AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F825-F836, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welling, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welling, P. A.
Vol. 273, Issue 5, F825-F836, November 1997

Primary structure and functional expression of a cortical collecting duct Kir channel

Paul A. Welling

Department of Physiology, University of Maryland School of Medicine, Baltimore, Maryland 21201

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Maintenance of a negative membrane potential in the cortical collecting duct (CCD) principal cell depends on a small-conductance, inward-rectifying basolateral membrane K+ (Kir) channel. In the present study, a candidate cDNA encoding this K+ channel, CCD-IRK3, was isolated from a mouse collecting duct cell line, M1. CCD-IRK3 shares a high degree of homology with a human brain inward-rectifier K+ channel (Kir 2.3). By Northern analysis, CCD-IRK3 transcript (2.9 kb) was readily detected in M1 CCD cells but not in Madin-Darby canine kidney, LLC-PK1, Chinese hamster ovary, or monkey kidney fibroblast cell lines. CCD-IRK3-specific reverse transcription-polymerase chain reaction confirmed bonafide expression in the kidney. Functional expression studies in Xenopus oocytes revealed that CCD-IRK3 operates as strongly inward-rectifying K+ channel. The cation selectivity profile of CCD-IRK3 [ionic permeability values (PK/Pi), Tl >=  Rb >=  K+ >>  NH4 > Na; inward-slope conductance (GK/Gi), Tl >=  K+ >>  NH4 > Na > Rb] is similiar to the macroscopic CCD basolateral membrane K+ conductance (GK/Gi, K+ >>  NH4 > Rb; PK/Pi, Rb approx  K+ >>  NH4). CCD-IRK3 also exhibits the pharmacological features of the native channel. Patch-clamp analysis reveals that CCD-IRK3 functions as a high open probability, voltage-independent, small-conductance channel (14.5 pS), consistent with the native channel. Based on these independent lines of evidence, CCD-IRK3 is a possible candidate for the small-conductance basolateral Kir channel in the CCD.

kidney; inward-rectifying potassium channel; epithelial transport; fluid and electrolyte balance

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

RENAL POTASSIUM EXCRETION and potassium homeostasis are ultimately dependent on the regulation of the K+ channel activity in the distal nephron. Consider the cortical collecting duct (CCD) principal cells, the major site of K+ excretion in the kidney. In these cells, the vectorial movement of K+ from interstitium to lumen is dependent on the operation of several asymmetrically distributed K+ channels and pumps (27). In the first step, K+ is actively transported from the interstitium into the cell by the basolateral Na-K-adenosinetriphosphatase. Having actively accumulated above electrochemical equilibrium, potassium then passively exits the principal cell either via apically orientated K+ channels or through physiologically distinct K+ channels on the basolateral membrane. In this way, the rate of renal K+ secretion is governed by the relative activity of the different CCD K+ channels, as well as the relative K+ driving forces across each membrane. Normally, both the macroscopic K+ conductance and the driving force on the apical membrane exceed those that of the basolateral membrane, favoring K+ secretion (12, 29).

Characterization of native CCD channels by patch-clamp techniques, complimented by recent insights from molecular cloning, has begun to provide some definitive answers to the basis of differential K+ channel regulation in the collecting duct. The apical conductive pathway is the best characterized. K+ exit across this membrane appears to be mediated by a unique intermediate conductance (20-45 pS), mildly inward-rectifying, voltage-independent, high open probability K+ channel (5, 33). Like the ATP-sensitive K+ channels (KATP), first identified by Noma (26) in the cardiac myocyte, a central hallmark of the apical secretory channel is the ability of cytoplasmic ATP (33) to induce channel closure. With a new class of channel proteins characterized by their inward-rectifying properties (Kir, Ref. 4), the initial breakthrough discovery of Ho and Hebert (9) has provided some important hints about the molecular structure of the apical channel. These investigators isolated a K+ channel cDNA, called ROMK1, from the inner strip of the outer medulla of the rat kidney, whereas Zhou et al. (40) isolated a splice variant of ROMK1, ROMK2 (40). When expressed in Xenopus oocytes, ROMK channels exhibit many but not all properties characteristic of the apical membrane KATP channel (24). Moreover, the ROMK family of channels appears to be expressed in the distal nephron (18) exclusively on the apical membrane (S. Hebert, personal communication). These observations strongly suggest that ROMK encodes an important, perhaps not exclusive, functional unit of the secretory K+ channel in the CCD. Certainly the recent discovery that pancreatic beta -islet cell and cardiac myocyte KATP channels (10, 11) are formed of Kir channel subunits and ATP binding cassette proteins predicts a similar complex heteromultimeric nature for the native CCD KATP channel.

In comparison with the emerging picture of apical K+ channel structure and function, less is known about the basolateral K+ channels. However, observations that the basolateral and apical membrane K+ macroscopic conductances exhibit different biophysical and pharmacological properties (30) has suggested that particular K+ channels, encoded by different gene products, are specifically targeted to either each membrane to meet different specialized physiological demands. This prediction has been borne out by recent patch-clamp studies of Wang et al. (20, 34) and Hirsch and Schlatter (6-8). As many as three types of ATP-insensitive K+ channels that are significantly different than the KATP channels observed on the apical membrane have been identified. An inward-rectifying "low-conductance" channel (27-30 pS) appears to be the major determinant of the basolateral membrane K+ conductance (21). In addition, a 67-pS ohmic channel and hyperpolarization-activated, intermediate-conductance channel (50-90 pS) both also appear to contribute to the "resting" principal cell basolateral membrane K+ c onductance.

In the present study, an expression cloning strategy, using a CCD cell line as a source of mRNA, was perused to further elucidate the molecular basis for renal CCD K+ channels. Here I describe the molecular identification of a CCD basolateral membrane K+ channel candidate by molecular cloning and functional expression.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cell culture. A CCD cell line, M1, described by Stoos et al. (31), was used in the present study as source of CCD RNA. Passages 8-18 cells were grown on 100-mm plastic supports in a serum-free medium (PC1, Ventrex), supplemented with 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin, and exchanged every other day. Cells were maintained in a 5% CO2-95% air, 37°C atmosphere. Identical conditions have been previously shown to support the growth and development of cells that exhibit many phenotypic properties of the CCD principal cell (13). In some studies, cells were allowed to grow to confluence (7-12 days) in the serum-free, PC1 medium and then placed in Dulbecco's modified Eagle's medium-Ham's F-12 (DMEM/F12) containing insulin (5 µg/ml), transferrin (5 µg/ml), selenium (5 ng/ml) (the PC1 base medium), and 10% fetal calf serum (FCS) for 6 days.

RNA isolation. Confluent monolayers of M1 cells (12-14 days postseeding) were washed three times with cold, sterile, ribonuclease (RNase)-free phosphate-buffered solution. Total RNA was subsequently isolated using the extraction procedure described by Chomczynski and Sacchi (3). Yields were typically 100-200 µg/100-mm plate. Mouse kidney RNA was harvested in an identical manner. Both were then selected for poly(A)+ RNA by oligo(dT) chromatography, using either Pharmacia spin columns or the Promega PolyAtract system according to the manufacturer's recommendations, with similar results.

