AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F961-F975, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Piscione, T. D.
Right arrow Articles by Rosenblum, N. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piscione, T. D.
Right arrow Articles by Rosenblum, N. D.
Vol. 273, Issue 6, F961-F975, December 1997

BMP-2 and OP-1 exert direct and opposite effects on renal branching morphogenesis

Tino D. Piscione1, Thomas D. Yager1,2, Indra R. Gupta1, Branko Grinfeld1, York Pei3, Liliana Attisano4, Jeffrey L. Wrana2,5, and Norman D. Rosenblum1,2

5 Division of Gastroenterology and Nutrition and 2 Program in Developmental Biology, 1 Division of Nephrology, Hospital for Sick Children, 3 Division of Nephrology, Toronto Hospital, and 4 Department of Anatomy and Cell Biology, University of Toronto, Toronto, Ontario, Canada M5G 1X8

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

The bone morphogenetic proteins, BMP-2 and OP-1, are candidates for growth factors that control renal branching morphogenesis. We examined their effects in embryonic kidney explants and in the mIMCD-3 cell model of collecting duct morphogenesis (mIMCD-3 cells are derived from the terminal inner medullary collecting duct of the SV40 mouse). Osteogenic protein-1 (OP-1), at a dose of 0.25 nM, increased explant growth by 30% (P = 0.001). In contrast, 100-fold greater concentrations of OP-1 (28 nM) decreased explant growth by 10% (P < 0.001). BMP-2 was entirely inhibitory (maximum inhibition of 7% at 5 nM, P < 0.0004). In an in vitro model for branching morphogenesis utilizing the kidney epithelial cell line, mIMCD-3, low doses of OP-1 (<0.5 nM) increased the number of tubular structures formed by 28 ± 5% (P = 0.01), whereas concentrations >0.5 nM decreased that number by 22 ± 8% (P = 0.02). All concentrations of BMP-2 (0.05-10 nM) were inhibitory (maximum inhibition at 10 nM of 88 ± 3%, P < 0.0001). Stimulatory doses of OP-1 increased tubular length (P = 0.003) and the number of branch points/structure (3.2-fold increase, P = 0.0005) compared with BMP-2. To determine the molecular basis for these effects, we demonstrated that BMP-2 is bound to mIMCD-3 cells by the type I serine/threonine kinase receptor, ALK-3, and that OP-1 bound to an ~80-kDa protein using ligand-receptor affinity assays. To demonstrate that OP-1 can exert both stimulatory and inhibitory effects within a developing kidney, embryonic explants were treated with agarose beads saturated with 2 µM OP-1. OP-1 decreased the number of ureteric bud/collecting duct branches adjacent to the beads by 58 ± 1% (P < 0.0001). In contrast, the number of branches in tissue distal to the OP-1 beads was enhanced, suggesting a stimulatory effect at lower doses of OP-1. We conclude that OP-1 and BMP-2 directly control branching morphogenesis and that the effects of OP-1 are dependent on its local concentration within developing kidney tissue.

bone morphogenetic protein-2; osteogenic protein-1; bone morphogenetic protein-7; inner medullary collecting duct; tubulogenesis

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

RENAL BRANCHING morphogenesis is defined as the growth and branching of epithelial tubules during embryonic development (30). In the kidney, branching morphogenesis results from reciprocal mesenchymal-epithelial tissue interactions between the mesenchymal metanephric blastema and the epithelial ureteric bud (and its derivative collecting ducts). These interactions are mediated, in part, by peptide growth factors. Recent evidence suggests that bone morphogenetic proteins (BMPs), a family of growth factors within the transforming growth factor-beta (TGF-beta ) superfamily, play a role in controlling these tissue interactions (7, 8, 19, 34).

BMPs constitute the largest subgroup within the TGF-beta superfamily. They are related to other TGF-beta - related families including the activins and TGF-beta s by the homology among their carboxy-terminal domains (reviewed in Ref. 14). The BMPs are subdivided into three subgroups: 1) BMP-2/4, 2) BMP-5, BMP-6, and BMP-7 (also named osteogenic protein-1, OP-1), and 3) BMP-3 and BMP-8 (16). BMPs induce cellular responses by forming heteromeric complexes with type I and type II cell surface transmembrane serine/threonine kinase receptors (28). The cellular response to a BMP is defined by the particular member of the type I receptor family to which it binds, since the type I receptor transduces a signal to downstream intracellular target molecules (37). Binding assays in model cell systems suggest that ALK-3 and ALK-6 are candidate type I receptors for BMP-2 (18) and that ALK-2 is a candidate receptor for OP-1 (33).

A large body of evidence in multiple species indicates that BMPs are involved in controlling morphogenetic steps at multiple stages of development (14). Several types of evidence suggest a role for BMPs during mammalian kidney development. BMP-2/4 and OP-1 and ALK-3 and ALK-6 are expressed in a temporal and spatial pattern that is consistent with a role in inductive mesenchymal-epithelial tissue interactions (2, 6, 7, 24, 35). OP-1 induces the differentiation of epithelial elements when added to explanted uninduced metanephric blastema (34). Mutational inactivation of the murine Op-1 gene results in underdevelopment and disorganization of both the mesenchymal- and epithelial-derived elements in the embryonic kidney. This phenotype suggests that OP-1 may function to control aspects of renal development other than inductive tissue interactions (7, 19). However, the cellular complexity of the developing kidney and the ongoing nature of reciprocal mesenchymal-epithelial interactions severely limit the ability to distinguish the effects of OP-1 at the primary versus secondary level. Therefore, the Op-1 -/- renal phenotype does not provide direct evidence regarding the role of OP-1 in branching morphogenesis. The function of BMP-2 and its candidate ALK receptors is also undefined. Mutational inactivation of BMP-2 and its type I serine/threonine kinase receptor, ALK-3, results in embryonic lethality before the onset of organogenesis (14, 21).

In this report, we determined the direct effects of BMP-2 and OP-1 on renal branching morphogenesis. Our initial experiments in embryonic kidney explants yielded the surprising result that low doses of OP-1 (0.25 nM) stimulated explant growth, specifically the ureteric bud/collecting ducts, whereas higher doses (28 nM) were inhibitory. BMP-2 only inhibited explant growth. We characterized the direct effects of these BMPs on developing collecting ducts in the mIMCD-3 model (4). Consistent with our results in explants, OP-1 (<0.25 nM) stimulated the number of tubules formed, the number of branch points/tubule and tubular length. In contrast, concentrations of OP-1 >0.5 nM and 0.05-10 nM BMP-2 were inhibitory. To determine the molecular basis for these opposite effects, we identified candidate cell surface receptors for BMP-2 and OP-1. Our results demonstrate that both BMP-2 and OP-1 are bound to mIMCD-3 cells by the type II serine/threonine kinase receptor, ActRII/IIB. BMP-2 is also bound by the type I serine/threonine kinase receptor, ALK-3, and OP-1 is bound by an ~80-kDa protein. Since peptide growth factors exist in a concentration gradient in some developing tissues (11), we tested the possibility that OP-1 exerts a stimulatory or inhibitory effect on branching morphogenesis in embryonic kidney tissue depending on its local concentration. Using agarose beads saturated with micromolar amounts of OP-1, we demonstrated an inhibition of ureteric bud/collecting duct branching adjacent to the beads but stimulation in tissue distal to the beads. Taken together, our results suggest that OP-1 and BMP-2 directly control renal branching morphogenesis and that the effects of OP-1 are dependent on its local concentrations within developing kidney tissue.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Embryonic kidney organ culture and treatment of organs with recombinant proteins. Mouse embryos were surgically resected from embryonic day 12 (E12) pregnant CD1 mice. Embryonic kidneys were isolated by microdissection and were cultured on 0.45 µm polyethylene terephthalate membranes (Falcon) (40) in 12-well multiwell plates in the presence of Richter's modification of Dulbecco's modified Eagle's medium-Ham's F-12 nutrient mixture (DMEM-F12, BRL Life Technologies) containing 50 µg/ml transferrin (Sigma) (25). Culture medium was changed every 48 h. BMP-2 (provided by Genetech) and OP-1 (provided by Creative Biomolecules) were either added directly to the culture medium or were absorbed at 37°C for 30 min onto Affi-Gel blue agarose beads (100-200 mesh, 75-150 µm diameter; Bio-Rad), previously washed once with phosphate-buffered saline, pH 7.4 (PBS). Treated beads were washed once in Richter's modified DMEM-F12 medium and manually placed on organ cultures (31). The effect on kidney growth was defined by measuring the surface area of the explants using image analysis software (NIH Image) and by imaging 5-µm paraffin-embedded tissue sections stained with hematoxylin and eosin.

