AJP - Renal  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 274: F10-F17, 1998;
0363-6127/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Vol. 274, Issue 1, F10-F17, January 1998

Young SHR express increased type 1 angiotensin II receptors in renal proximal tubule

Hui-Fang Cheng1, Jun-Ling Wang1, Gavin P. Vinson2, and Raymond C. Harris1

1 Department of Medicine, Vanderbilt University School of Medicine, and Department of Veterans Affairs Medical Center, Nashville, Tennessee 37232; and 2 Department of Biochemistry, University of London, Queen Mary and Westfield College, London E1 4NS, United Kingdom

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

A potential role for the renin-angiotensin system (RAS) in the development and/or maintenance of hypertension in the genetic model of rat hypertension, spontaneously hypertensive rats (SHR), has been suggested by studies indicating that treatment of immature animals with angiotensin-converting enzyme (ACE) inhibitors prevents subsequent development of hypertension. Because young SHR also demonstrate RAS-dependent increased sodium retention, we examined proximal tubule type 1 angiotensin II receptor (AT1R) mRNA expression in young (4 wk) or adult (14 wk) SHR compared with age-matched Wistar-Kyoto (WKY) rats. Proximal tubules were isolated by Percoll gradient centrifugation, and AT1R mRNA expression was measured by quantitative reverse transcription-polymerase chain reaction (RT-PCR). At 14 wk, when SHR had established hypertension [mean arterial blood pressure (MAP) of SHR vs. WKY: 145 ± 6 vs. 85 ± 5 mmHg, n = 14-15], there were no differences in proximal tubule AT1R mRNA levels [SHR vs. WKY: 79 ± 14 vs. 72 ± 14 counts/min (cpm) per cpm mutant AT1R per cpm beta -actin × 10-6, n = 6; not significant (NS)]. In contrast, in 4 wk SHR, at a time of minimal elevations in blood pressure (MAP: 70 ± 8 vs. 63 ± 3), SHR proximal tubule AT1R mRNA levels were 263 ± 30% that of WKY (143 ± 18 vs. 60 ± 11 cpm per cpm of mutant AT1R per cpm beta -actin × 10-6, n = 8; P < 0.005). We have recently shown that chronic ACE inhibition decreases proximal tubule AT1R expression and have also shown that chronic L-3,4-dihydroxyphenylalamine (L-DOPA) administration inhibits AT1R expression in adult Sprague-Dawley proximal tubule and cultured proximal tubule, and this inhibition is mediated via Gs-coupled DA1 receptors. When 3-wk-old animals were given L-DOPA or captopril for 1 wk, MAP was not altered (70 ± 8 vs. 60 ± 4 or 61 ± 5 mmHg), but proximal tubule AT1R mRNA was no longer significantly different between SHR and WKY (68 ± 9 vs. 38 ± 7 or 20 ± 3 vs. 47 ± 15 cpm per cpm of mutant AT1R per cpm beta -actin × 10-6), due to a significant decrease in proximal tubule AT1R expression in SHR (P < 0.005, compared with untreated SHR). Immunoreactive proximal tubule AT1R expression also was increased in 4 wk SHR and was reversed with captopril or L-DOPA treatment. Therefore, these results indicate that young, but not adult, SHR have increased expression of proximal tubule AT1R and that chronic L-DOPA or captopril treatment decreased the elevated AT1R expression to control levels. These results provide further support for an important role of the RAS in the development of hypertension in SHR.

kidney; spontaneously hypertensive rats; angiotensin-converting enzyme inhibitor; L-3,4-dihydroxyphenylalaine

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

FUNCTIONAL RENAL ABNORMALITIES have been implicated in the development of hypertension in spontaneously hypertensive rats (SHR). Young SHR have decreased glomerular filtration and renal blood flow and decreased sodium and water excretion compared with aged-matched animals of the normotensive Wistar-Kyoto (WKY) strain (1, 3, 5, 28, 29, 50, 51). In adult SHR, as hypertension develops, these abnormalities are no longer detectable. The initial impairment in glomerular filtration rate (GFR) may be a stimulus for increased salt and water reabsorption and increased blood pressure to return renal perfusion to normal (3). Although plasma renin levels are not elevated in SHR, a pathogenic role for the renin-angiotensin system in the development of hypertension in SHR has been suggested by numerous studies demonstrating that administration of either angiotensin-converting enzyme (ACE) inhibitors or angiotensin receptor antagonists to immature SHR will prevent the development of hypertension and that these antihypertensive effects persist even after cessation of treatment (28, 29, 36, 37, 57).

The proximal tubule is a major site of salt and water reabsorption in the mammalian nephron, with up to 60% of the filtrate reabsorbed in this segment, and angiotensin II (ANG II) is a major regulator of proximal tubule function. ANG II binding sites are found in high concentrations in mammalian proximal tubule, and ANG II exerts direct effects on proximal tubule transport, independent of its effects on systemic or renal hemodynamics (8, 20, 46). Both in vivo and in vitro studies have determined that the physiological effects of ANG II to modulate salt and water reabsorption in this nephron segment are largely, if not entirely, mediated by type 1 angiotensin II receptors (AT1R) (9, 58). Because previous studies have indicated that ANG II mediates the increased proximal tubule reabsorption seen in immature SHR (50, 51), the present studies were designed to determine whether SHR have increased expression of AT1R and to examine potential mechanisms involved in mediating altered receptor expression.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Materials. Unless otherwise specified, all chemicals were purchased from Sigma Chemical (St. Louis, MO). [32P]CTP (3,000 Ci/mmol) and ECL enhanced chemiluminescence kits were from Amersham (Arlington Heights, IL). Bicinchoninic acid protein assay reagent kit and Immunopure avidin-biotin peroxidase complex staining kit, biotin-labeled goat anti-mouse immunoglobulin G (IgG) (Fc) antibody and mouse anti-rabbit IgG (H+L) antibody were from Pierce (Rockford, IL). Monoclonal anti-AT1R antibody 6313/G2 was described previously by Barker et al. (4), and rabbit polyclonal anti-AT1R antibody (N-10) was from Santa Cruz Biotechnology (Santa Cruz, CA).

