INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

POSTISCHEMIC RENAL FAILURE is characterized by reduction in glomerular filtration function due to afferent arteriolar vasoconstriction, backleak of glomerular filtrate, and luminal obstruction with cellular debris. Recovery of renal function after reperfusion depends on restoration of glomerular hemodynamics and on cellular proliferation and differentiation, especially in proximal tubule segments, which are particularly susceptible to this form of injury (2, 35). In rat models of renal ischemia, proximal tubular cell proliferation peaks at 48-72 h after reperfusion, followed by a period of hypertrophy, differentiation, and migration of cells to areas of denuded epithelium, ultimately restoring tubular integrity (2, 7, 35). Programmed cell death of tubular epithelial cells may also be involved in the recovery phase. In this regard, enhanced tubular cell apoptosis has been reported in rat kidneys up to 4 mo after ischemic injury (29).

Angiotensin (ANG) II is a potent intrarenal vasoconstrictor and also modulates glomerular filtration rate by exerting direct effects on afferent and efferent arteriolar tone and on mesangial cell function (8). In proximal tubule cells, ANG II stimulates hypertrophy by binding to apical or basolateral receptors (3, 36) and has been shown to augment epidermal growth factor (EGF)-stimulated proximal tubule cell mitogenesis (22). The proximal tubule contains mRNA for all components of the renin-angiotensin system, and high levels of ANG II are present in proximal tubular lumen (10⁹ M) (27). This suggests that ANG II is synthesized locally and can act in an autocrine or paracrine fashion on tubular cells. The intrarenal effects of ANG II on hemodymanics and tubular growth responses are thought to be mediated by AT₁ ANG II receptors. In contrast, the localization and function of AT₂ ANG II receptors in the adult kidney remain unclear. AT₂ receptors are present in abundance in fetal kidney, disappear shortly after birth (28), and are linked to apoptosis in other tissues (38).

The role of the renin-angiotensin system in the recovery phase of renal ischemic injury remains incompletely understood. In the postischemic kidney, enhanced vascular sensitivity to sympathetic nervous stimulation has been reported to be due to intrarenal ANG II (24). In dogs, administration of angiotensin-converting enzyme inhibitors (ACEI) before renal artery clamping is associated with reduced severity of postischemic renal failure (17). In the present studies, we tested the hypotheses that renal ischemia alters expression of components of the intrarenal renin-angiotensin system in rats and that AT₁ receptor-mediated actions of ANG II modify the recovery of renal function. Our results reveal an increase in intrarenal levels of ANG II early after renal ischemia, accompanied by downregulation of cortical angiotensinogen and proximal tubular AT₁ receptor mRNAs, decreased renal cortical and medullary ANG II binding, and preservation of glomerular binding. New expression of AT₂ receptor mRNA occurs in proximal tubules and outer medulla 120 h after reperfusion. We demonstrate that blockade of AT₁ receptors with losartan, administered at the time of reperfusion, decreases serum creatinine levels, with no effect on proliferation of cortical tubular cells.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Animal model and surgery. Male Sprague-Dawley rats (250-350 g) were used for all studies and were housed in the University of Ottawa Animal Care Facility. The protocol used in these studies was approved by the University of Ottawa Animal Care Committee. Rats were anesthetized with somnotol (6.5 mg/kg ip) and were administered a bolus of isotonic saline (20 ml/kg sc). Throughout surgery, all rats were kept at 37°C with a water-circulated heating apparatus (Micro-Temp pump; Seabrook Medical Systems, Cincinnati, OH). All rats underwent surgical exposure of the left and right renal pedicles via midline incision. To induce renal ischemia, both renal pedicles were occluded for 60 min with vascular clamps (no. Ru-2955-10; Ryan Medical Distributor, Oakville, ON, Canada). Sham rats underwent the same procedure, without renal pedicle clamping. After 60 min, the clamps were removed, and kidneys were observed to undergo reperfusion. In some experiments, rats were treated with the AT₁ receptor antagonist losartan (25 mg · kg¹ · day¹ sc) (32), starting at the time of reperfusion. The abdominal muscle layer was closed with an interrupted suture, and the skin layer was closed with a continuous subcutaneous suture. For analgesia, rats received topical lidocaine jelly (2%) to the wound for the first 24 h and one dose of acetaminophen (6.8 mg/kg pr) as deemed necessary by the Animal Care staff. All rats had free access to water and food. At various time points after kidney reperfusion (0, 1, 3, 6, 24, 72, or 120 h), rats were killed, and kidneys were rapidly removed for further analysis. Immediately before being killed, rats underwent intracardiac puncture for collection of blood for assay of blood urea nitrogen (BUN) and serum creatinine (measured by the Ottawa General Hospital Biochemistry Laboratory). In each experiment, each sham rat was paired with a rat undergoing kidney ischemia/reperfusion. Northern analyses and reverse transcription-polymerase chain reaction (RT-PCR) were utilized to compare mRNA expression between sham and ischemic tissue, and histoautoradiography of kidney slices was used for comparison of ANG II binding.

