AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F892-F898, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tank, J. E.
Right arrow Articles by Moe, O. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tank, J. E.
Right arrow Articles by Moe, O. W.
Vol. 273, Issue 6, F892-F898, December 1997

Regulation of glomerular and proximal tubule renin mRNA by chronic changes in dietary NaCl

Julia E. Tank, William L. Henrich, and Orson W. Moe

Department of Medicine, Oregon Health Sciences University, Portland, Oregon 97201-3098; Department of Medicine, Medical College of Ohio, Toledo, Ohio 43699-0008; and Department of Internal Medicine, Department of Veterans Affairs and University of Texas Southwestern Medical Centers, Dallas, Texas 75235-8856

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Renal adaptations to chronic changes in dietary NaCl and extracellular fluid volume involve both glomerular and tubular mechanisms that result in preservation of glomerular filtration rate and modifications of renal tubular transport to secure external NaCl balance. Although the systemic renin-angiotensin system (RAS) mediates some of these responses, the possible contributions of local glomerular and proximal tubule RASs in these adaptations have not been examined. Thus, in this study, glomeruli and proximal tubules were microdissected from rats adapted to high (4.0%)-, normal (0.5%), or low (0.01%)-NaCl diets, and renin mRNA was measured using quantitative competitive reverse transcription-polymerase chain reaction. After 4 days of the diets, glomerular renin mRNA abundance was increased 100% by the low-NaCl diet (P < 0.05) and suppressed 50% (P < 0.01) by the high-NaCl diet compared with controls. Renin mRNA in proximal tubules was stimulated 230% (P < 0.05) by the low-NaCl diet and tended to be suppressed (68% decrease, not significant) by the high-NaCl diet. When the high-NaCl diet was continued for 2 wk, proximal tubule renin mRNA was suppressed by 89% (P < 0.05). This study provides evidence that glomerular and proximal tubule renin transcript levels are regulated by chronic changes in dietary NaCl, suggesting that local RASs contribute to the renal adaptations in response to chronic alterations in NaCl.

extracellular fluid volume; blood pressure; autocrine renin-angiotensin system

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THE MAJOR DEFENSE of extracellular fluid volume (ECFV) homeostasis is the ability of the kidney to regulate NaCl excretion in response to changes in dietary NaCl intake. This adaptive response restores whole organism NaCl balance, albeit at the expense of either an expanded or contracted ECFV (33). In the glomerulus, chronic dietary NaCl restriction leads to increased glomerular capillary hydraulic pressure and decreased glomerular plasma flow while maintaining single nephron glomerular filtration rate (35). This effect is due to efferent arteriolar constriction and is largely mediated by angiotensin (ANG) II (35). These hemodynamic changes lead to alterations in peritubular factors that favor enhanced proximal tubule solute and water reabsorption (33). In addition, various neural and hormonal factors also regulate proximal tubule transport directly. ANG II, for example, is a potent stimulator of proximal tubule NaCl and HCO3 absorption (23, 36) and may contribute to the increased proximal tubule transport in response to chronic changes in ECFV.

Circulating ANG II levels are elevated in states of dietary NaCl restriction and suppressed in states of dietary NaCl excess, and they likely mediate many of the glomerular and tubular adaptations described above (14, 18). Recently, local intrarenal renin-ANG systems (RASs) have been described in the glomerulus and proximal tubule of the kidney (9, 10, 26, 31, 36) and, therefore, may contribute to the adaptive modifications that enable the kidney to conserve or excrete NaCl. Although the potential exists for the glomerulus and proximal tubule to generate ANG II and regulate glomerular hemodynamics and proximal tubule transport in an autocrine or paracrine fashion, the functional significance of these local RASs is not fully defined. The present study examines the effect of dietary NaCl on the abundance of renin transcript in microdissected glomeruli and proximal tubules by quantitative reverse transcription-polymerase chain reaction (RT-PCR). Chronic dietary NaCl restriction increases, whereas chronic dietary NaCl excess decreases, glomerular and proximal tubule renin transcript abundance. These findings lend support to the hypothesis that the local glomerular and proximal tubule RASs play physiological roles in renal regulation of ECFV.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Experimental animals. Pathogen-free male Sprague-Dawley rats weighing 150-175 g (Sasco, Omaha, NE) were allowed access to tap water ad libitum and were maintained on either low (0.01%)-, normal (0.5%), or high (4%)-NaCl diets for 4 days. The contents of the diets were otherwise identical (Harlan-Teklad; 0.01% TD94208, 0.5% TD90155, 4% TD90156). After 3 days of equilibration on a normal NaCl diet, animals were started on the appropriate experimental diets. Twenty-four-hour urine collections were made on the fourth day of the experimental diets for urinary Na excretion and creatinine clearance (CCr) assessment; animals were anesthetized with pentobarbital sodium (50-60 mg/kg ip; Abbott Laboratories, Chicago, IL) and prepared for either microdissection of glomeruli and proximal tubules or for blood sampling via aortic puncture. A separate group of animals was maintained on each of the diets for 2 wk to examine the effect of more sustained dietary NaCl excess on proximal tubule renin expression.