M1 cDNA library construction and screening. For the initial expression cloning studies, an M1 CCD cDNA library was constructed from a Kir-enriched 1.2- to 2.5-kb-size fraction of M1 mRNA (35) using the SuperScript system for cDNA synthesis and plasmid cloning according the manufacturer's recommendations (GIBCO-BRL; Life Technologies, Gaithersburg, MD). An oligo(dT) primer adapter containing a Not I site was used in the first-strand synthesis reaction to facilitate directional cloning. After second-strand replacement synthesis and the addition of Sal I adapters, the cDNA was digested with the rare cutter, Not I, to produce cDNAs with Not I and Sal I termini. The cut cDNA was then size selected for >500 bp by column chromatography (Sephacryl 500 HR, GIBCO-BRL) and then directionally ligated into a Not I-Sal I-cut pSPORT plasmid.

A second plasmid library was constructed for hybridization screening in an identical manner as the first library with the following exceptions. For first-strand synthesis, total, instead of fractionated, M1 cell poly(A)+ was used as a template, and a combination of random hexamers and oligo(dT)12-18 were used for priming. After second-strand replacement synthesis, EcoR I adapters were added to produce cDNAs with EcoR I termini. After size selection, the cDNA was ligated into EcoR I-cut pSPORT plasmid.

For functional expression screening, cRNA was transcribed in vitro from pools of the directional-cloned, size-fractionated M1 CCD cell cDNA library and injected into oocytes. K+ channel activity was subsequently assessed by measuring barium-sensitive (1 mM) currents in 90 mM K+ (Ca-free KD-90) under voltage clamp at -80 mV to detect the expression of Kir channels in Xenopus oocytes. By successively subdividing one of the active pools, a CCD K+ channel cDNA (M1F4.11E4B) was eventually isolated. Sequencing revealed that M1F4.11E4B was truncated at an internal Not I site at the 3' end of the open reading frame.

To isolate the full-length clone, the second M1 CCD library was screened by hybridization. Replicate filters (Hybond-N, Amersham) containing approx 105 clones were screened using an approx 500-bp 3' restriction fragment (Dra III-Not I) of the M1F4.11E4B clone. The Dra III-Not I M1F4.11E4B fragment was labeled with [32P]dCTP by random primer extension [0.2-1 × 109 counts · min-1 · µg-1 (cpm/µg)]. Duplicate filters were hybridized with the probe (2 × 106 cpm/ml) in a buffer containing 5× SSPE [1× SSPE is 0.9 M sodium chloride, 50 mM sodium phosphate (pH 7.4), and 5 mM EDTA], 5× Denhardt's solution, 0.5% sodium dodecyl sulfate (SDS), and 0.05 mg/ml denatured salmon sperm DNA at 65°C for 12-18 h. Filters were washed at a final stringency of 0.1× SSPE, 0.1% SDS at 65°C and exposed to X-ray film for 6-12 h.

Sequencing. Both strands of the low-conductance, inward-rectifying basolateral membrane K+ channel (CCD-IRK3) were sequenced with chain-terminating inhibitors using Sequenase or by automated Abi Prism dye terminator-cycle sequencing. Oligonucleotides corresponding to the SP6 or T7 sites of the plasmid pSPORT and/or a series of internal CCD-IRK3 sites were used for primer extension.

Northern analysis. RNA was size fractionated by denaturing (formaldehyde) agarose gel electrophoresis, transferred to GeneScreen+ membranes (DuPont-NEN) by capillary elution, ultraviolet cross-linked, and hybridized at high stringency with a random prime 32P-labeled Dra III-Not I, 533-bp CCD-IRK3 fragment [108-109 disintegrations · min-1 · µg-1 (dpm/µg)]. Hybridization was carried out with approx 5 × 106 of probe in 5× SSPE, 5× Denhardt's solution, 1% SDS, 10% dextran sulfate, 50% formamide, and 100 µg/ml of denatured salmon sperm DNA at 50°C for 18 h. Membranes were washed at a final stringency of 0.1× SSPE, 0.2% SDS at 65°C and exposed to Kodak XAR film with intensifying screens at -70°C.

Reverse transcription-polymerase chain reaction and Southern blotting. Mouse kidney mRNA (approx 10 ng) was reverse transcribed using oligo(dT) (15 mer) and SuperScript reverse transcriptase (200 U) at 42°C for 50 min in 15 µl of 20 mM tris(hydroxymethyl)aminomethane hydrochloride (Tris · HCl), 50 mM KCl, 2.5 mM MgCl2, 0.1 mg/ml bovine serum albumin, 0.5 mM dNTPs, and 10 mM dithiothreitol. After the reverse transcription (RT) reaction, RNase H (Boehringer-Mannheim) was added to each reaction tube (0.1 U/µl) and incubated at 37°C for 20 min. The negative control reactions (RT-) were handed in an identical manner, except that reverse transcriptase was excluded.

Polymerase chain reactions (PCR) were carried out in 50 µl containing 1 µl of the kidney RT reaction solution, 10 mM Tris · HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin, 0.2 mM dNTPs, 50 pM of the 5' and 3' primers, and 1 unit AmpliTaq DNA polymerase. After the addition of the enzyme, the reaction was raised to 94°C for 1 min and then sequentially cycled 18-32 times for 1-min durations at each of the following temperatures: 60°C (annealing), 72°C (extending), and 94°C (denaturing), using a MJ Research Thermal cycler. Two CCD-IRK3-specific primer sets were used to independently and specifically amplify two different regions of the IRK3 cDNA, reversed transcribed from mouse kidney. Oligonucleotides (primer set 1, P1) corresponding to bp 498-514 (sense, 5' TTGTCCAGTCCATTGTG 3') and bp 844-824 (sense, 5' GCTGTCCTCGTCGATTTCATG 3') were used in one reaction, oligonucleotides (primer set 2, P2) corresponding to bp 855 to bp 844-824 (sense, 5' GCTGTCCTCGTCGATTTCATG 3') were used in one reaction, and oligonucleotides (primer set 2, P2) corresponding to bp 855-872 (sense, 5' GCATGGGCAAGGAGGAGCT 3') and bp 1418-1397 (antisense, 5' AGAGGCTCTTGCGGGAATAGAG 3') were used in another reaction. Because these primers correspond to regions that are not well conserved across all of the known Kir channels (0-65% identity at the nucleotide level), CCD-IRK3 is specifically amplified.

PCR products were size fractionated by agarose gel (1.2%) electrophoresis, transferred to GeneScreen+ membranes (DuPont-NEN) by capillary elution, hybridized at high stringency with internal, 32P end-labeled, CCD-IRK3-specific probes (5 × 107 cpm/ml) in Church-Gilbert buffer (0.5 mM Na2HPO4, 1 mM Na-EDTA, 7% SDS, 1% bovine serum albumin) for 12 h at 48°C and then washed at high stringency (final wash, 0.1× standard sodium citrate, 0.5% SDS at 45°C). The oligonucleotide probes corresponding to bp positions 1261-1280 (5' AGAGGAGGCAGGCATTATCC 3') and 605-625 bp of 5' CATGCTGTCATCTCCGTTCGA 3' of the IRK3 gene product were labeled with [gamma -32P]ATP using polynucleotide kinase.

cRNA synthesis. cRNA was transcribed in vitro in the presence of capping analog, G(5')ppp(5')G from 1) Not I linearized pools or single clones of the pSPORT-Not I-Sal I M1 cDNA library or 2) Xba I linearized CCD-IRK3 subcloned between 5' and 3' untranslated regions of Xenopus beta -globin in a modified SP64T plasmid. T7 or SP6 RNA polymerase was used two reactions, respectively (Ambion, mMESSAGE mMACHINE). After deoxyribonuclease treatment, cRNA was purified by phenol-chloroform extraction and ammonium-acetate-ethanol precipitation. Yield and concentration were quantified spectrophotometrically.