Isolation of proximal tubule segments. Rat proximal tubule segments were isolated by the method of Vinay et al. (33). Briefly, renal cortices were dissected, gently minced, and suspended in a solution containing (in mM) 115 NaCl, 24 NaHCO₃, 5 KCl, 1.5 CaCl₂, 1.0 MgSO₄, 2.0 NaH₂PO₄, 5 glucose, 1.0 alanine, 10 N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (pH 7.4), 0.03% collagenase (type IV; Sigma, St. Louis, MO), and 0.01% soybean trypsin inhibitor (Sigma) (buffer A). The suspension was gassed with 95% O₂-5% CO₂ for 30 min at 37°C. After digestion, the cortical suspension was strained through a 250-µm brass sieve and then centrifuged for 1 min at 100 g. The pellet was resuspended in buffer A without collagenase or trypsin inhibitor and recentrifuged three times at 100 g. The pellet was then applied to a 40% Percoll solution of identical ionic composition as buffer A, which had been previously chilled to 4°C. The Percoll solution was centrifuged at 26,000 g for 30 min at 4°C, and the digested tissue was separated into four distinct bands, as described (33). The F4 layer, enriched in proximal tubular segments, was removed and utilized immediately for RNA isolation. In preliminary studies, proximal tubule suspensions from sham or ischemic rat kidneys demonstrated a high degree of viability, determined by exclusion of trypan blue (>95% of cells).

Northern hybridization. Total RNA was isolated from rat kidney cortex, outer medulla, and freshly isolated proximal tubular segments by homogenization in 4 M guanidinium isothiocyanate, 0.5% N-lauroylsarcosine, and 1% -mercaptoethanol, followed by ultracentrifugation on a 5.7 M CsCl gradient, as described (5). In some experiments, RNA was isolated, using a commercial kit (RNeasy kit; Qiagen, Chatsworth, CA). RNA (5-15 µg) was run on 1% agarose-2.2 M formaldehyde gels and transferred overnight onto nylon membranes (Schleicher and Schuell, Keene, NH), followed by ultraviolet cross-linking (Bio-Rad UV GS Gene Linker; Bio-Rad, Montreal, PQ, Canada). Membranes were hybridized with probes for a 1-kb Acc 1 fragment of the rat angiotensinogen cDNA [kindly provided by Dr. K. R. Lynch, Univ. of Virginia (18)] or the 1.2-kb Sac I-Kpn I cDNA encoding the rat AT_{1 A} ANG II receptor [kindly provided by Dr. T. Inagami, Vanderbilt Univ. (10)], labeled with [³²P]dCTP (3,000 Ci/mmol; Amersham, Mississauga, ON) by the random primer method (Multiprime DNA labeling system, Amersham). Hybridization was performed overnight at 42°C in a solution of 30% formamide, 5× SSC (1× SSC: 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 5× Denhardt's, 50 mM sodium phosphate (pH 7.0), 0.1% sodium dodecyl sulfate (SDS), 100 µg/l denatured salmon sperm DNA, 10% dextran sulfate, and [³²P]dCTP-labeled probe (sp act 0.5-1.5 × 10⁹ counts · min¹ · µg¹). The membranes were washed at low stringency (2× SSC, 0.1% SDS) for 40 min at 23°C and then at high stringency (0.2× SSC, 0.1% SDS) for 25 min at 65°C. Membranes were then exposed for 16 h at 70°C to Kodak X-OMAT film, with two Cronex intensifiers (Sigma).

