocultured ureteric buds with mesenchymes that had been maintained for 4 days with bFGF. As shown in Figs. 7, B and C, mesenchymes rescued with bFGF stimulated the branching of ureteric buds (n = 4 experiments), whereas control mesenchymes could not even support their structural integrity (Fig. 7D). In addition, we found that mesenchymes treated with bFGF had cells expressing GDNF, a growth factor produced by the E13 mesenchyme (Fig. 8) that is required for ureteral branching and growth (29, 41, 44).


View larger version (K):
[in this window]
[in a new window]
 
Fig. 7.   Metanephrogenic mesenchymes rescued from apoptosis with bFGF induce the branching of exogenous ureteric buds. Ureteric buds were isolated from embryonic day E13 (E13) rat kidneys (A and B) or from E11 mouse kidneys (C and D) and placed on top of mesenchymes that had been maintained in culture for 4 days with bFGF (100 ng). Cultures were then fixed and stained after an additional 4-7 days of incubation. A: a freshly isolated ureteric bud is branched once. Bar = 55 µm. B: a ureteric bud has branched twice after coculture for 4 days on a cluster of mesenchymes rescued by bFGF. Ureteric bud is visualized with D. biflorus lectin; the mesenchyme is beneath and surrounding the ureteric bud and not stained by the lectin. Bar = 80 µm. C and D: 8 ureteric buds from E11 Rosa mice were placed upon a cluster of 9 mesenchymes that had been maintained by bFGF (C) or had been cultured in basal media (D). Ureteric buds placed on mesenchymes rescued from apoptosis with bFGF are viable and undergo branching morphogenesis over 7 days (C), whereas ureteric buds do not survive when cultured upon involuting mesenchymes (D). Ureteric buds were visualized by histochemistry for beta -galactosidase. For C and D, bar = 270 µm.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 8.   Metanephrogenic mesenchymes rescued from apoptosis with bFGF express glial cell line-derived neurotrophic factor (GDNF). Freshly dissected mesenchymes (mesenchyme) and mesenchymes maintained in culture for 4 days with bFGF (mesenchyme + bFGF) were analyzed for the expression of GDNF by RT-PCR using two different primer sets. -RT, PCR reactions without prior reverse transcription of RNA.

To establish that the ureteric bud branched in response to the rescued mesenchyme and not in response to bFGF, we withdrew bFGF at the time the ureteric buds were cocultured with the rescued mesenchymes. Despite removal of bFGF, the ureteric buds grew over a 4-day period, suggesting that the rescued mesenchyme and not bFGF stimulated branching of the ureteric bud. As an additional control, we tested whether bFGF (100 ng) could enhance the survival of ureteric buds in culture. Both in the presence and absence of bFGF, some ureteric cells grew from the explanted buds. However, all of the cells died after 4 days in either bFGF-treated or control cultures. This demonstrates that bFGF does not directly enhance survival of ureteric epithelia.

Taken together, these data demonstrate that bFGF rescues mesenchymal cells, which in turn are competent to promote survival and branching morphogenesis of the ureteric bud.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Authentic Mesenchymal Growth Factors

At early stages of nephrogenesis, the ureteric bud rescues the metanephrogenic mesenchyme from apoptosis. This is demonstrated by the rapid death of the mesenchyme when invasion of the ureteric bud is defective in vivo (29, 41, 44, 49) or when the mesenchyme is mechanically separated from the ureteric bud in vitro (23).

To identify signals produced by the ureteric bud that rescue the mesenchyme from apoptosis, we previously isolated UB cells (1). We showed that UB cells are adequate surrogates for the native ureteric bud; they express proteins typical of the ureteric bud, and they induce the mesenchyme to grow and differentiate into epithelia that form tubules. These results suggest that our UB cells express the same factors as does the ureteric bud in vivo. Supporting this conclusion, we now find that bFGF, which is secreted by UB cells, is also expressed by the ureteric bud at the time of its invasion of the mesenchyme (E13 in the rat). Thus bFGF is an authentic mesenchymal growth factor expressed by the ureteric bud at a time when it rescues the mesenchyme from apoptosis.

Induction: Proliferation vs. Morphogenesis

In classic experiments with isolated metanephrogenic mesenchymes and spinal cord as an inducer, mesenchymal growth and epithelialization occurred simultaneously, suggesting that these two processes may result from the same inducing signal (48).

