|
|
||||||||
Department of Medicine, Yale University School of Medicine, New Haven 06520-8047; and Department of Veterans Affairs Medical Center, West Haven, Connecticut 06516
| |
ABSTRACT |
|---|
|
|
|---|
The oculocerebrorenal syndrome of Lowe (OCRL) is a hereditary multisystem disorder characterized by congenital cataracts, mental retardation, renal tubular dysfunction, and progressive renal insufficiency. Tubular abnormalities include proximal tubular dysfunction, a distal acidification defect, and a possible impairment of urinary concentrating ability. The most important renal manifestation of Lowe's syndrome is a progressive loss of kidney function associated with a glomerular lesion that progresses to end-stage renal disease in either the third or fourth decade. The gene responsible for Lowe's syndrome, OCRL-1, was recently identified by positional cloning, and mutations were demonstrated in many affected patients. In the present study reverse transcription-polymerase chain reaction (RT-PCR) was used to clone a partial-length cDNA encoding rabbit renal OCRL-1. There is a high degree of similarity between rabbit and human sequences, with nucleotide and amino acid identities of 92% and 97%, respectively. Northern analysis identified a 5.4-kb transcript that is expressed in both rabbit kidney cortex and medulla. Isolated nephron-segment RT-PCR showed that OCRL-1 is expressed in all segments studied: the glomerulus, proximal tubule, medullary and cortical thick ascending limb, distal convoluted tubule, connecting tubule, cortical collecting duct, and outer medullary collecting duct. Defective OCRL-1 expression in these regions may play a pathogenetic role in the renal manifestations of this syndrome.
Lowe's syndrome; Fanconi's syndrome; inositol polyphosphate-5-phosphatase; nephron segment reverse transcription-polymerase chain reaction
| |
INTRODUCTION |
|---|
|
|
|---|
THE OCULOCEREBRORENAL SYNDROME of Lowe (OCRL), also known as Lowe's syndrome, is an X-linked recessive multisystem disorder manifested clinically by congenital cataracts, mental retardation, renal tubular dysfunction, and progressive renal insufficiency (10). The syndrome was first described by Lowe et al. in 1952. Since that time, ~150 cases have been reported. Recently, the gene responsible for Lowe's syndrome (OCRL-1) was identified by positional cloning, and it encodes a protein that is 71% similar to the human 75-kDa inositol polyphosphate-5-phosphatase (2, 11). Support for an etiologic role of OCRL-1 in Lowe's syndrome comes from Northern and mutational analysis of affected patients (2, 9). The protein has been localized to the Golgi apparatus (17).
Renal involvement in Lowe's syndrome is manifested initially by tubular dysfunction that is present either at birth or develops in the first year, and it is characterized by aminoaciduria, phosphaturia, organic aciduria, and systemic acidosis. Although the urinary abnormalities in Lowe's syndrome are similar to those described in classic Fanconi's syndrome (a syndrome with generalized proximal tubule dysfunction), significant differences exist. First, OCRL patients do not have glucosuria as a prominent feature. Second, they have a lesser degree of amino aciduria (expressed as a percentage of total organic acids excreted). Third, they are unable to maximally acidify the urine in response to ammonium chloride loading (4, 10). In addition to the tubular dysfunction, a progressive loss of renal function is typical with the predicted development of end-stage renal disease by the fourth decade (4).
Pathological changes in the kidney, based on autopsy and biopsy data, appear to be age dependent and can be divided into three groups (1). Patients from birth to 3 mo of age usually show no evidence of renal pathology. Between 3 mo and 5 yr there is evidence of diffuse tubular changes with little or no glomerular pathology. Tubular abnormalities range from mild (dilation of the mitochondria and disruption of the cristae seen only on electron microscopic observation; see Ref. 15) to severe (diffusely dilated tubules with atrophy of the tubular epithelium, most of which are filled with proteinaceous casts; see Ref. 14). Distal nephron Ca2+ deposition may also occur. In more advanced stages of the disease, usually in patients over the age of 5-6 yr, the glomeruli may be fibrosed, hyalinized, or diffusely hypercellular with basement membrane thickening and foot process fusion. There is also multifocal tubular atrophy, basement membrane thickening, and interstitial fibrosis. The pathophysiology of the advanced glomerular and tubular changes is unclear.