RT-PCR. The mRNA for the rat AT₂ receptor was assayed by RT-PCR. After deoxyribonuclease digestion, samples of total RNA (1 µg) from outer medullas or proximal tubular segments were reverse transcribed, utilizing random hexamers and murine leukemia virus reverse transcriptase (Gene Amp kit; Perkin-Elmer, Roche Molecular Systems, Branchburg, NJ), in a total volume of 20 µl. After RT, the cDNA mixture was amplified by PCR, using AmpliTaq DNA polymerase (2.5 U) (all reagents from Perkin-Elmer) and 0.5 µM of oligonucleotide primers derived from the cDNA sequence of the rat AT₂ receptor (11) in a total volume of 100 µl. The upstream sense primer was 5' TGAGTCCGCATTTAACTGC 3', and the downstream antisense primer was 5' ACCACTGAGCATATTTCTCAGG 3', generating a 536-base pair (bp) product, representing nucleotides 226-761 of the rat AT₂ receptor cDNA (11). PCR was carried out in a Perkin-Elmer Gene Amp 2400 PCR system by denaturing at 94°C for 30 s, annealing at 60°C for 30 s, and extending at 72°C for 45 s, for 40 cycles. RT-PCR products were run on 3% agarose gels and were directly visualized by ethidium bromide staining. All RT-PCR reactions included negative controls in which RNA samples were incubated in the absence of reverse transcriptase to rule out amplification of genomic DNA. The 536-bp AT₂ receptor RT-PCR product from rat kidney was subcloned into the plasmid pCR-Script SK(+) (Stratagene, La Jolla, CA) and partially sequenced by the dideoxy termination method (Sequenase version 2.0 DNA sequencing kit, Amersham). The AT₂ receptor cDNA product had 100% homology to the reported sequence of the rat AT₂ receptor in the region of interest (11).

Histoautoradiography. Histoautoradiography of ANG II binding was determined on sham and ischemic rat kidneys, using ¹²⁵I-labeled [Sar¹,Ile⁸]ANG II (sp act 2,000 Ci/mmol, Amersham), essentially as described (20). Immediately after rats were killed, kidneys were perfused with phosphate-buffered saline (PBS; 0.9% NaCl in 10 mM sodium phosphate buffer, pH 7.4) via intracardiac puncture, removed, and rapidly preserved on dry ice. Kidneys were cut into 20-µm sagittal sections and thaw mounted on glass microscope slides. After drying overnight in a desiccator under reduced pressure at 4°C, tissue sections were preincubated in an isotonic solution consisting of (in mM) 150 NaCl, 5 disodium EDTA, 0.3 bacitracin, and 0.2% bovine serum albumin (BSA; fraction V; Sigma) for 15 min at 23°C, followed by a 60-min incubation in an identical solution with addition of 100 pM ¹²⁵I-labeled [Sar¹,Ile⁸]ANG II. Tissue sections were then washed four times for 1 min each in ice-cold 50 mM tris(hydroxymethyl)aminomethane buffer (pH 7.4), dried under warm air, and then exposed to Hyperfilm enhanced chemiluminescence (Amersham) at 70°C for 24-48 h. The film was developed with Kodak developer D-19 and fixed with Kodak rapid fixer (Sigma). In preliminary experiments, preincubation of kidney slices with an excess of unlabeled ANG II (10⁶ M) completely displaced radiolabeled ANG II binding, confirming specificity of receptor binding.

Immunocytochemistry. Localization of cortical tubular nuclei staining for proliferating cell nuclear antigen (PCNA) was performed on postischemic kidney sections from rats treated with or without losartan. Briefly, 5- to 6-mm kidney sections were fixed in 4% paraformaldehyde in 0.1 M sodium phosphate buffer (pH 7.4) for 4 h. Tissue sections were then rinsed in PBS and stored in 0.6 M sucrose in 0.1 M sodium phosphate buffer. Tissue was frozen on dry ice and cut into 8- µm sections with a cryotome, and sections were thaw mounted on slides. For PCNA staining, slides were incubated in PBS with 1% SDS for 5 min, followed by a 10-min wash in PBS and a 20-min incubation in PBS with 1% BSA. Slides were then incubated with mouse monoclonal antibody to PCNA (Dako clone PC10, lot 016; Cedarlane Laboratories, Hornby, ON) at 1:10 dilution in PBS with 1% BSA for 60 min at room temperature. This was followed by three washes in PBS. Slides were then incubated with secondary antibody, goat anti-mouse immunoglobulin G2a gamma (Caltag Laboratories, San Francisco, CA) coupled to fluorescein isothiocyanate (1:20 dilution), in PBS with 1% BSA for 60 min at room temperature, followed by three washes in PBS. To stain all nuclei, slides were also incubated for 1 min with 5 µg/ml of the dye Hoechst 33258 (Aldrich, Milwaukee, WI) before mounting. Sections were examined with a Zeiss Axioplan Universal microscope equipped for epifluorescence. To quantify PCNA staining, the number of Hoechst-positive nuclei that stained positively for PCNA was counted in 30 cortical tubules/section by an observer blinded to the experimental protocols. Results are expressed as percentage of PCNA-positive nuclei per kidney.