In contrast, we have found that four soluble factors secreted by UB cells induce growth but not epithelialization of the mesenchyme, whereas as previously shown, contact with UB cells induces mesenchymal-epithelial conversion (1). This suggests that growth and mesenchymal-epithelial conversion are mediated by different molecules. It is of course possible that withdrawal of the growth factors secreted by the ureteric bud could be the mechanism that triggers the expression of the mature phenotype, as occurs elsewhere (3, 19, 31, 35, 51). However, we found that bFGF does not inhibit epithelialization, since nephrons could be induced in the presence of bFGF by the addition of spinal cord. Furthermore, we found in preliminary experiments that the withdrawal of bFGF from rescued mesenchymes does not cause maturation but results in the fulminant death of the mesenchyme. These results show that bFGF neither stimulates nor inhibits mesenchymal-epithelial conversion but rather maintains epithelial precursors available for a secondary signal that triggers mesenchymal-epithelial conversion. Thus the data demonstrate that mesenchymal growth and conversion to epithelia are regulated by independent signaling mechanisms.

The sequence of nephrogenesis in vivo is consistent with the proposal that distinct molecules trigger proliferation and epithelialization. A localized proliferation of mesenchymal cells occurs around each branch of the ureteric bud (a process that has been called "condensation") prior to the appearance of epithelia (52). This suggests that the ureteric bud first stimulates proliferation of mesenchymal cells and then induces epithelialization. This of course could occur first by the exposure of mesenchymal cells to diffusible growth factors followed by the contact of mesenchymal cells with the ureteric bud.

Dichotomous control of mesenchymal proliferation and epithelialization by the ureteric bud also implies that dysfunction of each could occur. For example, defects in growth factor signaling should result in hypocellular kidneys with few nephrons, whereas defects in triggering mesenchymal-epithelial conversion would allow mesenchymal cell proliferation but not nephrogenesis. This could explain some of the phenotypes of recent gene deletion experiments. For example, the deletion of BMP-7 (expressed initially by the ureteric bud; see Ref. 54) results in hypocellular kidneys with a few nephrons (11, 26), suggesting that this factor predominantly acts as mesenchymal proliferative factor. We would predict that deletion of a ureteric molecule that converts mesenchyme to epithelia would result in a large number of mesenchymal cells clustered at each branch of the ureteric bud but no nephrons. This phenotype is found after deletion of Wnt-4, a mesenchymal protein that is necessary for mesenchymal-epithelial transition (50).

The Function of Multiple Ureteric Growth Factors

Since UB cells secrete many activities that rescue the mesenchyme from apoptosis, the question arises as to whether each has a unique function. There are two possibilities: each ureteric factor rescues a specific cell lineage, or alternatively, each factor stimulates the progenitors of multiple cell lineages. Distinguishing these possibilities for each ureteric growth factor will require their identification.

bFGF is the first growth factor secreted by UB cells that we have identified and confirmed to be produced by the ureteric bud in vivo. By examining the composition of mesenchymes rescued by bFGF from apoptosis, we found that this factor maintains progenitors of multiple cell lineages including nephron and capillary precursors as well as cells that stimulate branching of the ureteric bud, including GDNF-expressing mesenchymal cells (29, 41, 44). bFGF may rescue each of these progenitors directly or may only rescue a single type of mesenchymal cell that then mediates the effects of bFGF on other cells. The former possibility is more likely, since FGF receptors are widely expressed in the mesenchyme (22, 36, 39), and bFGF is a mitogen for at least some endothelia (12). Regardless, our data indicate that multiple progenitors present in the metanephrogenic mesenchyme at the stage of the invasion of the ureteric bud survive because of bFGF. Similarly, in other developing tissues, such as in the developing limb and during body axis elongation (8, 30), as well as during cardiac (28) and skeletal muscle proliferation (19), FGFs maintain multiple precursors without selecting subsets of cells.

Although the other, yet unidentified, growth factors secreted by UB cells may regulate the survival of specific precursor cells, they may be similar to bFGF and rescue multiple types of progenitors from apoptosis. In this case, the factors could have additive effects on their targets. At the stage in which the ureteric bud extends from the Wolffian duct to enter the mesenchyme, this organ contains only 103 cells. These cells must generate 104 nephrons (each initially composed of 100 cells; see Ref. 9) as well as a complex vasculature and stroma. Thus many soluble ureteric factors may be required to generate enough precursor cells in a short time. Estimations of total number of cells in the developing kidney in fact suggest a brief period for rapid cell multiplication; expansion of cell number occurs only in the first few days after the ureteric bud contacts the mesenchyme (55) and for only 48 h in mesenchymes grown in vitro with an inducer (48). In other systems, multiple growth factors are required to rescue precursors from apoptosis and to induce their proliferation (2, 4, 13, 53).

