Vol. 273, Issue 6, F892-F898, December 1997
Regulation of glomerular and proximal tubule renin mRNA by
chronic changes in dietary NaCl
Julia E.
Tank,
William L.
Henrich, and
Orson W.
Moe
Department of Medicine, Oregon Health Sciences University, Portland,
Oregon 97201-3098; Department of Medicine, Medical College of Ohio,
Toledo, Ohio 43699-0008; and Department of Internal Medicine,
Department of Veterans Affairs and University of Texas Southwestern
Medical Centers, Dallas, Texas 75235-8856
 |
ABSTRACT |
Renal adaptations
to chronic changes in dietary NaCl and extracellular fluid volume
involve both glomerular and tubular mechanisms that result in
preservation of glomerular filtration rate and modifications of renal
tubular transport to secure external NaCl balance. Although the
systemic renin-angiotensin system (RAS) mediates some of these
responses, the possible contributions of local glomerular and proximal
tubule RASs in these adaptations have not been examined. Thus, in this
study, glomeruli and proximal tubules were microdissected from rats
adapted to high (4.0%)-, normal (0.5%), or low (0.01%)-NaCl diets,
and renin mRNA was measured using quantitative competitive reverse
transcription-polymerase chain reaction. After 4 days of the diets,
glomerular renin mRNA abundance was increased 100% by the low-NaCl
diet (P < 0.05) and suppressed 50%
(P < 0.01) by the high-NaCl diet
compared with controls. Renin mRNA in proximal tubules was stimulated
230% (P < 0.05) by the low-NaCl
diet and tended to be suppressed (68% decrease, not significant) by
the high-NaCl diet. When the high-NaCl diet was continued for 2 wk,
proximal tubule renin mRNA was suppressed by 89%
(P < 0.05). This study provides
evidence that glomerular and proximal tubule renin transcript levels
are regulated by chronic changes in dietary NaCl, suggesting that local
RASs contribute to the renal adaptations in response to chronic
alterations in NaCl.
extracellular fluid volume; blood pressure; autocrine
renin-angiotensin system
 |
INTRODUCTION |
THE MAJOR DEFENSE of extracellular fluid volume (ECFV)
homeostasis is the ability of the kidney to regulate NaCl excretion in
response to changes in dietary NaCl intake. This adaptive response restores whole organism NaCl balance, albeit at the expense of either
an expanded or contracted ECFV (33). In the glomerulus, chronic dietary
NaCl restriction leads to increased glomerular capillary hydraulic
pressure and decreased glomerular plasma flow while maintaining single
nephron glomerular filtration rate (35). This effect is due to efferent
arteriolar constriction and is largely mediated by angiotensin (ANG) II
(35). These hemodynamic changes lead to alterations in peritubular
factors that favor enhanced proximal tubule solute and water
reabsorption (33). In addition, various neural and hormonal factors
also regulate proximal tubule transport directly. ANG II, for example,
is a potent stimulator of proximal tubule NaCl and
HCO3 absorption (23, 36) and may
contribute to the increased proximal tubule transport in response to
chronic changes in ECFV.
Circulating ANG II levels are elevated in states of dietary NaCl
restriction and suppressed in states of dietary NaCl excess, and they
likely mediate many of the glomerular and tubular adaptations described
above (14, 18). Recently, local intrarenal renin-ANG systems (RASs)
have been described in the glomerulus and proximal tubule of the kidney
(9, 10, 26, 31, 36) and, therefore, may contribute to the adaptive
modifications that enable the kidney to conserve or excrete NaCl.
Although the potential exists for the glomerulus and proximal tubule to
generate ANG II and regulate glomerular hemodynamics and proximal
tubule transport in an autocrine or paracrine fashion, the functional
significance of these local RASs is not fully defined. The present
study examines the effect of dietary NaCl on the abundance of renin
transcript in microdissected glomeruli and proximal tubules by
quantitative reverse transcription-polymerase chain reaction (RT-PCR).
Chronic dietary NaCl restriction increases, whereas chronic dietary
NaCl excess decreases, glomerular and proximal tubule renin transcript
abundance. These findings lend support to the hypothesis that the local
glomerular and proximal tubule RASs play physiological roles in renal
regulation of ECFV.
 |
METHODS |
Experimental animals.