Microdissection of glomeruli and proximal tubules. The left kidney was perfused with a N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid-buffered 1% collagenase-0.5% bovine serum albumin solution as previously described (26, 39). Cortical slices were prepared and incubated in the same solution for 30 min at 37°C. Glomeruli and proximal tubule segments were dissected at 4°C, and tubule lengths were measured with a calibrated eyepiece micrometer. Meticulous care was taken to remove all visible attached arteriolar material and juxtaglomerular (JG) apparatus. Any glomeruli deemed equivocal of attached material were discarded. Dissection time was limited to 1 h. Samples were dropped into 1 ml of GTC buffer (4 M guanidinium thiocyanate, 25 mM sodium acetate, pH 6.0, 0.8% beta -mercaptoethanol), snap frozen in liquid nitrogen, and stored at -70°C until RNA isolation. As a control for background contamination, 30 µl of dissection solution were sampled after dissection and subjected to identical RNA isolation, cDNA synthesis, and PCR procedures.

RNA isolation and cDNA synthesis. Tubular and glomerular RNA were isolated by a modification (39) of the method described by Chen et al. (10). Briefly, 20 µg of Escherichia coli rRNA (Boehringer Mannheim, Indianapolis, IN) were added to samples as a carrier, and the samples were layered onto a discontinuous CsCl gradient (1 ml 97% CsCl, bottom; 200 µl 40% CsCl, top) and centrifuged (Beckman TL-100 ultracentrifuge; TLS-55 rotor; 55,000 revolutions/min, 132,000 g; 16°C; 6 h); RNA pellets were resuspended in 0.3 M sodium acetate and were ethanol precipitated. cDNA was synthesized in a buffer containing 3 mM MgCl2, 5 µM oligo(dT)15, 40 U RNasin, 1 mM deoxynucleotide triphosphate set (dNTPs), and 5 mM dithiothreitol. The mixture was incubated at 65°C for 5 min and chilled on ice before addition of 200 U of Moloney murine leukemia virus RT (Promega, Madison, WI). RT was omitted in minus RT controls. RT profile was as follows: annealing at 25°C for 5 min, extension at 42°C for 60 min, and termination at 99°C for 5 min.

Renin quantitative competitive PCR. PCR reactions were performed in a thermal cycler (MJ Research, Watertown, MA) in a total volume of 50 µl containing 0.2 µM primers (forward, 5' TGCCACCTTGTTGTGTGAGG 3'; reverse, 5' ACCCGATGCGATTGTTATGCCG 3'), 4 mM MgCl2, 200 µM dNTP, 1× enzyme buffer, and 2.5 U of Taq DNA polymerase (all from Promega). The primers were previously shown to be in separate exons by the absence of a PCR product of predicted size in amplification of rat genomic DNA (data not shown). PCR profile was as follows: hot start at 94°C for 2 min; 35 cycles at 94°C for 30 s, 60°C for 60 s, and 72°C for 75 s; and final extension at 72°C for 5 min. Negative controls included dissection medium subjected to RT-PCR, water subjected to PCR, and aliquots from each RNA containing sample with RT omitted. All negative controls failed to generate PCR products (data not shown). Preliminary experiments showed that 35 cycles of PCR are well within the linear range, and no saturation was observed for renin from dissected glomeruli and proximal tubules.