Oocyte injection. Standard protocols were followed for the isolation and care of Xenopus laevis oocytes. Briefly, frogs were anesthetized by immersion in 0.5% tricaine, and a partial oophorectomy was performed through an abdominal incision. Oocyte aggregates were manually dissected from the ovarian lobes and then were incubated in a Ca-free ORII medium [82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), pH 7.5] containing collagenase (Sigma type IA, 2 mg/ml) for approx 2 h at room temperature to remove the follicular layer. After oocytes were washed extensively with collagenase-free OR II, they were placed in a modified L15 medium (50% Leibovitz's medium, 10 mM HEPES, pH 7.5) and stored at 19°C. After 12 to 24 h of isolation, healthy-looking Dumont stages V-VI oocytes were pneumatically injected (PV 820 picopump, World Precision Instruments) with 50 nl of water containing 0-50 ng of cRNA and then stored in L15 medium at 19°C. Channel activity was assessed 2-6 days postinjection.

Electrophysiology. Whole cell oocyte currents were monitored using a two-microelectrode voltage clamp equipped with a bath-clamp circuit (OC-725B; Warner, New Haven, CT). For these studies, oocytes were placed in a small Lucite chamber and continually superfused with a Ca-free ND88 (88 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES, pH 7.4) or KD-90 solution (90 mM KCl, 1 mM MgCl2, 5 mM HEPES, pH 7.4) at room temperature (21-23°C). For some experiments, K+ in the KD-90 medium was replaced equal molar N-methyl-D-glucamine (NMDG), keeping the monovalent cation concentration at 90 mM. For selectivity experiments, extracellular K+ (5 mM + 85 mM NMDG) was replaced by an equivalent concentration of either Tl, Rb, NH4, or Na, and the bi-ionic reversal potential and inward-slope conductance were measured. Because TlCl is not soluble and NO3 does not alter K+ currents (not shown), KNO3 and TlNO3 salts were for the used in the Tl studies.

Voltage-sensing and current-injecting electrodes had resistances of 0.5 to 1.5 MOmega when back filled with 3 M KCl. After a stable impalement was attained, such that both electrodes measured the same spontaneous membrane potential (±4 mV), pulse protocols shown below were conducted. Stimulation and data acquisition were performed with a Macintosh Centris 650 computer using an Instrutech ITC16 analog-to-digital, digital-to-analog converter and Pulse software. Data were filtered at 1 kHz and digitized online at 2 kHz to the hard disk using Pulse for latter analysis using Pulsefit.

Cation permeability of CCD-IRK3 relative to K+ (PX/PK) was estimated from the change in reversal potential (Delta Erev) observed when extracellular K+ was replaced with an equivalent concentration of test cation using the equation, PX/PK = e(ZFDelta Erev/RT). The zero-voltage dissociation constant (Kd0) and location of binding (delta ) for barium block were estimated as originally described by Woodhull (37) using the assumption that barium interacts with a single site within the CCD-IRK3 pore. Specifically, the fractionation of barium-blocked current, Io(V)/IBa(V)-1, vs. membrane potential data were fit to a linear, logarithmic transformation of a Boltzmann relation (Io(V)/IBa(V) -1 = ln([Ba]/Kd0) + delta ZF/RT), so that Kd0 and the fraction of the electric field sensed at the barium binding site, delta , could be extrapolated.

For patch-clamp experiments, the vitelline membrane was removed from oocytes following hyperosmotic shrinking. Patch-clamp electrodes, pulled from glass capillary tubes (Corning no. 7052), had resistances of 0.5-10 MOmega when back filled with 140 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 10 mM HEPES, pH 7.4. Cell-attached recordings of single channels were made using an Axopatch 200A. Current records were digitized at a sampling rate of 47 kHz using a VR-10B digital data recorder (Instrutech, Great Neck, NY) and were stored on a videotape. For analysis, recorded currents were transferred on to disk at 2-5 kHz through an analog-to-digital converter and digitally low-pass filtered at 0.5-1 kHz. Single-channel slope conductance and open probability was assessed by measuring single-channel currents at holding potentials ranging from a membrane potential of -100 to 0 mV.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cloning and primary structure of a CCD Kir. To elucidate the molecular structure of renal CCD K+ channels, particularly the basolateral Kir channels, an expression cloning strategy using the CCD cell line M1 as a source of mRNA was initiated. This approach was prompted by the observation in Xenopus oocytes that M1 cell mRNA reliably induced the expression of Kir channels like those found in the native CCD (35). Accordingly, a unidirectionally cloned cDNA library was constructed from a Kir-enriched 1.2- to 2.5-kb-size fraction of M1 mRNA. cRNA, transcribed in vitro, from two of the five pools of approx 6,000 independently cloned M1 cell cDNAs, induced expression of Kir-like channels in Xenopus oocytes. By measuring barium-sensitive (1 mM) currents in 90 mM K+ under voltage clamp at -80 mV to detect the expression of Kir channels in cRNA-injected oocytes and successively subdividing one of the active pools, an approx 1.2 kb K+ channel cDNA was eventually isolated. Sequencing this clone revealed one long open frame with a predicted primary structure similar to other Kir channel types. However, it appeared that this initial clone (M1F4.11E4B) was prematurely truncated at an extreme 3' Not I site (see METHODS, M1 cDNA library construction and screening). To isolate an overlapping cDNA with the 3' end intact, a second M1 cell library, lacking Not I digestion, was subsequently screened by hybridization to a 3' restriction fragment of the M1F4.11E4B clone under conditions of high stringency. Of six hybridizing clones, the longest clone contained the entire open reading frame (Fig. 1A).


View larger version (43K):
[in this window]
[in a new window]
 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   A: nucleotide and predicted amino acid sequence of a cortical collecting duct, inward-rectifying, basolateral membrane K+ channel (CCD-IRK3). Both the proposed membrane spanning regions (M1 and M2), deduced from hydropathy analysis (B), and the H5 region are underlined. Putative endoplasmic domains contain 5 consensus sites for protein kinase C phosphorylation (black-square), 2 potential sites for cAMP/cGMP-dependent kinase phosphorylation (bullet ), and 1 possible site for tyrosine kinase phosphorylation (black-down-triangle ). Not I site (*), which truncated initial clone, is shown. B: hydropathy plot of CCD-IRK3 was deduced by the method of Kyte and Doolittle with a 9 amino-acid window.