Pathogen-free male Sprague-Dawley rats weighing 150-175 g (Sasco,
Omaha, NE) were allowed access to tap water ad libitum and were
maintained on either low (0.01%)-, normal (0.5%), or high (4%)-NaCl
diets for 4 days. The contents of the diets were otherwise identical
(Harlan-Teklad; 0.01% TD94208, 0.5% TD90155, 4%
TD90156). After 3 days of equilibration on a normal NaCl diet,
animals were started on the appropriate experimental diets.
Twenty-four-hour urine collections were made on the fourth day of the
experimental diets for urinary Na excretion and creatinine clearance
(CCr) assessment; animals were
anesthetized with pentobarbital sodium (50-60 mg/kg ip; Abbott
Laboratories, Chicago, IL) and prepared for either microdissection of
glomeruli and proximal tubules or for blood sampling via aortic
puncture. A separate group of animals was maintained on each of the
diets for 2 wk to examine the effect of more sustained dietary NaCl
excess on proximal tubule renin expression.
Microdissection of glomeruli and proximal
tubules.
The left kidney was perfused with a
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid-buffered 1% collagenase-0.5% bovine serum albumin solution as
previously described (26, 39). Cortical slices were prepared and
incubated in the same solution for 30 min at 37°C. Glomeruli and
proximal tubule segments were dissected at 4°C, and tubule lengths
were measured with a calibrated eyepiece micrometer. Meticulous care
was taken to remove all visible attached arteriolar material and
juxtaglomerular (JG) apparatus. Any glomeruli deemed equivocal of
attached material were discarded. Dissection time was limited to 1 h.
Samples were dropped into 1 ml of GTC buffer (4 M guanidinium
thiocyanate, 25 mM sodium acetate, pH 6.0, 0.8%
-mercaptoethanol),
snap frozen in liquid nitrogen, and stored at
70°C until RNA
isolation. As a control for background contamination, 30 µl of
dissection solution were sampled after dissection and subjected to
identical RNA isolation, cDNA synthesis, and PCR procedures.
RNA isolation and cDNA synthesis.
Tubular and glomerular RNA were isolated by a modification (39) of the
method described by Chen et al. (10). Briefly, 20 µg of
Escherichia coli rRNA (Boehringer
Mannheim, Indianapolis, IN) were added to samples as a carrier, and the
samples were layered onto a discontinuous CsCl gradient (1 ml 97%
CsCl, bottom; 200 µl 40% CsCl, top) and centrifuged (Beckman TL-100
ultracentrifuge; TLS-55 rotor; 55,000 revolutions/min, 132,000 g; 16°C; 6 h); RNA pellets were resuspended in
0.3 M sodium acetate and were ethanol precipitated. cDNA was
synthesized in a buffer containing 3 mM MgCl2, 5 µM
oligo(dT)15, 40 U RNasin, 1 mM
deoxynucleotide triphosphate set (dNTPs), and 5 mM
dithiothreitol. The mixture was incubated at 65°C for 5 min and
chilled on ice before addition of 200 U of Moloney murine leukemia
virus RT (Promega, Madison, WI). RT was omitted in minus RT controls.
RT profile was as follows: annealing at 25°C for 5 min, extension
at 42°C for 60 min, and termination at 99°C for 5 min.
Renin quantitative competitive PCR.
PCR reactions were performed in a thermal cycler (MJ Research,
Watertown, MA) in a total volume of 50 µl containing 0.2 µM primers
(forward, 5' TGCCACCTTGTTGTGTGAGG 3'; reverse, 5'
ACCCGATGCGATTGTTATGCCG 3'), 4 mM
MgCl2, 200 µM dNTP, 1×
enzyme buffer, and 2.5 U of Taq DNA
polymerase (all from Promega). The primers were previously shown to be
in separate exons by the absence of a PCR product of predicted size in
amplification of rat genomic DNA (data not shown). PCR profile was as
follows: hot start at 94°C for 2 min; 35 cycles at 94°C for 30 s, 60°C for 60 s, and 72°C for 75 s; and final extension at
72°C for 5 min. Negative controls included dissection medium
subjected to RT-PCR, water subjected to PCR, and aliquots from each RNA
containing sample with RT omitted. All negative controls failed to
generate PCR products (data not shown). Preliminary experiments showed
that 35 cycles of PCR are well within the linear range, and no
saturation was observed for renin from dissected glomeruli and proximal
tubules.
