AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F790-F795, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erb, B. C.
Right arrow Articles by Reilly, R. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Erb, B. C.
Right arrow Articles by Reilly, R. F.
Vol. 273, Issue 5, F790-F795, November 1997

cDNA cloning and localization of OCRL-1 in rabbit kidney

Brian C. Erb, Heino Velázquez, Monique Gisser, Christine A. Shugrue, and Robert F. Reilly

Department of Medicine, Yale University School of Medicine, New Haven 06520-8047; and Department of Veterans Affairs Medical Center, West Haven, Connecticut 06516

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The oculocerebrorenal syndrome of Lowe (OCRL) is a hereditary multisystem disorder characterized by congenital cataracts, mental retardation, renal tubular dysfunction, and progressive renal insufficiency. Tubular abnormalities include proximal tubular dysfunction, a distal acidification defect, and a possible impairment of urinary concentrating ability. The most important renal manifestation of Lowe's syndrome is a progressive loss of kidney function associated with a glomerular lesion that progresses to end-stage renal disease in either the third or fourth decade. The gene responsible for Lowe's syndrome, OCRL-1, was recently identified by positional cloning, and mutations were demonstrated in many affected patients. In the present study reverse transcription-polymerase chain reaction (RT-PCR) was used to clone a partial-length cDNA encoding rabbit renal OCRL-1. There is a high degree of similarity between rabbit and human sequences, with nucleotide and amino acid identities of 92% and 97%, respectively. Northern analysis identified a 5.4-kb transcript that is expressed in both rabbit kidney cortex and medulla. Isolated nephron-segment RT-PCR showed that OCRL-1 is expressed in all segments studied: the glomerulus, proximal tubule, medullary and cortical thick ascending limb, distal convoluted tubule, connecting tubule, cortical collecting duct, and outer medullary collecting duct. Defective OCRL-1 expression in these regions may play a pathogenetic role in the renal manifestations of this syndrome.

Lowe's syndrome; Fanconi's syndrome; inositol polyphosphate-5-phosphatase; nephron segment reverse transcription-polymerase chain reaction

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE OCULOCEREBRORENAL SYNDROME of Lowe (OCRL), also known as Lowe's syndrome, is an X-linked recessive multisystem disorder manifested clinically by congenital cataracts, mental retardation, renal tubular dysfunction, and progressive renal insufficiency (10). The syndrome was first described by Lowe et al. in 1952. Since that time, ~150 cases have been reported. Recently, the gene responsible for Lowe's syndrome (OCRL-1) was identified by positional cloning, and it encodes a protein that is 71% similar to the human 75-kDa inositol polyphosphate-5-phosphatase (2, 11). Support for an etiologic role of OCRL-1 in Lowe's syndrome comes from Northern and mutational analysis of affected patients (2, 9). The protein has been localized to the Golgi apparatus (17).

Renal involvement in Lowe's syndrome is manifested initially by tubular dysfunction that is present either at birth or develops in the first year, and it is characterized by aminoaciduria, phosphaturia, organic aciduria, and systemic acidosis. Although the urinary abnormalities in Lowe's syndrome are similar to those described in classic Fanconi's syndrome (a syndrome with generalized proximal tubule dysfunction), significant differences exist. First, OCRL patients do not have glucosuria as a prominent feature. Second, they have a lesser degree of amino aciduria (expressed as a percentage of total organic acids excreted). Third, they are unable to maximally acidify the urine in response to ammonium chloride loading (4, 10). In addition to the tubular dysfunction, a progressive loss of renal function is typical with the predicted development of end-stage renal disease by the fourth decade (4).

Pathological changes in the kidney, based on autopsy and biopsy data, appear to be age dependent and can be divided into three groups (1). Patients from birth to 3 mo of age usually show no evidence of renal pathology. Between 3 mo and 5 yr there is evidence of diffuse tubular changes with little or no glomerular pathology. Tubular abnormalities range from mild (dilation of the mitochondria and disruption of the cristae seen only on electron microscopic observation; see Ref. 15) to severe (diffusely dilated tubules with atrophy of the tubular epithelium, most of which are filled with proteinaceous casts; see Ref. 14). Distal nephron Ca2+ deposition may also occur. In more advanced stages of the disease, usually in patients over the age of 5-6 yr, the glomeruli may be fibrosed, hyalinized, or diffusely hypercellular with basement membrane thickening and foot process fusion. There is also multifocal tubular atrophy, basement membrane thickening, and interstitial fibrosis. The pathophysiology of the advanced glomerular and tubular changes is unclear.