Recently, Karavanova et al. (21) found that conditioned media from a UB cell line triggers tubulogenesis when enriched with exogenous TGF-alpha and bFGF (21). These results suggest that soluble proteins in their media can trigger growth and tubulogenesis in metanephrogenic mesenchymes, that TGF-alpha is a ureteric factor, and that both TGF-alpha and bFGF are either not present or are present at limiting concentrations in their UB-conditioned media. It is likely that our UB cells differ from those used by Karavanova et al. (21) in their ability to secrete inducing or growth factors, since we found abundant bFGF but no TGF-alpha in our conditioned media (not shown). Furthermore, although the results of Karavanova et al. (21) indicate that TGF is a mesenchymal mitogen, it is of note that deletion of TGF-alpha in vivo does not inhibit renal development (25). Furthermore, although both Karavanova et al. (21) and we found that bFGF is a mesenchymal growth factor, neutralization of bFGF with anti-bFGF antibodies (100 µg/ml) does not block development of E13 kidneys (unpublished experiments). These data suggest that neither TGF-alpha nor bFGF is limiting to mesenchymal growth and development, but perhaps TGF-like or bFGF-like molecules are required in vivo.

In sum, our data suggest that the classic view of the ureteric bud as an inducer of the metanephrogenic mesenchyme should be expanded. We propose that the ureteric bud in vivo not only induces mesenchymal-epithelial conversion but independently determines the number of mesenchymal cells available to form nephrons and, ultimately, nephron number. In addition, by rescuing endothelial cells from apoptosis, the ureteric bud could locally regulate the vascularity of each nephron. Finally, by supporting the survival of mesenchymal cells that trigger its own growth, the ureteric bud indirectly regulates its own growth and thus the nephron and capillary precursors that it rescues from apoptosis. We therefore suggest that variable expression of one or more of these ureteric factors could account for variations in the number of nephrons found in human kidneys (32) and could be responsible for cases of congenital renal hypoplasia, where nephron number, but not nephron architecture, is disturbed.

    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Disease Grant 5PO-1-DK-46934 and by a Research Scholar Award of the American Society of Nephrology (to J. Barasch).

    FOOTNOTES

Address for reprint requests: J. Barasch, Columbia College Of Physicians and Surgeons, 630 W 168th St., New York, NY 10032.

Received 30 April 1997; accepted in final form 10 July 1997.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Barasch, J., L. Pressler, J. Connor, and A. Malik. A ureteric bud cell line induces nephrogenesis in two steps by two distinct signals. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F50-F61, 1996[Abstract/Free Full Text].

2.   Barres, B., and M. Raff. Control of oligodendrocyte number in the developing rat optic nerve. Neuron 12: 935-942, 1994[Medline].

3.   Barres, B., M. Raff, F. Gaese, I. Bartke, G. Dechant, and Y. Barde. A crucial role for neurotrophin-3 in oligodendrocyte development. Nature 367: 371-375, 1994[Medline].

4.   Barres, B., R. Schmid, M. Sendnter, and M. Raff. Multiple extracellular signals are required for long term-oligodendrocyte survival. Development 118: 283-295, 1993[Abstract].

5.   Burrow, C., and P. Wilson. A putative Wilms tumor-secreted growth factor activity required for primary culture of human nephroblasts. Proc. Natl. Acad. Sci. USA 90: 6066-6070, 1993[Abstract/Free Full Text].

6.   Choi-Lundberg, D., and M. Bohn. Ontogeny and distribution of glial cell line derived neurotrophic factor (GDNF) mRNA in rat. Dev. Brain Res. 85: 80-88, 1995[Medline].

7.   Coles, H., J. Burne, and M. Raff. Large-scale normal cell death in the developing rat kidney and its reduction by epidermal growth factor. Development 118: 777-784, 1993[Abstract].

8.   Crossley, P., and G. Martin. The mouse FGF8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121: 439-451, 1995[Abstract].