Animals. Four-week- and 14-wk-old male SHR and age-matched WKY rats (Harlan, Indianapolis, IN) fed normal rat chow were used for the study. Treatment groups consisted of 3-wk-old SHR and WKY rats given either captopril (100 mg · kg body wt-1 · day-1) (40) or L-3,4-dihydroxyphenylalamine (L-DOPA) (2 mg · kg-1 · day-1) (49) in the drinking water for 7 days; at age 4 wk, the animals were killed and studied. The tail-cuff microphonic manometer method was used to measure blood pressure (33).

Isolation of proximal tubules. Modification of the methods of Vinay et al. (Ref. 53; see also Refs. 18, 30) that we have previously reported were used for proximal tubule isolation. Briefly, renal cortices were gently minced and suspended in a solution containing (in mM) 105 NaCl, 24 NaHCO3, 5 KCl, 1.5 CaCl2, 1 MgSO4, 2.0 NaH2PO4, 10 N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, and 0.2% bovine serum albumin (BSA), pH 7.4 (buffer A), with the following additions: 8.3 mM glucose, 1 mM alanine, 0.03% collagenase (Sigma, type I), and 0.01% soybean trypsin inhibitor (Sigma), gassed with 95% O2-5% CO2, and maintained at 37°C. The cortical suspension was incubated for 45 min and gently agitated on a rocking platform. The suspension was strained through a large sieve, centrifuged, resuspended in oxygenated buffer A, then washed, and recentrifuged three times. The resulting pellet was mixed with 50 ml of a 40% Percoll solution with the identical ionic composition as buffer A and which had been previously gassed with 95% O2-5% CO2 and chilled to 4°C. The Percoll solution was centrifuged at 15,000 revolutions/min for 30 min at 4°C in a Beckman J2-21 high-speed preparative centrifuge using a JA-17 rotor. After centrifugation, the tissue was separated into four distinct bands (30). The lowermost band, which was enriched in proximal tubule segments, was collected.

Quantitation of AT1R by polymerase chain reaction. Total RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform method (19). Quantitative polymerase chain reaction (PCR) was performed as previously described for SV40 rabbit proximal tubule cells (16) and isolated rat proximal tubules (17). For PCR, total RNA (10 µg) and cRNA of an AT1 receptor Msc1/Msc-1 deletion mutant (100 pg) were mixed and reverse transcribed using murine reverse transcriptase (First Strand cDNA Synthesis Kit; Pharmacia, Piscataway, NJ) and a primer specific for the AT1R in a final reaction volume of 33 µl. The resultant single-strand cDNA mixture was then amplified in a Perkin-Elmer GeneAMP 9600 PCR System using Taq polymerase (Perkin-Elmer Cetus). The primers utilized were an upstream sense primer (5' TACATATTTGTCATGATTCCT 3') and a downstream anti-sense primer (3' GTGAATATTTGGTGGGGAAC 5'). PCR was performed for 35 cycles at 95°C for 20 s, 55°C for 30 s, and 72°C for 90 s, followed by a 10-min extension at 72°C. Amplification of intact and mutant AT1R mRNA by these primers gave 703- and 415-bp fragments, respectively. Characterization of this assay indicated that no amplification occurred in the absence of reverse transcriptase (RT) and that there was linearity of response for at least 40 cycles (18). Samples were routinely amplified in the presence of [alpha -32P]CTP (NEN, Boston, MA; 3,000 Ci/mmol, 2 µCi/sample). For normalization, parallel samples measured amplification of beta -actin, using the primers (5' AACCGCGAGAAGATGACCCAGATCATGTTT and 3' AGCAGCCGTGGCCATC TCTTGCTCGAAGTC) (16). After gel chromatography on 4% agarose gels, the bands corresponding to the AT1R, deletion fragment, and beta -actin were excised and counted by scintillation spectrometry. Results are represented as the ratio of intact and deletion-fragment AT1R mRNA amplified, normalized to the amount of amplified beta -action mRNA. This method provides a relative comparison of the amount of AT1R mRNA present among the different experimental groups (18, 38).

Immunoblotting. Membrane protein was purified using modifications of methods of Zelezna et al. (61). Briefly, proximal tubules separated by Percoll gradient centrifugation were homogenized in phosphate-buffered saline containing protease inhibitors [30 µg phenylmethylsulfonyl fluoride (PMSF), 300 µg EDTA, and 0.5 µg leupeptin/ml]. Homogenates were centrifuged at 20,000 g for 10 min at 4°C, and the pellets were rinsed twice and dissolved in 10 volumes of suspension buffer [10 mM tris(hydroxymethyl)aminomethane (Tris), pH 6.8, 1% Triton X-100 (TBST), 1 mM PMSF]. After quantitation of protein concentration, using the bicinchoninic acid reaction (Pierce), 20 µg protein in 20-µl sample buffer [50 mM Tris · Cl, pH 6.8, 1.6% sodium dodecyl sulfate (SDS), 0.16% BPB, 8% glycerol, 0.1 M dithiothreitol] were loaded into each well and electrophoresed in an 8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gel. Separated proteins were transferred onto an Immobilon-P membrane (0.45 µM, Millipore). After being blocked and washed, the membrane was incubated for 4 h at room temperature in block buffer (5% milk, 3% BSA in TBST) containing a 1:800 diluted anti-AT1R monoclonal or 1:500 diluted polyclonal anti-AT1R antibody, followed by incubation with the corresponding second antibody at RT for 1 h and development with ECL reagents (Amersham). In preliminary experiments, it was determined that all binding of the polyclonal antibody to proximal tubule proteins was prevented by preincubation with AT1R peptide (Santa Cruz Biotechnology).