Defective OCRL-1 expression leads, through unknown mechanisms, to a unique pattern of renal dysfunction and the other clinical manifestations of Lowe's syndrome. In human, OCRL-1 is normally expressed in kidney and brain, in addition to other organs not known to be affected in this syndrome (2). The expression of OCRL-1 mRNA in specific nephron segments has not been reported. To address these issues, we cloned a partial-length cDNA encoding rabbit renal OCRL-1. We then conducted isolated nephron-segment reverse transcription-polymerase chain reaction (RT-PCR) in rabbit. We chose to work in rabbit for the following two reasons: 1) the difficulty in performing isolated nephron-segment RT-PCR in humans; and 2) the differentiation between various segments of the distal nephron [distal convoluted tubule (DCT), connecting tubule (CNT), and initial collecting duct] is easier to define. Determining the normal mRNA expression pattern in individual nephron segments may aid in the understanding of the renal manifestations of Lowe's syndrome.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

cDNA synthesis and RT-PCR. First-strand cDNA was synthesized from 1 µg of poly(A)+ RNA isolated from whole kidney using Superscript II reverse transcriptase (GIBCO-BRL) primed with oligo(dT)17. One microliter of cDNA was used as template for each RT-PCR. Unique oligonucleotides were designed based on the previously published human OCRL-1 sequence (2) and included the following: 2191+, ATTCTCGTCCTTCACCTGGAT; and 2805-, GAGAAGACTAGTGAAGAGAG. Oligonucleotide numbers were assigned by their 5'-most base according to the human sequence; plus (+) corresponds to the sense sequence, and minus (-) corresponds to the antisense sequence. RT-PCR was carried out in a reaction volume of 50 µl as previously described (12, 13). The reaction mixture was heated for 3 min at 94°C in a thermal cycler (Perkin-Elmer), then cooled to 4°C. Taq DNA polymerase, 2.5 U, was added, and the mixture was overlaid with mineral oil. Forty cycles of RT-PCR were performed, with each consisting of the following steps: denaturation for 1 min at 94°C, annealing of oligonucleotides for 1 min at 55°C, and extension for 1.5 min at 72°C. A final extension was performed at 72°C for 15 min. A reagent control that contained all the necessary components for RT-PCR but without the addition of template DNA was negative (data not shown). RT-PCR reaction products were analyzed by agarose-gel electrophoresis in low-melting agarose. The appropriate-sized band was excised and ligated (in gel) into EcoR V-digested pBluescript II KS+, and competent Escherichia coli strain DH5alpha was transformed. Maxipreps were generated and then sequenced using the dideoxynucleotide chain termination method with modified T7 DNA polymerase (Sequenase, US Biochemical) and 35S-labeled dATP.

Genomic PCR. Genomic PCR was carried out using the GeneAmp XL PCR kit (Perkin-Elmer). The "hot-start" technique was employed using AmpliWax PCR Gems. Upper and lower reagent mixes were separated by the wax bead, with the oligonucleotides in the lower reagent mix and the template (1 µg of genomic DNA) in the upper reagent mix. The final concentration of reagents in a 100-µl volume was as follows: 1× XL buffer; 1.2 mM Mn(OAc)2; 200 µM each of dATP, dCTP, dGTP, and dTTP; 0.4 µM of each oligonucleotide; and 4 U/100 µl of rTth DNA polymerase XL. Forty cycles of PCR were performed, each consisting of denaturation for 1 min at 94°C, annealing of oligonucleotides at 60°C for 1 min, and extension for 12 min at 72°C.

