AJP - Renal Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 273: F976-F983, 1997;
0363-6127/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welch, W. J.
Right arrow Articles by Wilcox, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welch, W. J.
Right arrow Articles by Wilcox, C. S.
Vol. 273, Issue 6, F976-F983, December 1997

Salt loading enhances rat renal TxA2/PGH2 receptor expression and TGF response to U-46,619

William J. Welch, Bo Peng, Kazuhisa Takeuchi, Keishi Abe, and Christopher S. Wilcox

Division of Nephrology and Hypertension, Georgetown University Medical Center, Washington, District of Columbia 20007; and Second Department of Internal Medicine,Tohoku University School of Medicine, Sendai 980, Japan

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

The tubuloglomerular feedback (TGF) response is potentiated by thromboxane A2 (TxA2) and/or prostaglandin endoperoxide (PGH2) acting on specific receptors. Infusion of the TxA2/PGH2 mimetic, U-46,619, into conscious rats leads to hypertension that is potentiated by a high-salt intake. Therefore, we tested the hypothesis that a high-salt intake enhances the expression of transcripts for TxA2/PGH2 receptors in the kidney and glomeruli and enhances the response of TGF to TxA2/PGH2 receptor stimulation. Groups of rats were accommodated to a low-salt (LS), normal salt (NS), or high-salt (HS) diet for 8-10 days. TxA2/PGH2 receptor mRNA was detected by reverse transcription-polymerase chain reaction in kidney cortex, isolated glomeruli, and abdominal aorta. TxA2/PGH2 mRNA abundance was significantly (P < 0.001) increased during intake of high-salt compared with low-salt diets in the kidney cortex (1.34 ± 0.10 vs. 0.84 ± 0.04 arbitrary units) and isolated outer cortical glomeruli (0.68 ± 0.04 vs. 0.32 ± 0.03 arbitrary units), but there was no effect of salt on TxA2/PGH2 receptor mRNA expression in the aorta. Maximal TGF responses were assessed from the increase in proximal stop flow pressure (an index of glomerular capillary pressure) during increases in loop of Henle perfusion with artificial tubular fluid from 0 to 40 nl/min. Compared with vehicle, the enhancement of maximal TGF with U-46,619 (10-6 M) added to the perfusate was greater in rats adapted to high-salt than normal salt (HS: +9.6 ± 1.1 vs. NS: +5.1 ± 0.4 mmHg; P < 0.001) or low-salt (LS: +3.8 ± 1.3 mmHg; P < 0.001) intakes. Responses to U-46,619 at each level of salt intake were blocked by >70% by the TxA2/PGH2 receptor antagonist ifetroban. In contrast, enhancement of TGF by peritubular capillary perfusion of arginine vasopressin (AVP; 10-7 M) was similar in high-salt and low-salt rats (HS: +1.5 ± 0.6 vs. LS: +1.6 ± 0.5 mmHg; not significant). We conclude that salt loading increases selectively the abundance of TxA2/PGH2 receptor transcripts in the kidney cortex and glomerulus, relative to the aorta, and enhances selectively TGF responses to TxA2/PGH2 receptor activation but not to AVP.

thromboxane mimetic; thromboxane A2/prostaglandin endoperoxide receptors; arginine vasopressin; glomerulus

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THROMBOXANE A2 (TxA2), prostaglandin endoperoxide (PGH2), and isoprostanes act on the same or similar receptors that have a widespread expression in the kidney (6), vascular smooth muscle cells (5), blood vessels (7), endothelium (20), and platelets (6). Recent studies have reported the cloning of a gene encoding TxA2/PGH2 receptors in the rat (11) and the expression of transcripts for this gene in kidney (1) and vascular endothelium (17). These receptors have been implicated in several models of hypertension, in which they mediate responses to an endothelium-derived vasoconstrictor factor (13) and to vasoconstrictor prostaglandins produced in the kidneys and blood vessels of rats with several forms of hypertension (10, 12, 16, 23, 29, 32).

The tubuloglomerular feedback (TGF) response is a graded vasoconstriction of the afferent arteriole that leads to a reduction in the glomerular capillary pressure (PGC) and single-nephron glomerular filtration rate during NaCl reabsorption at the macula densa segment (3). The mediator of this vasoconstriction is currently unclear, but previous studies have implicated vasoconstrictor prostaglandins. Thus TGF responses are blunted by systemic administration of a TxA2/PGH2 receptor antagonist or a TxA2 synthase inhibitor (26, 27), whereas TGF responses are enhanced during systemic administration or local microperfusion of a TxA2/PGH2 mimetic, U-46,619, into the lumen of the macula densa or the surrounding interstitium (28). However, little is known about the potential functional significance of the effects of TxA2/PGH2 on TGF. We have found that infusion of U-46,619 into conscious rats increases their blood pressure (BP) and that this increase is potentiated by a high-salt intake (25). This suggests that salt loading might enhance TxA2/PGH2 receptor expression or action. The present experiments were designed to test the hypothesis that a high-salt intake enhances the abundance of transcripts for TxA2/PGH2 receptors in the kidney and glomerulus and enhances the action of a TxA2/PGH2 receptor agonist on TGF responses.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Male Sprague-Dawley rats (240-320 g) were maintained on a high-salt (HS; Na content 2.4 g/100 g), a normal salt (NS; Na content 0.3 g/100 g), or a low-salt (LS; Na content 0.03 g/100 g) diet for 8-10 days before testing. The high- and low-salt diets were identical, apart from salt content (Teklad, Madison, WI), but the normal salt diet was regular rat chow (Purina Rat Chow; St. Louis, MO). The low-salt diet was sufficient for normal growth over this time.