A mutant renin template [internal 142-base pair (bp) deletion] was prepared from renin cDNA by composite primers as an internal standard, as described previously (39). Aliquots of sample cDNA from one-half glomerulus (0.5 of 1 ml of GTC lysate was used) or 3 mm of proximal tubule were competitively amplified against a fivefold step dilution series of mutant templates and consistently produced two bands of predicted lengths (renin 372 bp, mutant 232 bp). PCR reaction products were size fractionated by agarose gel electrophoresis, transferred to nylon membranes, and probed with a 32P-end-labeled internal oligonucleotide common to both templates (5' GCTTGCATGATCAACTGCAGG 3'). Hybridizations were performed exactly as described previously (39). PCR products were quantified by autoradiographic densitometry, and the ratio of renin to mutant product was plotted against the starting amount of mutant template. Linear regression lines were fitted to the data, and the number of molecules of renin cDNA in each sample was determined by a renin-to-mutant ratio of one. In pilot studies, the ability of the quantitative RT-PCR to reliably detect known differences in starting amounts of cDNA was verified and demonstrated to be accurate in discerning differences as small as 50% (data not shown).

Analytic methods and statistical analysis. All data are expressed as means ± SE. Comparisons between low-, normal, and high-NaCl groups were performed, using one-way analysis of variance. The unpaired Student's t-test was used for comparison between two groups. Statistical significance was defined as P < 0.05.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Whole animal data. The effect of varying dietary NaCl on renal Na excretion is presented in Table 1. After 4 days of a low-, normal, or high-salt diet, no differences were detected in body weight, kidney weight, or plasma electrolytes. Urinary Na excretion was extremely low in the low-NaCl group and increased appropriately in the normal and high-salt groups. CCr was increased in the normal salt group compared with the low- and high-salt groups. The reason for this small increase in CCr is unclear. After 2 wk of the experimental protocol, animals on 0.01% NaCl diets had markedly reduced food consumption and body weights (body weight: 4% NaCl, 238 ± 4 g; 0.5% NaCl, 250 ± 4 g; 0.01% NaCl, 176 ± 4 g; P < 0.001, 0.01% NaCl vs. others) and significant hypofiltration (CCr: 4% NaCl, 1.24 ± 0.12 ml/min; 0.5% NaCl, 1.60 ± 0.20 ml/min vs. 0.01% NaCl, 0.81 ± 0.20 ml/min; P < 0.01, 0.01% vs. others), whereas animals on the 4% NaCl diet had body weights and CCr comparable with controls.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Whole animal data (4 days)

Renin transcript levels in microdissected glomeruli and proximal tubules. To investigate whether local intrarenal renin gene expression is regulated by dietary NaCl, renin mRNA was measured in microdissected glomeruli and proximal tubule, using quantitative RT-PCR. Figure 1 shows the Southern blots (A) and linear quantitation (B) from one representative experiment from glomeruli microdissected after 4 days of the three diets. NaCl restriction markedly increased, whereas NaCl excess decreased, glomerular renin gene expression. Figure 2 summarizes the data from all the experiments. A low-NaCl diet increased glomerular renin expression by 100%, whereas a high-NaCl diet inhibited it by 50% (in 103 copies/glomerulus: 0.01% NaCl, 1,312 ± 169; 0.5% NaCl, 678 ± 106; 4% NaCl, 299 ± 67).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   Competitive quantitative polymerase chain reaction (PCR) from representative experiments in glomeruli after 4 days of 0.01%, 0.5%, and 4% NaCl diet. Aliquots of cDNA from one-half glomerulus were each coamplified against a 5-fold step dilution series of mutant renin template. A: Southern blots. R, PCR product from tissue renin cDNA [372 base pairs (bp)]; M, PCR product from mutant renin template (232 bp). M1-M4 represent starting number of mutant copies: M1 = 545,000; M2 = 109,000; M3 = 21,800; M4= 4,360. B: linear regression of renin-to-mutant ratios. Copies of tissue renin cDNA per one-half glomerulus were calculated from a renin-to-mutant ratio of 1.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Summary of all experiments on effect of 4 days of dietary NaCl variation on glomerular renin transcript levels. Results are means ± SE; n = no. of animals studied. Glom, glomerulus.