Assay of intrarenal ANG II. Intrarenal levels of ANG II were measured in ischemic and sham rat kidneys at 24 and 120 h after reperfusion by high-performance liquid chromatography (HPLC) and radioimmunoassay, using the method of Ruzicka et al. (26). Briefly, kidneys were perfused in situ with PBS to remove blood, via intracardiac injection, and then removed and snap frozen in liquid nitrogen. Snap-frozen kidneys were weighed, minced, and then boiled for 20 min in 1 M acetic acid. Tissue was then homogenized for 1 min, using a hand-held homogenizer (Tissue Tearor; Biospec Products, Racine, WI), and centrifuged at 10,000 g for 10 min at 4°C. The aqueous phase was removed and passed through a C₁₈ Sep-Pak cartridge (Waters, Milford, MA) that had been preconditioned with 10 ml of deionized distilled water and 10 ml 100% methanol, followed by 10 ml deionized distilled water, at a rate of 5 ml/min. The sample was applied to the cartridge at a rate of 1 ml/min, followed by rinsing with 5 ml of 0.1% acetic acid, and eluted in 6 ml of 4% acetic acid in ethanol at a rate of 1 ml/min. Eluants were dried in a Speed Vac concentrator for further analysis. HPLC separation of ANG II was kindly performed by the laboratory of Dr. F. Leenen (Univ. of Ottawa), according to published protocol (26). After HPLC, ANG II levels were measured in the eluants by radioimmunoassay, utilizing a commercial kit (Amersham) that employs ¹²⁵I-ANG II and rabbit antiserum to ANG II. Standard curves were prepared, using [Asn¹,Val⁵]ANG II (Sigma) as substrate. Results are expressed as femtomoles ANG II per gram kidney.

Densitometry of Northern blots and histoautoradiographs. Northern blots and histoautoradiographs were analyzed, using a computer-based image analysis software program (Image 1.47). In preliminary experiments, densitometry of autoradiographs of Northern blots revealed that signal intensity for the AT₁ receptor was linear for RNA concentrations between 3 and 18 µg. For Northern blots, signal intensities were quantitated and are expressed as relative intensity of ischemic kidney to sham kidney signals. For histoautoradiographs, the images of kidney cortical and outer medullary regions were captured and outlined, and the mean signal density was recorded. Results are expressed as mean density of ¹²⁵I-[Sar¹,Ile⁸]ANG II binding (ischemic kidney/sham kidney).

Statistics. Results are expressed as means ± SE. The Z score test, which uses a standardized normal distribution, was used to analyze data from Northern analyses and histoautoradiography. The Student's t-test (unpaired) was used for single comparisons. Significance was assigned at P < 0.05.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

Demonstration of acute renal failure with renal ischemia/reperfusion. In rats with renal ischemia/reperfusion injury, both serum creatinine concentration and BUN increased significantly, peaking 72 h after reperfusion and returning to levels not different from those in sham rats at 120 h (Fig. 1). In renal histological sections from rats with ischemia/reperfusion, extensive tubular necrosis was evident after 24 h, with preservation of glomerular morphology (not shown). At 120 h after reperfusion, kidney sections revealed intact tubules with flattened epithelium and papillary fronds extending into tubular lumens, representing proliferation of tubular epithelial cells, as previously described (1, 29). Apoptotic bodies were also present within tubules (Fig. 2). Together, these data indicate that our model induced extensive acute tubular necrosis, with recovery of filtration function by 120 h, consistent with other studies on rat renal ischemia/reperfusion injury (1).