Series 1. The aim of these molecular biology studies was to assess the effects of high-salt compared with low-salt intakes on the abundance of transcripts for TxA2/PGH2 receptors in the kidney cortex, glomerulus, and abdominal aorta. For preparation of the kidneys and aortae, groups of rats were accommodated to a high-salt (n = 6) or low-salt (n = 6) intake for 8-10 days. Under thiobarbital anesthesia, the abdomen was opened, and the aorta was cannulated to allow flushing of the kidneys and aorta with ice-cold 0.154 M NaCl. One kidney and a 0.5-cm length of abdominal aorta distal to the renal arteries were removed, cleared of connective tissue, and placed in ice-cold saline solution. The kidney was cut longitudinally and a segment of cortex removed. Total RNA was extracted, using RNA ATAT-60 (Tel-test B, Friendswood, TX). The mRNA was reverse transcribed with oligo(dT)16 as primer and murine leukemia virus reverse transcriptase, using an RNA polymerase chain reaction (PCR) kit (Perkin-Elmer, Branchburg, NJ). The primers used for PCR for the TxA2/PGH2 receptor gene product were selected from the published cDNA sequences of the rat renal TxA2/PGH2 receptor (1). They were nucleotides 5' TGGACTGGCGTGCCACTGAT 3' (sense primer, position bp 275-294) and 5' AGCAAGGGCATCCAACACACCGTG 3' (antisense primer, position bp 753-776). The PCR product had a predicted length of 502 bp. beta -Actin was selected as a "housekeeper gene" for comparison, since beta -actin mRNA abundance in the rat kidney is reported to be independent of salt intake (19). The primers used for beta -actin mRNA were as follows: sense primer 5' GATCAAGATCATTGCTCCTC 3' (position bp 2860-3003 with exon 2867-2990 deleted) and antisense primer 5' TGTACAATCAAAGTCCTCAG 3' (position bp 3390-3407). The PCR product had a predicted length of 426 bp. The amounts of TxA2/PGH2 receptor cDNAs were normalized by the amounts of beta -actin cDNA. The reaction mixture contained 50 pmol of each primer, 1.25 mM deoxynucleotide mixture, 2.5 µl Taq DNA polymerase, 10 mM tris(hydroxymethyl)aminomethane hydrochloride (pH 10), 50 mM KCl, 1.5 mM MgCl2, and 0.001% (wt/vol) gelatine in a final volume of 50 µl. The PCR was carried out by the following protocol: after an initial melting temperature of 94°C for 4 min, there were 30 s of denaturation at 94°C, 45 s of annealing at 60°C, and 45 s of extension at 72°C for repeated cycles of amplification, followed by a final extension at 72°C for 7 min. The PCR product was analyzed on a 1.5% agarose gel stained with ethidium bromide and visualized under ultraviolet light. The size of the products was compared with a rat kidney cDNA probe for TxA2/PGH2 receptors, kindly provided by Dr. Kazu Takeuchi (Tokohu University). To verify the authenticity of the PCR products, the amplified TxA2/PGH2 receptor cDNAs from rat kidney cortex and abdominal aorta were purified with MICROCON (Amicon, Beverly, MA) and sequenced with AmpliTaq cycle sequencing kit (Perkin-Elmer).

The method of Pelayo et al. (15) was used to isolate mRNA from single glomeruli. Groups of high-salt (n = 6) and low-salt (n = 6) rats were prepared as described above. For these studies, mRNA abundance was expressed per single glomerulus. Blue 1- to 5-µm latex microspheres (Polysciences, Warrington, PA) were infused in N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid buffer (pH 7.4) into the left kidney. After perfusion, the kidney was excised, cut into coronal slices, and placed on ice, and a glomerulus from the outer cortex was microdissected under stereomicroscopy. Thereafter, the mRNA was extracted, transcribed, and amplified, as described above.

Care was taken to optimize conditions for the reverse transcription (RT)-PCR. For all products, pilot studies were undertaken with graded amounts of cDNA to ensure that product (as assessed by densitometry) increased log-linearly with cDNA amount in the ranges tested. Negative controls were undertaken by PCR without prior RT and by RT-PCR of the buffer used.