Statistics. Results are presented as means ± SE. Statistical comparisons utilized analysis of variance and Bonferroni modification of Student's t-test, with P < 0.05 indicating significance.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Mean arterial blood pressures (MAP) of SHR were significantly increased at 14 wk compared with age-matched WKY rats (145 ± 6 vs. 85 ± 5 mmHg; n = 14-15, P < 0.0001) (Fig. 1), although body weights were comparable (243 ± 5 vs. 248 ± 6 g). Blood pressure was not statistically significantly increased in the 4 wk animals compared with age-matched WKY rats (70 ± 8 vs. 63 ± 3 mmHg; n = 5-12, NS), nor were body weights different (89 ± 1 vs. 91+1 g). AT1R mRNA expression in proximal tubule was also not different between 14 wk SHR and WKY (79 ± 14 vs. 72 ± 14 counts/min per counts/min of mutant AT1R per counts/min beta -actin × 10-6; n = 6, NS) (Fig. 2, A and C). In contrast, proximal tubule AT1R mRNA levels of 4 wk SHR were 277 ± 26% of WKY (145 ± 17 vs. 56 ± 8 counts/min per counts/min of mutant AT1R per counts/min beta -actin × 10-6; n = 10-12, P < 0.005) (Fig. 2, B and C).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Mean arterial blood pressure (MAP) in 4 wk (n = 5-12) and 14 wk (n = 14-15) spontaneously hypertensive rats (SHR) and Wistar-Kyoto (WKY) rats. * P < 0.0001 compared with 14 wk WKY.


View larger version (80K):
[in this window]
[in a new window]
 


View larger version (55K):
[in this window]
[in a new window]
 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   A: representative reverse transcription-polymerase chain reaction (RT-PCR) amplification of type 1 angiotensin II receptor (AT1R) mRNA in proximal tubules from 14 wk WKY and SHR. Amplified fragment of intact AT1R is 703 bp, internal Msc1/Msc-1 deletion control is 415 bp, and beta -actin is 354 bp. Lane 1: WKY; lane 2: SHR. B: representative RT-PCR amplification of AT1R mRNA in proximal tubules from 4 wk WKY and SHR. Lane 1: WKY; lane 2: SHR. C: summary of AT1R mRNA expression in proximal tubules in young and adult SHR and WKY rats. Results are expressed as counts/min (cpm) AT1R per cpm deletion fragment per cpm beta -actin × 10-6 (n = 6 for adults, n = 10-12 for young; * P < 0.005).

Because chronic administration of ACE inhibitors decreased proximal tubule AT1R expression in New Zealand rabbits (14), the effect of ACE administration on proximal tubule AT1R in young SHR and WKY rats was investigated. After 7 days of treatment with captopril, the MAP of 4 wk SHR and WKY were not significantly altered (SHR: 61 ± 5 vs. 70 ± 8 mmHg, n = 5, NS; WKY: 60 ± 8 vs. 63 ± 3 mmHg, n = 4-12, NS); however, proximal tubule AT1R mRNA expression in SHR was significantly decreased, compared with untreated SHR (47 ± 15 vs. 145 ± 17 counts/min per counts/min of mutant AT1R per counts/min beta -actin × 10-6; n = 4, P < 0.005) (Fig. 3). Proximal tubule AT1R mRNA expression in WKY rats treated with captopril was also decreased compared with untreated animals (20 ± 2 vs. 56 ± 8; n = 6).


View larger version (104K):
[in this window]
[in a new window]
 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   A: representative RT-PCR amplification of AT1R mRNA in proximal tubules from 4 wk WKY and SHR with or without captopril treatment. Lane 1: WKY; lane 2: SHR; lane 3: WKY + captopril (100 mg · kg-1 · day-1) for 1 wk; lane 4: SHR + captopril. B: summary of AT1R mRNA expression in proximal tubules in young SHR and WKY rats after 1 wk of captopril treatment (n = 4-12; * P < 0.005).

When 3-wk-old SHR were given L-DOPA for 1 wk, MAP was not significantly different compared with untreated animals (60 ± 4 vs. 70 ± 8 mmHg; n = 5-10, NS), but proximal tubule AT1R mRNA in SHR decreased compared with untreated animals (68 ± 9 counts/min per counts/min of mutant AT1R per counts/min beta -actin × 10-6; n = 6, P < 0.005) (Fig. 4). MAP was not significantly altered in young WKY treated with L-DOPA (61 ± 2 vs. 63 ± 3 mmHg; n = 4-12, NS). AT1R mRNA expression decreased to 30 ± 3 counts/min per counts/min of mutant AT1R per counts/min beta -actin × 10-6 (n = 7).


View larger version (104K):
[in this window]
[in a new window]
 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   A: representative RT-PCR amplification of AT1R mRNA in proximal tubules from 4 wk WKY and SHR with or without L-3,4-dihydroxyphenylalamine (L-DOPA) treatment. Lane 1: WKY; lane 2: SHR; lane 3: WKY + L-DOPA (2 mg · kg-1 · day-1) for 1 wk; lane 4: SHR + L-DOPA. B: summary of AT1R mRNA expression in proximal tubules in young SHR and WKY rats after 1 wk of L-DOPA treatment (n = 6-12; * P < 0.005).