View larger version (13K): [in this window] [in a new window]   View larger version (12K): [in this window] [in a new window]   Fig. 1.   Effect of renal ischemia/reperfusion on serum creatinine (A) and blood urea nitrogen (BUN; B) in rats. Values of serum creatinine and BUN from rats with renal ischemia were significantly elevated above sham values, starting at 6 h after reperfusion and continuing through 72 h. At 120 h, serum creatinine and BUN did not significantly differ between the 2 groups. Values represent means ± SE. , Shams; , ischemia/reperfusion.

View larger version (131K): [in this window] [in a new window]   Fig. 2.   Papillary proliferation and apoptosis in renal cortex 120 h after reperfusion. A representative black and white photomicrograph of 20 µm toluidine blue-stained rat kidney section 120 h after ischemia/reperfusion is shown. Arrow, papillary frond extending into lumen of tubule; arrowhead, apoptotic body. Magnification, ×280.

Intrarenal ANG II levels. ANG II levels were measured in sham and postischemic kidneys 24 and 120 h after reperfusion. As shown in Fig. 3, intrarenal ANG II levels were significantly increased 24 h after reperfusion (sham: 102 ± 67 vs. ischemic: 529 ± 119 fmol/g; P < 0.025, n = 4) but did not differ from levels in sham kidneys after 120 h [sham: 143 ± 40 vs. ischemic: 90 ± 26 fmol/g; P = not significant (NS), n = 6]. Intrarenal ANG II levels in sham kidneys were comparable to those previously reported in adult rat kidney (39).

View larger version (24K): [in this window] [in a new window]   Fig. 3.   Intrarenal ANG II levels 24 and 120 h after ischemia/reperfusion. ANG II was measured by high-performance liquid chromatography and radioimmunoassay as described in METHODS. Results are means ± SE; n = 4 for 24 h and n = 6 for 120 h. * P < 0.025 vs. sham at 24 h.

Expression of angiotensinogen and AT₁ receptor mRNAs in the postischemic kidney. To characterize further the effect of renal ischemia/reperfusion on the intrarenal renin-angiotensin system, renal angiotensinogen mRNA expression was studied by Northern blot analysis of renal cortical total RNA. As depicted in Fig. 4, in ischemic renal cortex at 6, 24, and 72 h after reperfusion, angiotensinogen mRNA was markedly decreased [angiotensinogen mRNA intensity (ischemic/sham) at 6 h: 0.42 ± 0.14, P < 0.04 vs. sham, n = 4; 24 h: 0.01 ± 0.01, P < 0.001 vs. sham, n = 5; 72 h: 0.02 ± 0.01, P < 0.001 vs. sham, n = 4]. Renal angiotensinogen gene expression recovered at 120 h after reperfusion, relative to sham rats [mRNA intensity (ischemic/sham): 0.82 ± 0.15, P = NS, n = 5].

View larger version (15K): [in this window] [in a new window]   View larger version (66K): [in this window] [in a new window]   Fig. 4.   Renal ischemia/reperfusion decreases renal cortical angiotensinogen mRNA. A: bar graph depicting effect of ischemia/reperfusion on angiotensinogen mRNA intensity at various times after reperfusion. Results are means ± SE. Values in parentheses are numbers of separate experiments. * P < 0.02, ** P < 0.001 vs. sham. B: representative Northern blots at 24 and 120 h after reperfusion. The 1.9-kb angiotensinogen mRNA is shown. Beneath each blot are photographs of ethidium bromide-stained gels for corresponding RNA samples depicting 28S and 18S rRNA subunits and indicating equality of RNA loading for paired experiments. Lanes 1 and 2, sham (24 h); lanes 3 and 4, renal ischemia (24 h after reperfusion) (lanes 1 and 3 and lanes 2 and 4 are from paired experiments); lane 5, sham (120 h); lane 6, renal ischemia (120 h after reperfusion).