A mutant renin template [internal 142-base pair (bp)
deletion] was prepared from renin cDNA by composite primers as an
internal standard, as described previously (39). Aliquots of sample
cDNA from one-half glomerulus (0.5 of 1 ml of GTC lysate was used) or 3 mm of proximal tubule were competitively amplified against a fivefold
step dilution series of mutant templates and consistently produced two
bands of predicted lengths (renin 372 bp, mutant 232 bp). PCR reaction
products were size fractionated by agarose gel electrophoresis,
transferred to nylon membranes, and probed with a
32P-end-labeled internal
oligonucleotide common to both templates (5'
GCTTGCATGATCAACTGCAGG 3'). Hybridizations were performed exactly as described previously (39). PCR products were quantified by autoradiographic densitometry, and the ratio of renin to mutant product
was plotted against the starting amount of mutant template. Linear
regression lines were fitted to the data, and the number of molecules
of renin cDNA in each sample was determined by a renin-to-mutant ratio
of one. In pilot studies, the ability of the quantitative RT-PCR to
reliably detect known differences in starting amounts of cDNA was
verified and demonstrated to be accurate in discerning differences as
small as 50% (data not shown).
Analytic methods and statistical
analysis.
All data are expressed as means ± SE. Comparisons between low-,
normal, and high-NaCl groups were performed, using one-way analysis of
variance. The unpaired Student's
t-test was used for comparison between
two groups. Statistical significance was defined as
P < 0.05.
 |
RESULTS |
Whole animal data.
The effect of varying dietary NaCl on renal Na excretion is presented
in Table 1. After 4 days of a low-, normal,
or high-salt diet, no differences were detected in body weight, kidney
weight, or plasma electrolytes. Urinary Na excretion was
extremely low in the low-NaCl group and increased appropriately in the
normal and high-salt groups. CCr
was increased in the normal salt group compared with the low- and
high-salt groups. The reason for this small increase in
CCr is unclear. After 2 wk of the
experimental protocol, animals on 0.01% NaCl diets had markedly
reduced food consumption and body weights (body weight: 4% NaCl, 238 ± 4 g; 0.5% NaCl, 250 ± 4 g; 0.01% NaCl, 176 ± 4 g;
P < 0.001, 0.01% NaCl vs. others)
and significant hypofiltration
(CCr: 4% NaCl, 1.24 ± 0.12 ml/min; 0.5% NaCl, 1.60 ± 0.20 ml/min vs. 0.01% NaCl, 0.81 ± 0.20 ml/min; P < 0.01, 0.01% vs.
others), whereas animals on the 4% NaCl diet had body weights and
CCr comparable with controls.
Renin transcript levels in microdissected glomeruli
and proximal tubules.
To investigate whether local intrarenal renin gene expression is
regulated by dietary NaCl, renin mRNA was measured in microdissected glomeruli and proximal tubule, using quantitative RT-PCR. Figure 1 shows the Southern blots
(A) and linear quantitation
(B) from one representative
experiment from glomeruli microdissected after 4 days of the three
diets. NaCl restriction markedly increased, whereas NaCl excess
decreased, glomerular renin gene expression. Figure
2 summarizes the data from all the
experiments. A low-NaCl diet increased glomerular renin expression by
100%, whereas a high-NaCl diet inhibited it by 50% (in
103 copies/glomerulus: 0.01%
NaCl, 1,312 ± 169; 0.5% NaCl, 678 ± 106; 4% NaCl, 299 ± 67).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Competitive quantitative polymerase chain reaction (PCR) from
representative experiments in glomeruli after 4 days of 0.01%, 0.5%,
and 4% NaCl diet. Aliquots of cDNA from one-half glomerulus were each
coamplified against a 5-fold step dilution series of mutant renin
template. A: Southern blots. R, PCR
product from tissue renin cDNA [372 base pairs (bp)]; M,
PCR product from mutant renin template (232 bp). M1-M4 represent
starting number of mutant copies: M1 = 545,000; M2 = 109,000; M3 = 21,800; M4= 4,360. B: linear
regression of renin-to-mutant ratios. Copies of tissue renin cDNA per
one-half glomerulus were calculated from a renin-to-mutant ratio of
1.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 2.