Whole mount immunostaining of embryonic kidneys. Embryonic kidneys were fixed in 4% formaldehyde in PBS for 10 min, washed with PBS four times for 10 min each wash, and then stored in blocking buffer consisting of 1% goat serum and 0.0001% Tween-20 in PBS. Kidneys were then incubated for 2 h with fluorescein-conjugated Dolichos biflorus agglutinin (20 µg/ml) (Vector Labs) in blocking buffer and then washed with PBS four times for 10 min each wash. The effect of ligand on the collecting system was defined by counting the number of ureteric bud/collecting duct branches formed on either side of the ureteric bud.

mIMCD cell culture. The mIMCD-3 cell line is derived from the terminal inner renal medullary collecting duct of the SV40 transgenic mouse. mIMCD-3 cells retain several differentiated characteristics of this nephron segment, as previously described (26). Monolayer cultures of mIMCD-3 cells (obtained from American Tissue Culture Collection) were maintained in DMEM-F12 supplemented with 5% fetal bovine serum (Hyclone), penicillin (100 U/ml), and streptomycin (100 U/ml) in 5% CO2 at 37°C. For assays of tubulogenesis, collagen gels were prepared on ice by mixing 4 µl of 1 M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (Sigma), 8 µl of 1 M NaHCO3, 40 µl DMEM-F12, 200 µl rat type I collagen (Collaborative Biomedical Products), and 25,000-250,000 mIMCD-3 cells. Aliquots (50 µl/well) were seeded in 96-well culture plates. After the gels solidified at 37°C, 100 µl of DMEM-F12 containing 5% fetal bovine serum were added to each well. Cultures were then maintained at 37°C in 5% CO2 and the medium was changed every 48 h.

Effect of growth factors on mIMCD-3 tubulogenesis. Serial dilutions of activin A and TGF-beta 1 (kindly provided by Genetech), OP-1, and BMP-2 were prepared in DMEM-F12 and added to newly established cultures of mIMCD-3 cells embedded in collagen gels. After 48 h in culture, gels were fixed in 4% formaldehyde in PBS for 10 min at room temperature. Fixed gels were then washed four times in PBS and stored in blocking buffer at 4°C. After fixation, gels were directly imaged by differential interference contrast (DIC) microscopy using an Axioskop microscope and plan-neofluar objectives (Carl Zeiss). Representative microscopic fields were photographed with a MC80 magnetic shutter camera (Carl Zeiss) using fine-grain black and white film (Kodak T-Max 400 or Ilford Delta 400) at ×100 magnification. The effect of each ligand on mIMCD-3 tubulogenesis was determined by counting the number of continuous, elongated, linear structures per quadrant of photograph.

Morphometric analysis of mIMCD-3 structures. Collagen gels were prepared containing 5,000 cells/gel. Cell culture medium containing ligand was immediately added to wells containing solidified gels to achieve the following concentrations: OP-1, 0.25 nM; and BMP-2, 5 nM. Two or seven days later, gels were fixed and stained with bis-benzamide (Hoechst No. 33258, Sigma) for 30 min at 4°C in the dark and then destained with PBS for 15 min at room temperature in the dark. In some experiments, mIMCD-3 nuclei were detected with a monoclonal anti-human histone-1 antibody (Chemicon) and a rhodamine-labeled mouse anti-human secondary antibody (BRL-Life Technologies). Bis-benzamide or antibody-treated gels were directly imaged by DIC and fluorescence microscopy. Fluorescence microscopy was performed with a HBO 50-W mercury vapor short-arc lamp using a Shott-38 band-pass filter and a 3-FL fluorescence reflector. Representative structures imaged by both DIC and fluorescence microscopy were photographed. Morphometric analysis was conducted by making scaled measurements of the photographed structures for the length of long axis, number of branch points per structure, length of branches, and number of Hoechst-stained nuclei per structure and per branch. A branch was defined by the presence of one or more nuclei beyond the branch point, whereas a cell process was defined by the absence of any nuclei in a structure extending beyond a branch point.

Reverse transcription-polymerase chain reaction cloning of BMPs and receptor serine/threonine kinases. Poly(A)+ mRNA was isolated from E13 mouse metanephroi by the oligo(dT) method using a commercial kit (Fast Track, Invitrogen). Oligo(dT)-primed first-strand cDNA was synthesized using 200 ng poly(A)+ mRNA as substrate and reverse transcriptase (Superscript II, GIBCO-BRL).

For reverse transcription-polymerase chain reaction (RT-PCR) cloning of cDNAs encoding BMPs, E13 metanephric cDNA was used as a substrate for PCR using degenerate oligonucleotides directed against conserved sequences present in the subfamily of TGF-beta members that includes the BMPs, Vg-1 and decapentaplegic (1). A 130-bp DNA band was generated and cloned into pBluescript. Recombinant plasmids were purified and sequenced by the dideoxy chain-termination method using a commercial kit (Pharmacia). For RT-PCR cloning of cDNAs encoding receptor serine/threonine kinases, first-strand E13 metanephric cDNA was used as substrate for PCR using degenerate oligonucleotides directed against conserved sequences present in the family of receptor serine/threonine kinases (9). A 450-bp PCR product was generated and cloned into pBluescript. Recombinant plasmids were isolated and sequenced.

Detection of mIMCD-3 serine/threonine kinase receptor RNAs. Ribonuclease (RNase) protection assays were performed using specific antisense riboprobes for Tbeta RI (ALK-5), Tbeta RII, ActRIB (ALK-4), ActRII, and c-met. Riboprobes were prepared from linearized plasmid templates treated with proteinase K (50 µg/ml at 37°C for 30 min). Riboprobes were then synthesized by performing in vitro transcription with T3 polymerase in the presence of [32P]UTP (Amersham). Following digestion of template DNA with RNase-free deoxyribonuclease I, full-length radiolabeled transcripts were isolated by gel purification. RNase protection assays were performed using a commercial kit (Ambion). A quantity of 10 µg of mIMCD-3 total RNA was coprecipitated with 5 × 105 cpm of riboprobe, resuspended in 20 µl of hybridization buffer (80% formamide, 100 mM sodium citrate, 300 mM sodium acetate, and 1 mM EDTA) and hybridized overnight at 50°C. For a positive control, 5 µg of mouse liver total RNA was hybridized with 5 × 104 cpm of an antisense mouse beta -actin riboprobe. For a negative control, 10 µg of yeast RNA was hybridized with each riboprobe. Following hybridization, RNase digestion was carried out at 37°C for 30 min. The precipitated RNA was dissolved in 8 µl of 80% loading buffer, heat-denatured at 90°C for 3 min, and electrophoresed in a 8 M urea/6% acrylamide gel.

RT-PCR was used to detect mIMCD-3 mRNAs encoding the ALK-2, ALK-3, and ALK-6 receptors. First-strand cDNA was synthesized as described above. PCR reactions were then performed using the following primers, all of which encode sequences in the extracellular domains of specific ALK receptors: ALK-2 sense 5' GATGAGAAGCCCAAGGTCAACC 3', ALK-2 antisense 5' ATGTTCCTGTTACACCAGTCCC 3' (GenBank/EMBL accession no. L15436); ALK-3 sense 5' GTGCTATTGCTCAGGACACTGC 3', ALK-3 antisense 5' AATGAGCACAACCAGCCATCGG 3' (GenBank/EMBL accession no. Z23154); ALK-6 sense 5' CACCAAGAAGGAGGATGG 3', ALK-6 antisense 5' ACAGACAGTCACAGAGATAAGC 3' (GenBank/EMBL accession no. Z32143). Thirty-five cycles of PCR amplification were performed in a programmable Dri-Block (Perkin-Elmer) using the following thermal-cycling protocol: 94°C for 1 min, 58°C for 2 min, and 72°C for 3 min, for 35 cycles.