Series 2. The aim of this series of physiological studies was to determine the effects of dietary salt intake on the PGC response to orthograde microperfusion of a TxA2/PGH2 mimetic into the macula densa segment during full activation of TGF. These studies utilized U-46,619, which is a TxA2/PGH2 mimetic that has a similar action on renal hemodynamics as native TxA2 (4). We found previously that orthograde microperfusion of U-46,619 (10-6 M) in artificial tubular fluid (ATF) into the loop of Henle of rats receiving a normal salt intake potentiates TGF consistently by ~5 mmHg; therefore, this concentration was selected for these studies. Nephrons were perfused with ATF + vehicle or ATF + U-46,619 (10-6 M) in random order. In each rat, paired measurements were made of stop flow pressure (PSF) during zero loop perfusion and during perfusion at 40 nl/min. Perfusion of nephrons with ATF at 40 nl/min elicits a maximal reduction in TGF. The maximal TGF response was therefore taken as the difference between PSF at zero loop perfusion and during perfusion at 40 nl/min with ATF + vehicle or ATF + U-46,619. Salt intake did not affect the PSF at zero loop perfusion.

For micropuncture studies, groups of high-salt, normal salt, and low-salt rats were prepared as described previously (28) under thiobarbital anesthesia (Inactin, 100 mg/kg; Research Biochemicals, Natick, MA). A catheter was placed in a jugular vein for fluid infusion and in a femoral artery for recording of mean arterial pressure from the electrically damped output of a pressure transducer (Statham). A tracheotomy tube was inserted, and the animals were allowed to breath spontaneously. The left kidney was exposed by a flank incision, cleaned of connective tissue, and stabilized in a Lucite cup. This kidney was bathed in 0.154 M NaCl maintained at 37°C. After completion of surgery, rats were infused with a solution of 2.5% dextrose, 0.077 M NaCl, and 1% albumin at 1.5 ml/h to maintain a euvolemic state. Micropuncture studies were begun after 60 min for stabilization.

For orthograde microperfusion of the loop of Henle, a micropipette (8 µm OD) containing ATF stained with FD&C dye was inserted into a late proximal tubule (28). Injections of the colored ATF identified the nephron and the direction of flow. An immobile bone wax block was inserted into this micropuncture site via a micropipette (10-15 µm) connected to a hydraulic drive (Trent Wells, La Jolla, CA) to halt tubular fluid flow. A perfusion micropipette (6-8 µm) containing ATF with test compounds or vehicle was inserted into the proximal tubule downstream from the wax block and connected to a nanoliter perfusion pump (WPI, Sarasota, FL). A pressure micropipette (1-2 µm) was inserted into the proximal tubule upstream from the wax block to measure proximal PSF. Changes in PSF are an index of changes in PGC. Measurements of PSF were made in each nephron during zero loop perfusion and during perfusion with ATF at 40 nl/min.

Additional rats were studied to determine the efficacy of the specific TxA2/PGH2 receptor antagonist, ifetroban, in blocking the U-46,619-induced changes in TGF at different levels of salt intake (14). Groups of high-salt (n = 8), normal salt (n = 8), and low-salt (n = 8) rats were infused with ifetroban for 90 min before and throughout the study (10 mg/kg and 10 mg · kg-1 · h-1, respectively). TGF responses were again assessed during loop of Henle perfusion of ATF + vehicle and ATF + U-46,619 (10-6 M).

Series 3. Further studies were undertaken in rats adapted to low-salt, normal salt, or high-salt intakes to test the hypothesis that the effects of salt intake on the response to U-46,619 are specific for this method of enhancing TGF. Arginine vasopressin (AVP) (10-7 M) was added to artificial plasma (AP) (28) and microperfused at 15 nl/min via the peritubular capillaries (PTC) into the interstitium surrounding the test nephron. The TGF response to orthograde luminal perfusion of ATF at zero and 40 nl/min was assessed before and during microperfusion of AVP into the PTC. We have shown previously that microperfusion of AP into the PTC at 20 nl/min does not perturb TGF responses (28).