Summary of all experiments on effect of 4 days of dietary NaCl
variation on glomerular renin transcript levels. Results are means ± SE; n = no. of animals studied.
Glom, glomerulus.
|
|
In the proximal tubule, 4 days of dietary NaCl restriction resulted in
upregulation of proximal tubule renin mRNA. One set of representative
Southern blots and linear quantitation is shown in Fig.
3, A and
B. Figure
4 shows the summary of all the experiments. A low-NaCl diet increased proximal tubule renin expression by 230%
(P < 0.01), whereas a high-NaCl diet
inhibited renin expression by 68%, a difference that was not
statistically significant (in 103
copies/mm tubule: 0.01% NaCl, 63.2 ± 15; 0.5% NaCl, 18.8 ± 7; 4% NaCl, 5.9 ± 2.5).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 3.
Competitive quantitative PCR from representative experiments in
proximal tubules after 4 days of 0.01%, 0.5%, and 4% NaCl diet.
Aliquots of cDNA from 3 mm of proximal tubules were each coamplified
against a 5-fold step dilution series of mutant renin template.
A: Southern blots (see legend to Fig.
1 for explanation of M1-M4). B:
linear regression of renin-to-mutant ratios. Copies of tissue renin
cDNA per 3 mm of proximal tubules were calculated from a
renin-to-mutant ratio of 1.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Summary of all experiments on effect of 4 days of dietary NaCl
variation on proximal tubule (PT) renin transcript levels. Results are
means ± SE; n = no. of animals
studied. NS, not significant.
|
|
To see whether significant downregulation of proximal tubule renin
occurred later in the adaptation, quantitative RT-PCR was performed in
a separate group of animals after 2 wk of normal and high-NaCl diets.
After this more prolonged dietary NaCl excess, proximal tubule renin
mRNA was clearly suppressed (in
103 copies/mm tubule: 0.05% NaCl,
18.9 ± 7.0 vs. 4% NaCl, 2.0 ± 0.8; P < 0.05; Figs.
5 and 6).
Because the effect of low dietary NaCl was evident after 4 days as well
as the confounding complications of poor somatic growth and
hypofiltration associated with prolonged dietary Na restriction,
microdissection and quantitation of proximal tubule renin mRNA were not
performed in these animals.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Southern blots (top) and linear
regression quantitation (bottom) of
competitive quantitative PCR from representative experiments in PT
after 2 wk of 0.5% and 4% NaCl diet. Copies of tissue renin cDNA per
3 mm of PT were calculated from a renin-to-mutant ratio of 1. See
legend to Fig. 1 for explanation of M1-M4.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6.
Summary data of all experiments on effect of 2 wk of normal or
high-NaCl diet on PT renin transcript levels. Results are means ± SE; n = no. of animals studied.
* P < 0.05.
|
|
 |
DISCUSSION |
Expression of angiotensinogen, ANG-converting enzyme (ACE), renin, and
ANG II receptors, which constitute full components of localized tissue
RASs, has been described in cardiac muscle, adrenal glands, vascular
smooth muscle, and in the kidney in the glomerulus and the proximal
tubule (7, 9, 10, 12, 26, 28, 31, 36, 40). In the kidney, ANG II is a
key regulator of efferent and afferent arteriolar resistances and the
capillary ultrafiltration coefficient in the glomeruli (4, 19, 27). In
addition, ANG II stimulates the
Na+/H+
exchanger, Na-3HCO3 cotransporter,
and
Na+-K+-ATPase
in the proximal tubule (8, 16, 17, 19, 32). Theoretically, all these
hemodynamic and transport functions can be regulated in an
autocrine/paracrine fashion by the local RASs in the glomerulus and
proximal tubule. Quan and Baum (29) recently used in vivo
microperfusion to show that either luminal ANG II receptor blockade or
ACE inhibition decreases proximal tubule volume absorption, an effect
that can be restored by luminal ANG II application. Their
data strongly support a functional role of the proximal tubule RAS in
transport regulation. Another approach is to examine for changes in
local RASs in response to physiological perturbations. Although the
evidence is only circumstantial, this approach has the distinct
advantage of observing the operation of the local RAS in its intact
physiological state. A number of important conclusions have been drawn
about the role of the intracardiac RAS in myocardial function and the
coronary circulation based on correlative studies in whole organisms
(11, 22).