Ligand-receptor affinity binding studies. Human recombinant BMP-2, OP-1, and TGF-beta 1 (R & D Systems) were iodinated as described by Frolik et al. (10). For receptor binding studies, 0.1 nM 125I-labeled TGF-beta , 10 nM 125I-OP-1, or 10 nM 125I-BMP-2 were incubated with mIMCD-3 cell monolayers and were affinity cross-linked using disuccinimidyl suberate as previously described (20). For immunoprecipitations, cells were lysed in lysis buffer [20 mM tris(hydroxymethyl)aminomethane chloride, pH 7.4, 150 mM NaCl, and 0.5% Triton X-100] in the presence of protease inhibitors and centrifuged to remove debris. 125I-BMP-2- and 125I-OP-1-labeled cell extracts were incubated with polyclonal antibodies to ALK-1, ALK-2, ALK-3, and ALK-6 [generously provided by P. ten Dijke and K. Miyazono (32, 33)], and TGF-beta -labeled cell extracts were incubated with polyclonal Tbeta R-I or Tbeta R-II antibodies (generously provided by J. Massagué). Lysates were incubated with antibodies for 1 to 2 h at 4°C and collected on protein A-Sepharose beads (Pharmacia). The immunoprecipitates were washed five times in cold lysis buffer and then resuspended in sample buffer for analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography.

Statistical analysis. Data were analyzed using the Statview statistical analysis program (version 4.01; Abacus Concepts, Berkeley, CA). For the dose-response analyses and explant treatment experiments, mean differences between the effect of the various ligands were examined by Student's two-tailed t-test. Differences between measurements obtained in the morphometric analyses of mIMCD branching structures were examined by analysis of variance. Significance was taken at a value of P < 0.05 (two-tailed).

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

BMP-2 and OP-1 control kidney morphogenesis. We identified BMPs expressed in the developing kidney by RT-PCR cloning using degenerate PCR primers encoding sequences contained within the BMPs, Vg-1 and decapentaplegic (1). Comparison of DNA sequences obtained from 28 recombinant plasmids to the nonredundant GenBank/EMBL database using the BLAST algorithm revealed that 23/28 encode OP-1, whereas 5/28 encode BMP-2.

We first determined the overall effects of BMP-2 and OP-1 on kidney development by measuring the growth of cultured embryonic murine kidney explants treated with each BMP. The surface area of each explant was computed from images obtained at 24 and 48 h after initiation of culture (Fig. 1), and the percent change in surface area over 24 h was determined (Fig. 2). Both OP-1 and BMP-2 exerted a direct and rapid effect on kidney growth. Surprisingly, OP-1 exerted opposite effects depending on dose. Whereas control kidneys increased in surface area by ~3%, those treated with 0.25 nM OP-1 increased by 30% (P = 0.001). In contrast, nanomolar concentrations of OP-1 exerted a negative effect on explant growth, as indicated by a 7% decrease in surface area with 28 nM OP-1 (P < 0.001). BMP-2 was entirely inhibitory (5% inhibition at 5 nM, P < 0.001) and did not stimulate growth at picomolar doses. Histological analysis indicated that 0.25 nM OP-1 stimulated the development of both epithelial- and mesenchymal-derived elements (Fig. 3). The ureteric bud/collecting ducts were notably longer and more highly branched compared with control. In contrast, 10 nM OP-1 attenuated the development of the ureteric bud and appeared to reduce the mass of mesenchymal cells. Despite a reduction in kidney surface area, the architecture of BMP-2-treated explants was preserved. However, the tissue appeared to be more compact than control, and the ureteric bud was somewhat attenuated compared with that observed in 0.25 nM OP-1-treated explants. Together these data indicate a direct role for OP-1 and BMP-2 in regulating embryonic kidney development. However, the cellular complexity of the organ culture explant limits the ability to determine the direct effects of BMP-2 and OP-1 on cell types within the kidney and specifically on tubulogenesis. Therefore, we developed an in vitro model using mIMCD-3 cells to investigate the direct effects of BMPs on branching morphogenesis.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 1.   Osteogenic protein-1 (OP-1) and bone morphogenetic protein-2 (BMP-2) control the growth of embryonic kidney explants. Embryonic day 12 (E12) mouse kidneys were cultured in serum-free medium containing OP-1 or BMP-2 and photographed as whole mounts 24 and 48 h after establishing cultures. Representative images are shown. Explants treated with 0.25 nM OP-1 grew substantially more than control (no ligand). In contrast, 10 nM OP-1 decreased explant size. Explants treated with 5 nM BMP-2 also decreased in size.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   BMPs control the growth of metanephric explants. E12 embryonic mouse kidneys were cultured in serum-free medium containing OP-1 or BMP-2. Explant surface area was computed from images obtained 24 and 48 h after establishing cultures (Fig. 1). Data represent the percent change in kidney surface area between 24 and 48 h in each treatment group; 0.25 nM OP-1 increased surface area by ~30%, whereas explants cultured without BMP (control) increased by ~3%. In contrast, treatment with 2.8 nM and 28 nM OP-1 caused a decrease in surface area in a dose-dependent manner. Treatment with 5 nM BMP-2 also caused surface area to decrease at a similar quantitative level; n = 3 separate experiments.


View larger version (114K):
[in this window]
[in a new window]
 
Fig. 3.   BMP-2 and OP-1 control development of epithelial-derived kidney elements. E12 embryonic mouse kidneys were cultured in serum-free medium containing OP-1 or BMP-2. After 48 h, paraffin-embedded 5-µm tissue sections were generated from fixed explant tissue. Images are of hematoxylin-eosin-stained tissue sections. Left: sections imaged at ×75 magnification. Right: identical sections imaged at ×150 magnification. Arrows, ureteric bud/collecting duct structures. Ureteric bud/collecting ducts in 0.25 nM OP-1-treated explants are longer and more highly branched than in other treatment groups. Treatment with 10 nM OP-1 attenuates this development. BMP-2 generates short ureteric bud/collecting ducts with heavily stained resident epithelial cells.

BMP-2 and OP-1 exert opposite effects on tubulogenesis in vitro. mIMCD-3 cells are derived from the terminal inner medullary collecting duct of the SV40 mouse (26) and form branching structures in three-dimensional matrices (4). The mIMCD-3 cell model provides an opportunity to test the activity of controlled quantities of ligands on collecting duct morphogenesis without interaction with other cell types. mIMCD-3 cells cultured in type I collagen form branching tubular structures when induced with 5% fetal bovine serum (Fig. 4). We defined intermediate structures formed after induction of mIMCD-3 cells in collagen gels by directly imaging structures at different times after cultures were initiated. Multicellular spheroid structures were observed within 6 h of induction (Fig. 4, A and D), elongated structures by 18 h (Fig. 4, B and E), and elongated branching forms by 72 h (Fig. 4, C and F). Subcellular structures, specifically large cytoplasmic processes, were observed at the ends of structures before and during branch formation (Fig. 4G). Cross sections of elongated branched mIMCD-3 structures revealed that they consist of interconnected cells organized around a central lumen (Fig. 4H); therefore, they can be defined as tubules.


View larger version (76K):
[in this window]
[in a new window]
 


View larger version (37K):
[in this window]
[in a new window]
 


View larger version (87K):
[in this window]
[in a new window]
 


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4.   mIMCD-3 cells form tubular structures in vitro. mIMCD-3 cells (50,000 cells/gel) were cultured in type I collagen in presence of serum. A and D: cellular aggregate after 6 h in culture imaged by differential interference contrast microscopy (DIC) (magnification = ×400) (A) and immunofluorescence microscopy (IF) to identify cell nuclei (D). B and E: elongated structure imaged by DIC (B) and IF (E) by 18 h in culture (magnification = ×400). C and F: elongated structure with a branch imaged by DIC (C) and IF (F) by 72 h in culture (magnification = ×200). G: high-power view (magnification = ×400) of a branch point to identify long, thin cellular processes (arrowhead) arising from cells at the branch point (left is DIC; right is IF). H: cross section of mIMCD-3 structure stained with hematoxylin and eosin 72 h after initiation of culture.