The 1,421-bp cDNA encodes a protein of 445 amino acids with a predicted molecular mass of 49,641 daltons. Like other Kir channels, the deduced amino acid sequence predicts two membrane-spanning regions (M1 and M2) that flank a structure exhibiting a high degree of homology with the "pore" or H5 region of voltage-dependent K+ channels (Fig. 1). Although the CCD Kir channel has the predicted topological Kir motif, it also displays several unique regions that presumably confer isoform-specific function. A novel glycine/proline-rich region of 17 additional amino acids is predicted to from a longer extracellular loop between M1 and H5. Moreover, hydrophilic NH2-terminal and longer COOH-terminal regions, both predicted to be endoplasmic, show weak homology to the classic inward-rectifier, IRK1 (15), the ATP-regulated ROMK Kir channel (9), the G protein-regulated Kir channels (16), or KATP channel subunits (10, 11). These putative endoplasmic domains contain a number sites for posttranslational modification, including five consensus sites for protein kinase C phosphorylation, two potential sites for adenosine 3',5'-cyclic monophosphate/guanosine 3',5'-cyclic monophosphate (cAMP/cGMP)-dependent kinase phosphorylation and one possible site for tyrosine kinase phosphorylation (Fig. 1A) but no consensus sites for ATP binding.

Based on the identity (approx 96%) of the CCD Kir with an inward-rectifier K+ channel cDNA, recently isolated from human brain (23, 28) while this study was in progress, this clone was named CCD-IRK3 (mKir 2.3 by current nomenclature).

Expression of IRK3 mRNA in CCD cell culture and kidney. In Northern analysis, a CCD-IRK3 probe strongly hybridized to a approx 2.9-kb transcript in M1 CCD (Fig. 2A). Absolute expression of the CCD-IRK3 mRNA in M1 CCD cell culture is not an unusual result of tissue culture conditions employed to generate the cDNA library; either the serum-free PC1 medium or the base DMEM/F12 medium supplemented with 10% FCS supports the expression of the CCD-IRK3 transcript (Fig. 2A). The 1.7-fold increase in the abundance of the CCD-IRK3 mRNA in the FCS medium compared with the PC1 medium (n = 3) does, however, raise the possibility that CCD-IRK3 mRNA abundance is under hormonal control. The observation that the CCD-IRK3 transcript could not be detected in Northern blot analysis using the same amount RNA from Madin-Darby canine kidney (MCDK), LLC-PK1 (pig kidney cell line), Chinese hamster ovary (CHO), or monkey kidney fibroblast (COS) cell lines grown under identical conditions (Fig. 2B) provides strong evidence that CCD-IRK3 expression is not a universal consequence of cell culture. The specific physiological role of CCD-IRK3 in the kidney is, however, supported by RT-PCR analysis (Fig. 2C). CCD-IRK3 mRNA was readily amplified from mouse kidney (n = 4). As resolved by agarose gel electrophoresis and visualized by ethidium-bromide staining, reaction products of predicted size were observed using mouse kidney first-strand cDNA as a template and two different IRK3-specific primer sets (>= 18-20 amplification cycles). Southern blots with internal IRK3-specific oligonucleotides confirmed CCD-IRK3 identity (Fig. 2B).The observation that no amplification product could be detected when mRNA rather than cDNA was used as a template (i.e, RT-), rules out spurious genomic amplification and verifies bona fide IRK3 mRNA expression in the kidney.


View larger version (34K):
[in this window]
[in a new window]
 


View larger version (58K):
[in this window]
[in a new window]
 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   CCD-IRK3 mRNA is expressed in the kidney and in CCD cell culture. A: Northern analysis using a CCD-IRK3 probe and M1 CCD RNA. Either PC1 medium (lane 1) or base DMEM/F12 medium + 5% fetal calf serum (lane 2) support the expression of 2.9-kb IRK3 transcript in CCD cell culture. Both lanes contain 25 µg of total RNA. Blots were washed at a final stringency of 0.1× SSPE, 0.2% SDS at 65°C. B: in contrast, CCD-IRK3 transcript could not be detected in Northern blot analysis using an identical amount RNA from Madin-Darby canine kidney (MDCK), M1-CCD, LLC-PK1, monkey kidney fibroblast (COS), or Chinese hamster ovary (CHO) cells. C: reverse transcription-polymerase chain reaction (RT-PCR) analysis of IRK3 expression in the mouse kidney. Reaction products of predicted size were observed using mouse kidney first-strand cDNA (RT+) as a template and two different IRK3-specific primer sets (P1 and P2). Southern blots are shown with internal IRK3-specific oligonucleotides (P1i and P2i). mRNA (RT-) was used as a negative control template.

Functional expression in Xenopus oocytes. To begin to elucidate the physiological counterpart of CCD-IRK3 in the kidney, a detailed functional analysis of cloned CCD-IRK3 was conducted. Recombinant RNA transcribed in vitro from the CCD-IRK3-pSP64T cDNA induced the expression of inward-rectifying K+ channels in Xenopus oocytes [CCD-IRK3 currents measured under the 2-microelectode voltage clamp had a peak amplitude of 10.54 ± 1 µA when injected with 250 pg cRNA at -150 mV in 45 mM K+ + 45 mM NMDG (n = 30)]. No such channel activity was observed in oocytes injected with water.

CCD-IRK3 is strongly inward rectifying (Fig. 3) and exhibits slight inactivation at extreme hyperpolarizing potentials. From a 0-mV holding potential, hyperpolarizing test pulses evoked much larger K+ currents than those observed at depolarizing test pulses. The large inward CCD-IRK3 currents display very rapid activation kinetics (<= 10 ms). Similar to native inward rectifiers (19), the rate of activation is influenced by membrane potential and external K+, being augmented by further hyperpolarization or an increase in the K+ concentration (Fig. 3A). After rapid activation, CCD-IRK3 exhibits some degree of inactivation. Although not apparent at voltage steps more positive than approx EK -60 mV, larger hyperpolarizing steps caused inactivation; at these potentials, peak CCD-IRK3 currents relaxed over the 400-ms test pulse to a quasi-steady-state value >= 80% of the maximum. More predominant than the closely related IRK1 channel (15) but less than IRK2 (32), inactivation cannot be explained by external cation block (1) since K+ is the only charge carrier present in these studies (45 mM K+ + 45 mM NMDG). The most remarkable feature of CCD-IRK3 is the strong rectification. In contrast to the large inward currents, outward K+ currents are not easily detected in oocytes injected with 250 ng of cRNA. If more RNA is injected (1 ng) to increase expression, then small but significant outward currents are easily detected (Fig. 4).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   CCD-IRK3 is a strong inward-rectifying K+ channel. A: CCD-IRK3 currents, recorded from a CCD-IRK3 cRNA-injected oocyte, were elicited from a 0-mV holding potential by voltage pulses from -150 to +50 mV for 400 ms at the different extracellular K+ (Ko) concentrations shown [K + N-methyl-D-glucamine (NMDG) = 90 mM]. Arrows indicate the zero current line. B: instantaneous currents are plotted against applied voltage as a function of extracellular K+. V, voltage. C: reversal potential (Erev) vs. extracellular K+ concentration (K + Na = 90 mM) has a slope of 56 mV/decade. D: slope conductance from data in B vs. extracellular K+ are fit by linear regression, slope near 0.5 (K + NMDG = 90 mM).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   Despite its strong inward-rectifying nature, CCD-IRK3 can carry small outward currents K+ currents. Steady-state currents were measured from a +50 mV or -60 mV holding potential (VH) on voltage pulses from -60 to +50 mV for 400 ms in 5 mM extracellular K+ (K + NMDG = 90 mM, n = 6). Bell-shaped current-voltage (I-V) relationship presumably reflects the voltage-dependent binding of intracellular polyamines and Mg, causing a negative slope conductance at voltages more positive than -20 mV. Barium acetate (5 mM) completely blocked the newly expressed current. Oocytes shown here were injected with 4 times more cRNA than the oocytes shown in Fig. 3.