Northern analysis. Total RNA was isolated from 16 rabbit organs (lung, bladder, brain, eye, heart, kidney, colon, liver, pancreas, skeletal muscle, small intestine, spleen, stomach, testes, uterus, and fallopian tube) using the Trizol reagent (GIBCO-BRL) as described by the manufacturer. Poly(A)+ RNA was purified from 1 mg of total RNA from each organ using a modification of the one step method of Hartmann et al. (7). In addition, poly(A)+ RNA from kidney cortex and medulla were examined separately. Cortex was dissected to exclude medulla, and medulla was dissected to exclude cortex. Ten micrograms of poly(A)+ RNA were size fractionated in each lane by denaturing agarose-gel electrophoresis and then transferred to a nylon filter. The rabbit renal OCRL-1 cDNA was radiolabeled with [alpha -32P]dCTP to a specific activity of 4 × 109 counts · min-1 · µg-1 (cpm/µg) using random primer extension (New England Biolabs). Northern blots were prehybridized overnight in Church-Gilbert solution [0.5 M sodium phosphate (pH 7.2), 1 mM EDTA, 7% sodium dodecyl sulfate (SDS), and 1% bovine serum albumin] containing 50% formamide, and 100 µg/ml salmon sperm DNA at 42°C. 32P-labeled probe, 106 cpm/ml, was added and hybridized for 24 h. Blots were washed for 30 min in 2× standard sodium citrate (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0) at room temperature, for 30 min in 0.5× SSC with 0.1% SDS at 60°C, and then exposed to film.

Nephron segment dissection. New Zealand White rabbits were anesthetized with ketamine (50 mg/kg) and pentobarbital sodium (50 mg/kg). The kidneys were removed via a flank incision and chilled in ice-cold dissecting solution (135 mM NaCl, 1 mM Na2HPO4, 1.5 mM MgSO4, 2 mM CaCl2, 5 mM KCl, 5 mM glucose, 5 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.4 with NaOH). Ribonuclease-free media, beakers, and instruments were used throughout. One-millimeter transverse slices of kidney were transferred to a dissection dish that was placed on the stage of a dissecting microscope fitted with a chilled-water circulator. Sections were transilluminated, and tubules were dissected by hand using sharpened forceps. Proximal convoluted tubules (PCT-S2), cortical thick ascending limbs (CTAL), and cortical collecting ducts (CCD) were dissected from the medullary rays in the cortex. Late proximal tubule (PCT-S3) was dissected from the outer stripe of the outer medulla. To dissect the DCT, a glomerulus with associated thick ascending limb and DCT segment was isolated first; subsequently, the DCT was harvested. The CNT was dissected from the arcades in the deep cortex. The medullary thick ascending limb (MTAL) and the outer medullary collecting duct (OMCD) were dissected from the outer medulla. Two glomeruli or a total of 1 mm of each tubular segment was adsorbed to a glass bead, placed in 10 µl of lysis solution (2% Triton X-100, 5 mM dithiothreitol, and 2.2 U/µl RNasin), and frozen at -70°C for later use in isolated nephron-segment RT-PCR as described below.

Isolated nephron-segment RT-PCR. Oligonucleotide pairs that span an intron/exon boundary were used so that the amplification of cDNA and genomic DNA templates could be differentiated based on the size of the amplified product. Although the complete genomic organization of the OCRL-1 gene has not been published in any species, it is known that in the mouse genome the nucleotide sequence between 2686 and 2797 represents a single exon (9), and in a mutational analysis study of Lowe's syndrome patients, one individual was found to have a 112-bp deletion that corresponded to the mouse exon. This deletion was thought to result from a splicing error (9). Therefore, we selected this region of the cDNA for amplification. The antisense oligonucleotide (2781-) was located within the segment deleted in the patient described above, and the sense oligonucleotide (2342+) was located 5' of this exon.