We determined the effect of BMP-2 and OP-1 on mIMCD-3 tubulogenesis by adding these ligands to the culture medium which bathed the collagen gels. The apoptotic response of mIMCD-3 cells cultured in collagen gels in the absence of serum precluded analysis of the effect of these ligands in the absence of serum. Therefore, in these experiments the effects of BMP-2 and OP-1 were compared in the presence of 5% serum. To determine whether mIMCD-3 tubulogenesis was regulated in vitro in a manner consistent with effects observed in whole organ explants cultured in vitro, we first tested the effects of known positive and negative regulators of tubulogenesis. TGF-beta and activin A are known inhibitors of tubulogenesis in embryonic kidney explants (4, 27), and hepatocyte growth factor (HGF) is stimulatory (29). Consistent with these effects on intact organs, serum alone (Fig. 5A) and 20 ng/ml HGF (Fig. 5B) stimulated mIMCD-3 tubulogenesis. In contrast, 0.5 nM TGF-beta and 1 nM activin A inhibited mIMCD-3 tubulogenesis (Fig. 5, D and E). BMP-2 and OP-1 altered both the number and phenotype of the structures that were formed within 48 h. This is precisely quantitated below; here, we focus on the broad phenotype. Treatment with 0.25 nM OP-1 appeared to increase the number of structures formed compared with serum alone (Fig. 5C). In contrast, 2.5 nM BMP-2 produced a marked reduction in the number of mIMCD-3 structures formed (Fig. 5F). These results suggested that BMP-2 and OP-1 have opposite effects on the morphogenesis of mIMCD-3 tubular structures in collagen gels.


View larger version (91K):
[in this window]
[in a new window]
 


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 5.   Members of the transforming growth factor-beta (TGF-beta ) family modulate the phenotype of mIMCD-3 structures formed in vitro. mIMCD-3 cells (50,000 cells/gel) were cultured in type I collagen in presence of serum alone (A) or with hepatocyte growth factor (HGF, B), TGF-beta 1 (D), activin A (E), BMP-2 (F), or OP-1 (C) and imaged by DIC 48 h after initiation of cultures. Bar in A = 200 µm.

To precisely define the effects of BMP-2 and OP-1 on mIMCD-3 tubule formation, we performed dose response analyses of mIMCD-3 tubule formation in the presence of varying doses of these ligands. We assessed the number of mIMCD-3 tubular structures formed 48 h after induction in collagen gels in the presence of serum supplemented medium containing OP-1, BMP-2, TGF-beta , or activin A (Fig. 6). For each ligand, four experiments were performed, and we counted up to 144 mIMCD-3 linear structures in 4 different scaled photographic fields. OP-1 affected mIMCD-3 tubule formation in a biphasic concentration-dependent manner (Fig. 6A). At low concentrations, OP-1 increased the number of mIMCD-3 tubular structures formed above control values with a maximum effect observed at 0.25 nM (28 ± 5% increase, P = 0.01). However, at concentrations greater than 0.5 nM, OP-1 inhibited the number of mIMCD-3 tubular structures formed with maximal inhibition observed at 10 nM (81 ± 8% inhibition, P = 0.02). In contrast, the effect of BMP-2 was entirely inhibitory with maximal inhibition at a dose of 10 nM (88 ± 3% inhibition, P < 0.0001) (Fig. 6B). BMP-2 was also inhibitory at concentrations as low as 0.05 nM and was never observed to stimulate the formation of mIMCD-3 tubules. Both TGF-beta and activin A inhibited the formation of serum-induced mIMCD-3 tubular structures in a concentration-dependent manner consistent with previous studies (4, 27) (Fig. 6, C and D). These results demonstrate that OP-1 exerts direct but opposite effects on mIMCD-3 tubulogenesis in a dose-dependent manner. In contrast, BMP-2 is inhibitory and more potent than high-dose OP-1 and other members of the TGF-beta superfamily.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   BMP-2 and OP-1 modulate mIMCD-3 tubulogenesis in a dose-dependent manner. mIMCD-3 cells (50,000 cells/gel) were cultured in type I collagen in presence of serum with TGF-beta 1 (C), activin A (D), BMP-2 (B), or OP-1 (A) and imaged by DIC 48 h after initiation of cultures. Numbers of tubules (linear structures) formed are expressed as percentage of control (5% fetal bovine serum alone) in 4 independent experiments. A: OP-1 is stimulatory at concentrations <= 0.5 nM [28 ± 5% increase (max), P = 0.01] and inhibitory at concentrations >0.5 nM (1 nM, 13 ± 4% inhibition, P = 0.05; 2.5 nM, 19 ± 11% inhibition, P = 0.16; 10 nM, 22 ± 8% inhibition, P = 0.02). B: BMP-2 is inhibitory at all concentrations tested (1 nM, 45 ± 13% inhibition, P = 0.04; 2.5 nM, 62 ± 8% inhibition, P = 0.005; 5 nM, 80 ± 3% inhibition, P = 0.0001; 10 nM, 88 ± 3% inhibition, P < 0.0001). C: TGF-beta 1 is inhibitory at all concentrations tested (0.5 nM, 45 ± 12% inhibition, P = 0.03; 1 nM, 67 ± 12% inhibition, P = 0.01). D: activin A is inhibitory at all concentrations tested (2.5 nM, 45 ± 14% inhibition, P = 0.05; 5.0 nM, 39 ± 7% inhibition, P = 0.009; 10 nM, 55 ± 13% inhibition, P = 0.02).

BMP-2 and OP-1 modulate the phenotype of mIMCD-3 tubular structures. Our initial results suggested that BMP-2- and OP-1-treated structures differ in their phenotype. Therefore, we analyzed their structural characteristics. Representative structures imaged simultaneously by DIC and immunofluorescence microscopy are shown in Fig. 7. Morphometric measurements were made using photographed images of 155 structures generated by 2 days and 7 days after induction in collagen gels consisting of a low density of cells (5,000 cells/gel). At this low concentration of cells, mIMCD-3 structures can be imaged at high resolution without optical interference by other adjacent structures. Compared with the structures imaged in higher cell-density gels (Fig. 5), structures formed in low-density gels contain fewer cells and develop more slowly as a function of time.


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 7.   Morphometric analysis of BMP-2- and OP-1-treated mIMCD-3 structures. mIMCD-3 cells (5,000 cells/gel) were cultured in type I collagen in presence of serum and 5 nM BMP-2 or 0.25 nM OP-1. Two days or seven days after initiation of culture, fixed structures were stained with bis-benzamide and imaged by DIC (A, C, E, and G) and IF (B, D, F, and H) microscopy. As exemplified in E, the long axis (solid bar) and the number of branch points (arrowheads) were determined for each imaged structure. Arrow in C marks the position of a cellular process extending from a branch point. A and B: BMP-2-treated structure after 2 days in culture (length = 58 µm). Structure is short and unbranched. C and D: OP-1-treated structure after 2 days in culture (length = 96 µm). Structure is long relative to BMP-2 structure and consists of a branch point. E and F: BMP-2-treated structure after 7 days in culture (length = 148 µm). Structure is short and consists of short, stubby branches. G and H: long, multibranched OP-1-treated structure after 7 days in culture (length = 364 µm).

We analyzed the morphometric characteristics of mIMCD-3 tubules during the early phase of tubulogenesis (2 days) and when mature tubules with lumens were formed (7 days). OP-1-treated structures differed from BMP-2-treated structures in the number of branch points per structure and in length (Table 1). Two days after induction of tubulogenesis, OP-1-treated structures were more highly branched than BMP-2-treated structures [OP-1 (n = 48) vs. BMP-2 (n = 44): 0.6 ± 0.1 vs. 0.07 ± 0.05 branch points/structure, respectively; P < 0.0001] (Fig. 7, A-D). Only 3/44 BMP-2-treated structures contained branch points or were branched. Further analysis of structures arising from branch points revealed that only three of all the branches generated in OP-1- and BMP-2-treated structures contained nuclei (Fig. 7, C and D). This suggests that an early step in the formation of a branch is the formation of a cell process and that BMP-2 inhibits the formation of these cell processes. In addition, OP-1-treated structures were longer than BMP-2-treated structures [OP-1 (n = 48) vs. BMP-2 (n = 44): length, 40.6 ± 4.9 vs. 29.5 ± 3.1 µm; P = 0.06]. Despite this difference in length, the number of nuclei/tube did not differ between OP-1- and BMP-2-treated structures [OP-1 (n = 48) vs. BMP-2 (n = 44), 1.8 ± 0.3 vs. 1.8 ± 0.4 nuclei/tube]. This suggests that OP-1 increases cell size.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effect of OP-1 and BMP-2 on the phenotype of mIMCD-3 cell structures