As expected for an inward-rectifier K+ channel, the apparent activation potential or reversal potential changed in close agreement with the Nernst equilibrium potential for K+ (56 ± 4 mV per decade change in K+ for NMDG substitution, n = 6; 57 ± 5 mV for Na substitution), illustrating the expressed channel is highly K+ selective over Na or NMDG (Fig. 3D). Double logarithmic plots of inward-slope conductance vs. extracellular K+ concentration were linear with a slope of approx 0.5, consistent with a multi-ion permeation mechanism (22) commonly observed with inward rectifiers (Fig. 3D).

Cation selectivity studies are also consistent with a complex permeation mechanism similar to the native CCD basolateral membrane macroscopic K+ conductance (Fig. 5). In these experiments, extracellular K+ (5 mM K+ + 85 mM NMDG) was replaced by an equivalent concentration of either Tl, Rb, NH4, or Na, and the bi-ionic reversal potential and steady-state inward-slope conductance were measured. Substitution of K+ with Tl caused a 12.6 ± 0.9 mV (n = 6) depolarization, indicating that PK/PTl is 0.61. The value is in close agreement with the increase in inward-slope conductance observed with Tl replacement (GK/GTl = 0.71). In constrast to the high permeability of CCD-IRK3 for Tl, the channel is relatively impermeable to Na or NH4. Yielding a PK/PNa of 9.5 and a PK/PNH4 of 3.16, substitution of Na or NH4 for K+ shifted the reversal potential by -55.7 ± 4 (n = 6) and -28.5 ± 2.4 mV (n = 6), respectively. Because the contaminating influence endogenous channels are more problematic when the CCD-IRK3 current becomes small, the relative permeability coefficients for Na and NH4 only reflect minimum estimates. Nonetheless, both relative permeabilities are in close agreement with the relative inward-slope conductance measurements; GK/GNa was found to be 4.1, and GK/GNH4 is estimated to be 3.53. Studies with Rb, on the other hand, are more consistent with a pore blocking action than permeation. Certainly, the discordance between the low relative ionic permeability value (PK/PRb = 0.8, n = 6) and high relative inward-slope conductance (GK/GRb = 8.31) suggests Rb binds more tightly within the CCD-IRK3 pore than K+. In any case, the cation selectivity profile of CCD-IRK3 (PK/Pi, Tl >=  Rb >=  K+ >>  NH4 > Na; GK/Gi, Tl >=  K+ >>  NH4 > Na > Rb) closely parallels that of the macroscopic CCD basolateral membrane K+ conductance (GK/Gi, K+ >>  NH4 > Rb; PK/Pi, Rb approx  K+ >>  NH4) (30).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5.   CCD-IRK3 is highly K+ selective. Inward currents through CCD-IRK3 channels, measured by 2-microeletrode voltage clamp in CCD-IRK3 injected oocytes, are dependent on the ionic nature of the charge carrier. Shown are currents relative to those measured in 5 mM K+ + 85 mM NMDG (-Iion/IK) with respect to voltage. In these studies, 5 mM K+ was replaced with 5 mM of either Na (triangle ), NH4 (black-lozenge ), Rb (black-square), or Tl (black-down-triangle ). Arrowheads indicate reversal potentials measured with signified extracellular cation (means ± SD, n =6).

Pharmacology. The pharmacological profile of CCD-IRK3 is also similar to the CCD basolateral membrane small-conductance K+ channel (W. Wang, personal communication). As shown in Fig. 6, external barium blocked CCD-IRK3 conduction in a voltage- and concentration-dependent manner. Assuming a 1:1 stoichiometry, barium binds at a site 18 ± 1.4% within the electric field with an inhibitor constant Ki (0 mV) of 364 ± 117 µM (n = 7, 45 mM K+ + 45 mM NMDG). Furthermore, CCD-IRK3 is sensitive to quinine (Fig. 7); 1 mM quinine inhibited 52% (n = 3) of the inward CCD-IRK3 current at -100 mV (45 mM K+ + 45 mM NMDG). No detectable changes in the functional properties of CCD-IRK3 were noted with external tetraethylammonium (TEA, 10 mM; n = 6) or glibenclamide (250 µM, n = 6).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6.   Barium blocks CCD-IRK3 in a voltage and concentration-dependent manner. Steady-state K+ currents through CCD-IRK3 channels, measured by 2- microelectrode voltage clamp in CCD-IRK3-injected oocytes (45 mM K+ + 45 mM NMDG), are shown as a function of voltage and extracellular barium (open circle , 0 µM Ba; bullet , 3 µM Ba; square , 30 µM Ba; black-square, 300 µM Ba; triangle , 3,000 µM Ba). Ki (0 mV) and delta  were estimated from linear regression fits of fractionation of barium-blocked current, IO(v)/IBa(v) - 1, vs. membrane potential data to a logarithmic transformation of a Boltzmann relation, i.e., IO(v)/IBa(v) - 1 = ln([Ba]/Kd0) + delta ZF/RT (inset).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Quinine blocks CCD-IRK3. Steady-state I-V relationships are shown in the presence (bullet ) and absence (open circle ) of 1 mM quinine (5 mM K+ + 85 mM NMDG).

Single-channel properties of CCD-IRK3. As noted with the small-conductance basolateral K+ channel in the CCD, patch-clamp studies with Xenopus oocytes in the cell-attached configuration reveal that CCD-IRK3 (Fig. 8) exhibits a high and voltage-independent open probability (Po = 0.78 ± 0.03 at -100 mV, n = 6). Compatible with the inward-rectifying nature of CCD-IRK3 channels observed macroscopically, single currents were detected at potentials more negative that EK in the cell-attached configuration but not at more positive holding potentials (Fig. 6). With the unitary inward current-voltage relation, the inward single-channel slope conductance is estimated to be 14.5 ± 1 pS (n = 6), close to the values reported for the small-conductance basolateral channel in the CCD. Furthermore, the observation that CCD-IRK3 spontaneously inactivates or runs down on patch excision from the cell suggests that channel activity is dependent on soluble cytosolic factors, as have been demonstrated for the native CCD channel (8, 21, 34).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   CCD-IRK3 is a small-conductance channel. A: single CCD-IRK3 currents in a cell-attached Xenopus oocyte patch with 140 mM K+ in the pipette and bath. B: open probability (Po) voltage relationships of channel. C: single channel records, shown at bottom, were low-pass filtered at 1 kHz.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

K+ homeostasis is ultimately dependent on K+ channel activity in the renal CCD, the major site of K+ secretion in the kidney. To be sure, functionally disparate K+ channels, expressed on either the basolateral or apical membrane, play specific roles in K+ secretion. The apical membrane KATP channel, characterized by a near linear current-voltage relationship (weak inward-rectifying properties), allows avid K+ efflux and efficient K+ secretion (5, 33). In contrast, the two types of K+ channels on the basolateral membrane, an inward-rectifier and a hyperpolarization-activated channel (6, 7, 34), carry less current in the outward direction. Subsequently, the basolateral channels maintain membrane potential and ensure a favorable driving force for the electrogenic K+ secretory process (and mineralocorticoid-dependent Na reabsorption) without significantly recycling K+ to the interstitium. In addition such channels, designed to carry K+ more efficiently into the cell than out of the cell, are ideally suited for their roles as conduits of K+ uptake in hypermineralocorticoid states when the basolateral membrane potential actually becomes more negative than the K+ equilibrium potential (29).