9.   Davies, J., and J. Bard. Inductive interactions between the mesenchyme and the ureteric bud. Exp. Nephrol. 4: 77-85, 1996[Medline].

10.   De Vries, C., J. Escobedo, H. Ueno, K. Houck, N. Ferrara, and L. Williams. The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255: 989-991, 1992[Abstract/Free Full Text].

11.   Dudley, A., K. Lyons, and E. Robertson. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9: 2795-2807, 1995[Abstract/Free Full Text].

12.   Flamme, I., and W. Risau. Induction of vasculogenesis and hematopoiesis. Development 116: 435-439, 1992[Medline].

13.   Gavrilovic, J., A. Brennan, R. Mirsky, and K. Jessen. Fibroblast growth factors and insulin growth factors combine to promote survival of rat Schwann cell precursors without induction of DNA synthesis. Eur. J. Neurosci. 7: 77-85, 1995[Medline].

14.   Hatini, V., S. Huh, D. Herzlinger, V. Soares, and E. Lai. Essential role of stromal morphogenesis in kidney morphogenesis revealed by targeted disruption of winged helix transcription factor, BF-2. Genes Dev. 10: 1467-1478, 1996[Abstract/Free Full Text].

15.   Herzlinger, D., C. Koseki, T. Mikawa, and Q. Al-Awqati. Metanephric mesenchyme contains multipotent stem cells whose fate is restricted after induction. Development 114: 565-572, 1992[Abstract].

16.   Herzlinger, D., J. Qiao, D. Cohen, N. Ramakrishna, and A. Brown. Induction of kidney epithelial morphogenesis by cells expressing Wnt-1. Dev. Biol. 166: 815-818, 1994[Medline].

17.   Hyink, D., and D. Abrahamson. Origin of the glomerular vasculature in the developing kidney. Semin. Nephrol. 15: 300-314, 1995[Medline].

18.   Hyink, D., D. Tucker, P. St. John, V. Leardkamolkarn, M. Accavitti, C. Abrass, and D. Abrahamson. Endogenous origin of glomerular endothelial and mesangial cells in grafts of embryonic kidney. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F886-F899, 1996[Abstract/Free Full Text].

19.   Itoh, N., T. Mima, and T. Mikawa. Loss of fibroblast growth factor receptors is necessary for terminal differentiation of embryonic limb muscle. Development 122: 291-300, 1996[Abstract].

20.   Jat, P., M. Noble, N. Ataliotis, Y. Tanaka, N. Yannoutsos, L. Larsen, and D. Kioussis. Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc. Natl. Acad. Sci. USA 88: 5096-5100, 1991[Abstract/Free Full Text].

21.   Karavanova, I. D., L. F. Dove, J. H. Resau, and A. O. Perantoni. Conditioned media from a rat ureteric bud cell line in combination with bFGF induces complete differentiation of isolated metanephric mesenchyme. Development 122: 4159-4167, 1996[Abstract].

22.   Kim, E., H. Kwon, C. Burrow, and B. Ballermann. Expression of rat fibroblast growth factor receptor 1 as three splicing variants during kidney development. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F66-F73, 1993[Abstract/Free Full Text].

23.   Koseki, C., D. Herzlinger, and Q. Al-Awqati. Apoptosis in metanephreic development. J. Cell Biol. 119: 1327-1333, 1992[Abstract/Free Full Text].

24.   Landels, E., C. Proschel, M. Noble, P. S. Jat, L. Fine, and A. Woolf. Receptor tyrosine kinases (RTKs) expressed in early nephrogenesis (Abstract). J. Am. Soc. Nephrol. 5: 721, 1994.

25.   Luetteke, N., T. Qiu, R. Peiffer, P. Oliver, O. Smithies, and D. Lee. TGF-alpha deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 69: 737-749, 1993.

26.   Luo, G., C. Hofmann, A. Bronckers, M. Sohocki, A. Bradley, and G. Karsenty. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 9: 2808-2820, 1995[Abstract/Free Full Text].

27.   Mansukhani, A., D. Moscatelli, D. Talarico, V. Levytska, and C. Basilico. A murine fibroblast growth factor (FGF) receptor expressed in CHO cells is activated by basic FGF and Kaposi FGF. Proc. Natl. Acad. Sci. USA 87: 4378-4382, 1990[Abstract/Free Full Text].