In contrast to 2-day structures, 7-day structures contained a much larger number of cells [OP-1 (n = 43) and BMP-2 (n = 20), 76 ± 12 and 38 ± 14 nuclei/structure, respectively]. Consistent with our analysis of 2-day structures, OP-1-treated structures were more highly branched than BMP-2-treated structures [OP-1 vs. BMP-2, 13 ± 2 vs. 4 ± 1 branch points/structure; P < 0.0001] (Fig. 7, E-H). The branches arising from these branch points consisted of true branches (contain nuclei) and pseudo branches (consist of cell processes only). Both true and pseudo branches were more numerous in OP-1-treated structures compared with BMP-2-treated branches [OP-1 vs. BMP-2 true branches, 7 ± 1 vs. 2 ± 1 true branches/structure (P = 0.0003); pseudo branches, 5 ± 1 vs. 1 ± 1 pseudo branches/structure (P < 0.0001)]. Also consistent with our analysis of 2-day structures was our finding that 7-day OP-1-treated structures were longer than BMP-2-treated structures, probably secondary to the larger number of cells in OP-1-treated tubules (OP-1 vs. BMP-2: length, 191 ± 14 vs. 118 ± 16 µm; P = 0.003). However, although BMP-2 inhibited tubular growth and branching, the smooth borders and width of BMP-2-treated tubules were more similar to native tubules than those treated with OP-1 (Fig. 7, E and G) (30). This suggests that BMP-2 plays a role in modulating the final shape of developing branched tubules. Taken together, our analysis of early and mature tubular structures suggests that 1) BMP-2 and OP-1 exert different activities during the formation of branched tubules, 2) the formation of a true branch is preceded by the elaboration of a cytoplasmic process by the cell, and 3) BMP-2 inhibits the formation of these branches possibly by interfering with cell process formation.

mIMCD cells express mRNAs encoding BMP receptors. Having demonstrated that BMP-2 and OP-1 control the number and type of mIMCD-3 structures formed in collagen gels, we sought to define the molecular basis for these effects. Since the specificity of the effects of these ligands resides, in part, with the cell surface receptors which bind them, we first identified receptors that are expressed in the E13 metanephros, a stage at which collecting duct morphogenesis is occurring. Since members of the TGF-beta superfamily are known to signal via a highly conserved family of cell surface transmembrane serine/threonine kinases, we used a RT-PCR cloning strategy to identify receptor mRNAs (9). By this method we identified cDNAs encoding Tbeta RI (ALK-5), Tbeta RII, ActR1B (ALK-2), ActRIIB, ALK-3, and ALK-6 (Table 2). Next, we determined by RNase protection and RT-PCR assays whether these mRNAs are also expressed by mIMCD-3 cells (Fig. 8; Table 2). RNase protection assays using exact match cRNA probes demonstrated protection of RNA fragments of 200, 380, 390, and 400 bp in size predicted for Tbeta RI (ALK-5), Tbeta RII, ActR1B (ALK-2), and ActRIIB, respectively. These are the known receptors for TGF-beta and activin A, respectively. Positive controls in this assay included beta -actin and c-met, the receptor for HGF (3). RT-PCR and Southern analysis using exact match primers and cDNA probes demonstrated that mIMCD-3 cells express ALK-3 and ALK-6, type I receptors known to bind BMP-2 (Fig. 8, B and C). Interestingly, we did not detect expression of ALK-2, a candidate OP-1 receptor. Together, these results demonstrate that the E13 metanephros and mIMCD-3 cells express mRNAs encoding type I and type II receptors, which bind TGF-beta superfamily members including BMP-2.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Expression of serine/threonine kinase receptor mRNA in E13 metanephros and mIMCD-3 cells


View larger version (93K):
[in this window]
[in a new window]
 


View larger version (54K):
[in this window]
[in a new window]
 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 8.   mIMCD-3 cells express a broad repertoire of type I and type II serine/threonine kinase receptor mRNAs. A: RNase protection assay demonstrating protection of mIMCD-3 RNAs using 32P-labeled antisense RNA probes for c-met, Tbeta R1, Tbeta RII, ActR1B, ActRIIB, and actin. B: agarose gel of DNA bands generated by reverse transcription-polymerase chain reaction (RT-PCR) of mIMCD-3 poly(A)+ mRNA using exact-match oligonucleotide primers for ALK-3 and ALK-6. C: Southern analysis of agarose gel, shown in B, demonstrating hybridization of 32P-labeled ALK-3 and ALK-6 cDNA probes to candidate ALK-3 and ALK-6 DNA bands generated by RT-PCR of mIMCD-3 RNA. MW, molecular weight markers.

BMP-2 binds to mIMCD-3 cells via ALK-3. To further define, at the protein level, the receptors that bind BMP-2 and OP-1, we performed ligand-receptor cross-linking with immunoprecipitation using antisera directed against type I and type II receptors (Fig. 9). Isolated receptors were resolved by SDS-PAGE. In these experiments, mIMCD-3 cell receptor affinity labeled with 125I-TGF-beta served as a positive control. As expected, we observed three labeled products corresponding to betaglycan, type II and type I receptors, typically observed in a wide variety of cell lines responsive to TGF-beta (38). The identities of Tbeta RII and Tbeta RI were confirmed by immunoprecipitation of total cell lysates with specific receptor antibodies (Fig. 9, middle). Since TGF-beta receptors typically form stable heteromeric complexes, immunoprecipitates using anti-Tbeta RII antibodies contained affinity-labeled species corresponding to Tbeta RII and additional species corresponding to betaglycan and Tbeta RI, as observed previously (36). Similarly, immunoprecipitates of anti-Tbeta RI antibodies contain labeled products corresponding to both Tbeta RI and Tbeta RII.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 9.   BMP-2 and OP-1 bind to mIMCD-3 cell surface proteins. 125I-labeled ligand was cross-linked to mIMCD-3 cells in monolayer. Labeled ligand-receptor complexes were immunoprecipitated using antisera directed against type I and type II receptors and analyzed by SDS-PAGE. Middle: total cell lysate after labeling of cells with 125I-TGF-beta 1 contains 3 labeled products, >180, 80-85, and 69 kDa in size. Immunoprecipitation of cell lysate with anti-Tbeta RII yielded two bands, the size of Tbeta RI and Tbeta RII. Immunoprecipitation of cell lysate with anti-Tbeta RI yielded a major band the size of Tbeta RI and a minor band the size of Tbeta RII. Left: total cell lysate after labeling of cells with 125I-BMP-2 contains 3 labeled products, 180, 80-85, and 75 kDa in size. Immunoprecipitation of the cell lysate with specific type I receptor antibodies demonstrating that only anti-ALK-3 immunoprecipitates contain affinity-labeled complexes. Right: total cell lysate after labeling of cells with 125I-OP-1 contains five labeled products, 200, 180, 150, 85, and 80 kDa in size. Immunoprecipitation of the cell lysate with ActRII/IIB antibodies demonstrates that OP-1 binds this type II receptor as in the cell line C5.18. Immunoprecipitation of cell lysate with specific type I receptor antibodies demonstrates that the 80-kDa protein (p80) is not ALK-1, ALK-2, ALK-3, or ALK-6.

mIMCD-3 cells labeled with 125I-BMP-2 yielded three labeled products, a high-molecular-weight band at ~180 kDa, a diffuse 80- to 85-kDa band, and a faster migrating 75-kDa band (Fig. 9, left). The two larger proteins likely represent the two alternatively spliced forms of BMPR-II (18). Alternatively, the 80- to 85-kDa form may also represent ActRII and ActRIIB, which under the appropriate conditions also bind BMP-2 (L. Attisano and J. L. Wrana, unpublished observations). To identify the specific BMP-2 binding type I receptors, lysates from affinity-labeled cells were subjected to immunoprecipitation with specific type I receptor antibodies. Only anti-ALK-3 immunoprecipitates contained affinity-labeled products. Furthermore, as expected from the known ability of BMP receptors to form heteromeric complexes (17), additional affinity-labeled products of 80-85 kDa and 180 kDa were also observed. These data indicate that the candidate cell surface receptor in the BMP-2 signaling pathway is ALK-3.

Affinity labeling of mIMCD-3 cell surface proteins with 125I-OP-1 yielded five labeled protein bands, 200, 180, 150, 85, and 80 kDa in size (Fig. 9, right). The 180- and 150-kDa bands may represent different forms of BMPR-II (18). Immunoprecipitation of mIMCD-3 proteins in the cell lysate with antibodies specific to ActRII/IIB yielded the 85-kDa band, as in the control cell line C5.18. To further characterize binding of OP-1 to p80, we performed competition assays using unlabeled OP-1. As previously observed (39), addition of unlabeled OP-1 did not displace binding of labeled OP-1 but rather increased binding to the cell lysates (data not shown). The basis for this phenomenon is currently unclear (39). To attempt to determine the identity of p80, we performed immunoprecipitation with antibodies directed against the type I receptors, ALK-1, ALK-2, ALK-3, and ALK-6. However, none of these antibodies identified p80. These results suggest that the OP-1 signaling pathway in mIMCD-3 cells includes ActRII/IIB and another as yet unidentified receptor that may correspond to p80.

