Vol. 273, Issue 6, F976-F983, December 1997
Salt loading enhances rat renal
TxA2/PGH2
receptor expression and TGF response to U-46,619
William J.
Welch,
Bo
Peng,
Kazuhisa
Takeuchi,
Keishi
Abe, and
Christopher S.
Wilcox
Division of Nephrology and Hypertension, Georgetown University
Medical Center, Washington, District of Columbia 20007; and Second
Department of Internal Medicine,Tohoku University School of
Medicine, Sendai 980, Japan
 |
ABSTRACT |
The
tubuloglomerular feedback (TGF) response is potentiated by thromboxane
A2
(TxA2) and/or
prostaglandin endoperoxide
(PGH2) acting on specific
receptors. Infusion of the
TxA2/PGH2
mimetic, U-46,619, into conscious rats leads to hypertension that is
potentiated by a high-salt intake. Therefore, we tested the hypothesis
that a high-salt intake enhances the expression of transcripts for TxA2/PGH2
receptors in the kidney and glomeruli and enhances the response of TGF
to
TxA2/PGH2
receptor stimulation. Groups of rats were accommodated to a low-salt
(LS), normal salt (NS), or high-salt (HS) diet for 8-10 days.
TxA2/PGH2
receptor mRNA was detected by reverse transcription-polymerase chain
reaction in kidney cortex, isolated glomeruli, and abdominal aorta.
TxA2/PGH2
mRNA abundance was significantly (P < 0.001) increased during intake of high-salt compared with low-salt
diets in the kidney cortex (1.34 ± 0.10 vs. 0.84 ± 0.04 arbitrary units) and isolated outer cortical glomeruli (0.68 ± 0.04 vs. 0.32 ± 0.03 arbitrary units), but there was no effect of salt
on
TxA2/PGH2
receptor mRNA expression in the aorta. Maximal TGF responses were
assessed from the increase in proximal stop flow pressure (an index of
glomerular capillary pressure) during increases in loop of Henle
perfusion with artificial tubular fluid from 0 to 40 nl/min. Compared
with vehicle, the enhancement of maximal TGF with U-46,619
(10
6 M) added to the
perfusate was greater in rats adapted to high-salt than normal salt
(HS: +9.6 ± 1.1 vs. NS: +5.1 ± 0.4 mmHg;
P < 0.001) or low-salt (LS: +3.8 ± 1.3 mmHg; P < 0.001) intakes.
Responses to U-46,619 at each level of salt intake were blocked by
>70% by the
TxA2/PGH2
receptor antagonist ifetroban. In contrast, enhancement of TGF by
peritubular capillary perfusion of arginine vasopressin (AVP;
10
7 M) was similar in
high-salt and low-salt rats (HS: +1.5 ± 0.6 vs. LS: +1.6 ± 0.5 mmHg; not significant). We conclude that salt loading increases
selectively the abundance of
TxA2/PGH2
receptor transcripts in the kidney cortex and glomerulus, relative to
the aorta, and enhances selectively TGF responses to
TxA2/PGH2
receptor activation but not to AVP.
thromboxane mimetic; thromboxane
A2/prostaglandin endoperoxide
receptors; arginine vasopressin; glomerulus
 |
INTRODUCTION |
THROMBOXANE A2
(TxA2), prostaglandin
endoperoxide (PGH2), and
isoprostanes act on the same or similar receptors that have a
widespread expression in the kidney (6), vascular smooth muscle cells
(5), blood vessels (7), endothelium (20), and platelets (6). Recent
studies have reported the cloning of a gene encoding
TxA2/PGH2
receptors in the rat (11) and the expression of transcripts for this
gene in kidney (1) and vascular endothelium (17). These receptors have
been implicated in several models of hypertension, in which they
mediate responses to an endothelium-derived vasoconstrictor factor (13)
and to vasoconstrictor prostaglandins produced in the kidneys and blood
vessels of rats with several forms of hypertension (10, 12, 16, 23, 29, 32).
The tubuloglomerular feedback (TGF) response is a graded
vasoconstriction of the afferent arteriole that leads to a reduction in
the glomerular capillary pressure
(PGC) and single-nephron glomerular filtration rate during NaCl reabsorption at the macula densa
segment (3). The mediator of this vasoconstriction is currently
unclear, but previous studies have implicated vasoconstrictor prostaglandins. Thus TGF responses are blunted by systemic
administration of a
TxA2/PGH2
receptor antagonist or a TxA2
synthase inhibitor (26, 27), whereas TGF responses are enhanced during
systemic administration or local microperfusion of a
TxA2/PGH2
mimetic, U-46,619, into the lumen of the macula densa or the
surrounding interstitium (28). However, little is known about the
potential functional significance of the effects of
TxA2/PGH2
on TGF. We have found that infusion of U-46,619 into conscious rats
increases their blood pressure (BP) and that this increase is
potentiated by a high-salt intake (25). This suggests that salt loading might enhance
TxA2/PGH2
receptor expression or action. The present experiments were designed to
test the hypothesis that a high-salt intake enhances the abundance of
transcripts for
TxA2/PGH2
receptors in the kidney and glomerulus and enhances the action of a
TxA2/PGH2 receptor agonist on TGF responses.
 |
METHODS |
Male Sprague-Dawley rats (240-320 g) were maintained on a
high-salt (HS; Na content 2.4 g/100 g), a normal salt (NS; Na content 0.3 g/100 g), or a low-salt (LS; Na content 0.03 g/100 g) diet for
8-10 days before testing. The high- and low-salt diets were identical, apart from salt content (Teklad, Madison, WI), but the
normal salt diet was regular rat chow (Purina Rat Chow; St. Louis, MO).