In the proximal tubule, 4 days of dietary NaCl restriction resulted in upregulation of proximal tubule renin mRNA. One set of representative Southern blots and linear quantitation is shown in Fig. 3, A and B. Figure 4 shows the summary of all the experiments. A low-NaCl diet increased proximal tubule renin expression by 230% (P < 0.01), whereas a high-NaCl diet inhibited renin expression by 68%, a difference that was not statistically significant (in 103 copies/mm tubule: 0.01% NaCl, 63.2 ± 15; 0.5% NaCl, 18.8 ± 7; 4% NaCl, 5.9 ± 2.5).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Competitive quantitative PCR from representative experiments in proximal tubules after 4 days of 0.01%, 0.5%, and 4% NaCl diet. Aliquots of cDNA from 3 mm of proximal tubules were each coamplified against a 5-fold step dilution series of mutant renin template. A: Southern blots (see legend to Fig. 1 for explanation of M1-M4). B: linear regression of renin-to-mutant ratios. Copies of tissue renin cDNA per 3 mm of proximal tubules were calculated from a renin-to-mutant ratio of 1.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Summary of all experiments on effect of 4 days of dietary NaCl variation on proximal tubule (PT) renin transcript levels. Results are means ± SE; n = no. of animals studied. NS, not significant.

To see whether significant downregulation of proximal tubule renin occurred later in the adaptation, quantitative RT-PCR was performed in a separate group of animals after 2 wk of normal and high-NaCl diets. After this more prolonged dietary NaCl excess, proximal tubule renin mRNA was clearly suppressed (in 103 copies/mm tubule: 0.05% NaCl, 18.9 ± 7.0 vs. 4% NaCl, 2.0 ± 0.8; P < 0.05; Figs. 5 and 6). Because the effect of low dietary NaCl was evident after 4 days as well as the confounding complications of poor somatic growth and hypofiltration associated with prolonged dietary Na restriction, microdissection and quantitation of proximal tubule renin mRNA were not performed in these animals.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Southern blots (top) and linear regression quantitation (bottom) of competitive quantitative PCR from representative experiments in PT after 2 wk of 0.5% and 4% NaCl diet. Copies of tissue renin cDNA per 3 mm of PT were calculated from a renin-to-mutant ratio of 1. See legend to Fig. 1 for explanation of M1-M4.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Summary data of all experiments on effect of 2 wk of normal or high-NaCl diet on PT renin transcript levels. Results are means ± SE; n = no. of animals studied. * P < 0.05.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Expression of angiotensinogen, ANG-converting enzyme (ACE), renin, and ANG II receptors, which constitute full components of localized tissue RASs, has been described in cardiac muscle, adrenal glands, vascular smooth muscle, and in the kidney in the glomerulus and the proximal tubule (7, 9, 10, 12, 26, 28, 31, 36, 40). In the kidney, ANG II is a key regulator of efferent and afferent arteriolar resistances and the capillary ultrafiltration coefficient in the glomeruli (4, 19, 27). In addition, ANG II stimulates the Na+/H+ exchanger, Na-3HCO3 cotransporter, and Na+-K+-ATPase in the proximal tubule (8, 16, 17, 19, 32). Theoretically, all these hemodynamic and transport functions can be regulated in an autocrine/paracrine fashion by the local RASs in the glomerulus and proximal tubule. Quan and Baum (29) recently used in vivo microperfusion to show that either luminal ANG II receptor blockade or ACE inhibition decreases proximal tubule volume absorption, an effect that can be restored by luminal ANG II application. Their data strongly support a functional role of the proximal tubule RAS in transport regulation. Another approach is to examine for changes in local RASs in response to physiological perturbations. Although the evidence is only circumstantial, this approach has the distinct advantage of observing the operation of the local RAS in its intact physiological state. A number of important conclusions have been drawn about the role of the intracardiac RAS in myocardial function and the coronary circulation based on correlative studies in whole organisms (11, 22).