Although recent observations strongly suggest that ROMK (Kir 1.1) encodes an important but not exclusive functional unit of the secretory KATP channel in the CCD (9), the molecular nature of the two different types of basolateral membrane K+ channels has remained undetermined. In the present study, a functional expression cloning strategy, unbiased toward homologous selection as are traditional hybridization-based screening methods, was employed to isolate a K+ channel cDNA, CCD-IRK3 (Kir 2.3), from a CCD cell line. Based on its origin and the functional resemblance to one of the CCD K+ channels, CCD-IRK3 is a possible candidate for the small-conductance basolateral Kir channel, the major determinant of the CCD principal cell K+ conductance (21).

As determined by sequence homology, CCD-IRK3 appears to be a mouse homolog of a human inward-rectifier K+ channel recently isolated from brain (HIR, Ref. 28; HRK1, Ref. 23), IRK3 (25), or Kir 2.3 (4). Like other Kir channels, the deduced amino acid sequence of CCD-IRK3 predicts two membrane-spanning regions that flank a structure exhibiting a high degree of homology with the "pore" or H5 region in voltage-dependent K+ channels. As recently demonstrated in a related Kir isoform (39), the assembly of four CCD-IRK3 "subunits" is presumably required for the formation of functional CCD-IRK3 channels. With the precedence for heteroligomeric assembly of other Kir isoforms, particularly the G protein-gated K+ channels (14), it remains to be determined whether the native CCD small-conductance Kir channel is formed of heteroligomeric or homooligomeric CCD-IRK3 complexes. In any case, although the CCD Kir channel shares the basic topological Kir motif (4), it does display several unique regions that presumably confer isoform-specific function. Most notably, a novel glycine/proline-rich region of 17 additional amino acids, predicted to form a longer extracellular loop between M1 and H5, may play a unique role in conduction or extracellular protein-protein interaction. The two putative endoplasmic domains, least conserved among the Kir channels, contain a number sites for posttranslational modification, as might be predicted from known avenues of CCD basolateral K+ channel regulation (8, 21, 34), including five consensus sites for protein kinase C phosphorylation, two potential sites for cAMP/cGMP-dependent kinase phosphorylation, and one possible site for tyrosine kinase phosphorylation.

Although initial Northern blot analysis suggested the human Kir 2.3 channel is primarily expressed in excitable tissue (28), a specific physiological role in the kidney, particularly in the CCD, is supported by these studies. First, the CCD-IRK3 cDNA was isolated from a CCD cell line, M1. Derived from a single CCD of a mouse transgenic for the SV40 large T antigen, M1 CCD cells exhibit phenotypic properties of the principal cell, including K+ secretion and amiloride-sensitive, electrogenic Na reabsorption (13, 31). The isolation of a K+ channel cDNA that has many functional characteristics of native CCD basolateral K+ channel and is abundantly expressed in M1 cell culture is consistent with the predominant basolateral K+ conductance found in M1 cells (13). Second, absolute expression of CCD-IRK3 mRNA in M1 cells is not an unusual result of tissue culture conditions used to derive the cDNA library. Although the cells for cDNA library construction were grown in a serum-free medium (PC1 medium, Ventrex) as before (13), the base medium, DMEM/F12, containing FCS also supports the expression of CCD-IRK3 mRNA. The increased expression of CCD-IRK3 in the FCS-supplemented medium does, however, raise the intriguing possibility that CCD-IRK3 mRNA abundance is under hormonal control as might be expected for a channel expressed in corticosteroid hormone-regulated principal cell (29). Third, the observation that the CCD-IRK3 transcript is not expressed in MDCK, LLC-PK1, CHO, or COS cells grown under identical conditions (PC1) demonstrates that CCD-IRK3 is not ubiquitously expressed in cell culture, providing compelling evidence for a specific role of CCD-IRK3 in the native collecting duct. Furthermore, although kidney IRK3 mRNA falls beyond the detection limits of Northern analysis, it is readily observed by RT-PCR. Finally, the role as a basolateral membrane channel is supported by preliminary studies from our group. Using an epitope-tag approach to follow subcellular expression of CCD-IRK3 in a IRK3-transfected epithelial cell line, we have found that this channel is targeted specifically to the basolateral membrane (17).

The functional similarities and differences that are exhibited between CCD-IRK3 and the small-conductance K+ basolateral channel in the rat CCD provide some insight into a possible physiological role of the recombinant mouse channel in the CCD. Extrapolation of a mouse clone to the native rat tissue seems appropriate since the rat homolog of IRK3 has been cloned and shown to have essentially the same functional features (2) as reported here for the mouse channel.

Although both the recombinant and native CCD channels exhibit inward rectification, the extent of rectification is different. Studied in the cell-attached mode, CCD-IRK3 is strongly inward rectifying. The native small-conductance basolateral Kir channel detected by Wang et al. (34), on the other hand, has been reported to be mildly inward rectifying in the presence of Mg. Unfortunately, the rectifying properties of the native channel have not been systematically studied in cell-attached patches as they have for CCD-IRK3, precluding an accurate comparison. Considering the mechanistic basis for inward rectification, the experimental configuration can have dramatic effects on the degree of rectification. In strong inward rectifiers, like mouse Kir 2.1 (38) and human Kir 2.3 channels (20), inward rectification is brought out by voltage-dependent occlusion of the ion conduction pore by intracellular polyamines and Mg, rather than intrinsic gating process. Subsequently, these Kir channels lose their strong rectifying properties on excision into polyamine-free solutions.

Using site-directed mutagenesis, Yang et al. (38) determined that the high-affinity polyamine and Mg binding site in the mouse Kir 2.1 channel is created by on an aspartic acid residue in the M2 segment and a glutamic acid at 44 amino acids away from the M2 domain in the hydrophilic COOH terminus. The presence of these critical amino acids at the corresponding positions in CCD-IRK3 is consistent with a similar labile inward-rectification mechanism. Subsequently, the discordance in the rectification properties of the two channels may reflect differences in the experimental configuration. Certainly further study is required before it is known whether extent of inward rectification of the native and recombinant channel are similar when measured under identical conditions. Unfortunately, the rapid rundown process of CCD-IRK3 on patch excision from the membrane makes this comparison technically arduous with the oocyte expression system.