Statistics. Results are presented as means ± SE. An analysis of variance (ANOVA) was used to assess the effects of interventions and of salt intake. Post hoc testing, when appropriate, was made by Dunnett's test. Statistical significance was considered at P < 0.05.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Series 1. Consistent RT-PCR products corresponding in size to mRNA for TxA2/PGH2 receptor and beta -actin were obtained from kidney cortex and aorta of rats adapted to high-salt and low-salt intakes. Sequencing of one of these products for TxA2/PGH2 receptors showed it to be identical to that reported previously from rat kidney (1). As shown in Fig. 1, strong PCR bands corresponding in size to TxA2/PGH2 receptor cDNA were obtained after RT of rat kidney cortex; the abundance of the RT-PCR product corresponding to TxA2/PGH2 receptor mRNA increased with salt intake, whereas the product corresponding to beta -actin mRNA was unchanged. Because the density of the product from the rats adapted to a normal salt intake appeared intermediate between that from high- and low-salt intakes, further studies were confined to the high-salt and low-salt groups. As shown in Fig. 2, the intensity of staining of PCR products for TxA2/PGH2 receptor mRNA from the renal cortex was greater in rats fed a high-salt than a low-salt diet, but there appeared to be no effects of salt intake on the intensity of beta -actin products. Strong bands corresponding to TxA2/PGH2 receptor mRNA were also obtained after RT of rat abdominal aorta. However, unlike the kidney cortex, the density of the bands from the aorta did not appear to be affected by salt intake (Fig. 3). Densitometric analysis showed no effect of dietary salt intake on beta -actin RT-PCR products from kidney cortex (HS: 0.62 ± 0.05 vs. LS: 0.68 ± 0.04 arbitrary units; not significant) or aorta (HS: 0.77 ± 0.06 vs. LS: 0.81 ± 0.02 arbitrary units; not significant). Likewise, there was no significant effect of dietary salt intake on the RT-PCR products for TxA2/PGH2 receptors from the aorta (HS: 0.69 ± 0.04 vs. LS: 0.68 ± 0.04 arbitrary units; not significant), but there was a consistent increase in the kidney cortex of high-salt compared with low-salt rats (HS: 0.82 ± 0.04 vs. LS: 0.58 ± 0.04 arbitrary units; P < 0.001). The ratio of densitometry for PCR products for TxA2/PGH2 receptors compared with beta -actin is shown in Fig. 4. It is apparent that there is a significant (P < 0.001) increase in this ratio with high-salt (1.34 ± 0.01) compared with low-salt (0.84 ± 0.04) intake in the kidney (Fig. 4A). However, there was no significant effect in the aorta (Fig. 4B; HS: 0.91 ± 0.03 vs. LS: 0.85 ± 0.06; not significant).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   Photograph of an agarose gel stained with ethidium bromide showing a molecular weight (MW) marker, a rat renal thromboxane A2 (TxA2)/prostaglandin endoperoxide (PGH2) receptor cDNA probe (502 bp), and reverse transcription-polymerase chain reaction (RT-PCR) products corresponding to TxA2/PGH2 receptor mRNAs (TxA2-R) and beta -actin from kidney cortex of rats adapted to a high-, normal, or low-salt diet. Negative control is RT-PCR reaction in buffer used. Data shown are either with (+) or without (-) reverse transcription.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2.   Photograph of a gel, similar to Fig. 1, showing individual RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors and beta -actin from kidney cortex of 6 high-salt and 6 low-salt rats. neg, Negative control.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Photograph of a gel, similar to Fig. 1, showing RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors and beta -actin from abdominal aorta of a high-salt and a low-salt rat.


View larger version (15K):
[in this window]
[in a new window]
 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Mean ± SE values for relative (to beta -actin) abundance of mRNA RT-PCR products for TxA2/PGH2 receptor. Data compare rats adapted to a low-salt with those adapted to a high-salt intake. n, Number of rats. A: kidney cortex; B: abdominal aorta. ns, Not significant.

As shown in Fig. 5, clear bands corresponding in size to cDNA for TxA2/PGH2 receptors were obtained after RT-PCR of an individual outer cortical glomerulus dissected from six rats fed a high-salt and six fed a low-salt diet. The intensity of the bands obtained from the glomeruli of rats fed a high-salt diet was consistently greater than that of rats fed a low-salt diet. As shown in Fig. 6, this was confirmed by densitometric analysis (HS: 0.68 ± 0.04 vs. LS: 0.32 ± 0.03 arbitrary units; P < 0.001).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Photograph of a gel, similar to Fig. 1, showing individual RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors. Each lane shows product from a single outer cortical glomerulus microdissected from rats receiving a high-salt (HS; lanes 1-6) or low-salt (LS; lanes 7-12) diet.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Mean ± SE values for relative abundance of mRNA transcripts for TxA2/PGH2 receptors per single glomerulus comparing rats adapted to a high-salt with those adapted to low-salt intake.

Series 2. As shown in Table 1, there were no differences among the groups of rats used for physiological studies, whether maintained on a high-salt, normal salt, or low-salt diet, for body weight, experimental kidney weight, mean arterial pressure, or heart rate. As shown in Tables 1 and 2, there were no significant differences among these groups for values of PSF during zero loop of Henle perfusion. However, the maximal TGF response, as shown from the reduction in PSF during loop perfusion with ATF + vehicle at 40 nl/min, compared with zero perfusion, was significantly blunted in high-salt compared with normal or low-salt rats. Compared with zero loop perfusion, perfusion with ATF + U-46,619 at 40 nl/min decreased PSF to a greater extent than with ATF alone in each group. The U-46,619-induced increase in maximal TGF responses was 5.6 ± 0.7 mmHg in rats on a normal salt intake. This U-46,619-induced change was significantly (P < 0.01) less in low-salt rats (3.8 ± 0.5 mmHg) and significantly (P < 0.01) more in high-salt rats (9.6 ± 0.9 mmHg).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Body weight, kidney weight, MAP, HR, and proximal PSF without loop of Henle perfusion of rats adapted to different salt intakes

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   TGF responses during addition of TxA2/PGH2 mimetic to loop of Henle perfusate or AVP to PTC perfusate: effects of salt intake

The responses to ATF + vehicle and ATF + U-46,619 were reassessed in nephrons of rats infused intravenously with ifetroban. Ifetroban blunted the U-46,619-induced increases in maximal TGF at all levels of salt intake. The increase in TGF response to microperfusion of ATF + U-46,619 compared with ATF + vehicle was reduced in rats infused with ifetroban in high-salt (9.5 ± 0.9 to 2.5 ± 0.4%; P < 0.001), in normal salt (5.6 ± 0.7 to 1.2 ± 0.3%; P < 0.01), and in low-salt groups (3.8 ± 0.5 to 0.6 ± 0.7%; P < 0.01).