Defective OCRL-1 expression leads, through unknown mechanisms, to a unique pattern of renal dysfunction and the other clinical manifestations of Lowe's syndrome. In human, OCRL-1 is normally expressed in kidney and brain, in addition to other organs not known to be affected in this syndrome (2). The expression of OCRL-1 mRNA in specific nephron segments has not been reported. To address these issues, we cloned a partial-length cDNA encoding rabbit renal OCRL-1. We then conducted isolated nephron-segment reverse transcription-polymerase chain reaction (RT-PCR) in rabbit. We chose to work in rabbit for the following two reasons: 1) the difficulty in performing isolated nephron-segment RT-PCR in humans; and 2) the differentiation between various segments of the distal nephron [distal convoluted tubule (DCT), connecting tubule (CNT), and initial collecting duct] is easier to define. Determining the normal mRNA expression pattern in individual nephron segments may aid in the understanding of the renal manifestations of Lowe's syndrome.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
cDNA synthesis and RT-PCR. First-strand cDNA was synthesized
from 1 µg of poly(A)+ RNA
isolated from whole kidney using Superscript II reverse transcriptase (GIBCO-BRL) primed with
oligo(dT)17. One microliter of
cDNA was used as template for each RT-PCR. Unique oligonucleotides were designed based on the previously published human OCRL-1 sequence (2)
and included the following: 2191+, ATTCTCGTCCTTCACCTGGAT; and
2805
, GAGAAGACTAGTGAAGAGAG. Oligonucleotide
numbers were assigned by their 5'-most base according to the
human sequence; plus (+) corresponds to the sense sequence, and minus
(
) corresponds to the antisense sequence. RT-PCR was carried out
in a reaction volume of 50 µl as previously described (12, 13). The
reaction mixture was heated for 3 min at 94°C in a thermal cycler
(Perkin-Elmer), then cooled to 4°C.
Taq DNA polymerase, 2.5 U, was added,
and the mixture was overlaid with mineral oil. Forty cycles of RT-PCR were performed, with each consisting of the following steps:
denaturation for 1 min at 94°C, annealing of oligonucleotides for 1 min at 55°C, and extension for 1.5 min at 72°C. A final
extension was performed at 72°C for 15 min. A reagent control that
contained all the necessary components for RT-PCR but without the
addition of template DNA was negative (data not shown). RT-PCR reaction products were analyzed by agarose-gel electrophoresis in low-melting agarose. The appropriate-sized band was excised and ligated (in gel)
into EcoR V-digested
pBluescript II KS+, and competent
Escherichia coli strain DH5
was
transformed. Maxipreps were generated and then sequenced using the
dideoxynucleotide chain termination method with modified T7 DNA
polymerase (Sequenase, US Biochemical) and 35S-labeled
dATP.
Genomic PCR. Genomic PCR was carried out using the GeneAmp XL PCR kit (Perkin-Elmer). The "hot-start" technique was employed using AmpliWax PCR Gems. Upper and lower reagent mixes were separated by the wax bead, with the oligonucleotides in the lower reagent mix and the template (1 µg of genomic DNA) in the upper reagent mix. The final concentration of reagents in a 100-µl volume was as follows: 1× XL buffer; 1.2 mM Mn(OAc)2; 200 µM each of dATP, dCTP, dGTP, and dTTP; 0.4 µM of each oligonucleotide; and 4 U/100 µl of rTth DNA polymerase XL. Forty cycles of PCR were performed, each consisting of denaturation for 1 min at 94°C, annealing of oligonucleotides at 60°C for 1 min, and extension for 12 min at 72°C.