The parallels between CCD-IRK3 and the native CCD basolateral K+ channel at the single channel level offer additional, albeit correlative, evidence that the two channel may be related. The "small-conductance" basolateral K+ channel in the native CCD has been reported by Hirsh and Schlatter (6, 7) to have a inward-slope conductance of 67 pS, whereas Wang (21, 34) has reported a value of 27-30 pS. At present, it is not known whether this actually represents two different channels in the rat CCD or different experimental differences. Nevertheless, when measured under similar ionic conditions as Wang et al. (21, 34) employed for native channel, CCD-IRK3 has a unitary inward single-channel conductance of 14 pS at room temperature. The value is close but slightly smaller than the 27- to 30-pS conductance of the native channel at 37°C. While small, disparity may reflect differences in the temperature of the two experimental preparations as would predicted by the temperature dependence of aqueous diffusion (Q10 = 1.3-1.8). Furthermore, like the native small-conductance channel described by Wang et al. (21, 34), IRK3 exhibits a voltage-independent high open probability. Besides these similarities in the single-channel biophysical fingerprints of the native basolateral K+ channel and CCD-IRK3, CCD-IRK3 also appears to be regulated by identical, albeit somewhat generic, processes. On patch excision from the cell, both channels also exhibit a rapid inactivation process, suggesting that activity of both the native (6, 8, 21) and recombinant channel is maintained by soluble cytosolic factors. Furthermore, preliminary studies from this lab indicate that elevation of cytosolic Ca suppresses CCD-IRK3 activity (36) by a similar, membrane delimited process as the small-conductance K+ channel on the basolateral membrane (7).

CCD-IRK3 shares several other generic biophysical and pharmacological features with the small basolateral membrane channel. Like the native channel (Ref. 7 and W. H. Wang, personal communication), IRK3 is inhibited by barium and quinine but is insensitive to TEA and glibenclamide. Although the selectivity of the native channel has not been systematically studied, the cationic selectivity sequence (PK/Pi, Tl >=  Rb >=  K+ >>  NH4 > Na; GK/Gi, Tl >=  K+ >>  NH4 > Na > Rb) of CCD-IRK3 is similiar to the macroscopic CCD K+ conductance on the basolateral membrane (GK/Gi, K+ >>  NH4 > Rb; PK/Pi, Rb approx  K+ >>  NH4) (30). Although indirect, the similarity in the selectivity profile is consistent observations that the small-conductance channel is the major determinant of the macroscopic conductance (21).

In summary, these studies provide correlative evidence that CCD-IRK3 may encode the CCD small-conductance basolateral membrane Kir channel. The molecular identification of the major determinant of the CCD principal K+ conductance offers a crucial step toward elucidating the molecular mechanisms of differential K+ channel targeting, expression, and regulation in the CCD and understanding the molecular basis for K+ homeostasis.

    ACKNOWLEDGEMENTS

The preliminary data on which these studies are based would not have been possible without the support, generosity, and wisdom of Gerhard Giebisch, who encouraged me to begin this study in his laboratory. I also like to thank the members of his laboratory and especially W. Wang, K. Tsuchiya, and J. Merot, who offered their help and advice. I would also like to thank K. Korbmacher for early help with cell culture, G. Fejes-Toth for the generous gift of the M1 cell line, and G. Desir and M. Caplan for their expert advice.

    FOOTNOTES

Early stages of this study were supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-01733 (to G. Giebisch) and completed with DRIF support from the University of Maryland School of Medicine and National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-08271 (to P. A. Welling).

Address for reprint requests: P. A. Welling, Dept. of Physiology, Univ. of Maryland School of Medicine, 655 W. Baltimore St., Baltimore, MD 21201.

Received 22 October 1996; accepted in final form 16 July 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Biermans, G., J. Vereecke, and E. Carmeliet. The mechanism of the inactivation of the inward-rectifying K current during hyperpolarizing steps in guinea-pig ventricular myocytes. Pflügers Arch. 410: 604-613, 1987[Medline].

2.   Bond, C. T., M. Pessia, X. M. Xia, A. Lagrutta, M. P. Kavanaugh, and J. P. Adelman. Cloning and expression of a family of inward rectifier K channels. Recept. Channels 2: 183-191, 1994[Medline].

3.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

4.   Doupnik, C. A., N. Davidson, and H. A. Lester. The inward rectifier K channel family. Curr. Opin. Neurobiol. 5: 268-277, 1995[Medline].

5.   Frindt, G., and L. G. Palmer. Low-conductance K channels in apical membrane of rat cortical collecting tubule. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F143-F151, 1989[Abstract/Free Full Text].

6.   Hirsch, J., and E. Schlatter. K+ channels in the basolateral membrane of rat cortical collecting duct. Pflügers Arch. 424: 470-477, 1993[Medline].

7.   Hirsch, J., and E. Schlatter. K channels in the basolateral membrane of rat cortical collecting duct. Kidney Int. 48: 1036-1046, 1995[Medline].

8.   Hirsch, J., and E. Schlatter. K channels in the basolateral membrane of rat cortical collecting duct are regulated by a cGMP-dependent protein kinase. Pflügers Arch. 429: 338-344, 1996.

9.   Ho, K., C. G. Nichols, W. J. Lederer, J. Lytton, P. M. Vassilev, M. V. Kanazirska, and S. C. Hebert. Cloning and expression of an inwardly rectifying ATP-regulated K channel. Nature 362: 31-38, 1993[Medline].

10.   Inagaki, N., T. Gonoi, J. P. Clement, N. Namba, J. Inazawa, G. Gonzalez, S. Seino, and J. Bryan. Reconstitution of IKATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 270: 1166-1170, 1995[Abstract/Free Full Text].

11.   Inagaki, N., T. Gonoi, J. P. Clement, C-Z. Wang, L. Aguilar-Bryan, J. Bryan, and S. Seino. A family of sulfonylurea receptors determines the pharmacological properties of ATP-senistive K channels. Neuron 16: 1011-1017, 1996[Medline].

12.   Koeppen, B. M., B. A. Biagi, and G. H. Giebisch. Intracellular microelectrode characterization of the rabbit cortical collecting duct. Am. J. Physiol. 244 (Renal Fluid Electrolyte Physiol. 13): F35-F47, 1983.

13.   Korbmacher, C., A. S. Segal, G. Fejes-Toth, G. Giebisch, and E. L. Boulpaep. Whole-cell currents in single and confluent M-1 mouse cortical collecting duct cells. J. Gen. Physiol. 102: 761-793, 1993[Abstract/Free Full Text].

14.   Krapivinsky, G., E. A. Gordon, K. Wickman, B. Velimirovic, and L. Krapivinsky. The G-protein-gated atrial K+ channel IKACh is a heteromultimer of two inwardly rectifying K+ channel proteins. Nature 374: 135-141, 1995[Medline].

15.   Kubo, Y., T. J. Baldwin, Y. N. Jan, and L. Y. Jan. Primary structure and functional expression of a mouse inward rectifier K channel. Nature 362: 127-133, 1993[Medline].