To study expression and regulation of AT1R protein in young SHR, two anti-peptide antibodies raised against the AT1R extracellular domain were utilized, a rabbit polyclonal anti-AT1R antibody raised against amino acids 15-24 and a monoclonal anti-AT1R antibody (6313/G2) raised against amino acids 8-17. Figure 5 indicates the predominant immunoreactive proteins recognized in proximal tubule membranes by both the polyclonal or monoclonal anti-AT1R peptide antibodies were at 70 and 125 kDa, with minor bands at ~100 and 85 kDa also noted. The immunoreactive proteins were increased in 4 wk SHR compared with age-matched WKY, and chronic treatment with either captopril or L-DOPA decreased expression in SHR proximal tubules. In four separate experiments using the polyclonal antibody, densitometric analysis indicated that the 70-kDa band was increased 2.2 ± 0.3-fold in 4 wk SHR compared with 4 wk WKY (P < 0.005). AT1R immunoreactivity was significantly decreased in both the captopril-treated SHR (1.2 ± 0.1-fold WKY; P < 0.01 compared with untreated SHR) and L-DOPA-treated SHR (1.4 ± 0.3-fold WKY; P < 0.05 compared with untreated SHR).


View larger version (44K):
[in this window]
[in a new window]
 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5.   Representative immunoblots of AT1R immunoreactive protein in proximal tubule membranes isolated from 4 wk SHR and WKY rats. A: polyclonal anti-AT1R peptide antibody. Lane 1: SHR; lane 2: SHR + captopril; lane 3: WKY; lane 4: WKY + captopril. Relative densitometry of 70 kDa band: lane 1, 5,497; lane 2, 2,831; lane 3, 2,003; and lane 4, 1,312. B: monoclonal anti-AT1R peptide antibody. Lane 1: WKY; lane 2: SHR; lane 3: SHR + captopril; lane 4: SHR + L-DOPA. Relative densitometry of 70 kDa band: lane 1, 2,204; lane 2, 3,118; lane 3, 2,404; lane 4, 1,494.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The present studies were designed to examine expression of AT1R mRNA and immunoreactive protein in the proximal tubule of young and adult SHR. They demonstrated that at 4 wk, at a time prior to the onset of significant hypertension, steady-state proximal tubule AT1R mRNA levels were >2.5-fold increased compared with that of age-matched WKY rats and increased immunoreactive protein was also detected in proximal tubule of young SHR compared with WKY rats. However, at 14 wk, at a time of established hypertension, no differences in AT1R mRNA expression were observed. Although previous studies have indicated that AT1a is the predominant AT1 subtype expressed in kidney proximal tubule (18), the PCR primers used in this experiment detected both AT1a and AT1b, and we did not determine whether there was an increase of a specific AT subtype.

The development of hypertension in SHR is due in part to abnormal kidney function (22, 23, 29). Young (4-6 wk) SHR have reduced GFR and renal blood flow and increased renal vascular resistance compared with WKY rats. After hypertension develops, the renal hemodynamic alterations become normalized (by 12-14 wk), and it has been suggested that the initially low GFR and renal blood flow in young SHR may be a stimulus for blood pressure to increase to return renal perfusion pressure to normal (3, 22, 23, 52). Numerous studies have documented that treatment of young SHR, prior to the onset of hypertension, with either ACE inhibitors or type 1 angiotensin II receptor antagonists, prevents the subsequent development of hypertension, even if the antihypertensive agent is subsequently discontinued (36, 37, 40). These observations have been interpreted to indicate an important role for the renin-angiotensin system in the pathogenesis of hypertension in this model. Against this argument is the lack of documentation of any increases in plasma renin activity. However, increased kidney tissue angiotensin has been detected in young SHR (33), suggesting that a local intrarenal renin-angiotensin system may be activated in the young animals.

In rat kidney, angiotensinogen mRNA has been localized to the proximal tubule (32). In addition, renin and angiotensin-converting enzyme have also been identified in the proximal tubule (8). The presence of all components of the renin-angiotensin system in proximal tubule suggests that locally produced ANG II could modulate proximal tubule function. ANG II concentrations in rat proximal tubule lumen have been determined by free-flow micropuncture to be in the range of 10-8 M, compared with concentrations in the range of 10-10 M in systemic plasma (6, 47). Although total kidney ANG II levels are increased in prehypertensive SHR (33), there have not yet been studies examining specifically whether proximal tubule ANG II levels are increased.

SHR have also been shown to exhibit abnormal responsiveness to ambient levels of angiotensin. There are increases in AT1R density in the preglomerular vasculature (11, 27). The increased intrarenal vascular sensitivity to ANG II may also be mediated through increased Gi/Go coupling, since pertussis toxin pretreatment blocked this hypersensitivity (52). In the renal vasculature of SHR, there may in fact be a generalized defect in responsiveness to vasodilators coupled to Gs (3, 12). Thomas et al. (51) measured proximal tubule reabsorption using split-drop reabsorption in micropuncture perfused tubules and found increased proximal tubule volume reabsorption from young SHR compared with WKY rats that was normalized by pretreatment with ACE inhibitors.

Previous studies have also indicated increased ANG II receptor density in kidney, renal cortical brush border, and in glomeruli of young SHR (21, 31, 39, 47). To date, no studies have examined altered expression of AT1R in more distal nephron segments, although there is increasing evidence for an important functional role for ANG II in the distal nephron (35, 55).

In earlier studies, we showed that administration of ACE inhibitors decreased and elevated ANG II increased proximal tubule AT1R expression (16). Therefore, our finding that captopril administration reduced the elevated AT1R expression in proximal tubules of young SHR is consistent with increased intrarenal ANG II levels and/or increased sensitivity to ANG II. In this regard, Wu et al. (57) found that newborn and 7-day-old SHR had increased losartan-sensitive 125I-labeled ANG II binding in membranes made from total kidneys compared with age-matched WKY animals, and treatment of breeding pairs with chronic captopril significantly decreased losartan-sensitive 125I-ANG II binding in kidneys from young SHR but not WKY offspring.

There is also evidence that proximal tubule dopamine receptor function is abnormal in SHR. Although renal dopamine production and proximal tubule dopamine receptor concentration have been reported not to be altered in SHR, functional hyposensitivity of proximal tubule to dopamine is observed, which has been suggested to be secondary to decreased Gs coupling to type 1 dopamine receptors (DA1) (2, 12, 13, 15, 24, 34, 41, 48). The diminished natriuresis in SHR in response to volume expansion has been suggested to be at least partly secondary to this functional defect.