Northern analysis. Total RNA was isolated from 16 rabbit organs (lung, bladder, brain, eye, heart, kidney, colon, liver,
pancreas, skeletal muscle, small intestine, spleen, stomach, testes,
uterus, and fallopian tube) using the Trizol reagent (GIBCO-BRL) as
described by the manufacturer.
Poly(A)+ RNA was purified from 1 mg of total RNA from each organ using a modification of the one step
method of Hartmann et al. (7). In addition,
poly(A)+ RNA from kidney cortex
and medulla were examined separately. Cortex was dissected to exclude
medulla, and medulla was dissected to exclude cortex. Ten micrograms of
poly(A)+ RNA were size
fractionated in each lane by denaturing agarose-gel electrophoresis and
then transferred to a nylon filter. The rabbit renal OCRL-1 cDNA was
radiolabeled with
[
-32P]dCTP to a
specific activity of 4 × 109
counts · min
1 · µg
1
(cpm/µg) using random primer extension (New England Biolabs). Northern blots were prehybridized overnight in Church-Gilbert solution [0.5 M sodium phosphate (pH 7.2), 1 mM
EDTA, 7% sodium dodecyl sulfate (SDS), and 1% bovine serum
albumin] containing 50% formamide, and 100 µg/ml salmon sperm
DNA at 42°C. 32P-labeled probe,
106 cpm/ml, was added and
hybridized for 24 h. Blots were washed for 30 min in 2× standard
sodium citrate (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate,
pH 7.0) at room temperature, for 30 min in 0.5× SSC with 0.1%
SDS at 60°C, and then exposed to film.
Nephron segment dissection. New
Zealand White rabbits were anesthetized with ketamine (50 mg/kg) and
pentobarbital sodium (50 mg/kg). The kidneys were removed via a flank
incision and chilled in ice-cold dissecting solution (135 mM NaCl, 1 mM
Na2HPO4, 1.5 mM MgSO4, 2 mM
CaCl2, 5 mM KCl, 5 mM glucose, 5 mM
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.4 with NaOH). Ribonuclease-free media, beakers, and instruments were used throughout. One-millimeter transverse slices of
kidney were transferred to a dissection dish that was placed on the
stage of a dissecting microscope fitted with a chilled-water circulator. Sections were transilluminated, and tubules were
dissected by hand using sharpened forceps. Proximal convoluted tubules
(PCT-S2), cortical thick ascending limbs (CTAL), and cortical
collecting ducts (CCD) were dissected from the medullary rays in
the cortex. Late proximal tubule (PCT-S3) was dissected
from the outer stripe of the outer medulla. To dissect the DCT, a
glomerulus with associated thick ascending limb and DCT segment was
isolated first; subsequently, the DCT was harvested. The CNT was
dissected from the arcades in the deep cortex. The medullary thick
ascending limb (MTAL) and the outer medullary collecting duct (OMCD)
were dissected from the outer medulla. Two glomeruli or a total of 1 mm
of each tubular segment was adsorbed to a glass bead, placed in 10 µl of lysis solution (2% Triton X-100, 5 mM dithiothreitol, and 2.2 U/µl RNasin), and frozen at
70°C for later use in isolated
nephron-segment RT-PCR as described below.
Isolated nephron-segment RT-PCR. Oligonucleotide pairs that
span an intron/exon boundary were used so that the amplification of
cDNA and genomic DNA templates could be differentiated based on the
size of the amplified product. Although the complete genomic organization of the OCRL-1 gene has not been published in any species,
it is known that in the mouse genome the nucleotide sequence between
2686 and 2797 represents a single exon (9), and in a mutational
analysis study of Lowe's syndrome patients, one individual was found
to have a 112-bp deletion that corresponded to the mouse exon. This
deletion was thought to result from a splicing error (9). Therefore, we
selected this region of the cDNA for amplification. The antisense
oligonucleotide (2781
) was located within the segment deleted in
the patient described above, and the sense oligonucleotide (2342+) was
located 5' of this exon.