28.   Mima, T., H. Ueno, D. Fischman, L. Williams, and T. Mikawa. Fibroblast growth factor receptor is required for in vivo cardiac myocyte proliferation at early embryonic stages of heart development. Proc. Natl. Acad. Sci. USA 92: 467-471, 1995[Abstract/Free Full Text].

29.   Moore, M., R. Klein, I. Farinas, H. Sauer, M. Armaniani, H. Phillips, L. Reichardt, A. Ryan, K. Carver-Moore, and A. Rosenthal. Renal and neuronal abnormalities in mice lacking GDNF. Nature 382: 70-73, 1996[Medline].

30.   Niswander, L., S. Jeffrey, G. Martin, and C. Tickle. A positive feedback loop coordinates growth and patterning in the vertebrate limb. Nature 371: 609-612, 1994[Medline].

31.   Noble, M., K. Murray, P. Stroobant, M. Waterfield, and P. Riddle. Platelet derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocyte/type-2 astrocyte progenitor cell. Nature 333: 560-562, 1988[Medline].

32.  Nyengaard, J., and T. Bendtsen. Glomerular number and size in relation to age kidney weight, and body surface in normal man. Anat. Rec. 232: 194-201.

33.   Oelrichs, R., H. Reid, O. Bernard, A. Ziemiecki, and A. Wilks. NYK/FLK-1: a putative receptor protein kinase isolated from E10 embryonic neuroepithelium is expressed in endothelial cells of the developing embryo. Oncogene 8: 11-18, 1993[Medline].

34.   Oliver, J., M. Goldberg, and Q. Al-Awqati. Endothelial cell targeting during renal development: use of monoclonal antibodies. Am. J. Physiol. 272 (Renal Physiol. 41): F153-F159, 1997[Abstract/Free Full Text].

35.   Olwin, B., and S. Hauschka. Cell surface fibroblast growth factor and epidermal growth factor receptors are permanently lost during skeletal muscle terminal differentiation in culture. J. Cell Biol. 107: 761-769, 1988[Abstract/Free Full Text].

36.   Orr-Urtreger, A., D. Givol, A. Yayon, Y. Yarden, and P. Lonai. Developmental expression of two murine fibroblast growth factor receptors, flg and bek. Development 113: 1419-1434, 1991[Abstract].

37.   Perantoni, A., L. Dove, and I. Karavanova. Basic fibroblast growth factor can mediate the early inductive events in renal development. Proc. Natl. Acad. Sci. USA 92: 4696-4700, 1995[Abstract/Free Full Text].

38.   Perantoni, A., L. Dove, and C. Williams. Induction of tubules in the rat metanephric mesenchyme in the absence of an inductive tissue. Differentiation 48: 25-31, 1991[Medline].

39.   Peters, K., C. de Vries, and L. Williams. Vascular endothelial growth factor receptor expression during embryogenesis and tissue repair suggests a role in endothelial differentiation and blood vessel growth. Proc. Natl. Acad. Sci. USA 90: 8915-8919, 1993[Abstract/Free Full Text].

40.   Peters, K., S. Werner, G. Chen, and L. Williams. Two FGF receptor genes are differentially expressed in epithelial and mesenchymal tissues during limb formation and organogenesis in the mouse. Development 114: 233-243, 1992[Abstract].

41.   Pichel, J., L. Shen, H. Sheng, A.-C. Granholm, J. Drago, A. Grinberg, E. Lee, S. Huang, M. Saarma, B. Hoffer, H. Sariola, and H. Westphal. Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382: 70-73, 1996.

42.   Pinson, D., P. St. John, D. Tucker, and D. Abrahamson. Origin of glomerular microvascular developing in oculo. J. Am. Soc. Nephrol. 4: 474, 1993.

43.   Robert, B., P. St. John, D. Hyink, and D. Abrahamson. Evidence that embryonic kidney cells expressing flk-1 are intrinsic, vascuolgenic angioblasts. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F744-F753, 1996[Abstract/Free Full Text].

44.   Sanchez, M., I. Silos-Santiago, J. Frisen, B. He, S. Lira, and M. Barbacid. Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 382: 70-73, 1996.

45.   Santos-Ocampo, S., J. Colvin, A. Chellaiah, and D. Ornitz. Expression and biological activity of mouse fibroblast growth factor-9. J. Biol. Chem. 271: 1726-1731, 1996[Abstract/Free Full Text].