OP-1 exerts both stimulatory and inhibitory effects on branching morphogenesis in the developing kidney. On the basis of our results in embryonic kidney explants and in the mIMCD-3 model of collecting duct morphogenesis, we hypothesized that OP-1 exerts opposite effects on branching morphogenesis in different areas of developing kidney tissue depending on its local concentration. To test this directly, we delivered recombinant OP-1 and BMP-2 in a spatially restricted manner to developing murine E12 kidneys by saturating agarose beads with a micromolar amount of ligand and placing ligand-saturated beads on the kidney surface (Fig. 10) (25). Consistent with our previous results, the growth of kidney explants treated with high doses of OP-1 or BMP-2 was significantly less than that of kidneys treated with beads saturated with bovine serum albumin (Table 3). Since branched tubular structures are formed symmetrically on either side of the ureteric bud, we tested the effect of these BMPs on branching morphogenesis by applying them to one side of the kidney. We then compared the number of ureteric bud/collecting duct branches that formed in the side adjacent to the beads to that on the untreated contralateral side. On the sixth day in culture, control kidneys contained a nearly equivalent number of D. biflorus agglutinin-stained collecting system branches on either side of the ureteric bud (ratio of mean number on each side = 0.92 ± 0.01; Table 3). In contrast, the number of branches on the side receiving either 2 µM BMP-2 or 2 µM OP-1 beads was 64 ± 2% and 58 ± 1% less than that on the untreated contralateral side (P < 0.0001). Furthermore, in the tissue immediately adjacent to BMP-2 and OP-1 beads, which presumably received the highest dose of ligand, no ureteric bud/collecting duct structures were observed. In contrast, we consistently observed that the collecting system in the region of the kidney distal to the OP-1 beads was more highly branched than in any region of the control or BMP-2-treated explants. In this region, the concentration of OP-1 is predicted to be lower than in areas adjacent to the beads secondary to diffusion of the ligand. We attempted to demonstrate directly that agarose beads soaked in low doses of OP-1 stimulate branching morphogenesis in explants. We did not observe any stimulation under these conditions. This negative result is likely explained by the relatively narrow dosage range in which OP-1 is stimulatory, the strong affinity of OP-1 for the extracellular matrix (35), and the slow kinetics of peptide release from agarose beads (13, 31). Polypeptides such as epidermal growth factor and fibroblast growth factor are bound to agarose beads with an efficiency of 90-95%. Approximately 50% of bound protein is released within the first 24 h, whereas 10% is released during every subsequent 24-h period. Thus these release kinetics combined with the narrow dose response range and sequestration of growth factor by the extracellular matrix could easily mitigate against a stimulatory effect in explant tissue. However, taken together with our in vitro data, our results strongly support our hypothesis that OP-1 exerts different morphogenetic effects, depending on its local concentration in developing kidney tissue.


View larger version (127K):
[in this window]
[in a new window]
 
Fig. 10.   OP-1 and BMP-2 modulate branching morphogenesis in embryonic kidney explants. E12 embryonic mouse kidneys were cultured in vitro in serum-free medium and photographed on the second and sixth days after establishing cultures. On day 6 of culture, explants were fixed and stained with fluorescein-conjugated D. biflorus agglutinin (DBA) to identify ureteric bud/collecting duct branches (C, F, and I). Whole mount kidney explants were photographed on day 2 (A, D, and G) and day 6 (B, E, and H) of culture, respectively. Agarose beads are positioned in the upper pole of the explant treated with BMP-2 (D and E). Positions of beads in DBA-stained BMP-2-treated explant are marked by the two arrows overlying tissue on right ureteric bud (F). Branching structures are absent in tissue adjacent to these beads. Position of agarose beads in OP-1-treated kidneys is marked by arrowhead next to the ureteric bud (G and H). Position of these agarose beads in DBA-stained OP-1-treated explant is marked by 2 arrows at top. Branching structures are absent in tissue adjacent to these beads. In contrast, a multibranched structure (arrowhead) is present distal to the OP-1 beads (I).

                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Effect of BMP-2 and OP-1 on embryonic kidney growth and development

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Previous studies have demonstrated the spatial expression of OP-1 and BMP-2 early in mouse kidney development and have suggested a role for these BMPs in mesenchymal-epithelial interactions and their morphogenetic consequences (2, 8). During early murine kidney development, OP-1 mRNA is expressed in the ureteric bud and in the induced metanephric mesenchyme. In contrast, BMP-2 mRNA expression is restricted to the metanephric mesenchyme. Later, during maturation of mesenchymal-derived elements, OP-1 is expressed in maturing glomeruli, whereas BMP-2 expression decreases markedly. Although functional tests have indicated a role for OP-1 in the induction of the metanephric blastema (7, 19, 34), there is no direct evidence that either OP-1 or BMP-2 controls branching morphogenesis.

Our experiments in embryonic kidney explants (Figs. 1-3) and in an in vitro model of collecting duct morphogenesis (Figs. 5 and 6) demonstrate that OP-1 exerts opposite effects on branching morphogenesis in a dose-dependent manner. Picomolar amounts of OP-1 stimulate, whereas nanomolar amounts inhibit. In vitro, low doses of OP-1 (0.25 nM) increase mIMCD-3 tubule length and branching, and 100× higher doses attenuate these effects. The effects of 0.25 nM OP-1 and 10 nM OP-1 on embryonic kidney explants are consistent with the effects in vitro. In contrast, the effects of BMP-2 are monophasic and inhibitory. BMP-2 inhibits the formation of tubules. However, its qualitative effects are more complex. Although BMP-2 inhibits branch formation and linear growth, it generates a more sculpted, thicker tubular trunk in vivo and in vitro (Figs. 3 and 7). Thus OP-1 and BMP-2 may act cooperatively to regulate both the number and the structural characteristics of developing branched tubules.

The mechanism that underlies the stimulatory effect of OP-1 (<0.25 nM) on tubulogenesis is undefined. Further studies are needed to determine the effect of OP-1 on cellular mechanisms which appear to be critical during tubulogenesis. These include cell proliferation, cell process formation, and cell-cell adhesion (22). The mechanisms that underlie the inhibitory effect of BMP-2 and OP-1 (>0.25 nM) are also undefined. However, the observation that activation of the ALK-3 receptor mediates apoptosis in the developing limb (41) suggests that treatment of mIMCD-3 cells in collagen gels with BMP-2 may induce apoptosis via activation of ALK-3, thereby decreasing the number of cells capable of forming tubular structures. Further studies are required to test this possibility and to determine whether the inhibitory effect of high-dose OP-1 is mediated by a similar mechanism.

Our data provide insights into the mechanisms of branch formation. The structures that arise from branch points in immature OP-1-treated structures are cellular processes. More mature structures consist of true branches (consisting of one or more cells) that arise from these cellular processes. Immature BMP-2-treated structures rarely consist of a branch point. Thus our data suggest that BMP-2 controls branch formation by inhibiting the formation of cellular processes. Recent studies have defined some of the molecular elements involved in filopodia formation (23) and in the formation of tubulin-based processes (22), and this information may provide a basis to test the effects of BMP-2 and OP-1 on these pathways. Thus further studies are required to characterize whether these cellular processes are actin or microfilament based.

OP-1 also increases the length of mIMCD-3 structures. In our analysis of 2-day, immature structures and 7-day, mature structures, we found no significant difference in the number of resident nuclei within OP-1- vs. BMP-2-generated tubules. This suggests that properties other than cell number (e.g., cell shape, cell size) determine the length of these structures. Further studies will be required to test whether the effects of these BMPs on elements of the cytoskeleton are related to this observed effect on cell shape.