View larger version (49K): [in this window] [in a new window]   View larger version (49K): [in this window] [in a new window]   Fig. 5.   Effect of ischemia/reperfusion on renal cortical AT1 ANG II receptor mRNA. A: bar graph depicting effect of ischemia/reperfusion on AT1 mRNA isolated from total cortex at various times after reperfusion, determined by Northern blots. Results are means ± SE. Values in parentheses indicate numbers of separate experiments. There was no significant difference in cortical AT1 mRNA between sham and ischemic kidneys at any time point. B: representative Northern blots for 2.3-kb AT1 receptor mRNA in kidney cortex at 24 and 120 h after reperfusion. Beneath each blot are photographs of ethidium bromide-stained gels for corresponding RNA samples, depicting 28S and 18S rRNA subunits and indicating equality of RNA loading for paired experiments. Lane 1, sham (24 h); lane 2, renal ischemia (24 h after reperfusion); lane 3, sham (120 h); lane 4, renal ischemia (120 h after reperfusion).

View larger version (15K): [in this window] [in a new window]   View larger version (48K): [in this window] [in a new window]   Fig. 6.   Ischemia/reperfusion decreases proximal tubular AT1 receptor mRNA. A: bar graph depicting effect of ischemia/reperfusion on AT1 receptor mRNA in rat proximal tubules, determined by Northern analysis. Results are means ± SE. Values in parentheses are numbers of separate experiments. * P < 0.03, ** P < 0.001 vs. shams. B: representative Northern blots for AT1 receptor in proximal tubule at 24 and 120 h after reperfusion. Beneath each blot are photographs of ethidium bromide-stained gels for corresponding RNA samples depicting 28S and 18S rRNA subunits and indicating equality of RNA loading for paired experiments. Lane 1, sham (24 h); lane 2, renal ischemia (24 h after reperfusion); lane 3, sham (24 h); lane 4, renal ischemia (24 h after reperfusion); lane 5, sham (120 h); lane 6, renal ischemia (120 h after reperfusion); lane 7, sham (120 h); lane 8, renal ischemia (120 h after reperfusion).

View larger version (55K): [in this window] [in a new window]   Fig. 7.   Reverse transcription-polymerase chain reaction (RT-PCR) of AT1A and AT1B receptor mRNA in proximal tubule at 120 h. Left: ethidium bromide-stained agarose gel depicting amplification of AT1A receptor mRNA from sham and postischemic proximal tubules by RT-PCR (top). Amplification of -actin mRNA is depicted (bottom). Lane 1, sham (120 h) + RT; lane 2, sham (120 h) without RT; lane 3, renal ischemia (120 h after reperfusion) + RT; lane 4, renal ischemia (120 h after reperfusion) without RT. Similar results were obtained in 2 additional separate experiments (see RESULTS for data analysis). Right: ethidium bromide-stained agarose gel depicting amplification of AT1B mRNA [204 base pairs (bp)] from sham and postischemic proximal tubule segments by RT-PCR (top). Amplification of -actin mRNA is depicted (bottom). Lane 5, sham (120 h) + RT; lane 6, sham (120 h) without RT; lane 7, renal ischemia (120 h after reperfusion) + RT; lane 8, renal ischemia (120 h after reperfusion) without RT. Similar results were obtained in 2 additional separate experiments (see RESULTS for analysis).

Effect of renal ischemia/reperfusion on AT₂ receptor mRNA expression. To determine whether renal ischemia/reperfusion injury affected expression of AT₂ receptor mRNA, RT-PCR was utilized to amplify a 536-bp AT₂ receptor cDNA product. In preliminary experiments, RT-PCR of total RNA isolated from normal rat kidney cortex generated faint cDNA bands for the AT₂ receptor product on ethidium bromide-stained gels in two of six separate experiments. In proximal tubules from sham rats and in rats with renal ischemia/reperfusion injury, no AT₂ receptor mRNA was detected by RT-PCR at 0 or 72 h after reperfusion. At 120 h, however, AT₂ receptor cDNA was consistently amplified from ischemic proximal tubular segments and not from sham rats (Fig. 8).

View larger version (23K): [in this window] [in a new window]   Fig. 8.   Renal ischemia/reperfusion stimulates proximal tubular AT2 mRNA expression. RT-PCR for AT2 receptor cDNA (536-bp product) was performed on RNA isolated from proximal tubules in sham rats and in rats 120 h after reperfusion. Top: ethidium bromide-stained agarose gel depicting results from 4 separate experiments. Bottom: amplification of corresponding -actin mRNA. Lane 1, 100-bp DNA ladder; lanes 2-5, sham (120 h) + RT; lanes 6-9, renal ischemia (120 h after reperfusion) + RT; lanes 10-13, sham (120 h) without RT; lanes 14-17, renal ischemia (120 h after reperfusion) without RT. Identical results were obtained in 1 additional experiment (not shown).