Series 3. To test the specificity of the effects of salt on the TGF response to U-46,619, AVP (10-7 M) was infused into the PTC surrounding the test nephrons. As shown in Table 2 (Series 3), before AVP, the maximal TGF responses were greater in nephrons of low-salt and normal salt than high-salt rats. During PTC perfusion of AVP, the TGF responses were increased significantly (P < 0.05) in nephrons of rats, independently of the level of salt intake (LS: +1.8 ± 0.6 vs. NS: +1.5 ± 0.5 vs. HS: +2.2 ± 0.6 mmHg; not significant).

An ANOVA was applied to the maximal TGF response data in Table 2. The results showed that a low-salt intake, U-46,619, and AVP all enhance TGF responses significantly (P < 0.001). However, the effects of U-46,619 and AVP were significantly different (P < 0.01), and there was a significant effect of salt intake on the response to U-46,619 (P < 0.001) but not to AVP.

Because salt intake determined the basal TGF responses, the effects of salt intake on the percent enhancement of maximal TGF responses were compared in Fig. 7 for U-46,619 and AVP. As shown in Fig. 7A, there was a robust effect of salt intake on TGF responses to U-46,619; the percent enhancement was more than threefold greater in high-salt than in normal salt rats, and low-salt rats were slightly but significantly less responsive. In contrast, as shown in Fig. 7B, there were no significant effects of salt intake on the responses to AVP.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   Mean ± SE values for percent enhancement of maximal tubuloglomerular feedback (TGF) responses in rats adapted to low-, normal, or high-salt intakes. Values of maximal TGF are derived from changes in stop flow pressure during perfusion of loop of Henle at 0 and 40 nl/min during enhancement of TGF by addition of U-46,619 to loop perfusate (left) and by addition of arginine vasopressin (AVP, right) to peritubular perfusate. * P < 0.05 and ** P < 0.01 compared with normal salt intake.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The main new finding of this study is that there is a greater expression of the PCR product for the TxA2/PGH2 receptor in the kidney and outer cortical glomeruli from high-salt than from low-salt rats but no effect of salt on the expression of the product from the aorta. Orthograde microperfusion of a TxA2/PGH2 mimetic into the macula densa segment enhances TGF responses to a greater extent in rats adapted to high-salt than normal or low-salt intakes. These effects were blunted >70% by intravenous infusion of a TxA2/PGH2 receptor antagonist. In contrast, interstitial microperfusion of AVP enhances TGF responses independently of salt intake. It is clear that a factor other than the expression and ability of the TxA2/PGH2 receptor to respond is responsible for the blunted TGF response of salt-loaded rats.

Drugs that inhibit TxA2/PGH2 receptors blunt the TGF response by 40-60% when administered systemically before testing (26, 27). These data indicate a quantitatively important role for TxA2 and/or PGH2 or other ligands at this receptor in regulation of TGF and hence nephron hemodynamics. Because we found a similar degree of blunting of TGF after systemic administration of a TxA2 synthase inhibitor and no further effect on TGF of a TxA2/PGH2 receptor antagonist in rats pretreated with a TxA2 synthase inhibitor, we concluded that TxA2 was of particular importance (26). However, Franco et al. (8) found that local perfusion of the loop of Henle with a TxA2/PGH2 receptor antagonist did not alter TGF responses. In their studies, the nephron was blocked at the proximal tubule, and this may have isolated the macula densa cells from the major source of TxA2 and PGH2 production in the glomerulus (22).

The strong potentiation of maximal TGF responses by microperfusion of a thromboxane mimetic into the macula densa segment and blockade by a TxA2/PGH2 receptor antagonist confirm a previous study (28). Because the response to perfusion of U-46,619 (10-6 M) into the loop of Henle was largely prevented by coperfusion with furosemide, which inhibits macula densa reabsorption, and because microperfusion of U-46,619 stimulated net chloride transport from the loop of Henle, we concluded that, at this dose, it was acting predominantly on the macula densa to stimulate NaCl reabsorption, thereby increasing the signal for activation of TGF. However, U-46,619 is lipid soluble and can diffuse out of the tubule lumen (28). Thus it may vasoconstrict the afferent arteriole directly. Indeed, the reduction in PGC produced by microperfusion of higher doses of U-46,619 was not fully prevented by coperfusion with furosemide.

The present study is the first to examine factors that affect the response of TGF to TxA2/PGH2 receptor activation. The absolute enhancement of TGF by addition of the TxA2/PGH2 mimetic to ATF perfusate was more than twice as great in nephrons of rats adapted to high-salt than to normal salt intake. When assessed as percent changes, the effects of salt intake were even greater (Fig. 7). This has some specificity, since the enhancement of TGF by U-46,619 was blunted by ifetroban at each level of salt intake, and there were no such effects of salt intake on the TGF response to AVP microperfused into the interstitium surrounding the test nephron. A previous study showed that intravenous pressor doses of AVP enhance TGF, but during maintenance of renal perfusion pressure, systemic AVP infusion does not significantly alter TGF responsiveness, although sensitivity is enhanced by ~25% (18). AVP was selected for our study because it causes direct vasoconstriction of the afferent arteriole of the rabbit when applied from the interstitial side (24), and its effects on the glomerulus are independent of angiotensin II (9). Therefore, we anticipated that AVP responsiveness should not be greatly changed by salt intake, as indeed was the case.