16.   Kubo, Y., E. Reuveny, P. A. Slesinger, Y. N. Jan, and L. Y. Jan. Primary structure and functional expression of a rat G-protein-coupled muscarinic K channel. Nature 364: 802-806, 1993[Medline].

17.  Le Maout, S., M. Brejon, J. Merot, and P. A. Welling. Polarized expression of an epitope tagged CCD Kir channel, CCD-IRK3, in MDCK cells. Proc. Natl. Acad. Sci. USA In press.

18.   Lee, W. S., and S. C. Hebert. ROMK inwardly rectifying ATP-sensitive K+ channel. I. Expression in rat distal nephron segments. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F1124-F1131, 1995[Abstract/Free Full Text].

19.   Leech, C. A., and P. R. Stanfield. Inward rectification in frog skeletal muscle fibres and its dependence on membrane potential and external potassium. J. Physiol. (Lond.) 319: 295-309, 1981[Abstract/Free Full Text].

20.   Lopatin, A. N., E. N. Makhina, and C. G. Nichols. Potassium channel block by cytoplasmic polyamines as the mechanism of intrinsic rectification. Nature 372: 366-369, 1994[Medline].

21.   Lu, M., and W. H. Wang. Nitric oxide regulates the low-conductance K channel in the basolateral membrane of the cortical collecting duct. Am. J. Physiol. 270 (Cell Physiol. 39): C1336-C1342, 1996[Abstract/Free Full Text].

22.   Lu, Z., and R. MacKinnon. A conductance maximum observed in an inward-rectifier K channel. J. Gen. Physiol. 104: 477-486, 1994[Abstract/Free Full Text].

23.   Makhina, E. N., A. J. Kelly, A. N. Lopatin, R. W. Mercer, and C. G. Nichols. Cloning and expression of a novel human brain inward rectifier K channel. J. Biol. Chem. 269: 20468-20474, 1994[Abstract/Free Full Text].

24.   McNicholas, C. M., W. Wang, K. Ho, S. C. Hebert, and G. Giebisch. Regulation of ROMK1 K+ channel activity involves phosphorylation processes. Proc. Natl. Acad. Sci. USA 91: 8077-8081, 1994[Abstract/Free Full Text].

25.   Morishige, K., N. Takahashi, A. Jahangir, M. Yamada, H. Koyama, J. S. Zanelli, and Y. Kurachi. Molecular cloning and functional expression of a novel brain-specific inward rectifier K channel. FEBS Lett. 336: 375-380, 1993[Medline].

26.   Noma, A. ATP-regulated K+ channels in cardiac muscle. Nature 305: 147-148, 1983[Medline].

27.   O'Neil, R. G. Potassium secretion by the cortical collecting tubule. Federation Proc. 40: 2403-2407, 1981[Medline].

28.   Perier, F., C. M. Radeke, and C. A. Vandenberg. Primary structure and characterization of a small-conductance inwardly rectifying K channel from human hippocampus. Proc. Natl. Acad. Sci. USA 91: 6240-6244, 1994[Abstract/Free Full Text].

29.   Sansom, S. C., and R. G. O'Neil. Effects of mineralocorticoids on transport properties of cortical collecting duct basolateral membrane. Am. J. Physiol. 251 (Renal Fluid Electrolyte Physiol. 20): F743-F757, 1986[Abstract/Free Full Text].

30.   Schlatter, E., E. Lohrmann, and R. Greger. Properties of the K conductances of principal cells of rat cortical collecting ducts. Pflügers Arch. 420: 39-45, 1992[Medline].

31.   Stoos, B. A., A. Naray-Fejes-Toth, O. A. Carretero, S. Ito, and G. Fejes-Toth. Characterization of a mouse cortical collecting duct cell line. Kidney Int. 39: 1168-1175, 1991[Medline].

32.   Takahashi, N., K. Morishige, A. Jahangir, M. Yamada, I. Findlay, and H. Koyama. Molecular cloning and functional expression of cDNA encoding a second class of inward rectifier K channels in the mouse brain. J. Biol. Chem. 269: 23274-23279, 1994[Abstract/Free Full Text].

33.   Wang, W., A. Schwab, and G. Giebisch. Regulation of small-conductance K channel in apical membrane of rat cortical collecting tubule. Am. J. Physiol. 259 (Renal Fluid Electrolyte Physiol. 28): F494-F502, 1990[Abstract/Free Full Text].

34.   Wang, W. H., C. M. McNicholas, A. S. Segal, and G. Giebisch. A novel approach allows identification of K channels in the lateral membrane of rat CCD. Am. J. Physiol. 266 (Renal Fluid Electrolyte Physiol. 35): F813-F822, 1994[Abstract/Free Full Text].

35.   Welling, P. A., and G. Giebisch. Expression of a unique renal epithelial K channel in Xenopus oocytes (Abstract). Physiologist 35: A-5, 1992.

36.   Welling, P. A., and J. Merot. Ca-dependent regulation of a cloned CCD Kir channel, CCD-IRK3, in Xenopus oocytes (Abstract). J. Am. Soc. Nephrol. 7: 1294, 1996.

37.   Woodhull, A. M. Ionic blockage of sodium channels in nerve. J. Gen. Physiol. 61: 687-708, 1973[Abstract/Free Full Text].

38.   Yang, J., Y. N. Jan, and L. Y. Jan. Control of rectification and permeation by residues in two distinct domains in an inward rectifier K+ channel. Neuron 14: 1047-1054, 1995[Medline].

39.   Yang, J., Y. N. Jan, and L. Y. Jan. Determination of the subunit stoichiometry of an inwardly rectifying K channel. Neuron 15: 1441-1447, 1996.

40.   Zhou, H., S. S. Tate, and L. G. Palmer. Primary structure and functional properties of an epithelial K channel. Am. J. Physiol. 266 (Cell Physiol. 35): C809-C824, 1994[Abstract/Free Full Text].


AJP Renal Physiol 273(5):F825-F836
0363-6127/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Frindt, A. Shah, J. Edvinsson, and L. G. Palmer
Dietary K regulates ROMK channels in connecting tubule and cortical collecting duct of rat kidney
Am J Physiol Renal Physiol, February 1, 2009; 296(2): F347 - F354.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Lachheb, F. Cluzeaud, M. Bens, M. Genete, H. Hibino, S. Lourdel, Y. Kurachi, A. Vandewalle, J. Teulon, and M. Paulais
Kir4.1/Kir5.1 channel forms the major K+ channel in the basolateral membrane of mouse renal collecting duct principal cells
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1398 - F1407.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Alewine, B.-y. Kim, V. Hegde, and P. A. Welling
Lin-7 targets the Kir 2.3 channel on the basolateral membrane via a L27 domain interaction with CASK
Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1733 - C1741.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. A. Gray, G. Frindt, Y.-Y. Zhang, and L. G. Palmer
Basolateral K+ conductance in principal cells of rat CCD
Am J Physiol Renal Physiol, March 1, 2005; 288(3): F493 - F504.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. C. Hebert, G. Desir, G. Giebisch, and W. Wang
Molecular Diversity and Regulation of Renal Potassium Channels
Physiol Rev, January 1, 2005; 85(1): 319 - 371.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welling, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welling, P. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online