The differential effects of BMP-2 and OP-1 on branching morphogenesis are surprising, since both of these growth factors signal via a highly conserved family of cell surface receptors. To determine the molecular basis for these effects, we identified type I and II serine/threonine cell surface receptors, which can serve as binding partners for BMP-2 and OP-1 (Fig. 9). These results provide a biochemical basis for the phenotypic effects we observed. We demonstrate that the BMP-2 cell surface receptor complex consists of ALK-3 and a type II receptor, the size of which is consistent with either BMPRII or ActRIIB. These results are consistent with the recent demonstration that ligand-dependent phosphorylation of MADR1, a downstream effector of BMP-2, requires the coexpression of type I and type II BMP-2 receptors and can be mediated by either ActRIIB or BMPRII in conjunction with either ALK-3 or ALK-6 (15). Our results strongly suggest that in mIMCD-3 cells, ALK-3 is the type I receptor that signals in the BMP-2 pathway. Our results also demonstrate that the mIMCD-3 OP-1 receptor complex consists of the type II receptor, ActRII/IIB. We were not able to identify type I receptors (ALK-2, ALK-3, ALK-6) in this complex using specific antibodies. This may be because receptors such as ALK-2 are expressed in lower than detectable quantities. Our inability to detect receptors with these antibodies is not explained by cross-species differences, since the ALK-6 antibody is directed against a mouse peptide (32), the ALK-3 antibody identifies ALK-3 in the mIMCD-3 BMP-2 receptor complex, and the ALK-2 antibody is directed against a human peptide that is identical in mouse ALK-2. We did identify an unknown protein, p80, in the OP-1 receptor complex. However, the failure of unlabeled OP-1 to competitively displace radiolabeled OP-1 as previously described (39) limited our ability to determine whether p80 is a specific OP-1 receptor. This unusual property of OP-1 is possibly due to its high affinity for the extracellular matrix (35).

Our demonstration that BMP-2 and OP-1 have opposite effects on mIMCD-3 tubulogenesis is consistent with previous observations that members of the TGF-beta superfamily can induce different biological responses (16). For example, during patterning of the Xenopus embryo, activins can function to induce dorsal mesoderm while BMP-4 induces ventral mesoderm (12). The specificity of these responses appears to be mediated by the particular type I receptor that is activated by a particular BMP-type II receptor complex. Type I receptors with highly related kinase domains can mediate similar biological responses, whereas more distantly related type I receptors may mediate distinct responses (5). Such is the case for BMP-2 signaling, which is regulated by ALK-3 and ALK-6 but not by ALK-2 and ALK-5 (15). At the level of protein homology, the kinase domains of ALK-3 and ALK-6 are highly related to each other but share less identity with those of ALK-1, ALK-2, ALK-4, and ALK-5 (33). These observations support a hypothesis that predicts that at low concentrations, OP-1 signals via a type I receptor other than ALK-3 and ALK-6. Our studies demonstrate that the mIMCD-3 OP-1 receptor, p80, is not ALK-1, ALK-2, ALK-3, or ALK-6. In addition, our demonstration that OP-1 stimulates mIMCD-3 tubulogenesis and increases the number of branches and the length of structures suggests that the OP-1 receptors signal via a stimulatory pathway distinct from the BMP-2 pathway. The elements in both stimulatory and inhibitory pathways downstream of BMP-2 are largely unknown. Future studies aimed at identifying these elements will provide a necessary biochemical basis for the effects of these BMPs at the cellular level.

The growth and branching of the ureteric bud and its daughter collecting ducts appears to be tightly regulated during renal development. The expression of growth factors that signal via stimulatory or inhibitory pathways may serve as a mechanism to control these processes. Our observations that BMP-2 and OP-1 differentially regulate both the number and the phenotype of branched tubules in a dose-dependent manner suggest that both these BMPs are important regulatory molecules for these morphogenetic events. This is consistent with the known spatial expression of BMP-2 and OP-1 in the developing kidney and the knowledge that BMPs play diverse roles during the development of nonrenal tissues. Further studies aimed at determining the cellular targets of these growth factors in vivo during metanephric development will further define their role in regulating collecting duct development.

    ACKNOWLEDGEMENTS

We thank Ivanka Antoniewicz for expert technical assistance in the performance of these studies and Judith McNicoll for expert secretarial support. We also thank Herman Yeger for helpful assistance with metanephric organ culture and P. ten Dijke, K. Miyazano, K. Heldin, W. Vale, and J. Massagué for kindly providing antibodies used in these studies.

    FOOTNOTES

This work was supported, in part, by a Kidney Foundation of Canada Scholarship, I'Anson Professorship, and Pediatric Consultants (Hospital for Sick Children) Grant (to N. D. Rosenblum), Medical Research Council of Canada Scholarships and Operating Grants (to L. Attisano and J. L. Wrana), and a National Cancer Institute of Canada Operating Grant (to J. L. Wrana).

Address for reprint requests: N. D. Rosenblum, Division of Nephrology, Program in Developmental Biology, The Hospital for Sick Children, Univ. of Toronto, 555 Univ. Ave., Toronto, Ontario, Canada M5G 1X8.

Received 26 July 1997; accepted in final form 18 August 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Basler, K., T. Edlund, T. M. Jessell, and T. Yamada. Control of cell pattern in the neural tube: regulation of cell differentiation by dorsalin-1, a novel TGF-beta family member. Cell 73: 687-702, 1993[Medline].

2.   Bitgood, M. J., and A. M. McMahon. Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev. Biol. 172: 126-138, 1995[Medline].

3.   Bottaro, D. P., S. J. Rubin, D. L. Faletto, A. M.-L. Chan, T. E. Kmiecik, G. F. Van de Woude, and S. A. Aaronson. Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science 251: 802-804, 1991[Abstract/Free Full Text].

4.   Cantley, L. G., E. J. G. Barros, M. Gandhi, M. Rauchman, and S. K. Nigam. Regulation of mitogenesis, motogenesis, and tubulogenesis by hepatocyte growth factor in renal collecting duct cells. Am. J. Physiol. 267 (Renal Fluid Electrolyte Physiol. 36): F271-F280, 1994[Abstract/Free Full Text].

5.   Carcamo, J., F. M. B. Weis, F. Ventura, R. Wieser, J. L. Wrana, L. Attisano, and J. Massagué. Type I receptors specify growth-inhibitory and transcriptional responses to transforming growth factor beta  and activin. Mol. Cell. Biol. 14: 3810-3821, 1994[Abstract/Free Full Text].

6.   Dewulf, N., K. Verschueren, O. Lonnoy, A. Morén, S. Grimsby, K. Vande Spiegle, K. Miyazono, D. Huylebroeck, and P. ten Dijke. Distinct spatial and temporal expression patterns of two type 1 receptors for bone morphogenetic proteins during mouse embryogenesis. Endocrinology 136: 2652-2663, 1995[Abstract].

7.   Dudley, A. T., K. M. Lyons, and E. J. Robertson. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9: 2795-2807, 1995[Abstract/Free Full Text].

8.   Dudley, A. T., and E. J. Robertson. Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev. Dyn. 208: 349-362, 1997[Medline].

9.   Franzen, P., P. ten Dijke, H. Ichijo, H. Yamashita, P. Schulz, C.-H. Heldin, and K. Miyazono. Cloning of a TGFbeta type 1 receptor that forms a heteromeric complex with the TGFbeta type II receptor. Cell 75: 681-692, 1993[Medline].

10.   Frolik, C. A., L. M. Wakefield, D. M. Smith, and M. B. Sporn. Characterization of a membrane receptor for transforming growth factor-beta in normal rat kidney fibroblasts. J. Biol. Chem. 259: 10995-11000, 1984[Abstract/Free Full Text].

11.   Green, J. B. A., H. V. New, and J. C. Smith. Responses of embryonic Xenopus cells to activin and FGF are separated by multiple dose thresholds and correspond to distinct axes of the mesoderm. Cell 71: 731-739, 1992[Medline].

12.   Harland, R. M. The transforming growth factor beta  family and induction of the vertebrate mesoderm: bone morphogenetic proteins are ventral inducers. Proc. Natl. Acad. Sci. USA 91: 10243-10246, 1994[Free Full Text].

13.   Hayek, A., F. L. Culler, G. M. Beattie, A. D. Lopez, P. Cuevas, and A. Baird. An in vivo model for study of the angiogenic effects of basic fibroblast growth factor. Biochem. Biophys. Res. Commun. 147: 876-880, 1987[Medline].

14.   Hogan, B. L. M. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10: 1580-1594, 1996[Free Full Text].

15.   Hoodless, P. A., T. Haerry, S. Abdollah, M. Stapleton, M. B. O'Connor, L. Attisano, and J. L. Wrana. MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell 85: 489-500, 1996[Medline].

16.   Kingsley, D. M. The TGF-beta superfamily: new members, new receptors, and new genetic tests of function in different organisms. Genes Dev. 8: 133-146, 1994[Free Full Text].