In proximal tubules from normal rats, dopamine counteracts acute functional effects of ANG II at least in part by inhibiting the ANG II-mediated stimulation of Na+/H+ exchange (25, 26), and our previous studies indicated that dopamine can also decrease proximal tubule AT1R expression by Gs-coupled DA1 receptor activated adenosine 3',5'-cyclic monophosphate production (17). The demonstration that chronic administration of high concentrations of L-DOPA led to decreased expression of AT1R in SHR suggests that impaired proximal tubule adenylate cyclase production in young SHR in response to endogenous dopamine may also be a factor in the increased proximal tubule AT1R expression seen in these animals. Yoshimura et al. (60) determined that chronic treatment of 4-wk-old SHR with the peripheral DOPA decarboxylase inhibitor, carbidopa, to decrease endogenous dopamine led to acceleration of hypertension and decreased urinary sodium excretion. Although a previous study found that SHR administered the dopamine receptor agonist, bromocriptine, beginning at the age of 4 wk, were not hypertensive when studied at 12 wk of age (45), no studies have yet determined whether treatment of immature SHR with dopaminergic agonists will lead to sustained prevention of hypertension after cessation of treatment.

There was a distinct trend for both ACE inhibitors and DOPA to decrease AT1R mRNA expression in young WKY, and statistical analysis of intragroup comparisons suggested that both the L-DOPA-treated and captopril-treated WKY animals were significantly different from the untreated WKY rats. However, this statistical significance could not be demonstrated in the more rigorous intergroup comparisons between the SHR and WKY groups. It should also be noted that, although the absolute decreases in AT1R expression in young SHR by captopril or DOPA were greater than that seen in young WKY, the relative decreases were similar. Therefore, whereas a relative imbalance in activity and/or responsiveness of the renin-angiotensin and dopaminergic systems in the proximal tubule may underlie the increased proximal tubule AT1R expression in young SHR, it is also possible that other, as yet undetermined, factors may also mediate these increases in AT1R expression.

We have previously demonstrated that AT1R mRNA is expressed in rat proximal tubule and that specific 125I-ANG II binding to rat brush border and basolateral membranes is inhibited by the AT1R-specific antagonist, losartan (9, 18). In the present studies, we also employed two different anti-peptide antibodies recognizing the extracellular amino-terminal portion of the AT1R, monoclonal antibody 6313/G2, raised against residues 8-17, and a polyclonal antibody raised against residues 15-24. Both antibodies recognized similar immunoreactive proteins in membranes from proximal tubules of SHR and WKY rats (Fig. 5). These antibodies recognized predominant bands in both SHR and WKY proximal tubule membranes at ~70 and 125 kDa and minor bands at ~100 and 85 kDa.

Mammalian AT1R is 359 amino acids and has a predicted molecular mass of ~41 kDa. Earlier studies using photoaffinity labeling (10), crosslinking (42), and anti-idiotypic antibodies (44) indicated apparent molecular masses of angiotensin receptors of 65-68, 116, and 63 kDa, respectively. With the identification of the primary amino acid sequence of AT1R, a number of groups have reported results using anti-peptide antibodies directed against conserved regions of the extracellular amino-terminal region of the receptor. Vinson and co-workers (54) previously reported that the monoclonal antibody 6313/G2, raised against amino acid residues 8-17, recognized immunoreactive proteins of apparent molecular masses of ~60 and 40 kDa in COS-7 cells transfected with the AT1a receptor and an immunoreactive protein of 60-70 kDa in rat adrenal cortex and sperm (4, 54). Using a polyclonal antibody raised against amino acids 14-23, Zelezna et al. (61) determined that the predominant protein recognized in membranes from liver, adrenal, and total kidney was 70 kDa, with a less prominent band at 95 kDa. In contrast, Paxton et al. (43) reported that a polyclonal antibody against amino acids 15-24 recognized a major band of 43 and a minor band of 49 kDa in all rat tissues (including total kidney), as well as minor bands at 64 and 97 kDa in certain tissues. However, unlike the studies of Zelezna, as well as the present studies, protease inhibitors were not utilized during membrane preparation in the studies of Paxton et al. (43), and smaller molecular weight products may represent degradation products (61). Because the mature AT1R is a glycoprotein (59), the present studies suggest that the rat proximal tubule AT1R is highly glycosylated. Whether the different bands recognized in the current studies represent further posttranslational modification of the receptor or cross-reactivity with other proteins has not yet been determined, although the relative density of all of these bands was altered in parallel with the different experimental maneuvers (Fig. 5) and preincubation with the anti-peptide AT antibody blocked all bands. Although we employed reducing conditions for electrophoresis, the possibility of receptor dimerization should be considered, especially given that Capponi and Catt (10) identified two proteins by covalent photoaffinity ANG II binding of apparent molecular masses of 64.5 and 125 kDa, as determined by gel filtration and sucrose gradient centrifugation, and, after SDS-PAGE under reducing conditions, a single band of 65-68 kDa was seen.

In summary, these studies indicate that in young SHR, before the onset of significant hypertension, there was increased expression of type 1 angiotensin II receptor mRNA and immunoreactive protein compared with age-matched WKY rats. In contrast, in adult SHR, no differences in AT1R expression were noted. The increased expression in young SHR was inhibited by either ACE inhibition or exogenous administration of dopamine precursor. These studies are further suggestive evidence that alterations in the renin-angiotensin system may be involved in the pathogenesis of this genetic model of hypertension.

    ACKNOWLEDGEMENTS

This work was supported by funds from the Department of Veterans Affairs and by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-39261.