RT-PCR was carried out using the rTth
RNA PCR kit (Perkin-Elmer). rTth is a
thermostable DNA polymerase that possesses both reverse transcriptase
and DNA polymerase activity, thereby allowing reverse transcription and
subsequent amplification to be carried out in the same tube. The enzyme
efficiently transcribes RNA in the presence of
MnCl2 at elevated temperatures,
and PCR amplification is performed by chelating the
Mn2+ and adding
MgCl2. For reverse transcription,
the final concentration of reagents in a 20-µl volume was as follows:
1× reverse transcription buffer; 1.0 mM
MnCl2; 200 µM each of dATP,
dCTP, dGTP, and dTTP; 0.75 µM of a sequence-specific antisense
oligonucleotide (2781
, GATCATGTTGGCGCTGACGTTGTTGTAT); and 5 U/20
µl of rTth DNA polymerase. The
mixture was overlaid with 100 µl of mineral oil and incubated at
70°C for 15 min. The reverse transcription reaction was stopped by
placing the tubes on ice. Additional reagents required for PCR
[chelating buffer, MgCl2,
and sense oligonucleotide (2342+, AGAAATCCCTTCTGCAGATGGYCCCCTT)]
were assembled as a master mix, and a volume of 80 µl was added to
each tube. The final concentration for each of these components
in a 100-µl volume was 0.8× chelating buffer, 2.5 mM
MgCl2, and 0.15 µM sense
oligonucleotide. Forty cycles of two-step PCR were
performed, each consisting of denaturation for 1 min at 94°C
and annealing and extension of oligonucleotides for 1 min at 60°C.
Southern analysis of isolated nephron-segment and genomic
PCR. PCR reactions were size fractionated by agarose-gel
electrophoresis, transferred to a nylon filter, and fixed by
ultraviolet transillumination. An internal sequence-specific
oligonucleotide (2625
, ATAGAGCTCGTAACAGATGACAGGC) was
radiolabeled with
[
-32P]dATP using T4
polynucleotide kinase. Filters were prehybridized for 24 h in
Church-Gilbert solution at 55°C, then hybridized for 24 h at 55°C in the same medium that contained 100 µg/ml
denatured salmon sperm DNA, with
106 cpm/ml
32P-labeled probe. Filters were
washed 5 min in 2× SSC at room temperature, 5 min in 1× SSC
that contained 0.1% SDS at 60°C, and exposed to film.
Materials. Solutions for use with RNA were treated with
diethyl pyrocarbonate and autoclaved prior to use. Restriction
endonucleases and DNA size standards were obtained from New England
Biolabs. 32P-labeled nucleotides
were from Amersham. Competent E. coli
(strain DH5
) were purchased from GIBCO-BRL.
| |
RESULTS |
|---|
|
|
|---|
We designed two unique oligonucleotides to amplify a cDNA from rabbit kidney between nucleotides 2191 and 2805. RT-PCR of whole kidney cDNA was carried out, and a cDNA of the expected size was amplified (shown in Fig. 1A), subcloned, and sequenced. A comparison of the deduced amino acid sequence of the rabbit cDNA to human is shown in Fig. 2. The DNA sequence is 92% identical, and the deduced amino acid sequence is 97% identical to human OCRL-1.
|
|
Using this rabbit sequence information, we designed two
oligonucleotides for use in isolated nephron-segment RT-PCR, 2432+ and
2781
. To verify that these primers crossed an intron/exon boundary in rabbit, PCR was carried out using genomic DNA as template. Agarose-gel electrophoresis and ethidium bromide staining showed a
single amplified product ~4 kb in size (Fig.
1B). Southern analysis using a
sequence-specific internal oligonucleotide (2625
) showed specific hybridization only to the 4-kb product (Fig.
1C), indicating that the
oligonucleotide pair spanned at least one intron, and a total of ~3.6
kb of intron sequence.