High-affinity binding sites for TxA2/PGH2 receptor ligands have been identified in the kidney and isolated glomeruli (6). Immunocytochemical studies demonstrate TxA2/PGH2 receptor immunoreactive sites in the afferent arteriole, glomerulus, and tubules, including the luminal aspect of the thick ascending limb (2, 22). In situ hybridization has shown expression of TxA2/PGH2 receptor mRNA in glomeruli, afferent and efferent arterioles, the luminal aspects of the thick ascending limb and macula densa cells, and other tubular sites (22). Expressions of TxA2/PGH2 receptors on the luminal membrane of macula densa cells and the afferent arteriole are the probable sites at which TGF responses are enhanced during luminal perfusion of U-46,619. Our data demonstrate that there is increased TxA2/PGH2 receptor transcript expression within the outer cortical glomeruli and renal cortex during high-salt intake. As in a previous study (19), salt intake had no effects on the abundance of beta -actin mRNA. Of interest was the finding that the abundance of TxA2/PGH2 receptor mRNA was not increased by salt loading in the aorta. The renal circulation is especially sensitive to TxA2/PGH2 receptor stimulation, as shown by a greater increase in renal than femoral vascular resistance with infused U-46,619 (30) and, in dose-response studies, a 10- to 100-fold lower dose of infused U-46,619 required to raise renal vascular resistance compared with femoral vascular resistance or BP and a 100- to 1,000-fold lower dose to increase TGF (28). These data suggest that TxA2/PGH2 receptors in the kidney and juxtaglomerular apparatus could be quite important in regulation of renal hemodynamics in the rat and that this renal circulatory regulation may be dependent on salt intake. The mechanism of induction of TxA2/PGH2 receptor mRNA by salt intake is unknown. The 5' flanking transcriptional regulatory region of the gene contains a putative AP1 binding element, a glucocorticoid responsive element, and a shear stress response element (21), but the relationship of these potential regulatory sites to NaCl-dependent gene expression is currently unknown.

Previously, we found that infusions of U-46,619 caused progressive increases in systolic BP of conscious rats (25). The rise in systolic BP at 8-12 days was greater in rats adapted to a high-salt than to a low-salt intake. This may relate to the present finding of enhanced receptor transcript expression in the kidney and enhanced TGF responsiveness to the mimetic during salt loading. An alteration in kidney function is required for a sustained increase in BP to prevent the pressure natriuresis from reducing the extracellular fluid volume and restoring a normal BP. The TGF response is an integral part of the kidney's adaptation to change in salt intake, and a blunted response during a high-salt intake may be important in contributing to pressure natriuresis and preventing extracellular fluid volume expansion (3). Failure to blunt this response has been shown in a model of salt-dependent hypertension (31).

TxA2/PGH2 receptors mediate renal vasoconstriction, enhanced TGF responses, and NaCl reabsorption in the loop of Henle (26-28). The finding that the expression of these receptors and their responsiveness in the kidney are enhanced by a high-salt diet appears to counter homeostatic requirements. However, it may be that there is normally little TxA2 or PGH2 generated in the kidney during a high-salt intake, since angiotensin II, which is suppressed by salt loading, is a physiological stimulus to their production (12, 32). Indeed, the increased renal and glomerular TxA2/PGH2 receptor mRNA expression during high-salt intake could be a response to reduced TxA2/PGH2 receptor activation. On the other hand, in some models of hypertension, including the Lyon hypertensive (10) and the spontaneously hypertensive rat (16), the two-kidney, one-clip Goldblatt hypertensive rat (29), the angiotensin-infused rat (12), and the Dahl salt-sensitive rat (23), there can be overproduction of vasoconstrictor prostaglandins. In these settings, any enhancement of TxA2/PGH2 receptors during high-salt intakes could contribute to salt-sensitive hypertension.

    ACKNOWLEDGEMENTS

We are grateful to Dr. Juan C. Pelayo for teaching us his technique for microvascular preparation and mRNA analysis in the rat.

    FOOTNOTES

This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-36079 and DK-49870 and funds from the George F. Schreiner Chair of Nephrology.

Address for reprint requests: C. S. Wilcox, Div. of Nephrology and Hypertension, Georgetown Univ. Medical Center, 3800 Reservoir Rd., NW, PHC F6003, Washington, DC 20007.

Received 11 July 1997; accepted in final form 28 August 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Abe, T., K. Takeuchi, N. Takahashi, E. Tsutsumi, Y. Taniyama, and K. Abe. Rat kidney thromboxane receptor: molecular cloning, signal transduction, and intrarenal expression localization. J. Clin. Invest. 96: 657-664, 1995.