Chronic ECFV contraction elicits a myriad of adaptive responses in the
kidney. In the glomerular microcirculation, despite a fall in renal
plasma flow, single nephron glomerular filtration rate (SNGFR) is
sustained by preferential efferent arteriolar constriction (35). In
addition to maintaining SNGFR, the increased efferent arteriolar
resistance and filtration fraction also set the peritubular conditions
to a state conducive to increased proximal tubule NaCl reabsorption
(33). A large part of this chronic adaptation has been shown to be ANG
II dependent (35). The novel finding in the present study is the
adaptation observed in the glomerular RAS. However, an important
potential caveat of these data is possible contamination of glomeruli
with arterioles and/or JG cells, despite vigilant efforts in
dissection. Because renin from either the JG apparatus or glomerular
arterioles is stimulated by dietary NaCl restriction, one can argue
that contamination of glomeruli by these tissues can explain the
current findings. We believe this is unlikely for two reasons. First,
the amount of renin mRNA in the arterioles and JG cells is much higher
than in glomeruli. Tissue contamination, which is a random event,
should introduce large variations in the copy number of renin mRNA in the glomerular samples. However, the intersample variations in glomerular renin were no greater than those of the dissected proximal tubules, which clearly were not contaminated with other
renin-containing tissues. Second, using the identical dissection
techniques and RT-PCR, we previously detected activation of the
glomerular RAS in the face of suppressed JG renin. The demonstration of
this dissociation would not have been possible if glomeruli were
significantly contaminated with JG cells.
Adaptations intrinsic to the proximal tubule are also demonstrated in
the in vitro microperfused tubule and cortical membrane preparations in
states of chronic changes in ECFV. Chronic volume contraction increases
proximal tubule HCO3 and water
absorptive capacity and apical membrane
Na+/H+
exchanger activity (24, 25), whereas volume expansion inhibits apical
membrane
Na+/H+
exchanger activity and basolateral membrane
Na+-K+-ATPase
activity (3, 21). It is quite plausible that ANG II is responsible for
a majority of both the glomerular and tubular adaptations in response
to chronic changes in dietary NaCl. In the uninephrectomy model, we
postulated that the local glomerular and proximal tubule RASs may be
primarily responsible for the changes in glomerular hemodynamics and
proximal tubule transport, because the circulating RAS is
actually suppressed under these conditions (39). Because the systemic
RAS is activated by chronic NaCl depletion and suppressed by chronic
NaCl excess, the present studies cannot segregate the relative
contributions of the endocrine and the local RASs to the renal
adaptation. Renal tissue ACE activity as well as ANG I and ANG II
levels are all increased by chronic salt restriction and suppressed by
chronic salt excess (14). Although these studies used whole kidney
homogenates and hence cannot localize the exact source of the increase
in ACE, ANG I, and ANG II, the findings are compatible with regulation
of intrarenal RASs by dietary salt. Inglefinger et al. (20) showed that
chronic dietary NaCl restriction increases proximal tubule
angiotensinogen transcript levels by in situ hybridization. Singh et
al. (37) showed an inverse relationship between dietary Na and
angiotensinogen transcript levels in microdissected proximal convoluted
and proximal straight tubules. The regulation of glomerular and
proximal tubule renin mRNA by dietary NaCl now provides an additional
example of local RASs responding to physiological perturbations in
directions that are compatible with the observed changes in glomerular
and proximal tubule function. In contrast to chronic changes in ECFV, acute changes in ECFV do not lead to alterations in proximal tubule luminal ANG II levels (6) or apical membrane
Na+/H+
exchanger activity (25), suggesting differential mechanisms of
regulation of proximal tubule transport under acute and chronic situations.