RT-PCR was carried out using the rTth RNA PCR kit (Perkin-Elmer). rTth is a thermostable DNA polymerase that possesses both reverse transcriptase and DNA polymerase activity, thereby allowing reverse transcription and subsequent amplification to be carried out in the same tube. The enzyme efficiently transcribes RNA in the presence of MnCl2 at elevated temperatures, and PCR amplification is performed by chelating the Mn2+ and adding MgCl2. For reverse transcription, the final concentration of reagents in a 20-µl volume was as follows: 1× reverse transcription buffer; 1.0 mM MnCl2; 200 µM each of dATP, dCTP, dGTP, and dTTP; 0.75 µM of a sequence-specific antisense oligonucleotide (2781-, GATCATGTTGGCGCTGACGTTGTTGTAT); and 5 U/20 µl of rTth DNA polymerase. The mixture was overlaid with 100 µl of mineral oil and incubated at 70°C for 15 min. The reverse transcription reaction was stopped by placing the tubes on ice. Additional reagents required for PCR [chelating buffer, MgCl2, and sense oligonucleotide (2342+, AGAAATCCCTTCTGCAGATGGYCCCCTT)] were assembled as a master mix, and a volume of 80 µl was added to each tube. The final concentration for each of these components in a 100-µl volume was 0.8× chelating buffer, 2.5 mM MgCl2, and 0.15 µM sense oligonucleotide. Forty cycles of two-step PCR were performed, each consisting of denaturation for 1 min at 94°C and annealing and extension of oligonucleotides for 1 min at 60°C.

Southern analysis of isolated nephron-segment and genomic PCR. PCR reactions were size fractionated by agarose-gel electrophoresis, transferred to a nylon filter, and fixed by ultraviolet transillumination. An internal sequence-specific oligonucleotide (2625-, ATAGAGCTCGTAACAGATGACAGGC) was radiolabeled with [gamma -32P]dATP using T4 polynucleotide kinase. Filters were prehybridized for 24 h in Church-Gilbert solution at 55°C, then hybridized for 24 h at 55°C in the same medium that contained 100 µg/ml denatured salmon sperm DNA, with 106 cpm/ml 32P-labeled probe. Filters were washed 5 min in 2× SSC at room temperature, 5 min in 1× SSC that contained 0.1% SDS at 60°C, and exposed to film.

Materials. Solutions for use with RNA were treated with diethyl pyrocarbonate and autoclaved prior to use. Restriction endonucleases and DNA size standards were obtained from New England Biolabs. 32P-labeled nucleotides were from Amersham. Competent E. coli (strain DH5alpha ) were purchased from GIBCO-BRL.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We designed two unique oligonucleotides to amplify a cDNA from rabbit kidney between nucleotides 2191 and 2805. RT-PCR of whole kidney cDNA was carried out, and a cDNA of the expected size was amplified (shown in Fig. 1A), subcloned, and sequenced. A comparison of the deduced amino acid sequence of the rabbit cDNA to human is shown in Fig. 2. The DNA sequence is 92% identical, and the deduced amino acid sequence is 97% identical to human OCRL-1.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Polymerase chain reaction (PCR) of rabbit OCRL-1, the gene responsible for the oculocerebrorenal syndrome of Lowe. A: reverse transcription (RT)-PCR with oligonucleotides 2191+ and 2805- (DNA size markers are shown left). Amplified cDNA is indicated by the arrowhead. B: genomic PCR with oligonucleotides 2342+ and 2781-. Amplified product is indicated by the arrowhead. C: Southern analysis of genomic PCR depicted in B. Hybridizing product is indicated by the arrowhead.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Alignment of deduced amino acid sequences of human and rabbit OCRL-1. Amino acid residues are represented by their single letter codes and are numbered to the right. Amino acids that are identical are enclosed by boxes.

Using this rabbit sequence information, we designed two oligonucleotides for use in isolated nephron-segment RT-PCR, 2432+ and 2781-. To verify that these primers crossed an intron/exon boundary in rabbit, PCR was carried out using genomic DNA as template. Agarose-gel electrophoresis and ethidium bromide staining showed a single amplified product ~4 kb in size (Fig. 1B). Southern analysis using a sequence-specific internal oligonucleotide (2625-) showed specific hybridization only to the 4-kb product (Fig. 1C), indicating that the oligonucleotide pair spanned at least one intron, and a total of ~3.6 kb of intron sequence.