2.   Bresnahan, B. A., G. C. Le Breton, and E. A. Lianos. Localization of authentic thromboxane A2/prostaglandin H2 receptor in the rat kidney. Kidney Int. 49: 1207-1213, 1996[Medline].

3.   Briggs, J. P., and J. Schnermann. The tubuloglomerular feedback mechanism. In: Hypertension: Pathophysiology, Diagnosis and Management, edited by J. H. Laragh, and B. M. Brenner. New York: Raven, 1990, p. 1067-1087.

4.   Cirino, M., H. Morton, C. MacDonald, J. Hadden, and A. W. Ford-Hutchinson. Thromboxane A2 and prostaglandin endoperoxide analogue effects on porcine renal blood flow. Am. J. Physiol. 258 (Renal Fluid Electrolyte Physiol. 27): F109-F114, 1990[Abstract/Free Full Text].

5.   Dorn, G. W., and M. W. Becker. Thromboxane A2 stimulated signal transduction in vascular smooth muscle. J. Pharmacol. Exp. Ther. 265: 447-456, 1993[Abstract/Free Full Text].

6.   Folger, W. H., P. V. Halushka, C. S. Wilcox, and N. J. Guzman. Characterization of rat glomerular thromboxane A2 receptors: comparison to rat platelets. Eur. J. Pharmacol. Mol. Pharmacol. Sect. 2: 277-280, 1992.

7.   Folger, W. H., D. Lawson, C. S. Wilcox, and J. L. Mehta. Response of rat thoracic aortic rings to thromboxane mimetic U-46,619: roles of endothelium-derived relaxing factor and thromboxane A2 release. J. Pharmacol. Exp. Ther. 258: 669-675, 1991[Abstract/Free Full Text].

8.   Franco, M., P. D. Bell, and L. G. Navar. Evaluation of prostaglandins as mediators of tubuloglomerular feedback. Am. J. Physiol. 254 (Renal Fluid Electrolyte Physiol. 23): F642-F649, 1988[Abstract/Free Full Text].

9.   Fujisawa, Y., A. Miyatake, Y. Hayashida, Y. Aki, S. Kimura, T. Tamaki, and Y. Abe. Role of vasopressin on cardiovascular changes during hemorrhage in conscious rats. Am. J. Physiol. 267 (Heart Circ. Physiol. 36): H1713-H1718, 1994[Abstract/Free Full Text].

10.   Geoffroy, J., D. Benzoni, M. Vincent, and J. Sassard. Thromboxane A2 and development of genetic hypertension in the Lyon rat strain. Hypertension 16: 665-671, 1990.

11.   Hirata, M., Y. Hayashi, F. Ushikubi, Y. Yokota, R. Kageyama, S. Nakanishi, and S. Narumiya. Cloning and expression of cDNA for a human thromboxane A2 receptor. Nature 349: 617-620, 1991[Medline].

12.   Luft, F. C., C. S. Wilcox, T. Unger, R. Kuhn, G. Demmert, P. Rohmeiss, D. Ganten, and R. B. Sterzel. Angiotensin-induced hypertension in the rat: sympathetic nerve activity and prostaglandins. Hypertension 14: 396-403, 1989[Abstract/Free Full Text].

13.   Lüscher, T. F., C. M. Boulanger, Y. Dohi, and Z. Yang. Endothelium-derived contracting factors. Hypertension 19: 117-130, 1992[Abstract/Free Full Text].

14.   Ogletree, M. L., D. H. Harris, W. A. Schumacher, M. L. Webb, and R. N. Misra. Pharmacological profile of BMS 180,219: a potent, long-acting, orally active thromboxane A2/prostaglandin endoperoxide receptor antagonist. J. Pharmacol. Exp. Ther. 264: 570-578, 1993[Abstract/Free Full Text].

15.   Pelayo, J. C., M. A. Mobilia, S. Tjio, R. Singh, J. M. Nakamoto, and C. Van Dop. A method for isolation of rat renal microvessels and mRNA localization. Am. J. Physiol. 267 (Renal Fluid Electrolyte Physiol. 36): F497-F503, 1994[Abstract/Free Full Text].

16.   Purkerson, M. L., K. J. Martin, J. Yates, J. M. Kissane, and S. Klahr. Thromboxane synthesis and blood pressure in spontaneously hypertensive rats. Hypertension 8: 1113-1120, 1986[Abstract/Free Full Text].

17.   Raychowdhury, M. K., M. Yukawa, L. J. Collins, S. H. McGrail, K. C. Kent, and J. A. Ware. Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor. J. Biol. Chem. 269: 19256-19261, 1994[Abstract/Free Full Text].

18.   Schnermann, J. Vascular tone as a determinant of tubuloglomerular responsiveness. In: The Juxtaglomerular Apparatus, edited by A. E. Persson, and U. Boberg. Amsterdam, The Netherlands: Elsevier Science, 1988, p. 167-176.

19.   Singh, I., M. Grams, W.-H. Wang, T. Yang, P. Killen, A. Smart, J. Schnermann, and J. P. Briggs. Coordinate regulation of renal expression of nitric oxide synthase, renin, and angiotensinogen mRNA by dietary salt. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F1027-F1037, 1996[Abstract/Free Full Text].