Chronic ECFV contraction elicits a myriad of adaptive responses in the kidney. In the glomerular microcirculation, despite a fall in renal plasma flow, single nephron glomerular filtration rate (SNGFR) is sustained by preferential efferent arteriolar constriction (35). In addition to maintaining SNGFR, the increased efferent arteriolar resistance and filtration fraction also set the peritubular conditions to a state conducive to increased proximal tubule NaCl reabsorption (33). A large part of this chronic adaptation has been shown to be ANG II dependent (35). The novel finding in the present study is the adaptation observed in the glomerular RAS. However, an important potential caveat of these data is possible contamination of glomeruli with arterioles and/or JG cells, despite vigilant efforts in dissection. Because renin from either the JG apparatus or glomerular arterioles is stimulated by dietary NaCl restriction, one can argue that contamination of glomeruli by these tissues can explain the current findings. We believe this is unlikely for two reasons. First, the amount of renin mRNA in the arterioles and JG cells is much higher than in glomeruli. Tissue contamination, which is a random event, should introduce large variations in the copy number of renin mRNA in the glomerular samples. However, the intersample variations in glomerular renin were no greater than those of the dissected proximal tubules, which clearly were not contaminated with other renin-containing tissues. Second, using the identical dissection techniques and RT-PCR, we previously detected activation of the glomerular RAS in the face of suppressed JG renin. The demonstration of this dissociation would not have been possible if glomeruli were significantly contaminated with JG cells.

Adaptations intrinsic to the proximal tubule are also demonstrated in the in vitro microperfused tubule and cortical membrane preparations in states of chronic changes in ECFV. Chronic volume contraction increases proximal tubule HCO3 and water absorptive capacity and apical membrane Na+/H+ exchanger activity (24, 25), whereas volume expansion inhibits apical membrane Na+/H+ exchanger activity and basolateral membrane Na+-K+-ATPase activity (3, 21). It is quite plausible that ANG II is responsible for a majority of both the glomerular and tubular adaptations in response to chronic changes in dietary NaCl. In the uninephrectomy model, we postulated that the local glomerular and proximal tubule RASs may be primarily responsible for the changes in glomerular hemodynamics and proximal tubule transport, because the circulating RAS is actually suppressed under these conditions (39). Because the systemic RAS is activated by chronic NaCl depletion and suppressed by chronic NaCl excess, the present studies cannot segregate the relative contributions of the endocrine and the local RASs to the renal adaptation. Renal tissue ACE activity as well as ANG I and ANG II levels are all increased by chronic salt restriction and suppressed by chronic salt excess (14). Although these studies used whole kidney homogenates and hence cannot localize the exact source of the increase in ACE, ANG I, and ANG II, the findings are compatible with regulation of intrarenal RASs by dietary salt. Inglefinger et al. (20) showed that chronic dietary NaCl restriction increases proximal tubule angiotensinogen transcript levels by in situ hybridization. Singh et al. (37) showed an inverse relationship between dietary Na and angiotensinogen transcript levels in microdissected proximal convoluted and proximal straight tubules. The regulation of glomerular and proximal tubule renin mRNA by dietary NaCl now provides an additional example of local RASs responding to physiological perturbations in directions that are compatible with the observed changes in glomerular and proximal tubule function. In contrast to chronic changes in ECFV, acute changes in ECFV do not lead to alterations in proximal tubule luminal ANG II levels (6) or apical membrane Na+/H+ exchanger activity (25), suggesting differential mechanisms of regulation of proximal tubule transport under acute and chronic situations.

The concept of autocrine/paracrine regulation of renal tubular function is not unique to the RAS. Both acute and chronic changes in ECFV have been shown to modulate proximal tubule dopamine production, which in turn regulates proximal tubule solute transport via receptor-mediated actions on the proximal tubule apical Na+/H+ exchanger and basolateral membrane Na+-K+-ATPase (3, 12, 13, 34). Regulation of renal tubular prostaglandin production and prostaglandin action on renal tubular transport are other examples of an autocrine/paracrine system (5, 38). Finally, a potent autocrine/paracrine hormone in the proximal tubule that can serve a similar role is endothelin (15). The regulation of endothelin expression by acute/chronic changes in ECFV has not been examined to date.

In summary, these studies show that the local RASs in the glomerulus and proximal tubule respond to changes in dietary NaCl. Chronic dietary NaCl excess suppresses, whereas chronic dietary NaCl restriction stimulates, expression of renin transcript in these sites. These findings are congruent with the notion that local RASs participate in chronic ECFV homeostasis and NaCl balance by mediating changes in glomerular hemodynamics and proximal tubule transport.