    FOOTNOTES

Address for reprint requests: R. C. Harris, Division of Nephrology, Vanderbilt Univ. School of Medicine, S-3223 Medical Center North, Nashville, TN 37232.

Received 25 February 1997; accepted in final form 7 August 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Ader, J.-L., T. Tran-Van, and F. Praddaude. Reduced urinary kallikrein activity in rats developing spontaneous hypertension. Am. J. Physiol. 252 (Renal Fluid Electrolyte Physiol. 21): F964-F969, 1987[Abstract/Free Full Text].

2.   Aperia, A. Dopamine action and metabolism in the kidney. Curr. Opin. Nephrol. Hypertens. 3: 39-45, 1994[Medline].

3.   Arendshorst, W. J., C. Chatziantoniou, and F. H. Daniels. Role of angiotensin in the renal vasoconstriction observed during the development of genetic hypertension. Kidney Int. 38: S92-S96, 1990.

4.   Barker, S., W. Marchant, M. M. Ho, J. R. Puddefoot, J. P. Hinson, A. J. L. Clark, and G. P. Vinson. A monoclonal antibody to a conserved sequence in the extracellular domain recognizes the angiotensin ll AT1 receptor in mammalian target tissues. J. Mol. Endocrinol. 11: 241-245, 1993[Abstract/Free Full Text].

5.   Beierwaltes, W. H., W. J. Arrendshorst, and R. F. Klemmer. Electrolyte balance in young spontaneously hypertensive rats. Hypertension 4: 908-915, 1982[Abstract/Free Full Text].

6.   Bradshaw, B., and T. J. Moore. Abnormal regulation of adrenal angiotensin II receptors in spontaneously hypertensive rats. Hypertension 11: 49-54, 1988[Abstract/Free Full Text].

7.   Braam, B., K. D. Mitchel, J. Fox, and L. G. Navar. Proximal tubular secretion of angiotensin II in rats. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F891-F898, 1993[Abstract/Free Full Text].

8.   Burns, K. D., T. Homma, and R. C Harris. The intrarenal renin-angiotensin system. Semin. Nephrol. 13: 13-30, 1993[Medline].

9.   Burns, K. D., T. Inagami, and R. C. Harris. Cloning of a rabbit kidney cortex AT1 angiotensin II receptor that is present in proximal tubule epithelium. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F645-F654, 1993[Abstract/Free Full Text].

10.   Capponi, A. M., and K. J. Catt. Solubilization and characterization of adrenal and uterine angiotensin II receptors after photoaffinity labeling. J. Biol. Chem. 255: 12081-12086, 1980[Abstract/Free Full Text].

11.   Chatziantoniou, C., and W. J. Arendshorst. Angiotensin receptor sites in renal vasculature of rats developing genetic hypertension. Am. J. Physiol. 265 (Renal Fluid Electrolyte Physiol. 34): F853-F862, 1993[Abstract/Free Full Text].

12.   Chatziantoniou, C., X. Ruan, and W. J. Arendshorst. Defective G protein activation of the cAMP pathway in rat kidney during genetic hypertension. Proc. Natl. Acad. Sci. USA 92: 2924-2928, 1995[Abstract/Free Full Text].

13.   Chen, C., R. E. Beach, and M. F. Lokhandwala. Dopamine fails to inhibit renal tubular sodium pump in hypertensive rats. Hypertension 21: 364-372, 1993[Abstract/Free Full Text].

14.   Chen, C. J., S. Apparsundarum, and M. F. Lokhandwala. Intrarenally produced angiotensin II opposes the natriuretic action of the dopamine-1 receptor agonist fenoldopam in rats. J. Pharmacol. Exp. Ther. 256: 486-491, 1991[Abstract/Free Full Text].

15.   Chen, C. J., and M. F. Lokhandwala. An impairment of renal tubular DA-1 receptor function as the causative factor for diminished natriuresis to volume expansion in spontaneously hypertensive rats. Clin. Exp. Hypertens. 14: 615-628, 1992.

16.   Cheng, H.-F., B. N. Becker, K. D. Burns, and R. C. Harris. Angiotensin II regulates its receptor sites in rabbit proximal tubule. J. Clin. Invest. 95: 2012-2019, 1995.

17.   Cheng, H.-F., B. N. Becker, and R. C. Harris. Dopamine decreases expression of type-1 angiotensin ll receptors in renal proximal tubule. J. Clin. Invest. 97: 2745-2752, 1996[Medline].

18.   Cheng, H.-F., K. D. Burns, and R. C. Harris. Reduced proximal tubule angiotensin II receptor expression in experiment diabetes mellitus. Kidney Int. 46: 1603-1610, 1994[Medline].

19.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

20.   Cogan, M. G. Angiotensin II: a powerful controller of sodium transport in the early proximal tubule. Hypertension 15: 451-458, 1990[Abstract/Free Full Text].

21.   Correa, F. M., M. Viswanathan, G. M. Ciuffo, K. Tsutsumi, and J. M. Saavedra. Kidney angiotensin II receptors and converting enzyme in neonatal and adult Wistar-Kyoto and spontaneously hypertensive rats. Peptides 16: 19-24, 1995[Medline].

22.   Dilley, J. R., and W. J. Arendshorst. Enhanced tubuloglomerular feedback activity in rats developing spontaneous hypertension. Am. J. Physiol. 247 (Renal Fluid Electrolyte Physiol. 16): F672-F679, 1984.

23.   Dilley, J. R., C. T. Stier, Jr., and W. J. Arendshorst. Abnormalities in glomerular function in rats developing spontaneous hypertension. Am. J. Physiol. 246 (Renal Fluid Electrolyte Physiol. 15): F12-F20, 1984.

24.   Felder, R. A., S. Kinoshita, A. Sidhu, K. Ohbu, and F. J. Kaskel. A renal dopamine-1 defect in two genetic models of hypertension. Am. J. Hypertens. 3: 96S-99S, 1990[Medline].