20.   Sung, C., A. J. Arleth, and B. A. Berkowitz. Endothelial thromboxane receptors: biochemical characterization and functional implications. Biochem. Biophys. Res. Commun. 158: 326-333, 1989[Medline].

21.   Takahashi, N., K. Takeuchi, T. Abe, A. Sugawara, and K. Abe. Structure and transcriptional function of rat kidney thromboxane receptor gene (Abstract). J. Am. Soc. Nephrol. 7: 1651, 1996.

22.   Takahashi, N., K. Takeuchi, T. Abe, E. Tsutsumi, and K. Abe. Immunohistochemical localization of thromboxane receptor and thromboxane synthase in rat kidney (Abstract). J. Am. Soc. Nephrol. 6: 762, 1995.

23.   Uehara, Y., L. Tobian, J. Iwai, M. Ishii, and T. Sugimoto. Alterations of vascular prostacyclin and thromboxane A2 in Dahl genetical strain susceptible to salt-induced hypertension. Prostaglandins 33: 727-738, 1987[Medline].

24.   Weihprecht, H., J. N. Lorenz, J. P. Briggs, and J. Schnermann. Vasoconstrictor effect of angiotensin and vasopressin in isolated rabbit afferent arterioles. Am. J. Physiol. 261 (Renal Fluid Electrolyte Physiol. 30): F273-F282, 1991[Abstract/Free Full Text].

25.   Welch, W. J., N. G. Ahlstrom, and C. S. Wilcox. Mechanism of hypertension during prolonged infusion of thromboxane mimetic. Eur. J. Int. Med. 2: 277-280, 1992.

26.   Welch, W. J., and C. S. Wilcox. Modulating role for thromboxane in the tubuloglomerular feedback response in the rat. J. Clin. Invest. 81: 1843-1849, 1988.

27.   Welch, W. J., and C. S. Wilcox. Feedback responses during sequential inhibition of angiotensin and thromboxane. Am. J. Physiol. 258 (Renal Fluid Electrolyte Physiol. 27): F457-F466, 1990[Abstract/Free Full Text].

28.   Welch, W. J., and C. S. Wilcox. Potentiation of tubuloglomerular feedback in the rat by thromboxane mimetic. Role of macula densa. J. Clin. Invest. 89: 1857-1865, 1992.

29.   Wilcox, C. S., J. Cardozo, and W. J. Welch. AT1 and TxA2/PGH2 receptors maintain hypertension throughout 2K,1C Goldblatt hypertension in the rat. Am. J. Physiol. 271 (Regulatory Integrative Comp. Physiol. 40): R891-R896, 1996[Abstract/Free Full Text].

30.   Wilcox, C. S., W. H. Folger, and W. J. Welch. Renal vasoconstriction with U-46,619: role of arachidonate metabolites. J. Am. Soc. Nephrol. 5: 1120-1124, 1994[Abstract].

31.  Wilcox, C. S., and W. J. Welch. TGF and nitric oxide: effects of salt intake and salt-sensitive hypertension. Kidney Int. 49, Suppl. 55: S9-S13, 1996.

32.   Wilcox, C. S., W. J. Welch, and H. Snellen. Thromboxane mediates renal hemodynamic response to infused angiotensin II. Kidney Int. 40: 1090-1097, 1991[Medline].


AJP Renal Physiol 273(6):F976-F983
0363-6127/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Araujo and W. J. Welch
Cyclooxygenase 2 inhibition suppresses tubuloglomerular feedback: roles of thromboxane receptors and nitric oxide
Am J Physiol Renal Physiol, April 1, 2009; 296(4): F790 - F794.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Gluais, J. Paysant, C. Badier-Commander, T. Verbeuren, P. M. Vanhoutte, and M. Feletou
In SHR aorta, calcium ionophore A-23187 releases prostacyclin and thromboxane A2 as endothelium-derived contracting factors
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2255 - H2264.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. J. Welch
Effects of isoprostane on tubuloglomerular feedback: roles of TP receptors, NOS, and salt intake
Am J Physiol Renal Physiol, April 1, 2005; 288(4): F757 - F762.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
V. Thongboonkerd, J. B. Klein, W. M. Pierce, A. W. Jevans, and J. M. Arthur
Sodium loading changes urinary protein excretion: a proteomic analysis
Am J Physiol Renal Physiol, June 1, 2003; 284(6): F1155 - F1163.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. S. Wilcox and W. J. Welch
Thromboxane synthase and TP receptor mRNA in rat kidney and brain: effects of salt intake and ANG II
Am J Physiol Renal Physiol, March 1, 2003; 284(3): F525 - F531.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. D. Krier, M. Rodriguez-Porcel, P. J. M. Best, J. C. Romero, A. Lerman, and L. O. Lerman
Vascular responses in vivo to 8-epi PGF2alpha in normal and hypercholesterolemic pigs
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2002; 283(2): R303 - R308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welch, W. J.
Right arrow Articles by Wilcox, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welch, W. J.
Right arrow Articles by Wilcox, C. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online