View larger version (30K): [in this window] [in a new window]   Fig. 9.   Renal ischemia/reperfusion stimulates AT2 receptor mRNA in outer medulla. RT-PCR for AT2 receptor cDNA (536-bp product) was performed on RNA isolated from outer medulla in sham rats and in rats 120 h after reperfusion. Top: ethidium bromide-stained gel depicting results from 3 separate experiments. Bottom: amplification of -actin mRNA. Lane 1, 100-bp DNA ladder; lanes 2-4, sham (120 h) + RT; lanes 5-7, renal ischemia (120 h after reperfusion) + RT; lanes 8-10, sham (120 h) without RT; lanes 11-13, renal ischemia (120 h after reperfusion) without RT. Similar results were obtained in 1 additional experiment (not shown).

Histoautoradiographic studies. To determine the effect of renal ischemia/reperfusion on ANG II binding sites, histoautoradiography was performed on rat kidney slices, using ¹²⁵I-[Sar¹,Ile⁸ ]ANG II. Image analysis of histoautoradiographs revealed that ischemia/reperfusion caused a significant decrease in total renal cortical binding 24 h after reperfusion, with no significant difference in binding between sham and ischemic kidneys at 0, 3, or 120 h after reperfusion [Fig. 10A; cortical image density (ischemic/sham) at 24 h: 0.48 ± 0.06, P < 0.001 vs. sham, n = 4]. Examination of histoautoradiographs revealed preservation of glomerular ANG II binding at all reperfusion times, with reduction in cortical binding in periglomerular areas 24 h after reperfusion (Fig. 10B). In outer medulla, renal ischemia/reperfusion was associated with significant reduction in ANG II binding at 3 and 24 h after reperfusion but not at 0 or 120 h [Fig. 11; outer medulla image density (ischemic/sham) at 3 h: 0.49 ± 0.10, P < 0.02 vs. sham, n = 5; 24 h: 0.35 ± 0.07, P < 0.001 vs. sham, n = 4].

View larger version (14K): [in this window] [in a new window]   View larger version (87K): [in this window] [in a new window]   Fig. 10.   A: bar graph showing cortical density of 125I-labeled [Sar1,Ile8]ANG II binding at various reperfusion times compared with cortical binding in sham rats. Results are means ± SE. Values in parentheses are numbers of separate experiments. * P < 0.001 vs. sham. B: representative histoautoradiograph of sham and ischemic kidney slices 24 h after reperfusion. Cortical and outer medullary ANG II binding densities are reduced after reperfusion, with preservation of glomerular binding (intense black dots in cortex).

View larger version (14K): [in this window] [in a new window]   Fig. 11.   Histoautoradiography of ANG II binding in outer medulla. Bar graph shows density of 125I-[Sar1,Ile8]ANG II binding in outer medulla at various reperfusion times compared with outer medullary binding in sham rats. Results are means ± SE. Values in parentheses are numbers of separate experiments. * P < 0.02, ** P < 0.001 vs. sham.

5

5

Effect of losartan on PCNA expression and renal functional recovery. The data demonstrating an increase in intrarenal ANG II levels early after reperfusion, associated with reduction in proximal tubular AT₁ receptor mRNA expression and preservation of glomerular AT₁ binding, suggested that AT₁ receptor activation might be involved in the pathophysiology of acute renal failure in this model. Accordingly, studies were performed to determine the effect of AT₁ receptor blockade on tubular cell proliferation and on recovery of renal function after ischemic injury. Treatment of rats with losartan (25 mg/kg sc daily), starting at the time of reperfusion, had no effect on the percentage of cortical tubular cells expressing PCNA 24 and 72 h after reperfusion (Fig. 12; 24 h ischemic: 15.5 ± 1.6% vs. ischemic + losartan: 14.9 ± 2.2%, P = NS, n = 3; 72 h ischemic: 16.5 ± 2.9% vs. ischemic + losartan: 21.3 ± 3.0%, P = NS, n = 6). In contrast, although treatment with losartan had no effect on serum creatinine values 24 h after reperfusion (Fig. 13; ischemic: 253 ± 33 µM vs. ischemic + losartan: 263 ± 27 µM, P = NS, n = 8), it caused a significant decrease in serum creatinine values at 72 h (ischemic: 334 ± 69 µM vs. ischemic + losartan: 135 ± 28 µM, P < 0.025, n = 6).