    ACKNOWLEDGEMENTS

We acknowledge the technical expertise of Elizabeth McAllister and Audrey Eskue. We are grateful to Drs. Robert A. Star and Richard Scheuermann for helpful discussions.

    FOOTNOTES

This work was supported by the Department of Veterans Affairs Research Service (W. L. Henrich and O. W. Moe) and the National Institute of Diabetes and Digestive and Kidney Diseases (DK-48482 to O. W. Moe). J. E. Tank was a recipient of an National Research Service Award from the National Institutes of Health (1F32-DK-08970).

Address for reprint requests: O. W. Moe, Dept. of Medicine, Univ. of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75225-8856.

Received 4 June 1997; accepted in final form 31 July 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Alexander, R. W., J. R. Gill, Jr., H. Yamabe, W. Lovenberg, and H. R. Keiser. Effects of dietary sodium and of acute saline infusion on the interrelationship between dopamine excretion and adrenergic activity in man. J. Clin. Invest. 54: 194-200, 1974.

2.   Bella-Reuse, E., Y. Higashi, and Y. Kaneda. Dopamine decreases fluid absorption in the rabbit proximal tubule. Miner. Electrolyte Metab. 9: 147-150, 1983[Medline].

3.   Bertorello, A., T. Hokfelt, M. Goldstein, and A. Aperia. Proximal tubule Na+-K+-ATPase activity is inhibited during high-salt diet: evidence for DA-mediated effect. Am. J. Physiol. 254 (Renal Fluid Electrolyte Physiol. 23): F795-F801, 1988[Abstract/Free Full Text].

4.   Blantz, R. C., K. S. Konnen, and B. J. Tucker. Angiotensin II effects upon the glomerular microcirculation and ultrafiltration coefficient of the rat. J. Clin. Invest. 57: 419-434, 1976.

5.   Bonvalet, J. P., P. Pradelles, and N. Farman. Segmental synthesis and actions of prostaglandins along the nephron. Am. J. Physiol. 253 (Renal Fluid Electrolyte Physiol. 22): F377-F387, 1987[Abstract/Free Full Text].

6.   Braam, B., K. D. Mitchell, J. Fox, and L. G. Navar. Proximal tubular secretion of angiotensin II in rats. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F891-F898, 1993[Abstract/Free Full Text].

7.   Campbell, D. J. Circulating and tissue angiotensin systems. J. Clin. Invest. 79: 1-6, 1987.

8.   Cano, A., R. T. Miller, R. J. Alpern, and P. A. Preisig. Angiotensin II stimulation of Na-H antiporter activity is cAMP independent in OKP cells. Am. J. Physiol. 266 (Cell Physiol. 35): C1603-C1608, 1994[Abstract/Free Full Text].

9.   Chansel, D., J. Dussaule, N. Ardaillou, and R. Ardaillou. Identification and regulation of renin in human cultured mesangial cells. Am. J. Physiol. 252 (Renal Fluid Electrolyte Physiol. 21): F32-F38, 1987[Abstract/Free Full Text].

10.   Chen, M., M. Harris, A. Smart, X. He, M. Kretzler, J. Briggs, and J. Schnermann. Renin and renin mRNA in proximal tubules of the rat kidney. J. Clin. Invest. 94: 237-243, 1994.

11.   Dostal, D. E., and K. M. Baker. Evidence for a role of an intracardiac renin-angiotensin system in normal and failing hearts. Trends Cardiovasc. Med. 3: 67-74, 1993.

12.  Dzau, V. J. Circulating versus local renin-angiotensin systems in cardiovascular homeostasis. Circulation 77, Suppl. 19: 1-4, 1988.

13.   Felder, C. C., T. Campbell, F. Albrecht, and P. A. Jose. Dopamine inhibits Na+-H+ exchanger activity in renal BBMV by stimulation of adenylate cyclase. Am. J. Physiol. 259 (Renal Fluid Electrolyte Physiol. 28): F297-F303, 1990[Abstract/Free Full Text].