Organ Northern analysis was carried out to determine whether the tissue distribution of OCRL-1 expression is similar in rabbit and human. Northern blots were probed with the rabbit kidney cDNA at high stringency. A 5.4-kb transcript was detected in all organs examined (shown in Fig. 3, A and B). This was slightly smaller than the 5.8-kb transcript reported in human. Expression was detected in brain, skeletal muscle, heart, kidney, and lung as previously described in humans. Expression was also detected in 11 tissues not previously reported, including eye, bladder, testis, uterus, fallopian tube, stomach, small intestine, colon, liver, pancreas, and spleen.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 3.   Northern blot hybridization of rabbit RNA. In A and B, poly(A)+ RNA from 16 different rabbit organs was analyzed by Northern blot hybridization as described under MATERIALS AND METHODS. Positions of 28S and 18S ribosomal RNA are shown on left. In C, poly(A)+ RNA from kidney cortex and medulla were analyzed.

To potentially limit the nephron segments we would need to examine using isolated nephron-segment RT-PCR, we next examined OCRL-1 expression separately in cortex and medulla. A Northern blot was probed at high stringency with the rabbit kidney cDNA. A single 5.4-kb transcript was detected in both regions (shown in Fig. 3C).

RT-PCR was performed on glomeruli and isolated tubular segments from both cortex and medulla. Products were size fractionated by agarose-gel electrophoresis and detected by ethidium bromide staining (Fig. 4). In all RT-PCR reactions performed, the lysis buffer control (no added template) was negative by both ethidium bromide staining and Southern analysis (data not shown). In Fig. 4, an ethidium bromide-stained band of the expected size is evident in all segments studied (glomerulus, PCT-S2, PCT-S3, MTAL, CTAL, DCT, CNT, CCD, and OMCD). For each nephron segment, a total of three to six RT-PCR reactions were conducted. By Southern analysis (oligonucleotide 2625-), a cDNA of expected size was detected in 3/3 glomeruli, 3/3 PCT-S2s, 3/3 PCT-S3s, 6/6 MTALs, 3/6 CTALs, 3/3 DCTs, 3/3 CNTs, 3/3 CCDs, and 5/6 OMCDs. Quantitative conclusions regarding the relative expression of OCRL-1 in various tubular segments cannot be drawn from these data.


View larger version (101K):
[in this window]
[in a new window]
 
Fig. 4.   Agarose-gel electrophoresis and ethidium bromide staining of isolated dissected RT-PCR of glomeruli and tubular segments. RT-PCR was carried out as described in MATERIALS AND METHODS, and samples were electrophoresed on agarose gels and ethidium bromide stained. The top four DNA size markers shown in the first lane are the following sizes (from top to bottom): 622 bp, 527 bp, 404 bp, and 307 bp. PCT, proximal convoluted tubule; MTAL and CTAL, medullary and cortical thick ascending limb, respectively; DCT, distal convoluted tubule; CNT, connecting tubule; CCD, cortical collecting duct; and OMCD, outer medullary collecting duct.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Although the major clinical manifestations of Lowe's syndrome involve the eye, nervous system, and kidney, OCRL-1 expression is not restricted to these organs. Using Northern analysis in human, Attree et al. (2) demonstrated a 5.8-kb transcript in brain, skeletal muscle, heart, kidney, lung, and placenta. Similarly, in rabbit we have shown that a 5.4-kb transcript is expressed in all 16 tissues examined, including several that were not reported in humans: eye, bladder, testis, uterus, fallopian tube, stomach, small intestine, colon, liver, pancreas, and spleen. Many of these organs are not known to be clinically affected in Lowe's syndrome. Two potential explanations for this observation are 1) subclinical involvement of additional organ systems in Lowe's syndrome may require more rigorous clinical testing or 2) the degree of organ dysfunction may be affected by the expression of other proteins that perform similar functions in seemingly unaffected tissues, thereby protecting them from overt clinical manifestations.

In kidney, a 5.4-kb transcript was detected in both cortex and medulla. Agarose-gel electrophoresis with ethidium bromide staining and Southern analysis of isolated nephron-segment RT-PCR products detected expression in all segments studied (glomerulus, PCT-S2, PCT-S3, MTAL, CTAL, DCT, CNT, CCD, and OMCD). This pattern of expression in kidney may help explain several of the renal manifestations of Lowe's syndrome.

The expression of OCRL-1 in the glomerulus may have pathogenetic significance. A number of glomerular histological changes have been described in OCRL patients, and a progressive decline in glomerular filtration rate is a typical feature of this syndrome. The detection of OCRL-1 transcript by RT-PCR in normal rabbit glomerulus raises the possibility that abnormal expression of OCRL-1 may be directly responsible for the decline in glomerular filtration. It is important to note, however, that expression of OCRL-1 in the glomerulus does not rule out the possibility that tubulointerstitial disease may result in a secondary glomerular lesion.