Organ Northern analysis was carried out to determine whether the tissue distribution of OCRL-1 expression is similar in rabbit and human. Northern blots were probed with the rabbit kidney cDNA at high stringency. A 5.4-kb transcript was detected in all organs examined (shown in Fig. 3, A and B). This was slightly smaller than the 5.8-kb transcript reported in human. Expression was detected in brain, skeletal muscle, heart, kidney, and lung as previously described in humans. Expression was also detected in 11 tissues not previously reported, including eye, bladder, testis, uterus, fallopian tube, stomach, small intestine, colon, liver, pancreas, and spleen.
|
To potentially limit the nephron segments we would need to examine using isolated nephron-segment RT-PCR, we next examined OCRL-1 expression separately in cortex and medulla. A Northern blot was probed at high stringency with the rabbit kidney cDNA. A single 5.4-kb transcript was detected in both regions (shown in Fig. 3C).
RT-PCR was performed on glomeruli and isolated tubular segments from
both cortex and medulla. Products were size fractionated by agarose-gel
electrophoresis and detected by ethidium bromide staining (Fig.
4). In all RT-PCR reactions performed, the
lysis buffer control (no added template) was negative by both ethidium bromide staining and Southern analysis (data not shown). In Fig. 4, an
ethidium bromide-stained band of the expected size is evident in all
segments studied (glomerulus, PCT-S2, PCT-S3, MTAL, CTAL, DCT, CNT,
CCD, and OMCD). For each nephron segment, a total of three to six
RT-PCR reactions were conducted. By Southern analysis (oligonucleotide
2625
), a cDNA of expected size was detected in 3/3 glomeruli,
3/3 PCT-S2s, 3/3 PCT-S3s, 6/6 MTALs, 3/6 CTALs, 3/3 DCTs, 3/3 CNTs, 3/3
CCDs, and 5/6 OMCDs. Quantitative conclusions regarding the relative
expression of OCRL-1 in various tubular segments cannot be drawn from
these data.
|
| |
DISCUSSION |
|---|
|
|
|---|
Although the major clinical manifestations of Lowe's syndrome involve the eye, nervous system, and kidney, OCRL-1 expression is not restricted to these organs. Using Northern analysis in human, Attree et al. (2) demonstrated a 5.8-kb transcript in brain, skeletal muscle, heart, kidney, lung, and placenta. Similarly, in rabbit we have shown that a 5.4-kb transcript is expressed in all 16 tissues examined, including several that were not reported in humans: eye, bladder, testis, uterus, fallopian tube, stomach, small intestine, colon, liver, pancreas, and spleen. Many of these organs are not known to be clinically affected in Lowe's syndrome. Two potential explanations for this observation are 1) subclinical involvement of additional organ systems in Lowe's syndrome may require more rigorous clinical testing or 2) the degree of organ dysfunction may be affected by the expression of other proteins that perform similar functions in seemingly unaffected tissues, thereby protecting them from overt clinical manifestations.
In kidney, a 5.4-kb transcript was detected in both cortex and medulla. Agarose-gel electrophoresis with ethidium bromide staining and Southern analysis of isolated nephron-segment RT-PCR products detected expression in all segments studied (glomerulus, PCT-S2, PCT-S3, MTAL, CTAL, DCT, CNT, CCD, and OMCD). This pattern of expression in kidney may help explain several of the renal manifestations of Lowe's syndrome.
The expression of OCRL-1 in the glomerulus may have pathogenetic significance. A number of glomerular histological changes have been described in OCRL patients, and a progressive decline in glomerular filtration rate is a typical feature of this syndrome. The detection of OCRL-1 transcript by RT-PCR in normal rabbit glomerulus raises the possibility that abnormal expression of OCRL-1 may be directly responsible for the decline in glomerular filtration. It is important to note, however, that expression of OCRL-1 in the glomerulus does not rule out the possibility that tubulointerstitial disease may result in a secondary glomerular lesion.