The concept of autocrine/paracrine regulation of renal tubular function
is not unique to the RAS. Both acute and chronic changes in ECFV have
been shown to modulate proximal tubule dopamine production, which in
turn regulates proximal tubule solute transport via receptor-mediated actions on the proximal tubule apical
Na+/H+
exchanger and basolateral membrane
Na+-K+-ATPase
(3, 12, 13, 34). Regulation of renal tubular prostaglandin production
and prostaglandin action on renal tubular transport are other examples
of an autocrine/paracrine system (5, 38). Finally, a potent
autocrine/paracrine hormone in the proximal tubule that can serve a
similar role is endothelin (15). The regulation of endothelin
expression by acute/chronic changes in ECFV has not been examined to
date.
In summary, these studies show that the local RASs in the glomerulus
and proximal tubule respond to changes in dietary NaCl. Chronic dietary
NaCl excess suppresses, whereas chronic dietary NaCl restriction
stimulates, expression of renin transcript in these sites. These
findings are congruent with the notion that local RASs participate in
chronic ECFV homeostasis and NaCl balance by mediating changes in
glomerular hemodynamics and proximal tubule transport.
 |
ACKNOWLEDGEMENTS |
We acknowledge the technical expertise of Elizabeth McAllister and
Audrey Eskue. We are grateful to Drs. Robert A. Star and Richard
Scheuermann for helpful discussions.
 |
FOOTNOTES |
This work was supported by the Department of Veterans Affairs Research
Service (W. L. Henrich and O. W. Moe) and the National Institute of
Diabetes and Digestive and Kidney Diseases (DK-48482 to O. W. Moe). J. E. Tank was a recipient of an National Research Service Award from the
National Institutes of Health (1F32-DK-08970).
Address for reprint requests: O. W. Moe, Dept. of Medicine, Univ. of
Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX
75225-8856.
Received 4 June 1997; accepted in final form 31 July 1997.
 |
REFERENCES |
1.
Alexander, R. W.,
J. R. Gill, Jr.,
H. Yamabe,
W. Lovenberg,
and
H. R. Keiser.
Effects of dietary sodium and of acute saline infusion on the interrelationship between dopamine excretion and adrenergic activity in man.
J. Clin. Invest.
54:
194-200,
1974.
2.
Bella-Reuse, E.,
Y. Higashi,
and
Y. Kaneda.
Dopamine decreases fluid absorption in the rabbit proximal tubule.
Miner. Electrolyte Metab.
9:
147-150,
1983[Medline].
3.
Bertorello, A.,
T. Hokfelt,
M. Goldstein,
and
A. Aperia.
Proximal tubule Na+-K+-ATPase activity is inhibited during high-salt diet: evidence for DA-mediated effect.
Am. J. Physiol.
254 (Renal Fluid Electrolyte Physiol. 23):
F795-F801,
1988[Abstract/Free Full Text].
4.
Blantz, R. C.,
K. S. Konnen,
and
B. J. Tucker.
Angiotensin II effects upon the glomerular microcirculation and ultrafiltration coefficient of the rat.
J. Clin. Invest.
57:
419-434,
1976.
5.
Bonvalet, J. P.,
P. Pradelles,
and
N. Farman.
Segmental synthesis and actions of prostaglandins along the nephron.
Am. J. Physiol.
253 (Renal Fluid Electrolyte Physiol. 22):
F377-F387,
1987[Abstract/Free Full Text].
6.
Braam, B.,
K. D. Mitchell,
J. Fox,
and
L. G. Navar.
Proximal tubular secretion of angiotensin II in rats.
Am. J. Physiol.
264 (Renal Fluid Electrolyte Physiol. 33):
F891-F898,
1993[Abstract/Free Full Text].
7.
Campbell, D. J.
Circulating and tissue angiotensin systems.
J. Clin. Invest.
79:
1-6,
1987.
8.
Cano, A.,
R. T. Miller,
R. J. Alpern,
and
P. A. Preisig.
Angiotensin II stimulation of Na-H antiporter activity is cAMP independent in OKP cells.
Am. J. Physiol.
266 (Cell Physiol. 35):
C1603-C1608,
1994[Abstract/Free Full Text].
9.