Proximal tubular dysfunction is the most frequently described renal abnormality in Lowe's syndrome. Although not characteristic of a true Fanconi's syndrome, the proximal tubular lesion is a prominent feature of Lowe's syndrome and likely contributes to the systemic acidosis. As expected, isolated nephron-segment RT-PCR confirmed that OCRL-1 is expressed in both the S2 and S3 segments of the proximal tubule.

The expression of OCRL-1 in the MTAL may also have pathogenetic significance. This segment of the nephron plays an important role in establishing the corticomedullary osmolar gradient, and its dysfunction could lead to a urinary concentrating defect. Although formal testing of urinary concentrating ability in patients with Lowe's syndrome has not been reported, the study by Charnas et al. (4) of 23 patients with Lowe's syndrome showed increased urine volume and decreased urine osmolality in nearly all patients.

OCRL-1 expression in distal nephron may explain the urinary acidification defect originally described by Lowe et al. (10). This defect has generally been underappreciated in Lowe's syndrome and may contribute to the systemic acidosis. Nephrocalcinosis, also a feature of OCRL (16), is characteristic of distal renal tubular acidosis and is not seen in Fanconi's syndrome. At least three different distal tubular abnormalities could act alone or in combination to produce the urinary acidification defect; i.e., diminished generation of intraluminal negativity, increased proton backleak, and decreased vacuolar H+-adenosinetriphosphatase (H+-ATPase) activity. The biosynthetic and endocytic pathways play an important role in the normal regulation of vacuolar H+-ATPase, and OCRL-1 has recently been postulated to play a part in normal vesicular trafficking (5, 17). The preferred substrate of OCRL-1 is phosphatidylinositol 4,5-bisphosphate (PIP2) (18), which acts in concert with ADP-ribosylation factor, a monomeric GTPase, as a regulator of the biosynthetic pathway (3, 5, 6, 8). In addition, immunofluorescence studies in fibroblasts localize the OCRL-1 protein to the Golgi (17). Both the role of PIP2 in vesicular trafficking and the localization of the OCRL-1 protein to the Golgi are suggestive that a disruption of H+-ATPase activity might be responsible for the abnormality in distal tubular acidification.

In summary, we have shown that OCRL-1 is expressed throughout the nephron, i.e., in the glomerulus, the proximal tubule, MTAL, and the distal nephron. Defective OCRL-1 expression in these regions may play a pathogenetic role in the progressive loss of glomerular function, the Fanconi-like syndrome, as well as the concentrating and acidification defects seen in this disorder.

    ACKNOWLEDGEMENTS

This research was supported by a grant-in-aid from the American Heart Association. R. F. Reilly is a recipient of a Department of Veterans Affairs Research Associate Career Award.

    FOOTNOTES

Address for reprint requests: R. F. Reilly, Section of Nephrology, University of Colorado Health Science Center, 4200 E. Ninth Ave., Denver, CO 80262.

Received 24 October 1996; accepted in final form 10 July 1997.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Abbassi, V., C. U. Lowe, and P. L. Calcagno. Oculo-cerebro-renal syndrome. Am. J. Dis. Child. 115: 145-168, 1968[Medline].

2.   Attree, O., I. M. Olivos, I. Okabe, L. C. Bailey, D. L. Nelson, R. A. Lewis, R. R. McInnes, and R. L. Nussbaum. The Lowe's oculocerebrorenal syndrome gene encodes a protein highly homologous to inositol polyphosphate-5-phosphatase. Nature 358: 239-242, 1992[Medline].

3.   Brown, H. A., S. Gutowski, C. R. Moomaw, C. Slaughter, and P. C. Sternweis. ADP-ribosylation factor, a small GTP-dependent regulatory protein stimulates phospholipase D activity. Cell 75: 1137-1144, 1993[Medline].

4.   Charnas, L. R., I. Bernardini, D. Rader, J. M. Hoeg, and W. A. Gaul. Clinical and laboratory findings in the oculocerebrorenal syndrome of Lowe, with special reference to growth and renal function. N. Engl. J. Med. 324: 1318-1325, 1991[Abstract].