17.   Letsou, A., K. Arora, J. L. Wrana, K. Simin, V. Twombly, J. Jamal, K. Staehling-Hampton, F. M. Hoffmann, W. M. Gelbart, J. Massagué, and M. B. O'Connor. Drosophila dpp signaling is mediated by the punt gene product: a dual ligand-binding type II receptor of the TGFbeta receptor family. Cell 80: 899-908, 1995[Medline].

18.   Liu, F., F. Ventura, J. Doody, and J. Massagué. Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model of the BMPs. Mol. Cell. Biol. 15: 3479-3486, 1995[Abstract].

19.   Luo, G., C. Hofmann, A. L. J. J. Bronckers, M. Sohocki, A. Bradley, and G. Karsenty. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 9: 2808-2820, 1995[Abstract/Free Full Text].

20.   Massagué, J. Identification of receptors for type-beta transforming growth factor. Methods Enzymol. 146: 174-195, 1987[Medline].

21.   Mishina, Y. A., A. Susuki, N. Ueno, and R. R. Behringer. BMPr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev. 9: 3027-3037, 1995[Abstract/Free Full Text].

22.   Näthke, I. S., C. L. Adams, P. Polakis, J. H. Sellin, and W. J. Nelson. The adenomatous polyposis coli tumour suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134: 165-179, 1996[Abstract/Free Full Text].

23.   Nobes, C. D., and A. Hall. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamillipodia and filopodia. Cell 81: 53-62, 1995[Medline].

24.   Ozkaynak, E., P. N. Schnegelsberg, and H. Oppermann. Murine osteogenic protein (OP-1): high levels of mRNA in kidney. Biochem. Biophys. Res. Commun. 179: 116-123, 1991[Medline].

25.   Pichel, J. G., L. Shen, H. Z. Sheng, A.-C. Granholm, D. J. A. Grinberg, E. J. Lee, S. P. Huang, M. Saarmas, B. J. Hoffer, H. Sariola, and H. Westphal. Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382: 73-76, 1996[Medline].

26.   Rauchman, M. I., S. K. Nigam, E. Delpire, and S. R. Gullans. An osmotically tolerant inner medullary collecting duct cell line from an SV40 transgenic mouse. Am. J. Physiol. 265 (Renal Fluid Electrolyte Physiol. 34): F416-F424, 1993[Abstract/Free Full Text].

27.   Ritvos, O., T. Tuuri, M. Eramaa, K. Sainio, K. Hilden, L. Saxen, and S. F. Gilbert. Activin disrupts epithelial branching morphogenesis in developing glandular organs of the mouse. Mech. Dev. 50: 229-245, 1995[Medline].

28.   Ruberte, E., T. Marty, D. Nellen, M. Affolter, and K. Basler. An absolute requirement for both the type II and type I receptors, punt and thick veins, for dpp signaling in vivo. Cell 80: 889-897, 1995[Medline].

29.   Santos, O. F. P., and S. K. Nigam. HGF-induced tubulogenesis and branching of epithelial cells is modulated by extracellular matrix and TGF-beta . Dev. Biol. 160: 293-302, 1993[Medline].

30.   Saxen, L. Organogenesis of the Kidney. Cambridge: Cambridge University Press, 1987.

31.   Schreiber, A. B., M. E. Winkler, and R. Derynk. Transforming growth factor-alpha : a more potent angiogenic mediator than epidermal growth factor. Science 232: 1250-1253, 1986[Abstract/Free Full Text].

32.   Ten Dijke, P., H. Yamashita, H. Ichijo, P. Franzen, M. Laiho, K. Miyazono, and C.-H. Heldin. Characterization of type 1 receptors for transforming growth factor-beta and activin. Science 264: 101-104, 1994[Abstract/Free Full Text].

33.   Ten Dijke, P., H. Yamashita, T. K. Sampath, A. H. Reddi, M. Estevez, D. L. Riddle, H. Ichijo, C.-H. Heldin, and K. Miyazono. Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J. Biol. Chem. 269: 16985-16988, 1994[Abstract/Free Full Text].

34.   Vukicevic, S., J. B. Kopp, F. P. Luyten, and T. K. Sampath. Induction of nephrogenic mesenchyme by osteogenic protein 1 (bone morphogenetic protein 7). Proc. Natl. Acad. Sci. USA 93: 9021-9026, 1996[Abstract/Free Full Text].

35.   Vukicevic, S., V. Latin, P. Chen, R. Batorsky, A. H. Reddi, and T. K. Sampath. Localization of osteogenic protein-1 (bone morphogenetic protein-7) during human embryonic development: high affinity binding to basement membranes. Biochem. Biophys. Res. Commun. 198: 693-700, 1994[Medline].

36.   Wrana, J. L., L. Attisano, J. Carcamo, A. Zentella, J. Doody, M. Laiho, X.-F. Wang, and J. Massagué. TGFbeta signals through a heteromeric protein kinase receptor complex. Cell 71: 1003-1014, 1992[Medline].

37.   Wrana, J. L., L. Attisano, R. Wieser, F. Ventura, and J. Massagué. Mechanism of activation of the TGF-beta receptor. Nature 370: 341-347, 1994[Medline].

38.   Wrana, J. L., H. Tran, L. Attisano, K. Arora, S. R. Childs, J. Massagué, and M. B. O'Connor. Two distinct transmembrane serine/threonine kinases from Drosophila melanogaster form an activin receptor complex. Mol. Cell. Biol. 14: 944-950, 1994[Abstract/Free Full Text].

39.   Yamashita, H., P. ten Dijke, D. Huylebroeck, T. K. Sampath, M. Andries, J. C. Smith, C.-H. Heldin, and K. Miyazono. Osteogenic protein-1 binds to activin type II receptors and induces certain activin-like effects. J. Cell Biol. 130: 217-226, 1995[Abstract/Free Full Text].

40.   Yeger, H., D. Forget, J. Alami, and B. R. Williams. Analysis of WT1 gene expression during mouse nephrogenesis in organ culture. In Vitro Cell. Dev. Biol. 32: 496-504, 1996.

41.   Zou, H., and L. Niswander. Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272: 738-741, 1996[Abstract].


AJP Renal Physiol 273(6):F961-F975
0363-6127/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Vrljicak, D. Myburgh, A. K. Ryan, M. A. van Rooijen, C. L. Mummery, and I. R. Gupta
Smad expression during kidney development
Am J Physiol Renal Physiol, April 1, 2004; 286(4): F625 - F633.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Nakamura, J. B. Stokes, and P. B. McCray Jr.
Endogenous and exogenous glucocorticoid regulation of ENaC mRNA expression in developing kidney and lung
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C762 - C772.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. E. Fisher, L. Michael, M. W. Barnett, and J. A. Davies
Erk MAP kinase regulates branching morphogenesis in the developing mouse kidney
Development, November 1, 2001; 128(21): 4329 - 4338.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
N. Miao, B. Fung, R. Sanchez, J. Lydon, D. Barker, and K. Pang
Isolation and Expression of PASK, a Serine/Threonine Kinase, During Rat Embryonic Development, with Special Emphasis on the Pancreas
J. Histochem. Cytochem., October 1, 2000; 48(10): 1391 - 1400.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Pavlova, R. O. Stuart, M. Pohl, and S. K. Nigam
Evolution of gene expression patterns in a model of branching morphogenesis
Am J Physiol Renal Physiol, October 1, 1999; 277(4): F650 - F663.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. R. Gupta, T. D. Piscione, S. Grisaru, T. Phan, M. Macias-Silva, X. Zhou, C. Whiteside, J. L. Wrana, and N. D. Rosenblum
Protein Kinase A Is a Negative Regulator of Renal Branching Morphogenesis and Modulates Inhibitory and Stimulatory Bone Morphogenetic Proteins
J. Biol. Chem., September 10, 1999; 274(37): 26305 - 26314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. T. Clark and J. F. Bertram
Molecular regulation of nephron endowment
Am J Physiol Renal Physiol, April 1, 1999; 276(4): F485 - F497.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Karihaloo, S. A. Karumanchi, J. Barasch, V. Jha, C. H. Nickel, J. Yang, S. Grisaru, K. T. Bush, S. Nigam, N. D. Rosenblum, et al.
Endostatin regulates branching morphogenesis of renal epithelial cells and ureteric bud
PNAS, October 23, 2001; 98(22): 12509 - 12514.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Piscione, T. D.
Right arrow Articles by Rosenblum, N. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piscione, T. D.
Right arrow Articles by Rosenblum, N. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online