14.   Fox, J., S. Guan, A. A. Hymel, and L. G. Navar. Dietary Na and ACE inhibition effects on renal tissue angiotensin I and II and ACE activity in rats. Am. J. Physiol. 262 (Renal Fluid Electrolyte Physiol. 31): F902-F909, 1992[Abstract/Free Full Text].

15.   Garcia, N. H., and J. L. Garvin. Endothelin's biphasic effect on fluid absorption in the proximal straight tubule and its inhibitory cascade. J. Clin. Invest. 93: 2572-2577, 1994.

16.   Garvin, J. L. Angiotensin stimulates HCO3 transport and Na-K-ATPase in rat proximal straight tubule. J. Am. Soc. Nephrol. 1: 1146-1152, 1991[Abstract].

17.   Geibel, J. G., G. Giebisch, and W. F. Boron. Angiotensin II stimulates both Na/H exchange and Na/HCO3 cotransport in the rabbit proximal tubule. Proc. Natl. Acad. Sci. USA 87: 7917-7920, 1990[Abstract/Free Full Text].

18.   Hall, J. E., A. C. Guyton, M. J. Smith, Jr., and T. G. Coleman. Chronic blockade of angiotensin II formation during sodium deprivation. Am. J. Physiol. 237 (Renal Fluid Electrolyte Physiol. 6): F424-F432, 1979[Abstract/Free Full Text].

19.   Ichikawa, I., and R. C. Harris. Angiotensin actions in the kidney: renewed insight into the old hormone. Kidney Int. 40: 583-596, 1991[Medline].

20.   Inglefinger, J. R., R. E. Pratt, K. E. Ellison, and V. J. Dzau. Sodium regulation of angiotensin mRNA expression in rat kidney cortex and medulla. J. Clin. Invest. 78: 1311-1315, 1986.

21.   Lewis, J. L., and D. G. Warnock. Renal apical membrane sodium-hydrogen exchange in genetic salt-sensitive hypertension. Hypertension 24: 491-498, 1994[Abstract/Free Full Text].

22.   Lindpaintner, K., and D. Ganten. The cardiac renin-angiotensin system: a synopsis of current experimental and clinical data. News Physiol. Sci. 6: 227-232, 1991.[Abstract/Free Full Text]

23.   Liu, F.-Y., and M. G. Cogan. Angiotensin II: a potent regulator of acidification in the rat early proximal convoluted tubule. J. Clin. Invest. 80: 272-275, 1987.

24.   Maddox, D. A., and J. Gennari. Load dependence of proximal tubule bicarbonate reabsorption in chronic metabolic alkalosis in the rat. J. Clin. Invest. 77: 709-716, 1986.

25.   Moe, O. W., A. Tejedor, M. Levi, D. W. Seldin, P. A. Preisig, and R. J. Alpern. Dietary NaCl modulates Na+-H+ antporter activity in renal cortical apical membrane vesicles. Am. J. Physiol. 260 (Renal Fluid Electrolyte Physiol. 29): F130-F137, 1991[Abstract/Free Full Text].

26.   Moe, O. W., K. Ujiie, R. A. Star, R. T. Miller, J. Widell, R. J. Alpern, and W. L. Henrich. Renin expression in the renal proximal tubule. J. Clin. Invest. 91: 774-779, 1993.

27.   Navar, J. G., and L. Rosivall. Contribution of the renin-angiotensin system to the control of intrarenal hemodynamics. Kidney Int. 25: 857-868, 1984[Medline].

28.   Paul, M., J. Wagner, and V. J. Dzau. Gene expression of the renin angiotensin system in human tissues. J. Clin. Invest. 91: 2058-2064, 1993.

29.   Quan, A., and M. Baum. Endogenous production of angiotensin II modulates rat proximal tubule transport. J. Clin. Invest. 97: 2878-2882, 1996[Medline].

30.   Rosenberg, M., S. Kren, and T. Hostetter. Glomerular renin synthesis and storage in the remnant kidney in the rat. Kidney Int. 40: 677-683, 1991[Medline].

31.   Rosivall, L., R. Taugner, and L. G. Navar. Intrarenal formation of angiotensin II and its effect on renal hemodynamics. In: Proceedings of the 10th International Congress of Nephrology, edited by A. M. Davison. Philadelphia, PA: Bailliere, 1988, p. 46-56.