25.   Gesek, F. A., and A. C. Schoolwerth. Hormonal interactions with the proximal Na+-H+ exchanger. Am. J. Physiol. 258 (Renal Fluid Electrolyte Physiol. 27): F514-F521, 1990[Abstract/Free Full Text].

26.   Gesek, F. A., and A. C. Schoolwerth. Hormone responses of proximal Na+-H+ exchanger in spontaneously hypertensive rats. Am. J. Physiol. 261 (Renal Fluid Electrolyte Physiol. 30): F526-F536, 1991[Abstract/Free Full Text].

27.   Haddad, G., and R. Garcia. Characterization and hemodynamic implications of renal vascular angiotensin II receptors in SHR. J. Mol. Cell. Cardiol. 28: 351-361, 1996[Medline].

28.  Harrap, S. B., and A. E. Doyle. Renal haemodynamics and total body sodium in immature spontaneously hypertensive and Wistar-Kyoto rats. J. Hypertens. 4, Suppl. 3: S249-S252, 1986.

29.   Harrap, S. B., J. A. Nicolaci, and A. E. Doyle. Persistent effects on blood pressure and renal haemodynamics following chronic angiotensin converting enzyme inhibition with perindopril. Clin. Exp. Pharmacol. Physiol. 13: 753-765, 1986[Medline].

30.   Harris, R. C., and T. O. Daniel. Epidermal growth factor binding, stimulation of phosphorylation and inhibition of gluconeogenesis in rat proximal tubule. J. Cell. Physiol. 139: 383-391, 1989[Medline].

31.   Haws, R. M., P. W. Shaul, B. S. Arant, Jr., B. A. Atiyeh, and M. G. Seikaly. Glomerular losartan (DuP 753)-sensitive angiotensin II receptor density is increased in young spontaneously hypertensive rats. Pediatr. Res. 35: 671-676, 1994[Medline].

32.   Ingelfinger, J. R., W. Min Zuo, E. A. Fon, K. E. Ellison, and V. J. Dzau. In situ hybridization evidence for angiotensinogen messenger RNA in the rat proximal tubule. J. Clin. Invest. 85: 417-423, 1990.

33.   Iwai, N., and T. Inagami. Identification of a candidate gene responsible for the high blood pressure of spontaneously hypertensive rats. J. Hypertens. 10: 1155-1157, 1992[Medline].

34.   Kinoshita, S., A. Sidhu, and R. A. Felder. Defective dopamine-1 receptor adenylate cyclase coupling in the proximal convoluted tubule from the spontaneously hypertensive rat. J. Clin. Invest. 84: 1849-1856, 1989.

35.   Levine, D. Z., M. Iacovitti, S. Buckman, and K. D. Burns. Role of angiotensin II in dietary modulation of rat late distal tubule bicarbonate flux in vivo. J. Clin. Invest. 97: 120-125, 1996[Medline].

36.   Li, P., and E. K. Jackson. Enhanced slow-pressor response to angiotensin II in spontaneously hypertensive rats. J. Pharmacol. Exp. Ther. 251: 909-921, 1989[Abstract/Free Full Text].

37.   Madeddu, P., V. Anania, M. V. Varoni, P. P. Parpaglia, M. P. Demontis, M. C. Fattaccio, D. Palomba, D. Pollock, and N. Glorioso. Prevention by blockade of angiotensin subtype 1-receptors of the development of genetic hypertension but not its heritability. Br. J. Pharmacol. 115: 557-562, 1995[Medline].

38.   Makita, N., N. Iwai, T. Inagami, and K. F. Badr. Two distinct pathways in the down-regulation of type-I angiotensin II receptor gene in rat glomerular mesangial cells. Biochem. Biophys. Res. Commun. 185: 142-146, 1992[Medline].

39.   Matsushima, Y., M. Kawamura, and S. Akabane. Increases in renal angiotensin II content and tubular angiotensin II receptors in prehypertensive spontaneously hypertensive rats. J. Hypertens. 6: 791-796, 1988[Medline].

40.   Morton, J. J., E. C. Beattie, and F. Macpherson. Angiotensin II receptor antagonist losartan has persistent effects on blood pressure in the young spontaneously hypertensive rat: lack of relation to vascular structure. J. Vasc. Res. 29: 264-269, 1992[Medline].

41.   Ohbu, K., and R. A. Felder. Nephron specificity of dopamine receptor-adenylyl cyclase defect in spontaneous hypertension. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F274-F279, 1993[Abstract/Free Full Text].

42.   Paglin, S., and J. D. Jamieson. Covalent crosslinking of angiotensin II to its binding sites in rat adrenal membranes. Proc. Natl. Acad. Sci. USA 79: 3739-3743, 1982[Abstract/Free Full Text].

43.   Paxton, W. G., M. Runge, C. Horaist, C. Cohen, R. W. Alexander, and K. E. Bernstein. Immunohistochemical localization of rat angiotensin II AT1 receptor. Am. J. Physiol. 264 (Renal Fluid Electrolyte Physiol. 33): F989-F995, 1993[Abstract/Free Full Text].

44.   Pfister, J., D. Felix, and H. Imboden. Immunohistochemical demonstration of angiotensin II receptors in rat brain by use of an anti-idiotypic antibody. Regul. Pept. 44: 109-117, 1993[Medline].

45.   Racz, K., O. Kuchel, and N. T. Buu. Bromocriptine decreases blood pressure of spontaneously hypertensive rats without affecting the adrenomedullary synthesis of catecholamines. J. Cardiovasc. Pharmacol. 8: 676-680, 1986[Medline].

46.   Schuster, V. L., J. P. Kokko, and H. R. Jacobson. Angiotensin II directly stimulates sodium transport in rabbit proximal convoluted tubules. J. Clin. Invest. 73: 507-515, 1984.