The low-salt diet was sufficient for normal growth over this time.
Series 1.
The aim of these molecular biology studies was to assess the effects of
high-salt compared with low-salt intakes on the abundance of
transcripts for
TxA2/PGH2
receptors in the kidney cortex, glomerulus, and abdominal aorta. For
preparation of the kidneys and aortae, groups of rats were accommodated
to a high-salt (n = 6) or
low-salt (n = 6) intake for 8-10
days. Under thiobarbital anesthesia, the abdomen was opened, and the
aorta was cannulated to allow flushing of the kidneys and aorta with
ice-cold 0.154 M NaCl. One kidney and a 0.5-cm length of abdominal
aorta distal to the renal arteries were removed, cleared of connective
tissue, and placed in ice-cold saline solution. The kidney was cut
longitudinally and a segment of cortex removed. Total RNA was
extracted, using RNA ATAT-60 (Tel-test B, Friendswood, TX). The mRNA
was reverse transcribed with
oligo(dT)16 as primer and murine
leukemia virus reverse transcriptase, using an RNA polymerase chain
reaction (PCR) kit (Perkin-Elmer, Branchburg, NJ). The primers used for
PCR for the
TxA2/PGH2
receptor gene product were selected from the published cDNA sequences
of the rat renal
TxA2/PGH2
receptor (1). They were nucleotides 5' TGGACTGGCGTGCCACTGAT
3' (sense primer, position bp 275-294) and 5'
AGCAAGGGCATCCAACACACCGTG 3' (antisense primer, position bp
753-776). The PCR product had a predicted length of 502 bp.
-Actin was selected as a "housekeeper gene" for comparison,
since
-actin mRNA abundance in the rat kidney is reported to be
independent of salt intake (19). The primers used for
-actin mRNA
were as follows: sense primer 5' GATCAAGATCATTGCTCCTC 3'
(position bp 2860-3003 with exon 2867-2990 deleted) and
antisense primer 5' TGTACAATCAAAGTCCTCAG 3' (position bp
3390-3407). The PCR product had a predicted length of 426 bp. The
amounts of
TxA2/PGH2
receptor cDNAs were normalized by the amounts of
-actin cDNA. The
reaction mixture contained 50 pmol of each primer, 1.25 mM
deoxynucleotide mixture, 2.5 µl Taq
DNA polymerase, 10 mM tris(hydroxymethyl)aminomethane hydrochloride (pH
10), 50 mM KCl, 1.5 mM MgCl2, and
0.001% (wt/vol) gelatine in a final volume of 50 µl.
The PCR was carried out by the following protocol: after an initial
melting temperature of 94°C for 4 min, there were 30 s of
denaturation at 94°C, 45 s of annealing at 60°C, and 45 s of
extension at 72°C for repeated cycles of amplification, followed by
a final extension at 72°C for 7 min. The PCR product was analyzed
on a 1.5% agarose gel stained with ethidium bromide and visualized
under ultraviolet light. The size of the products was compared with a
rat kidney cDNA probe for
TxA2/PGH2
receptors, kindly provided by Dr. Kazu Takeuchi (Tokohu University). To
verify the authenticity of the PCR products, the amplified
TxA2/PGH2
receptor cDNAs from rat kidney cortex and abdominal aorta were purified
with MICROCON (Amicon, Beverly, MA) and sequenced with
AmpliTaq cycle sequencing kit
(Perkin-Elmer).
The method of Pelayo et al. (15) was used to isolate mRNA from single
glomeruli. Groups of high-salt (n = 6)
and low-salt (n = 6) rats were
prepared as described above. For these studies, mRNA abundance was
expressed per single glomerulus. Blue 1- to 5-µm latex microspheres
(Polysciences, Warrington, PA) were infused in
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid buffer (pH 7.4) into the left kidney. After perfusion, the kidney
was excised, cut into coronal slices, and placed on ice, and a
glomerulus from the outer cortex was microdissected under
stereomicroscopy. Thereafter, the mRNA was extracted, transcribed, and
amplified, as described above.
Care was taken to optimize conditions for the reverse transcription
(RT)-PCR. For all products, pilot studies were undertaken with graded
amounts of cDNA to ensure that product (as assessed by densitometry)
increased log-linearly with cDNA amount in the ranges tested. Negative
controls were undertaken by PCR without prior RT and by RT-PCR of the
buffer used.
Series 2.
The aim of this series of physiological studies was to determine the
effects of dietary salt intake on the
PGC response to orthograde
microperfusion of a
TxA2/PGH2
mimetic into the macula densa segment during full activation of TGF.