46.   Sariola, H., E. Aufderheide, H. Bernhard, S. Henke-Fahle, W. Dippold, and P. Ekblom. Antibodies to cell surface ganglioside GD3 perturb inductive epithelial-mesenchymal interactions. Cell 54: 235-245, 1988[Medline].

47.   Saxen, L. Experimental tubulogenesis. In: Organogenesis of the Kidney, edited by P. Barlow, P. Green, and C. Wylie. Cambridge, UK: Cambridge, 1987, p. 88-128.

48.   Saxen, L., J. Salonen, P. Ekblom, and S. Nordling. DNA synthesis and cell generation cycle during determination and differentiation of the metanephric mesenchyme. Dev. Biol. 98: 130-138, 1983[Medline].

49.   Schuchardt, A., V. D'Agati, F. Larsson-Blomberg, F. Costantini, and V. Pachnis. Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor ret. Nature 373: 699-702, 1994.

50.   Stark, K., S. Vainio, G. Vassileva, and A. McMahon. Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372: 679-683, 1994[Medline].

51.   Temple, S., and M. Raff. Differentiation of a bipotential glial progenitor cell in single cell microculture. Nature 313: 223-225, 1985[Medline].

52.   Vainio, S., M. Jalkanen, M. Bernfield, and L. Saxen. Transient expression of syndecan in mesenchymal cell aggregates of the embryonic kidney. Dev. Biol. 152: 221-231, 1992[Medline].

53.   Vicario-Abejon, C., K. Johe, T. Hazel, D. Collazo, and R. McKay. Functions of basic fibroblast growth factor and neurotrophins in the differentiation of hippocampal neurons. Neuron 15: 115-126, 1995[Medline].

54.   Vukicevic, S., J. Kopp, F. Luyten, and T. Sampath. Induction of nephrogenic mesenchyme by osteogenic protein 1 (bone morphogenic protein 7). Proc. Natl. Acad. Sci. USA 93: 9021-9026, 1996[Abstract/Free Full Text].

55.   Weller, A., L. Sorokin, E. Illgen, and P. Ekblom. Development and growth of mouse embryonic kidney in organ culture and modulation of development by soluble growth facto. Dev. Biol. 144: 248-261, 1991[Medline].

56.   Werner, S., D. Duan, C. de Vries, K. Peters, D. Johnson, and L. Williams. Differential splicing in the extracellular region of fibroblast growth factor receptor 1 generates receptor variants with different ligand-binding specificities. Mol. Cell. Biol. 12: 82-88, 1992[Abstract/Free Full Text].

57.   Woolf, A. S., M. Kotalsi-Joannou, P. Hardman, E. Andermacher, C. Moorby, L. G. Fine, P. Jat, M. D. Noble, and E. Gherardi. Roles of hepatocyte growth factor/scatter factor and Met receptor in the early development of the metanephros. J. Cell Biol. 128: 171-184, 1995[Abstract/Free Full Text].

58.   Zhang, G., J. Sato, M. Herley, M. Tsang, H. Ye, H. Liu, T. Ichimura, G. Yan, W. Mckeehan, and J. Stevens. Stable and temperature sensitive transformation of rat kidney epithelial cells suppresses expression of acidic fibroblast growth factor 1 but activates secretion of fibroblast growth factor 3 (int 2) and vascular endothelial growth factor. Cell Growth Differ. 5: 349-357, 1994[Abstract].


AJP Renal Physiol 273(5):F757-F767
0363-6127/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Li, M. Jerebtsova, X.-H. Liu, P. Tang, and P. E. Ray
Novel cystogenic role of basic fibroblast growth factor in developing rodent kidneys
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F289 - F296.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
G. Challen, B. Gardiner, G. Caruana, X. Kostoulias, G. Martinez, M. Crowe, D. F. Taylor, J. Bertram, M. Little, and S. M. Grimmond
Temporal and spatial transcriptional programs in murine kidney development
Physiol Genomics, October 17, 2005; 23(2): 159 - 171.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Yang, K. Mori, J. Y. Li, and J. Barasch
Iron, lipocalin, and kidney epithelia
Am J Physiol Renal Physiol, July 1, 2003; 285(1): F9 - F18.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Hu, J. A. Oliver, M. R. Goldberg, and Q. Al-Awqati
LRP: a new adhesion molecule for endothelial and smooth muscle cells
Am J Physiol Renal Physiol, October 1, 2001; 281(4): F739 - F750.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. J. CARROLL and A.