Proximal tubular dysfunction is the most frequently described renal abnormality in Lowe's syndrome. Although not characteristic of a true Fanconi's syndrome, the proximal tubular lesion is a prominent feature of Lowe's syndrome and likely contributes to the systemic acidosis. As expected, isolated nephron-segment RT-PCR confirmed that OCRL-1 is expressed in both the S2 and S3 segments of the proximal tubule.
The expression of OCRL-1 in the MTAL may also have pathogenetic significance. This segment of the nephron plays an important role in establishing the corticomedullary osmolar gradient, and its dysfunction could lead to a urinary concentrating defect. Although formal testing of urinary concentrating ability in patients with Lowe's syndrome has not been reported, the study by Charnas et al. (4) of 23 patients with Lowe's syndrome showed increased urine volume and decreased urine osmolality in nearly all patients.
OCRL-1 expression in distal nephron may explain the urinary acidification defect originally described by Lowe et al. (10). This defect has generally been underappreciated in Lowe's syndrome and may contribute to the systemic acidosis. Nephrocalcinosis, also a feature of OCRL (16), is characteristic of distal renal tubular acidosis and is not seen in Fanconi's syndrome. At least three different distal tubular abnormalities could act alone or in combination to produce the urinary acidification defect; i.e., diminished generation of intraluminal negativity, increased proton backleak, and decreased vacuolar H+-adenosinetriphosphatase (H+-ATPase) activity. The biosynthetic and endocytic pathways play an important role in the normal regulation of vacuolar H+-ATPase, and OCRL-1 has recently been postulated to play a part in normal vesicular trafficking (5, 17). The preferred substrate of OCRL-1 is phosphatidylinositol 4,5-bisphosphate (PIP2) (18), which acts in concert with ADP-ribosylation factor, a monomeric GTPase, as a regulator of the biosynthetic pathway (3, 5, 6, 8). In addition, immunofluorescence studies in fibroblasts localize the OCRL-1 protein to the Golgi (17). Both the role of PIP2 in vesicular trafficking and the localization of the OCRL-1 protein to the Golgi are suggestive that a disruption of H+-ATPase activity might be responsible for the abnormality in distal tubular acidification.
In summary, we have shown that OCRL-1 is expressed throughout the nephron, i.e., in the glomerulus, the proximal tubule, MTAL, and the distal nephron. Defective OCRL-1 expression in these regions may play a pathogenetic role in the progressive loss of glomerular function, the Fanconi-like syndrome, as well as the concentrating and acidification defects seen in this disorder.
| |
ACKNOWLEDGEMENTS |
|---|
This research was supported by a grant-in-aid from the American Heart Association. R. F. Reilly is a recipient of a Department of Veterans Affairs Research Associate Career Award.
| |
FOOTNOTES |
|---|
Address for reprint requests: R. F. Reilly, Section of Nephrology, University of Colorado Health Science Center, 4200 E. Ninth Ave., Denver, CO 80262.
Received 24 October 1996; accepted in final form 10 July 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abbassi, V.,
C. U. Lowe,
and
P. L. Calcagno.
Oculo-cerebro-renal syndrome.
Am. J. Dis. Child.
115:
145-168,
1968[Medline].
2.
Attree, O.,
I. M. Olivos,
I. Okabe,
L. C. Bailey,
D. L. Nelson,
R. A. Lewis,
R. R. McInnes,
and
R. L. Nussbaum.
The Lowe's oculocerebrorenal syndrome gene encodes a protein highly homologous to inositol polyphosphate-5-phosphatase.
Nature
358:
239-242,
1992[Medline].
3.
Brown, H. A.,
S. Gutowski,
C. R. Moomaw,
C. Slaughter,
and
P. C. Sternweis.
ADP-ribosylation factor, a small GTP-dependent regulatory protein stimulates phospholipase D activity.
Cell
75:
1137-1144,
1993[Medline].
4.
Charnas, L. R.,
I. Bernardini,
D. Rader,
J. M. Hoeg,
and
W. A. Gaul.
Clinical and laboratory findings in the oculocerebrorenal syndrome of Lowe, with special reference to growth and renal function.