32.   Saccomani, G., K. D. Mitchell, and L. G. Navar. Angiotensin II stimulation of Na+-H+ exchange in proximal tubule cells. Am. J. Physiol. 258 (Renal Fluid Electrolyte Physiol. 27): F1188-F1196, 1990[Abstract/Free Full Text].

33.   Seldin, D. W., P. A. Preisig, and R. J. Alpern. Regulation of proximal reabsorption by effective arterial blood volume. Semin. Nephrol. 11: 212-219, 1991[Medline].

34.   Seri, I., B. C. Kone, S. R. Gullans, A. Aperia, and B. M. Brenner. Locally formed dopamine inhibits Na+-K+-ATPase in rat renal cortical tubule cells. Am. J. Physiol. 255 (Renal Fluid Electrolyte Physiol. 24): F666-F673, 1988[Abstract/Free Full Text].

35.   Schor, N., I. Ichikawa, and B. M. Brenner. Glomerular adaptations to chronic dietary salt restriction or excess. Am. J. Physiol. 238 (Renal Fluid Electrolyte Physiol. 7): F428-F436, 1980[Abstract/Free Full Text].

36.   Schuster, V. L., J. P. Kokko, and H. R. Jacobson. Angiotensin II directly stimulates sodium transport in rabbit proximal convoluted tubule. J. Clin. Invest. 73: 507-515, 1984.

37.   Singh, I., M. Grams, W.-H. Wang, T. Yang, P. Killen, A. Smart, J. Schnerman, and J. P. Briggs. Coordinate regulation of renal expression of nitric oxide synthase, renin, and angiotensinogen mRNA by dietary salt. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F1027-F1037, 1996[Abstract/Free Full Text].

38.   Stokes, J. B., and J. P. Kokko. Inhibition of Na transport by prostaglandin E2 across the isolated, perfused rabbit collecting tubule. J. Clin. Invest. 59: 1099-1104, 1977.

39.   Tank, J. E., O. W. Moe, R. A. Star, and W. L. Henrich. Differential regulation of rat glomerular and proximal tubule renin mRNA following uninephrectomy. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F776-F783, 1996[Abstract/Free Full Text].

40.  Unger, T., P. Gohlke, M. Paul, and R. Rettig. Tissue renin-angiotensin systems: fact or fiction? J. Cardiovasc. Pharmacol. 18, Suppl. 2: S20-S25, 1991. 


AJP Renal Physiol 273(6):F892-F898
0363-6127/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
M. C. Prieto-Carrasquero, H. Kobori, Y. Ozawa, A. Gutierrez, D. Seth, and L. G. Navar
AT1 receptor-mediated enhancement of collecting duct renin in angiotensin II-dependent hypertensive rats
Am J Physiol Renal Physiol, September 1, 2005; 289(3): F632 - F637.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Charbonneau, M. Leclerc, and M. G. Brunette
Effect of angiotensin II on calcium reabsorption by the luminal membranes of the nephron
Am J Physiol Endocrinol Metab, June 1, 2001; 280(6): E928 - E936.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. J. Wehbi, J. Zimpelmann, R. M. Carey, D. Z. Levine, and K. D. Burns
Early streptozotocin-diabetes mellitus downregulates rat kidney AT2 receptors
Am J Physiol Renal Physiol, February 1, 2001; 280(2): F254 - F265.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. Rohrwasser, T. Morgan, H. F. Dillon, L. Zhao, C. W. Callaway, E. Hillas, S. Zhang, T. Cheng, T. Inagami, K. Ward, et al.
Elements of a Paracrine Tubular Renin-Angiotensin System Along the Entire Nephron
Hypertension, December 1, 1999; 34(6): 1265 - 1274.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. E. Gilbert, L. L. Wu, D. J. Kelly, A. Cox, J. L. Wilkinson-Berka, C. I. Johnston, and M. E. Cooper
Pathological Expression of Renin and Angiotensin II in the Renal Tubule after Subtotal Nephrectomy : Implications for the Pathogenesis of Tubulointerstitial Fibrosis
Am. J. Pathol., August 1, 1999; 155(2): 429 - 440.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tank, J. E.
Right arrow Articles by Moe, O. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tank, J. E.
Right arrow Articles by Moe, O. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online