Chansel, D.,
J. Dussaule,
N. Ardaillou,
and
R. Ardaillou.
Identification and regulation of renin in human cultured mesangial cells.
Am. J. Physiol.
252 (Renal Fluid Electrolyte Physiol. 21):
F32-F38,
1987[Abstract/Free Full Text].
10.
Chen, M.,
M. Harris,
A. Smart,
X. He,
M. Kretzler,
J. Briggs,
and
J. Schnermann.
Renin and renin mRNA in proximal tubules of the rat kidney.
J. Clin. Invest.
94:
237-243,
1994.
11.
Dostal, D. E.,
and
K. M. Baker.
Evidence for a role of an intracardiac renin-angiotensin system in normal and failing hearts.
Trends Cardiovasc. Med.
3:
67-74,
1993.
12.
Dzau, V. J. Circulating versus local
renin-angiotensin systems in cardiovascular homeostasis.
Circulation 77, Suppl. 19: 1-4, 1988.
13.
Felder, C. C.,
T. Campbell,
F. Albrecht,
and
P. A. Jose.
Dopamine inhibits Na+-H+ exchanger activity in renal BBMV by stimulation of adenylate cyclase.
Am. J. Physiol.
259 (Renal Fluid Electrolyte Physiol. 28):
F297-F303,
1990[Abstract/Free Full Text].
14.
Fox, J.,
S. Guan,
A. A. Hymel,
and
L. G. Navar.
Dietary Na and ACE inhibition effects on renal tissue angiotensin I and II and ACE activity in rats.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F902-F909,
1992[Abstract/Free Full Text].
15.
Garcia, N. H.,
and
J. L. Garvin.
Endothelin's biphasic effect on fluid absorption in the proximal straight tubule and its inhibitory cascade.
J. Clin. Invest.
93:
2572-2577,
1994.
16.
Garvin, J. L.
Angiotensin stimulates HCO3 transport and Na-K-ATPase in rat proximal straight tubule.
J. Am. Soc. Nephrol.
1:
1146-1152,
1991[Abstract].
17.
Geibel, J. G.,
G. Giebisch,
and
W. F. Boron.
Angiotensin II stimulates both Na/H exchange and Na/HCO3 cotransport in the rabbit proximal tubule.
Proc. Natl. Acad. Sci. USA
87:
7917-7920,
1990[Abstract/Free Full Text].
18.
Hall, J. E.,
A. C. Guyton,
M. J. Smith, Jr.,
and
T. G. Coleman.
Chronic blockade of angiotensin II formation during sodium deprivation.
Am. J. Physiol.
237 (Renal Fluid Electrolyte Physiol. 6):
F424-F432,
1979[Abstract/Free Full Text].
19.
Ichikawa, I.,
and
R. C. Harris.
Angiotensin actions in the kidney: renewed insight into the old hormone.
Kidney Int.
40:
583-596,
1991[Medline].
20.
Inglefinger, J. R.,
R. E. Pratt,
K. E. Ellison,
and
V. J. Dzau.
Sodium regulation of angiotensin mRNA expression in rat kidney cortex and medulla.
J. Clin. Invest.
78:
1311-1315,
1986.
21.
Lewis, J. L.,
and
D. G. Warnock.
Renal apical membrane sodium-hydrogen exchange in genetic salt-sensitive hypertension.
Hypertension
24:
491-498,
1994[Abstract/Free Full Text].
22.
Lindpaintner, K.,
and
D. Ganten.
The cardiac renin-angiotensin system: a synopsis of current experimental and clinical data.
News Physiol. Sci.
6:
227-232,
1991.[Abstract/Free Full Text]
23.
Liu, F.-Y.,
and
M. G. Cogan.
Angiotensin II: a potent regulator of acidification in the rat early proximal convoluted tubule.
J. Clin. Invest.
80:
272-275,
1987.
24.
Maddox, D. A.,
and
J. Gennari.
Load dependence of proximal tubule bicarbonate reabsorption in chronic metabolic alkalosis in the rat.
J. Clin. Invest.
77:
709-716,
1986.
25.
Moe, O. W.,
A. Tejedor,
M. Levi,
D. W. Seldin,
P. A. Preisig,
and
R. J. Alpern.
Dietary NaCl modulates Na+-H+ antporter activity in renal cortical apical membrane vesicles.