These studies utilized U-46,619, which is a
TxA2/PGH2
mimetic that has a similar action on renal hemodynamics as native
TxA2 (4). We found previously that
orthograde microperfusion of U-46,619
(10
6 M) in artificial
tubular fluid (ATF) into the loop of Henle of rats receiving a normal
salt intake potentiates TGF consistently by ~5 mmHg; therefore, this
concentration was selected for these studies. Nephrons were perfused
with ATF + vehicle or ATF + U-46,619 (10
6 M) in random order. In
each rat, paired measurements were made of stop flow pressure
(PSF) during zero loop perfusion
and during perfusion at 40 nl/min. Perfusion of nephrons with ATF at 40 nl/min elicits a maximal reduction in TGF. The maximal TGF response was therefore taken as the difference between
PSF at zero loop perfusion and
during perfusion at 40 nl/min with ATF + vehicle or ATF + U-46,619.
Salt intake did not affect the PSF
at zero loop perfusion.
For micropuncture studies, groups of high-salt, normal salt, and
low-salt rats were prepared as described previously (28) under
thiobarbital anesthesia (Inactin, 100 mg/kg; Research Biochemicals, Natick, MA). A catheter was placed in a jugular vein for fluid infusion
and in a femoral artery for recording of mean arterial pressure from
the electrically damped output of a pressure transducer (Statham). A tracheotomy tube was inserted, and the animals were allowed to breath spontaneously. The left kidney was exposed by a flank
incision, cleaned of connective tissue, and stabilized in a Lucite cup.
This kidney was bathed in 0.154 M NaCl maintained at 37°C. After
completion of surgery, rats were infused with a solution of 2.5%
dextrose, 0.077 M NaCl, and 1% albumin at 1.5 ml/h to maintain a
euvolemic state. Micropuncture studies were begun after 60 min for
stabilization.
For orthograde microperfusion of the loop of Henle, a micropipette (8 µm OD) containing ATF stained with FD&C dye was inserted into a late
proximal tubule (28). Injections of the colored ATF identified the
nephron and the direction of flow. An immobile bone wax block was
inserted into this micropuncture site via a micropipette (10-15
µm) connected to a hydraulic drive (Trent Wells, La Jolla, CA) to
halt tubular fluid flow. A perfusion micropipette (6-8 µm)
containing ATF with test compounds or vehicle was inserted into the
proximal tubule downstream from the wax block and connected to a
nanoliter perfusion pump (WPI, Sarasota, FL). A pressure micropipette
(1-2 µm) was inserted into the proximal tubule upstream from the
wax block to measure proximal PSF.
Changes in PSF are an index of
changes in PGC. Measurements of
PSF were made in each nephron
during zero loop perfusion and during perfusion with ATF at 40 nl/min.
Additional rats were studied to determine the efficacy of the specific
TxA2/PGH2
receptor antagonist, ifetroban, in blocking the U-46,619-induced
changes in TGF at different levels of salt intake (14). Groups of
high-salt (n = 8), normal salt
(n = 8), and low-salt
(n = 8) rats were infused with
ifetroban for 90 min before and throughout the study (10 mg/kg and 10 mg · kg
1 · h
1,
respectively). TGF responses were again assessed during loop of Henle
perfusion of ATF + vehicle and ATF + U-46,619
(10
6 M).
Series 3.
Further studies were undertaken in rats adapted to low-salt, normal
salt, or high-salt intakes to test the hypothesis that the effects of
salt intake on the response to U-46,619 are specific for this method of
enhancing TGF. Arginine vasopressin (AVP)
(10
7 M) was added to
artificial plasma (AP) (28) and microperfused at 15 nl/min via the
peritubular capillaries (PTC) into the interstitium surrounding the
test nephron. The TGF response to orthograde luminal perfusion of ATF
at zero and 40 nl/min was assessed before and during microperfusion of
AVP into the PTC. We have shown previously that microperfusion of AP
into the PTC at 20 nl/min does not perturb TGF responses (28).
Statistics.
Results are presented as means ± SE. An analysis of variance
(ANOVA) was used to assess the effects of interventions and of salt
intake. Post hoc testing, when appropriate, was made by Dunnett's test. Statistical significance was considered at
P < 0.05.
 |
RESULTS |
Series 1.
Consistent RT-PCR products corresponding in size to mRNA for
TxA2/PGH2
receptor and
-actin were obtained from kidney cortex and aorta of
rats adapted to high-salt and low-salt intakes. Sequencing of one of
these products for
TxA2/PGH2
receptors showed it to be identical to that reported previously from
rat kidney (1). As shown in Fig.
1, strong PCR bands
corresponding in size to TxA2/PGH2
receptor cDNA were obtained after RT of rat kidney cortex; the
abundance of the RT-PCR product corresponding to
TxA2/PGH2 receptor mRNA increased with salt intake, whereas the product corresponding to
-actin mRNA was unchanged. Because the density of
the product from the rats adapted to a normal salt intake appeared intermediate between that from high- and low-salt intakes, further studies were confined to the high-salt and low-salt groups. As shown in
Fig. 2, the intensity of staining of PCR
products for TxA2/PGH2
receptor mRNA from the renal cortex was greater in rats fed a high-salt
than a low-salt diet, but there appeared to be no effects of salt
intake on the intensity of
-actin products. Strong bands
corresponding to
TxA2/PGH2
receptor mRNA were also obtained after RT of rat abdominal aorta.
However, unlike the kidney cortex, the density of the bands from the
aorta did not appear to be affected by salt intake (Fig.
3). Densitometric analysis showed no effect
of dietary salt intake on
-actin RT-PCR products from kidney cortex
(HS: 0.62 ± 0.05 vs. LS: 0.68 ± 0.04 arbitrary units; not
significant) or aorta (HS: 0.77 ± 0.06 vs. LS: 0.81 ± 0.02 arbitrary units; not significant). Likewise, there was no significant
effect of dietary salt intake on the RT-PCR products for
TxA2/PGH2
receptors from the aorta (HS: 0.69 ± 0.04 vs. LS: 0.68 ± 0.04 arbitrary units; not significant), but there was a consistent increase
in the kidney cortex of high-salt compared with low-salt rats (HS: 0.82 ± 0.04 vs. LS: 0.58 ± 0.04 arbitrary units;
P < 0.001). The ratio of
densitometry for PCR products for
TxA2/PGH2
receptors compared with
-actin is shown in Fig. 4. It is apparent that there is a
significant (P < 0.001) increase in
this ratio with high-salt (1.34 ± 0.01) compared with low-salt (0.84 ± 0.04) intake in the kidney (Fig.
4A). However, there was no
significant effect in the aorta (Fig.
4B; HS: 0.91 ± 0.03 vs. LS: 0.85 ± 0.06; not significant).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
Photograph of an agarose gel stained with ethidium bromide showing a
molecular weight (MW) marker, a rat renal thromboxane
A2
(TxA2)/prostaglandin
endoperoxide (PGH2) receptor
cDNA probe (502 bp), and reverse transcription-polymerase chain
reaction (RT-PCR) products corresponding to
TxA2/PGH2
receptor mRNAs (TxA2-R) and
-actin from kidney cortex of rats adapted to a high-, normal, or
low-salt diet. Negative control is RT-PCR reaction in buffer used. Data
shown are either with (+) or without ( ) reverse transcription.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Photograph of a gel, similar to Fig. 1, showing individual RT-PCR
products corresponding to mRNA for
TxA2/PGH2
receptors and -actin from kidney cortex of 6 high-salt and 6 low-salt rats. neg, Negative control.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 3.
Photograph of a gel, similar to Fig. 1, showing RT-PCR products
corresponding to mRNA for
TxA2/PGH2
receptors and -actin from abdominal aorta of a high-salt and a
low-salt rat.
|
|

View larger version (15K):
[in this window]
[in a new window]

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Mean ± SE values for relative (to -actin) abundance of mRNA
RT-PCR products for
TxA2/PGH2
receptor. Data compare rats adapted to a low-salt with those adapted to
a high-salt intake. n, Number of rats.
A: kidney cortex;
B: abdominal aorta. ns, Not
significant.
|
|
As shown in Fig. 5, clear bands
corresponding in size to cDNA for
TxA2/PGH2
receptors were obtained after RT-PCR of an individual outer cortical
glomerulus dissected from six rats fed a high-salt and six fed a
low-salt diet. The intensity of the bands obtained from the glomeruli
of rats fed a high-salt diet was consistently greater than that of rats
fed a low-salt diet. As shown in Fig. 6,
this was confirmed by densitometric analysis (HS: 0.68 ± 0.04 vs.
LS: 0.32 ± 0.03 arbitrary units; P < 0.001).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Photograph of a gel, similar to Fig. 1, showing individual RT-PCR
products corresponding to mRNA for
TxA2/PGH2
receptors. Each lane shows product from a single outer cortical
glomerulus microdissected from rats receiving a high-salt (HS;
lanes 1-6)
or low-salt (LS; lanes 7-12)
diet.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6.
Mean ± SE values for relative abundance of mRNA transcripts for
TxA2/PGH2
receptors per single glomerulus comparing rats adapted to a high-salt
with those adapted to low-salt intake.
|
|
Series 2.
As shown in Table 1, there were no
differences among the groups of rats used for physiological studies,
whether maintained on a high-salt, normal salt, or low-salt diet, for
body weight, experimental kidney weight, mean arterial pressure, or
heart rate. As shown in Tables 1 and 2,
there were no significant differences among these groups for values of
PSF during zero loop of Henle perfusion. However, the maximal TGF response, as shown from the reduction in PSF during loop
perfusion with ATF + vehicle at 40 nl/min, compared with zero
perfusion, was significantly blunted in high-salt compared with normal
or low-salt rats. Compared with zero loop perfusion, perfusion with
ATF + U-46,619 at 40 nl/min decreased
PSF to a greater extent than with
ATF alone in each group. The U-46,619-induced increase in maximal TGF
responses was 5.6 ± 0.7 mmHg in rats on a normal salt intake. This
U-46,619-induced change was significantly
(P < 0.01) less in low-salt rats
(3.8 ± 0.5 mmHg) and significantly
(P < 0.01) more in high-salt rats (9.6 ± 0.9 mmHg).
View this table:
[in this window]
[in a new window]
|
Table 1.
Body weight, kidney weight, MAP, HR, and proximal PSF
without loop of Henle perfusion of rats adapted to different salt
intakes
|
|
View this table:
[in this window]
[in a new window]
|
Table 2.
TGF responses during addition of TxA2/PGH2
mimetic to loop of Henle perfusate or AVP to PTC perfusate: effects of
salt intake
|
|
The responses to ATF + vehicle and ATF + U-46,619 were reassessed in
nephrons of rats infused intravenously with ifetroban. Ifetroban
blunted the U-46,619-induced increases in maximal TGF at all levels of
salt intake. The increase in TGF response to microperfusion of ATF + U-46,619 compared with ATF + vehicle was reduced in rats infused with
ifetroban in high-salt (9.5 ± 0.9 to 2.5 ± 0.4%;
P < 0.001), in normal salt
(5.6 ± 0.7 to 1.2 ± 0.3%;
P < 0.01), and in low-salt groups
(3.8 ± 0.5 to 0.6 ± 0.7%; P < 0.01).
Series 3.
To test the specificity of the effects of salt on the TGF response to
U-46,619, AVP (10
7 M) was
infused into the PTC surrounding the test nephrons. As shown in Table 2
(Series
3), before AVP, the maximal TGF
responses were greater in nephrons of low-salt and normal salt than
high-salt rats. During PTC perfusion of AVP, the TGF responses were
increased significantly (P < 0.05)
in nephrons of rats, independently of the level of salt intake (LS:
+1.8 ± 0.6 vs. NS: +1.5 ± 0.5 vs. HS: +2.2 ± 0.6 mmHg; not
significant).
An ANOVA was applied to the maximal TGF response data in Table 2. The
results showed that a low-salt intake, U-46,619, and AVP all enhance
TGF responses significantly (P < 0.001). However, the effects of U-46,619 and AVP were significantly
different (P < 0.01), and there was
a significant effect of salt intake on the response to U-46,619
(P < 0.001) but not to AVP.
Because salt intake determined the basal TGF responses, the effects of
salt intake on the percent enhancement of maximal TGF responses were
compared in Fig. 7 for U-46,619 and AVP. As
shown in Fig. 7A, there was a robust
effect of salt intake on TGF responses to U-46,619; the percent
enhancement was more than threefold greater in high-salt than in normal
salt rats, and low-salt rats were slightly but significantly less
responsive. In contrast, as shown in Fig.
7B, there were no significant effects
of salt intake on the responses to AVP.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 7.
Mean ± SE values for percent enhancement of maximal
tubuloglomerular feedback (TGF) responses in rats adapted to low-,
normal, or high-salt intakes. Values of maximal TGF are derived from
changes in stop flow pressure during perfusion of loop of Henle at 0 and 40 nl/min during enhancement of TGF by addition of U-46,619 to loop
perfusate (left) and by addition of
arginine vasopressin (AVP, right) to peritubular
perfusate. * P < 0.05 and
** P < 0.01 compared with
normal salt intake.
|
|
 |
DISCUSSION |
The main new finding of this study is that there is a greater
expression of the PCR product for the
TxA2/PGH2
receptor in the kidney and outer cortical glomeruli from high-salt than
from low-salt rats but no effect of salt on the expression of the
product from the aorta. Orthograde microperfusion of a
TxA2/PGH2
mimetic into the macula densa segment enhances TGF responses to a
greater extent in rats adapted to high-salt than normal or low-salt
intakes. These effects were blunted >70% by intravenous infusion of
a
TxA2/PGH2 receptor antagonist. In contrast, interstitial microperfusion of AVP
enhances TGF responses independently of salt intake. It is clear that a
factor other than the expression and ability of the
TxA2/PGH2
receptor to respond is responsible for the blunted TGF response of
salt-loaded rats.
Drugs that inhibit
TxA2/PGH2
receptors blunt the TGF response by 40-60% when administered
systemically before testing (26, 27). These data indicate a
quantitatively important role for TxA2 and/or
PGH2 or other ligands at this
receptor in regulation of TGF and hence nephron hemodynamics. Because
we found a similar degree of blunting of TGF after systemic
administration of a TxA2 synthase
inhibitor and no further effect on TGF of a
TxA2/PGH2 receptor antagonist in rats pretreated with a
TxA2 synthase inhibitor, we
concluded that TxA2 was of
particular importance (26). However, Franco et al. (8) found that local
perfusion of the loop of Henle with a
TxA2/PGH2
receptor antagonist did not alter TGF responses. In their studies, the
nephron was blocked at the proximal tubule, and this may have isolated
the macula densa cells from the major source of
TxA2 and
PGH2 production in the glomerulus
(22).
The strong potentiation of maximal TGF responses by microperfusion of a
thromboxane mimetic into the macula densa segment and blockade by a
TxA2/PGH2
receptor antagonist confirm a previous study (28). Because the response
to perfusion of U-46,619
(10
6 M) into the loop of
Henle was largely prevented by coperfusion with furosemide, which
inhibits macula densa reabsorption, and because microperfusion of
U-46,619 stimulated net chloride transport from the loop of Henle, we
concluded that, at this dose, it was acting predominantly on the macula
densa to stimulate NaCl reabsorption, thereby increasing the signal for
activation of TGF. However, U-46,619 is lipid soluble and
can diffuse out of the tubule lumen (28). Thus it may vasoconstrict the
afferent arteriole directly. Indeed, the reduction in
PGC produced by microperfusion of
higher doses of U-46,619 was not fully prevented by coperfusion with furosemide.
The present study is the first to examine factors that affect the
response of TGF to
TxA2/PGH2
receptor activation. The absolute enhancement of TGF by addition of the
TxA2/PGH2
mimetic to ATF perfusate was more than twice as great in nephrons of
rats adapted to high-salt than to normal salt intake. When assessed as
percent changes, the effects of salt intake were even greater (Fig. 7). This has some specificity, since the enhancement of TGF by U-46,619 was
blunted by ifetroban at each level of salt intake, and there were no
such effects of salt intake on the TGF response to AVP microperfused
into the interstitium surrounding the test nephron. A previous study
showed that intravenous pressor doses of AVP enhance TGF, but during
maintenance of renal perfusion pressure, systemic AVP infusion does not
significantly alter TGF responsiveness, although sensitivity is
enhanced by ~25% (18). AVP was selected for our study because it
causes direct vasoconstriction of the afferent arteriole of the rabbit
when applied from the interstitial side (24), and its effects on the
glomerulus are independent of angiotensin II (9). Therefore, we
anticipated that AVP responsiveness should not be greatly changed by
salt intake, as indeed was the case.
High-affinity binding sites for
TxA2/PGH2
receptor ligands have been identified in the kidney and isolated
glomeruli (6). Immunocytochemical studies demonstrate
TxA2/PGH2
receptor immunoreactive sites in the afferent arteriole, glomerulus,
and tubules, including the luminal aspect of the thick ascending limb
(2, 22). In situ hybridization has shown expression of
TxA2/PGH2
receptor mRNA in glomeruli, afferent and efferent arterioles, the
luminal aspects of the thick ascending limb and macula densa cells, and other tubular sites (22). Expressions of
TxA2/PGH2
receptors on the luminal membrane of macula densa cells and the
afferent arteriole are the probable sites at which TGF responses are
enhanced during luminal perfusion of U-46,619. Our data demonstrate
that there is increased
TxA2/PGH2
receptor transcript expression within the outer cortical glomeruli and
renal cortex during high-salt intake. As in a previous study (19), salt
intake had no effects on the abundance of
-actin mRNA. Of interest
was the finding that the abundance of
TxA2/PGH2
receptor mRNA was not increased by salt loading in the aorta. The renal
circulation is especially sensitive to
TxA2/PGH2
receptor stimulation, as shown by a greater increase in renal than
femoral vascular resistance with infused U-46,619 (30) and, in
dose-response studies, a 10- to 100-fold lower dose of infused U-46,619
required to raise renal vascular resistance compared with femoral
vascular resistance or BP and a 100- to 1,000-fold lower dose to
increase TGF (28). These data suggest that
TxA2/PGH2
receptors in the kidney and juxtaglomerular apparatus could be quite
important in regulation of renal hemodynamics in the rat and that this
renal circulatory regulation may be dependent on salt intake. The
mechanism of induction of
TxA2/PGH2
receptor mRNA by salt intake is unknown. The 5' flanking
transcriptional regulatory region of the gene contains a putative AP1
binding element, a glucocorticoid responsive element, and a shear
stress response element (21), but the relationship of these potential regulatory sites to NaCl-dependent gene expression is currently unknown.
Previously, we found that infusions of U-46,619 caused progressive
increases in systolic BP of conscious rats (25). The rise in systolic
BP at 8-12 days was greater in rats adapted to a high-salt than to
a low-salt intake. This may relate to the present finding of enhanced
receptor transcript expression in the kidney and enhanced TGF
responsiveness to the mimetic during salt loading. An alteration in
kidney function is required for a sustained increase in BP to prevent
the pressure natriuresis from reducing the extracellular fluid volume
and restoring a normal BP. The TGF response is an integral part of the
kidney's adaptation to change in salt intake, and a blunted response
during a high-salt intake may be important in contributing to pressure
natriuresis and preventing extracellular fluid volume expansion (3).
Failure to blunt this response has been shown in a model of
salt-dependent hypertension (31).
TxA2/PGH2
receptors mediate renal vasoconstriction, enhanced TGF responses, and
NaCl reabsorption in the loop of Henle (26-28). The finding that
the expression of these receptors and their responsiveness in the
kidney are enhanced by a high-salt diet appears to counter homeostatic
requirements. However, it may be that there is normally little
TxA2 or
PGH2 generated in the kidney
during a high-salt intake, since angiotensin II, which is suppressed by
salt loading, is a physiological stimulus to their production (12, 32). Indeed, the increased renal and glomerular
TxA2/PGH2
receptor mRNA expression during high-salt intake could be a response to reduced
TxA2/PGH2
receptor activation. On the other hand, in some models of hypertension,
including the Lyon hypertensive (10) and the spontaneously hypertensive
rat (16), the two-kidney, one-clip Goldblatt hypertensive rat (29),
the angiotensin-infused rat (12), and the Dahl salt-sensitive rat (23),
there can be overproduction of vasoconstrictor prostaglandins. In these settings, any enhancement of
TxA2/PGH2
receptors during high-salt intakes could contribute to salt-sensitive
hypertension.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Juan C. Pelayo for teaching us his technique
for microvascular preparation and mRNA analysis in the rat.
 |
FOOTNOTES |
This study was supported by National Institute of Diabetes and
Digestive and Kidney Diseases Grants DK-36079 and DK-49870 and funds
from the George F. Schreiner Chair of Nephrology.
Address for reprint requests: C. S. Wilcox, Div. of Nephrology and
Hypertension, Georgetown Univ. Medical Center, 3800 Reservoir Rd., NW,
PHC F6003, Washington, DC 20007.
Received 11 July 1997; accepted in final form 28 August 1997.
 |
REFERENCES |
1.
Abe, T.,
K. Takeuchi,
N. Takahashi,
E. Tsutsumi,
Y. Taniyama,
and
K. Abe.
Rat kidney thromboxane receptor: molecular cloning, signal transduction, and intrarenal expression localization.
J. Clin. Invest.
96:
657-664,
1995.
2.
Bresnahan, B. A.,
G. C. Le Breton,
and
E. A. Lianos.
Localization of authentic thromboxane A2/prostaglandin H2 receptor in the rat kidney.
Kidney Int.
49:
1207-1213,
1996[Medline].
3.
Briggs, J. P.,
and
J. Schnermann.
The tubuloglomerular feedback mechanism.
In: Hypertension: Pathophysiology, Diagnosis and Management, edited by J. H. Laragh,
and B. M. Brenner. New York: Raven, 1990, p. 1067-1087.
4.
Cirino, M.,
H. Morton,
C. MacDonald,
J. Hadden,
and
A. W. Ford-Hutchinson.
Thromboxane A2 and prostaglandin endoperoxide analogue effects on porcine renal blood flow.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F109-F114,
1990[Abstract/Free Full Text].
5.
Dorn, G. W.,
and
M. W. Becker.
Thromboxane A2 stimulated signal transduction in vascular smooth muscle.
J. Pharmacol. Exp. Ther.
265:
447-456,
1993[Abstract/Free Full Text].
6.
Folger, W. H.,
P. V. Halushka,
C. S. Wilcox,
and
N. J. Guzman.
Characterization of rat glomerular thromboxane A2 receptors: comparison to rat platelets.
Eur. J. Pharmacol. Mol. Pharmacol. Sect.
2:
277-280,
1992.
7.
Folger, W. H.,
D. Lawson,
C. S. Wilcox,
and
J. L. Mehta.
Response of rat thoracic aortic rings to thromboxane mimetic U-46,619: roles of endothelium-derived relaxing factor and thromboxane A2 release.
J. Pharmacol. Exp. Ther.
258:
669-675,
1991[Abstract/Free Full Text].
8.
Franco, M.,
P. D. Bell,
and
L. G. Navar.
Evaluation of prostaglandins as mediators of tubuloglomerular feedback.
Am. J. Physiol.
254 (Renal Fluid Electrolyte Physiol. 23):
F642-F649,
1988[Abstract/Free Full Text].
9.
Fujisawa, Y.,
A. Miyatake,
Y. Hayashida,
Y. Aki,
S. Kimura,
T. Tamaki,
and
Y. Abe.
Role of vasopressin on cardiovascular changes during hemorrhage in conscious rats.
Am. J. Physiol.
267 (Heart Circ. Physiol. 36):
H1713-H1718,
1994[Abstract/Free Full Text].
10.
Geoffroy, J.,
D. Benzoni,
M. Vincent,
and
J. Sassard.
Thromboxane A2 and development of genetic hypertension in the Lyon rat strain.
Hypertension
16:
665-671,
1990.
11.
Hirata, M.,
Y. Hayashi,
F. Ushikubi,
Y. Yokota,
R. Kageyama,
S. Nakanishi,
and
S. Narumiya.
Cloning and expression of cDNA for a human thromboxane A2 receptor.
Nature
349:
617-620,
1991[Medline].
12.
Luft, F. C.,
C. S. Wilcox,
T. Unger,
R. Kuhn,
G. Demmert,
P. Rohmeiss,
D. Ganten,
and
R. B. Sterzel.
Angiotensin-induced hypertension in the rat: sympathetic nerve activity and prostaglandins.
Hypertension
14:
396-403,
1989[Abstract/Free Full Text].
13.
Lüscher, T. F.,
C. M. Boulanger,
Y. Dohi,
and
Z. Yang.
Endothelium-derived contracting factors.
Hypertension
19:
117-130,
1992[Abstract/Free Full Text].
14.
Ogletree, M. L.,
D. H. Harris,
W. A. Schumacher,
M. L. Webb,
and
R. N. Misra.
Pharmacological profile of BMS 180,219: a potent, long-acting, orally active thromboxane A2/prostaglandin endoperoxide receptor antagonist.
J. Pharmacol. Exp. Ther.
264:
570-578,
1993[Abstract/Free Full Text].
15.
Pelayo, J. C.,
M. A. Mobilia,
S. Tjio,
R. Singh,
J. M. Nakamoto,
and
C. Van Dop.
A method for isolation of rat renal microvessels and mRNA localization.
Am. J. Physiol.
267 (Renal Fluid Electrolyte Physiol. 36):
F497-F503,
1994[Abstract/Free Full Text].
16.
Purkerson, M. L.,
K. J. Martin,
J. Yates,
J. M. Kissane,
and
S. Klahr.
Thromboxane synthesis and blood pressure in spontaneously hypertensive rats.
Hypertension
8:
1113-1120,
1986[Abstract/Free Full Text].
17.
Raychowdhury, M. K.,
M. Yukawa,
L. J. Collins,
S. H. McGrail,
K. C. Kent,
and
J. A. Ware.
Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor.
J. Biol. Chem.
269:
19256-19261,
1994[Abstract/Free Full Text].
18.
Schnermann, J.
Vascular tone as a determinant of tubuloglomerular responsiveness.
In: The Juxtaglomerular Apparatus, edited by A. E. Persson,
and U. Boberg. Amsterdam, The Netherlands: Elsevier Science, 1988, p. 167-176.
19.
Singh, I.,
M. Grams,
W.-H. Wang,
T. Yang,
P. Killen,
A. Smart,
J. Schnermann,
and
J. P. Briggs.
Coordinate regulation of renal expression of nitric oxide synthase, renin, and angiotensinogen mRNA by dietary salt.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F1027-F1037,
1996[Abstract/Free Full Text].
20.
Sung, C.,
A. J. Arleth,
and
B. A. Berkowitz.
Endothelial thromboxane receptors: biochemical characterization and functional implications.
Biochem. Biophys. Res. Commun.
158:
326-333,
1989[Medline].
21.
Takahashi, N.,
K. Takeuchi,
T. Abe,
A. Sugawara,
and
K. Abe.
Structure and transcriptional function of rat kidney thromboxane receptor gene (Abstract).
J. Am. Soc. Nephrol.
7:
1651,
1996.
22.
Takahashi, N.,
K. Takeuchi,
T. Abe,
E. Tsutsumi,
and
K. Abe.
Immunohistochemical localization of thromboxane receptor and thromboxane synthase in rat kidney (Abstract).
J. Am. Soc. Nephrol.
6:
762,
1995.
23.
Uehara, Y.,
L. Tobian,
J. Iwai,
M. Ishii,
and
T. Sugimoto.
Alterations of vascular prostacyclin and thromboxane A2 in Dahl genetical strain susceptible to salt-induced hypertension.
Prostaglandins
33:
727-738,
1987[Medline].
24.
Weihprecht, H.,
J. N. Lorenz,
J. P. Briggs,
and
J. Schnermann.
Vasoconstrictor effect of angiotensin and vasopressin in isolated rabbit afferent arterioles.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F273-F282,
1991[Abstract/Free Full Text].
25.
Welch, W. J.,
N. G. Ahlstrom,
and
C. S. Wilcox.
Mechanism of hypertension during prolonged infusion of thromboxane mimetic.
Eur. J. Int. Med.
2:
277-280,
1992.
26.
Welch, W. J.,
and
C. S. Wilcox.
Modulating role for thromboxane in the tubuloglomerular feedback response in the rat.
J. Clin. Invest.
81:
1843-1849,
1988.
27.
Welch, W. J.,
and
C. S. Wilcox.
Feedback responses during sequential inhibition of angiotensin and thromboxane.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F457-F466,
1990[Abstract/Free Full Text].
28.
Welch, W. J.,
and
C. S. Wilcox.
Potentiation of tubuloglomerular feedback in the rat by thromboxane mimetic. Role of macula densa.
J. Clin. Invest.
89:
1857-1865,
1992.
29.
Wilcox, C. S.,
J. Cardozo,
and
W. J. Welch.
AT1 and TxA2/PGH2 receptors maintain hypertension throughout 2K,1C Goldblatt hypertension in the rat.
Am. J. Physiol.
271 (Regulatory Integrative Comp. Physiol. 40):
R891-R896,
1996[Abstract/Free Full Text].
30.
Wilcox, C. S.,
W. H. Folger,
and
W. J. Welch.
Renal vasoconstriction with U-46,619: role of arachidonate metabolites.
J. Am. Soc. Nephrol.
5:
1120-1124,
1994[Abstract].
31.
Wilcox, C. S., and W. J. Welch. TGF and
nitric oxide: effects of salt intake and salt-sensitive hypertension.
Kidney Int. 49, Suppl. 55: S9-S13, 1996.
32.
Wilcox, C. S.,
W. J. Welch,
and
H. Snellen.
Thromboxane mediates renal hemodynamic response to infused angiotensin II.
Kidney Int.
40:
1090-1097,
1991[Medline].
AJP Renal Physiol 273(6):F976-F983
0363-6127/97 $5.00
Copyright © 1997 the American Physiological Society