5.   De Camilli, P., S. D. Emr, P. S. McPherson, and P. Novick. Phosphoinositides as regulators in membrane traffic. Science 271: 1533-1539, 1996[Abstract].

6.   Donaldson, J. G., D. Cassel, R. A. Kahn, and R. D. Klausner. ADP-ribosylation factor, a small GTP-binding protein, is required for binding of the coatomer protein beta -COP to Golgi membranes. Proc. Natl. Acad. Sci. USA 89: 6408-6412, 1992[Abstract/Free Full Text].

7.   Hartmann, K. P., V. Papa, E. J. Brown, U. Doerries, S. M. Rosenthal, and I. D. Goldfine. A rapid and simple one step method for isolation of poly(A)+ RNA from cells in monolayer. Endocrinology 127: 2038-2040, 1990[Abstract].

8.   Kahn, R. A., J. K. Yucel, and V. Malhotra. ARF signaling: a potential role for phospholipase D in membrane traffic. Cell 75: 1045-1048, 1993[Medline].

9.   Leahey, A.-M., L. R. Charnas, and R. L. Nussbaum. Nonsense mutations in the OCRL-1 gene in patients with the oculocerebrorenal syndrome of Lowe. Hum. Mol. Genet. 2: 461-463, 1993[Abstract/Free Full Text].

10.   Lowe, C. U., M. Terrey, and E. A. MacLachlan. Organic-aciduria, decreased renal ammonia production, hydrophthalmos, and mental retardation. Am. J. Dis. Child. 83: 164-184, 1952.

11.   Okabe, I., O. Attree, L. C. Bailey, D. L. Nelson, and R. L. Nussbaum. Isolation of cDNA sequences around the chromosomal breakpoint in a female with Lowe syndrome by direct screening of cDNA libraries with yeast artificial chromosomes. J. Inherit. Metab. Dis. 15: 526-531, 1992[Medline].

12.   Reilly, R. F., F. Hildebrandt, D. Biemesderfer, C. Sardet, J. Pouysségur, P. S. Aronson, C. W. Slayman, and P. Igarashi. cDNA cloning and immunolocalization of a Na/H exchanger in renal epithelial cells (LLC-PK1). Am. J. Physiol. 261 (Renal Fluid Electrolyte Physiol. 30): F1088-F1094, 1991[Abstract/Free Full Text].

13.   Reilly, R. F., and C. A. Shugrue. cDNA cloning of a renal Na+/Ca2+ exchanger. Am. J. Physiol. 262 (Renal Fluid Electrolyte Physiol. 31): F1105-F1109, 1992[Abstract/Free Full Text].

14.   Rutsaert, J., A. Segers-Cadranel, and P. Potvliege. Lowe's syndrome: pathologic studies of four cases. Pathol. Eur. 7: 249-262, 1972[Medline].

15.   Schoen, E. J. Lowe's syndrome: abnormalities in renal tubular function in combination with other congenital defects. Am. J. Med. 27: 781-792, 1959.

16.   Sliman, G. A., W. D. Winters, D. W. Shaw, and E. D. Avner. Hypercalciuria and nephrocalcinosis in the oculocerebrorenal syndrome. J. Urol. 153: 1244-1246, 1995[Medline].

17.   Suchy, S. F., I. M. Olivos-Glander, and R. L. Nussbaum. Lowe syndrome, a deficiency of a phosphatidylinositol 4,5-bisphosphate 5-phosphatase in the Golgi apparatus. Hum. Mol. Genet. 4: 2245-2250, 1995[Abstract/Free Full Text].

18.   Zhang, X., A. B. Jefferson, V. Auethavekiat, and P. W. Majerus. The protein deficient in Lowe syndrome is a phosphatidylinositol-4,5-bisphosphate 5-phosphatase. Proc. Natl. Acad. Sci. USA 92: 4853-4856, 1995[Abstract/Free Full Text].


AJP Renal Physiol 273(5):F790-F795




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erb, B. C.
Right arrow Articles by Reilly, R. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Erb, B. C.
Right arrow Articles by Reilly, R. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online