47.   Seikaly, M. G., B. S. Arant, Jr., and F. D. Seney, Jr. Endogenous angiotensin concentrations in specific intrarenal fluid compartments in the rat. J. Clin. Invest. 86: 1352-1357, 1990.

48.   Sidhu, A., P. Vachvanischsanong, P. A. Jose, and R. A. Felder. Persistent defective coupling of dopamine-1 receptors to G proteins after solubilization from kidney proximal tubules of hypertensive rats. J. Clin. Invest. 89: 789-793, 1992.

49.   Stier, C. T., Jr., H. D. Istkovitz, and Y. H. Chen. Urinary dopamine and sodium excretion in spontaneously hypertensive rats. Clin. Exp. Hypertens. 15: 105-123, 1993.

50.   Thomas, D., P. J. Harris, and T. O. Morgan. Altered responsiveness of proximal tubule fluid reabsorption of peritubular angiotensin II in spontaneously hypertensive rats. J. Hypertens. 8: 407-410, 1990[Medline].

51.   Thomas, D., P. J. Harris, and T. O. Morgan. Age-related changes in angiotensin II-stimulated proximal tubule fluid reabsorption in the spontaneously hypertensive rats. J. Hypertens. 6: S449-S451, 1988.

52.   Vyas, S. J., and E. K. Jackson. Angiotensin II: enhanced renal responsiveness in young genetically hypertensive rats. J. Pharmacol. Exp. Ther. 273: 768-777, 1995[Abstract/Free Full Text].

53.   Vinay, P., A. Gougoux, and G. Lemieux. Isolation of a pure suspension of rat proximal tubules. Am. J. Physiol. 241 (Renal Fluid Electrolyte Physiol. 10): F403-F411, 1981[Abstract/Free Full Text].

54.   Vinson, G. P., J. R. Puddefoot, M. M. Ho, S. Barker, J. Mehta, E. Saridogan, and O. Djahanbakhch. Type 1 angiotensin II receptors in rat and human sperm. J. Endocrinol. 144: 369-378, 1995[Abstract/Free Full Text].

55.   Weiner, I. D., A. R. New, A. E. Milton, and C. C. Tisher. Regulation of luminal alkalinization and acidification in the cortical collecting duct by angiotensin II. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F730-F738, 1995[Abstract/Free Full Text].

56.   Wood, J. M., C. R. Schnell, and N. R. Levens. Kidney is an important target for the antihypertensive action of an angiotensin II receptor antagonist in spontaneously hypertensive rats. Hypertension 21: 1056-1061, 1993[Abstract/Free Full Text].

57.   Wu, J. N., D. Edwards, and K. H. Berecek. Changes in renal angiotensin II receptors in spontaneously hypertensive rats by early treatment with the angiotensin-converting enzyme inhibitor captopril. Hypertension 23: 819-822, 1994[Abstract/Free Full Text].

58.   Xie, M.-H., F.-Y. Liu, P. C. Wong, P. B. M. W. H. Timmermans, and M. G. Cogan. Proximal nephron and renal effects of DuP 753, a nonpeptide angiotensin II antagonist. Kidney Int. 38: 473-479, 1990[Medline].

59.   Yamano, Y., K. Ohyama, S. Chaki, D. Guo, and T. Inagami. Identification of amino acid residues of rat angiotensin II receptor for ligand binding by site directed mutagenesis. Biochem. Biophys. Res. Commun. 187: 1426-1433, 1992[Medline].

60.   Yoshimura, M., S. Kambara, H. Okabayashi, H. Takahashi, and H. Ijichi. Effect of decreased dopamine synthesis on the development of hypertension induced by salt loading in spontaneously hypertensive rats. Clin. Exp. Hypertens. A9: 1141-1157, 1987.

61.   Zelezna, B., E. M. Richards, W. Tang, D. Lu, C. Sumners, and M. K. Raizada. Characterization of a polyclonal anti-peptide antibody to the angiotensin II type-1 (AT1) receptor. Biochem. Biophys. Res. Commun. 183: 781-788, 1992[Medline].


AJP Renal Physiol 274(1):F10-F17
0363-6127/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
L. M. Bivol, R. K. Berge, and B. M. Iversen
Differential effect of tetradecythioacetic acid on the renin-angiotensin system and blood pressure in SHR and 2-kidney, 1-clip hypertension
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F839 - F845.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. H. Siddiqui and T. Hussain
Enhanced AT1 receptor-mediated vasocontractile response to ANG II in endothelium-denuded aorta of obese Zucker rats
Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1722 - H1727.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. Schluter, R. Grimm, A. Steinbach, G. Lorenz, R. Rettig, and O. Grisk
Neonatal sympathectomy reduces NADPH oxidase activity and vascular resistance in spontaneously hypertensive rat kidneys
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2006; 291(2): R391 - R399.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Racasan, B. Braam, H. A. Koomans, and J. A. Joles
Programming blood pressure in adult SHR by shifting perinatal balance of NO and reactive oxygen species toward NO: the inverted Barker phenomenon
Am J Physiol Renal Physiol, April 1, 2005; 288(4): F626 - F636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. E. Magyar, Y. Zhang, N.-H. Holstein-Rathlou, and A. A. McDonough
Proximal tubule Na transporter responses are the same during acute and chronic hypertension
Am J Physiol Renal Physiol, August 1, 2000; 279(2): F358 - F369.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. Zicha and J. Kunes
Ontogenetic Aspects of Hypertension Development: Analysis in the Rat
Physiol Rev, October 1, 1999; 79(4): 1227 - 1282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J.-L. Wang, H.-F. Cheng, M.-Z. Zhang, James. A. McKanna, and R. C. Harris
Selective increase of cyclooxygenase-2 expression in a model of renal ablation
Am J Physiol Renal Physiol, October 1, 1998; 275(4): F613 - F622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online