Am. J. Physiol.
260 (Renal Fluid Electrolyte Physiol. 29):
F130-F137,
1991[Abstract/Free Full Text].
26.
Moe, O. W.,
K. Ujiie,
R. A. Star,
R. T. Miller,
J. Widell,
R. J. Alpern,
and
W. L. Henrich.
Renin expression in the renal proximal tubule.
J. Clin. Invest.
91:
774-779,
1993.
27.
Navar, J. G.,
and
L. Rosivall.
Contribution of the renin-angiotensin system to the control of intrarenal hemodynamics.
Kidney Int.
25:
857-868,
1984[Medline].
28.
Paul, M.,
J. Wagner,
and
V. J. Dzau.
Gene expression of the renin angiotensin system in human tissues.
J. Clin. Invest.
91:
2058-2064,
1993.
29.
Quan, A.,
and
M. Baum.
Endogenous production of angiotensin II modulates rat proximal tubule transport.
J. Clin. Invest.
97:
2878-2882,
1996[Medline].
30.
Rosenberg, M.,
S. Kren,
and
T. Hostetter.
Glomerular renin synthesis and storage in the remnant kidney in the rat.
Kidney Int.
40:
677-683,
1991[Medline].
31.
Rosivall, L.,
R. Taugner,
and
L. G. Navar.
Intrarenal formation of angiotensin II and its effect on renal hemodynamics.
In: Proceedings of the 10th International Congress of Nephrology, edited by A. M. Davison. Philadelphia, PA: Bailliere, 1988, p. 46-56.
32.
Saccomani, G.,
K. D. Mitchell,
and
L. G. Navar.
Angiotensin II stimulation of Na+-H+ exchange in proximal tubule cells.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F1188-F1196,
1990[Abstract/Free Full Text].
33.
Seldin, D. W.,
P. A. Preisig,
and
R. J. Alpern.
Regulation of proximal reabsorption by effective arterial blood volume.
Semin. Nephrol.
11:
212-219,
1991[Medline].
34.
Seri, I.,
B. C. Kone,
S. R. Gullans,
A. Aperia,
and
B. M. Brenner.
Locally formed dopamine inhibits Na+-K+-ATPase in rat renal cortical tubule cells.
Am. J. Physiol.
255 (Renal Fluid Electrolyte Physiol. 24):
F666-F673,
1988[Abstract/Free Full Text].
35.
Schor, N.,
I. Ichikawa,
and
B. M. Brenner.
Glomerular adaptations to chronic dietary salt restriction or excess.
Am. J. Physiol.
238 (Renal Fluid Electrolyte Physiol. 7):
F428-F436,
1980[Abstract/Free Full Text].
36.
Schuster, V. L.,
J. P. Kokko,
and
H. R. Jacobson.
Angiotensin II directly stimulates sodium transport in rabbit proximal convoluted tubule.
J. Clin. Invest.
73:
507-515,
1984.
37.
Singh, I.,
M. Grams,
W.-H. Wang,
T. Yang,
P. Killen,
A. Smart,
J. Schnerman,
and
J. P. Briggs.
Coordinate regulation of renal expression of nitric oxide synthase, renin, and angiotensinogen mRNA by dietary salt.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F1027-F1037,
1996[Abstract/Free Full Text].
38.
Stokes, J. B.,
and
J. P. Kokko.
Inhibition of Na transport by prostaglandin E2 across the isolated, perfused rabbit collecting tubule.
J. Clin. Invest.
59:
1099-1104,
1977.
39.
Tank, J. E.,
O. W. Moe,
R. A. Star,
and
W. L. Henrich.
Differential regulation of rat glomerular and proximal tubule renin mRNA following uninephrectomy.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F776-F783,
1996[Abstract/Free Full Text].
40.
Unger, T., P. Gohlke, M. Paul, and R. Rettig. Tissue
renin-angiotensin systems: fact or fiction? J. Cardiovasc. Pharmacol. 18, Suppl. 2: S20-S25,
1991.
AJP Renal Physiol 273(6):F892-F898
0363-6127/97 $5.00
Copyright © 1997 the American Physiological Society