N. Engl. J. Med.
324:
1318-1325,
1991[Abstract].
5.
De Camilli, P.,
S. D. Emr,
P. S. McPherson,
and
P. Novick.
Phosphoinositides as regulators in membrane traffic.
Science
271:
1533-1539,
1996[Abstract].
6.
Donaldson, J. G.,
D. Cassel,
R. A. Kahn,
and
R. D. Klausner.
ADP-ribosylation factor, a small GTP-binding protein, is required for binding of the coatomer protein
-COP to Golgi membranes.
Proc. Natl. Acad. Sci. USA
89:
6408-6412,
1992
7.
Hartmann, K. P.,
V. Papa,
E. J. Brown,
U. Doerries,
S. M. Rosenthal,
and
I. D. Goldfine.
A rapid and simple one step method for isolation of poly(A)+ RNA from cells in monolayer.
Endocrinology
127:
2038-2040,
1990[Abstract].
8.
Kahn, R. A.,
J. K. Yucel,
and
V. Malhotra.
ARF signaling: a potential role for phospholipase D in membrane traffic.
Cell
75:
1045-1048,
1993[Medline].
9.
Leahey, A.-M.,
L. R. Charnas,
and
R. L. Nussbaum.
Nonsense mutations in the OCRL-1 gene in patients with the oculocerebrorenal syndrome of Lowe.
Hum. Mol. Genet.
2:
461-463,
1993
10.
Lowe, C. U.,
M. Terrey,
and
E. A. MacLachlan.
Organic-aciduria, decreased renal ammonia production, hydrophthalmos, and mental retardation.
Am. J. Dis. Child.
83:
164-184,
1952.
11.
Okabe, I.,
O. Attree,
L. C. Bailey,
D. L. Nelson,
and
R. L. Nussbaum.
Isolation of cDNA sequences around the chromosomal breakpoint in a female with Lowe syndrome by direct screening of cDNA libraries with yeast artificial chromosomes.
J. Inherit. Metab. Dis.
15:
526-531,
1992[Medline].
12.
Reilly, R. F.,
F. Hildebrandt,
D. Biemesderfer,
C. Sardet,
J. Pouysségur,
P. S. Aronson,
C. W. Slayman,
and
P. Igarashi.
cDNA cloning and immunolocalization of a Na/H exchanger in renal epithelial cells (LLC-PK1).
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F1088-F1094,
1991
13.
Reilly, R. F.,
and
C. A. Shugrue.
cDNA cloning of a renal Na+/Ca2+ exchanger.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F1105-F1109,
1992
14.
Rutsaert, J.,
A. Segers-Cadranel,
and
P. Potvliege.
Lowe's syndrome: pathologic studies of four cases.
Pathol. Eur.
7:
249-262,
1972[Medline].
15.
Schoen, E. J.
Lowe's syndrome: abnormalities in renal tubular function in combination with other congenital defects.
Am. J. Med.
27:
781-792,
1959.
16.
Sliman, G. A.,
W. D. Winters,
D. W. Shaw,
and
E. D. Avner.
Hypercalciuria and nephrocalcinosis in the oculocerebrorenal syndrome.
J. Urol.
153:
1244-1246,
1995[Medline].
17.
Suchy, S. F.,
I. M. Olivos-Glander,
and
R. L. Nussbaum.
Lowe syndrome, a deficiency of a phosphatidylinositol 4,5-bisphosphate 5-phosphatase in the Golgi apparatus.
Hum. Mol. Genet.
4:
2245-2250,
1995
18.
Zhang, X.,
A. B. Jefferson,
V. Auethavekiat,
and
P. W. Majerus.
The protein deficient in Lowe syndrome is a phosphatidylinositol-4,5-bisphosphate 5-phosphatase.
Proc. Natl. Acad. Sci. USA
92:
4853-4856,
1995
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |