INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

THROMBOXANE A₂ (TxA₂), prostaglandin endoperoxide (PGH₂), and isoprostanes act on the same or similar receptors that have a widespread expression in the kidney (6), vascular smooth muscle cells (5), blood vessels (7), endothelium (20), and platelets (6). Recent studies have reported the cloning of a gene encoding TxA₂/PGH₂ receptors in the rat (11) and the expression of transcripts for this gene in kidney (1) and vascular endothelium (17). These receptors have been implicated in several models of hypertension, in which they mediate responses to an endothelium-derived vasoconstrictor factor (13) and to vasoconstrictor prostaglandins produced in the kidneys and blood vessels of rats with several forms of hypertension (10, 12, 16, 23, 29, 32).

The tubuloglomerular feedback (TGF) response is a graded vasoconstriction of the afferent arteriole that leads to a reduction in the glomerular capillary pressure (P_GC) and single-nephron glomerular filtration rate during NaCl reabsorption at the macula densa segment (3). The mediator of this vasoconstriction is currently unclear, but previous studies have implicated vasoconstrictor prostaglandins. Thus TGF responses are blunted by systemic administration of a TxA₂/PGH₂ receptor antagonist or a TxA₂ synthase inhibitor (26, 27), whereas TGF responses are enhanced during systemic administration or local microperfusion of a TxA₂/PGH₂ mimetic, U-46,619, into the lumen of the macula densa or the surrounding interstitium (28). However, little is known about the potential functional significance of the effects of TxA₂/PGH₂ on TGF. We have found that infusion of U-46,619 into conscious rats increases their blood pressure (BP) and that this increase is potentiated by a high-salt intake (25). This suggests that salt loading might enhance TxA₂/PGH₂ receptor expression or action. The present experiments were designed to test the hypothesis that a high-salt intake enhances the abundance of transcripts for TxA₂/PGH₂ receptors in the kidney and glomerulus and enhances the action of a TxA₂/PGH₂ receptor agonist on TGF responses.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Male Sprague-Dawley rats (240-320 g) were maintained on a high-salt (HS; Na content 2.4 g/100 g), a normal salt (NS; Na content 0.3 g/100 g), or a low-salt (LS; Na content 0.03 g/100 g) diet for 8-10 days before testing. The high- and low-salt diets were identical, apart from salt content (Teklad, Madison, WI), but the normal salt diet was regular rat chow (Purina Rat Chow; St. Louis, MO). The low-salt diet was sufficient for normal growth over this time.

Series 1. The aim of these molecular biology studies was to assess the effects of high-salt compared with low-salt intakes on the abundance of transcripts for TxA₂/PGH₂ receptors in the kidney cortex, glomerulus, and abdominal aorta. For preparation of the kidneys and aortae, groups of rats were accommodated to a high-salt (n = 6) or low-salt (n = 6) intake for 8-10 days. Under thiobarbital anesthesia, the abdomen was opened, and the aorta was cannulated to allow flushing of the kidneys and aorta with ice-cold 0.154 M NaCl. One kidney and a 0.5-cm length of abdominal aorta distal to the renal arteries were removed, cleared of connective tissue, and placed in ice-cold saline solution. The kidney was cut longitudinally and a segment of cortex removed. Total RNA was extracted, using RNA ATAT-60 (Tel-test B, Friendswood, TX). The mRNA was reverse transcribed with oligo(dT)₁₆ as primer and murine leukemia virus reverse transcriptase, using an RNA polymerase chain reaction (PCR) kit (Perkin-Elmer, Branchburg, NJ). The primers used for PCR for the TxA₂/PGH₂ receptor gene product were selected from the published cDNA sequences of the rat renal TxA₂/PGH₂ receptor (1). They were nucleotides 5' TGGACTGGCGTGCCACTGAT 3' (sense primer, position bp 275-294) and 5' AGCAAGGGCATCCAACACACCGTG 3' (antisense primer, position bp 753-776). The PCR product had a predicted length of 502 bp. -Actin was selected as a "housekeeper gene" for comparison, since -actin mRNA abundance in the rat kidney is reported to be independent of salt intake (19). The primers used for -actin mRNA were as follows: sense primer 5' GATCAAGATCATTGCTCCTC 3' (position bp 2860-3003 with exon 2867-2990 deleted) and antisense primer 5' TGTACAATCAAAGTCCTCAG 3' (position bp 3390-3407). The PCR product had a predicted length of 426 bp. The amounts of TxA₂/PGH₂ receptor cDNAs were normalized by the amounts of -actin cDNA. The reaction mixture contained 50 pmol of each primer, 1.25 mM deoxynucleotide mixture, 2.5 µl Taq DNA polymerase, 10 mM tris(hydroxymethyl)aminomethane hydrochloride (pH 10), 50 mM KCl, 1.5 mM MgCl₂, and 0.001% (wt/vol) gelatine in a final volume of 50 µl. The PCR was carried out by the following protocol: after an initial melting temperature of 94°C for 4 min, there were 30 s of denaturation at 94°C, 45 s of annealing at 60°C, and 45 s of extension at 72°C for repeated cycles of amplification, followed by a final extension at 72°C for 7 min. The PCR product was analyzed on a 1.5% agarose gel stained with ethidium bromide and visualized under ultraviolet light. The size of the products was compared with a rat kidney cDNA probe for TxA₂/PGH₂ receptors, kindly provided by Dr. Kazu Takeuchi (Tokohu University). To verify the authenticity of the PCR products, the amplified TxA₂/PGH₂ receptor cDNAs from rat kidney cortex and abdominal aorta were purified with MICROCON (Amicon, Beverly, MA) and sequenced with AmpliTaq cycle sequencing kit (Perkin-Elmer).

Series 2. The aim of this series of physiological studies was to determine the effects of dietary salt intake on the P_GC response to orthograde microperfusion of a TxA₂/PGH₂ mimetic into the macula densa segment during full activation of TGF. These studies utilized U-46,619, which is a TxA₂/PGH₂ mimetic that has a similar action on renal hemodynamics as native TxA₂ (4). We found previously that orthograde microperfusion of U-46,619 (10⁶ M) in artificial tubular fluid (ATF) into the loop of Henle of rats receiving a normal salt intake potentiates TGF consistently by ~5 mmHg; therefore, this concentration was selected for these studies. Nephrons were perfused with ATF + vehicle or ATF + U-46,619 (10⁶ M) in random order. In each rat, paired measurements were made of stop flow pressure (P_SF) during zero loop perfusion and during perfusion at 40 nl/min. Perfusion of nephrons with ATF at 40 nl/min elicits a maximal reduction in TGF. The maximal TGF response was therefore taken as the difference between P_SF at zero loop perfusion and during perfusion at 40 nl/min with ATF + vehicle or ATF + U-46,619. Salt intake did not affect the P_SF at zero loop perfusion.

1

1

6

Series 3. Further studies were undertaken in rats adapted to low-salt, normal salt, or high-salt intakes to test the hypothesis that the effects of salt intake on the response to U-46,619 are specific for this method of enhancing TGF. Arginine vasopressin (AVP) (10⁷ M) was added to artificial plasma (AP) (28) and microperfused at 15 nl/min via the peritubular capillaries (PTC) into the interstitium surrounding the test nephron. The TGF response to orthograde luminal perfusion of ATF at zero and 40 nl/min was assessed before and during microperfusion of AVP into the PTC. We have shown previously that microperfusion of AP into the PTC at 20 nl/min does not perturb TGF responses (28).

Statistics. Results are presented as means ± SE. An analysis of variance (ANOVA) was used to assess the effects of interventions and of salt intake. Post hoc testing, when appropriate, was made by Dunnett's test. Statistical significance was considered at P < 0.05.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

Series 1. Consistent RT-PCR products corresponding in size to mRNA for TxA₂/PGH₂ receptor and -actin were obtained from kidney cortex and aorta of rats adapted to high-salt and low-salt intakes. Sequencing of one of these products for TxA₂/PGH₂ receptors showed it to be identical to that reported previously from rat kidney (1). As shown in Fig. 1, strong PCR bands corresponding in size to TxA₂/PGH₂ receptor cDNA were obtained after RT of rat kidney cortex; the abundance of the RT-PCR product corresponding to TxA₂/PGH₂ receptor mRNA increased with salt intake, whereas the product corresponding to -actin mRNA was unchanged. Because the density of the product from the rats adapted to a normal salt intake appeared intermediate between that from high- and low-salt intakes, further studies were confined to the high-salt and low-salt groups. As shown in Fig. 2, the intensity of staining of PCR products for TxA₂/PGH₂ receptor mRNA from the renal cortex was greater in rats fed a high-salt than a low-salt diet, but there appeared to be no effects of salt intake on the intensity of -actin products. Strong bands corresponding to TxA₂/PGH₂ receptor mRNA were also obtained after RT of rat abdominal aorta. However, unlike the kidney cortex, the density of the bands from the aorta did not appear to be affected by salt intake (Fig. 3). Densitometric analysis showed no effect of dietary salt intake on -actin RT-PCR products from kidney cortex (HS: 0.62 ± 0.05 vs. LS: 0.68 ± 0.04 arbitrary units; not significant) or aorta (HS: 0.77 ± 0.06 vs. LS: 0.81 ± 0.02 arbitrary units; not significant). Likewise, there was no significant effect of dietary salt intake on the RT-PCR products for TxA₂/PGH₂ receptors from the aorta (HS: 0.69 ± 0.04 vs. LS: 0.68 ± 0.04 arbitrary units; not significant), but there was a consistent increase in the kidney cortex of high-salt compared with low-salt rats (HS: 0.82 ± 0.04 vs. LS: 0.58 ± 0.04 arbitrary units; P < 0.001). The ratio of densitometry for PCR products for TxA₂/PGH₂ receptors compared with -actin is shown in Fig. 4. It is apparent that there is a significant (P < 0.001) increase in this ratio with high-salt (1.34 ± 0.01) compared with low-salt (0.84 ± 0.04) intake in the kidney (Fig. 4A). However, there was no significant effect in the aorta (Fig. 4B; HS: 0.91 ± 0.03 vs. LS: 0.85 ± 0.06; not significant).

View larger version (38K): [in this window] [in a new window]   Fig. 1.   Photograph of an agarose gel stained with ethidium bromide showing a molecular weight (MW) marker, a rat renal thromboxane A2 (TxA2)/prostaglandin endoperoxide (PGH2) receptor cDNA probe (502 bp), and reverse transcription-polymerase chain reaction (RT-PCR) products corresponding to TxA2/PGH2 receptor mRNAs (TxA2-R) and -actin from kidney cortex of rats adapted to a high-, normal, or low-salt diet. Negative control is RT-PCR reaction in buffer used. Data shown are either with (+) or without () reverse transcription.

View larger version (44K): [in this window] [in a new window]   Fig. 2.   Photograph of a gel, similar to Fig. 1, showing individual RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors and -actin from kidney cortex of 6 high-salt and 6 low-salt rats. neg, Negative control.

View larger version (35K): [in this window] [in a new window]   Fig. 3.   Photograph of a gel, similar to Fig. 1, showing RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors and -actin from abdominal aorta of a high-salt and a low-salt rat.

View larger version (15K): [in this window] [in a new window]   View larger version (13K): [in this window] [in a new window]   Fig. 4.   Mean ± SE values for relative (to -actin) abundance of mRNA RT-PCR products for TxA2/PGH2 receptor. Data compare rats adapted to a low-salt with those adapted to a high-salt intake. n, Number of rats. A: kidney cortex; B: abdominal aorta. ns, Not significant.

View larger version (15K): [in this window] [in a new window]   Fig. 5.   Photograph of a gel, similar to Fig. 1, showing individual RT-PCR products corresponding to mRNA for TxA2/PGH2 receptors. Each lane shows product from a single outer cortical glomerulus microdissected from rats receiving a high-salt (HS; lanes 1-6) or low-salt (LS; lanes 7-12) diet.

View larger version (12K): [in this window] [in a new window]   Fig. 6.   Mean ± SE values for relative abundance of mRNA transcripts for TxA2/PGH2 receptors per single glomerulus comparing rats adapted to a high-salt with those adapted to low-salt intake.

Series 2. As shown in Table 1, there were no differences among the groups of rats used for physiological studies, whether maintained on a high-salt, normal salt, or low-salt diet, for body weight, experimental kidney weight, mean arterial pressure, or heart rate. As shown in Tables 1 and 2, there were no significant differences among these groups for values of P_SF during zero loop of Henle perfusion. However, the maximal TGF response, as shown from the reduction in P_SF during loop perfusion with ATF + vehicle at 40 nl/min, compared with zero perfusion, was significantly blunted in high-salt compared with normal or low-salt rats. Compared with zero loop perfusion, perfusion with ATF + U-46,619 at 40 nl/min decreased P_SF to a greater extent than with ATF alone in each group. The U-46,619-induced increase in maximal TGF responses was 5.6 ± 0.7 mmHg in rats on a normal salt intake. This U-46,619-induced change was significantly (P < 0.01) less in low-salt rats (3.8 ± 0.5 mmHg) and significantly (P < 0.01) more in high-salt rats (9.6 ± 0.9 mmHg).

Series 3. To test the specificity of the effects of salt on the TGF response to U-46,619, AVP (10⁷ M) was infused into the PTC surrounding the test nephrons. As shown in Table 2 (Series 3), before AVP, the maximal TGF responses were greater in nephrons of low-salt and normal salt than high-salt rats. During PTC perfusion of AVP, the TGF responses were increased significantly (P < 0.05) in nephrons of rats, independently of the level of salt intake (LS: +1.8 ± 0.6 vs. NS: +1.5 ± 0.5 vs. HS: +2.2 ± 0.6 mmHg; not significant).

View larger version (27K): [in this window] [in a new window]   Fig. 7.   Mean ± SE values for percent enhancement of maximal tubuloglomerular feedback (TGF) responses in rats adapted to low-, normal, or high-salt intakes. Values of maximal TGF are derived from changes in stop flow pressure during perfusion of loop of Henle at 0 and 40 nl/min during enhancement of TGF by addition of U-46,619 to loop perfusate (left) and by addition of arginine vasopressin (AVP, right) to peritubular perfusate. * P < 0.05 and ** P < 0.01 compared with normal salt intake.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

The main new finding of this study is that there is a greater expression of the PCR product for the TxA₂/PGH₂ receptor in the kidney and outer cortical glomeruli from high-salt than from low-salt rats but no effect of salt on the expression of the product from the aorta. Orthograde microperfusion of a TxA₂/PGH₂ mimetic into the macula densa segment enhances TGF responses to a greater extent in rats adapted to high-salt than normal or low-salt intakes. These effects were blunted >70% by intravenous infusion of a TxA₂/PGH₂ receptor antagonist. In contrast, interstitial microperfusion of AVP enhances TGF responses independently of salt intake. It is clear that a factor other than the expression and ability of the TxA₂/PGH₂ receptor to respond is responsible for the blunted TGF response of salt-loaded rats.

Drugs that inhibit TxA₂/PGH₂ receptors blunt the TGF response by 40-60% when administered systemically before testing (26, 27). These data indicate a quantitatively important role for TxA₂ and/or PGH₂ or other ligands at this receptor in regulation of TGF and hence nephron hemodynamics. Because we found a similar degree of blunting of TGF after systemic administration of a TxA₂ synthase inhibitor and no further effect on TGF of a TxA₂/PGH₂ receptor antagonist in rats pretreated with a TxA₂ synthase inhibitor, we concluded that TxA₂ was of particular importance (26). However, Franco et al. (8) found that local perfusion of the loop of Henle with a TxA₂/PGH₂ receptor antagonist did not alter TGF responses. In their studies, the nephron was blocked at the proximal tubule, and this may have isolated the macula densa cells from the major source of TxA₂ and PGH₂ production in the glomerulus (22).

The strong potentiation of maximal TGF responses by microperfusion of a thromboxane mimetic into the macula densa segment and blockade by a TxA₂/PGH₂ receptor antagonist confirm a previous study (28). Because the response to perfusion of U-46,619 (10⁶ M) into the loop of Henle was largely prevented by coperfusion with furosemide, which inhibits macula densa reabsorption, and because microperfusion of U-46,619 stimulated net chloride transport from the loop of Henle, we concluded that, at this dose, it was acting predominantly on the macula densa to stimulate NaCl reabsorption, thereby increasing the signal for activation of TGF. However, U-46,619 is lipid soluble and can diffuse out of the tubule lumen (28). Thus it may vasoconstrict the afferent arteriole directly. Indeed, the reduction in P_GC produced by microperfusion of higher doses of U-46,619 was not fully prevented by coperfusion with furosemide.

The present study is the first to examine factors that affect the response of TGF to TxA₂/PGH₂ receptor activation. The absolute enhancement of TGF by addition of the TxA₂/PGH₂ mimetic to ATF perfusate was more than twice as great in nephrons of rats adapted to high-salt than to normal salt intake. When assessed as percent changes, the effects of salt intake were even greater (Fig. 7). This has some specificity, since the enhancement of TGF by U-46,619 was blunted by ifetroban at each level of salt intake, and there were no such effects of salt intake on the TGF response to AVP microperfused into the interstitium surrounding the test nephron. A previous study showed that intravenous pressor doses of AVP enhance TGF, but during maintenance of renal perfusion pressure, systemic AVP infusion does not significantly alter TGF responsiveness, although sensitivity is enhanced by ~25% (18). AVP was selected for our study because it causes direct vasoconstriction of the afferent arteriole of the rabbit when applied from the interstitial side (24), and its effects on the glomerulus are independent of angiotensin II (9). Therefore, we anticipated that AVP responsiveness should not be greatly changed by salt intake, as indeed was the case.

High-affinity binding sites for TxA₂/PGH₂ receptor ligands have been identified in the kidney and isolated glomeruli (6). Immunocytochemical studies demonstrate TxA₂/PGH₂ receptor immunoreactive sites in the afferent arteriole, glomerulus, and tubules, including the luminal aspect of the thick ascending limb (2, 22). In situ hybridization has shown expression of TxA₂/PGH₂ receptor mRNA in glomeruli, afferent and efferent arterioles, the luminal aspects of the thick ascending limb and macula densa cells, and other tubular sites (22). Expressions of TxA₂/PGH₂ receptors on the luminal membrane of macula densa cells and the afferent arteriole are the probable sites at which TGF responses are enhanced during luminal perfusion of U-46,619. Our data demonstrate that there is increased TxA₂/PGH₂ receptor transcript expression within the outer cortical glomeruli and renal cortex during high-salt intake. As in a previous study (19), salt intake had no effects on the abundance of -actin mRNA. Of interest was the finding that the abundance of TxA₂/PGH₂ receptor mRNA was not increased by salt loading in the aorta. The renal circulation is especially sensitive to TxA₂/PGH₂ receptor stimulation, as shown by a greater increase in renal than femoral vascular resistance with infused U-46,619 (30) and, in dose-response studies, a 10- to 100-fold lower dose of infused U-46,619 required to raise renal vascular resistance compared with femoral vascular resistance or BP and a 100- to 1,000-fold lower dose to increase TGF (28). These data suggest that TxA₂/PGH₂ receptors in the kidney and juxtaglomerular apparatus could be quite important in regulation of renal hemodynamics in the rat and that this renal circulatory regulation may be dependent on salt intake. The mechanism of induction of TxA₂/PGH₂ receptor mRNA by salt intake is unknown. The 5' flanking transcriptional regulatory region of the gene contains a putative AP1 binding element, a glucocorticoid responsive element, and a shear stress response element (21), but the relationship of these potential regulatory sites to NaCl-dependent gene expression is currently unknown.

Previously, we found that infusions of U-46,619 caused progressive increases in systolic BP of conscious rats (25). The rise in systolic BP at 8-12 days was greater in rats adapted to a high-salt than to a low-salt intake. This may relate to the present finding of enhanced receptor transcript expression in the kidney and enhanced TGF responsiveness to the mimetic during salt loading. An alteration in kidney function is required for a sustained increase in BP to prevent the pressure natriuresis from reducing the extracellular fluid volume and restoring a normal BP. The TGF response is an integral part of the kidney's adaptation to change in salt intake, and a blunted response during a high-salt intake may be important in contributing to pressure natriuresis and preventing extracellular fluid volume expansion (3). Failure to blunt this response has been shown in a model of salt-dependent hypertension (31).

TxA₂/PGH₂ receptors mediate renal vasoconstriction, enhanced TGF responses, and NaCl reabsorption in the loop of Henle (26-28). The finding that the expression of these receptors and their responsiveness in the kidney are enhanced by a high-salt diet appears to counter homeostatic requirements. However, it may be that there is normally little TxA₂ or PGH₂ generated in the kidney during a high-salt intake, since angiotensin II, which is suppressed by salt loading, is a physiological stimulus to their production (12, 32). Indeed, the increased renal and glomerular TxA₂/PGH₂ receptor mRNA expression during high-salt intake could be a response to reduced TxA₂/PGH₂ receptor activation. On the other hand, in some models of hypertension, including the Lyon hypertensive (10) and the spontaneously hypertensive rat (16), the two-kidney, one-clip Goldblatt hypertensive rat (29), the angiotensin-infused rat (12), and the Dahl salt-sensitive rat (23), there can be overproduction of vasoconstrictor prostaglandins. In these settings, any enhancement of TxA₂/PGH₂ receptors during high-salt intakes could contribute to salt-sensitive hypertension.