View larger version (34K): [in this window] [in a new window]   Fig. 12.   Effect of losartan on cortical tubular expression of proliferating cell nuclear antigen (PCNA) at 24 and 72 h after reperfusion. Rats were treated without (ischemia) or with losartan (25 mg/kg sc daily; ischemia + losartan), starting at time of reperfusion, and kidneys were harvested for immunocytochemistry as described in METHODS. Results are percentages of nuclei staining for PCNA, expressed as means ± SE; n = 3 for 24 h and n = 6 for 72 h.

View larger version (29K): [in this window] [in a new window]   Fig. 13.   Losartan causes a reduction in serum creatinine levels 72 h after reperfusion. Rats were treated without (ischemia) or with losartan (25 mg/kg sc daily; ischemia + losartan), starting at time of reperfusion. At indicated times, rats were killed, and blood was collected for measurement of serum creatinine. Results are means ± SE; n = 8 for 24 h and n = 6 for 72 h. * P < 0.025 vs. ischemia at 72 h.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

ANG II regulates intrarenal blood flow and stimulates renal tubular cell growth. The purpose of the present studies was to examine the effect of renal ischemia/reperfusion on expression of the intrarenal renin-angiotensin system and to determine the role of AT₁ receptors in the early postischemic phase in this model.

Effect of renal ischemia on angiotensinogen mRNA and intrarenal ANG II. In rats with 40 min of renal artery occlusion, Rosenberg and Paller (25) determined that renal renin mRNA was undetectable 1 h after reperfusion but returned to normal levels at 24 and 48 h. Preliminary studies by Kim et al. (13) utilizing this model demonstrated marked suppression of renal renin gene expression 1 h after reperfusion, with only 50% recovery at 72 h. Plasma renin activity, in contrast, increases early after ischemic renal injury in humans (16). In the present studies, angiotensinogen mRNA was profoundly decreased in renal cortices up to 120 h after reperfusion, yet intrarenal ANG II levels were elevated at 24 h. Together, these data are consistent with the hypothesis that preformed substrate components of the renin-angiotensin system may be released early after ischemia, causing enhanced local ANG II production. It is also possible that ischemic injury causes release of preformed ANG II from proximal tubular cells, thought to be sources of ANG II production (27), or that other peptidases may be activated that are capable of cleaving released substrates, generating ANG II locally. This might explain why ACEI have variable effects on recovery after renal ischemic injury in dog and rat models (15, 17), whereas we observed that direct blockade of AT₁ receptors caused a significant reduction in serum creatinine levels at 72 h after reperfusion.

Effect of renal ischemia on intrarenal AT₁ receptors. Our data are consistent with the hypothesis that tubular responsiveness to ANG II is diminished in the early postreperfusion period. Both proximal tubular AT₁ receptor mRNA and renal cortical and outer medullary ANG II binding were decreased early after reflow. Interestingly, Northern analysis of RNA from total cortex did not demonstrate differences in AT₁ mRNA, although cortical binding was diminished by densitometry. In contrast, histoautoradiographs revealed complete preservation of glomerular ANG II binding at all reperfusion times. This suggests that regulatory mechanisms for AT₁ receptor mRNA differ between glomeruli and tubular cells. Indeed, our previous studies demonstrated that, whereas glomerular ANG II receptors are downregulated by elevated levels of ANG II, proximal tubular AT₁ receptors are upregulated by ANG II (4). Our present data, however, suggest that this mechanism is not responsible for the differences in AT₁ receptor mRNA and ANG II binding, since intrarenal ANG II levels were elevated 24 h after reperfusion, a time at which proximal tubular AT₁ mRNA is decreased and glomerular binding is preserved.

Effect of losartan on tubular cell proliferation. ANG II has been shown to promote mitogenesis in proximal tubular cells in the presence of EGF (22) and to stimulate DNA synthesis in thick ascending limb cells (37). Our results, however, are consistent with the hypothesis that AT₁ receptor activation does not contribute to enhanced tubular cell proliferation in the early phase after ischemia/reperfusion injury. Proximal tubular AT₁ mRNA was downregulated up to 72 h after reperfusion. Expression of a nuclear marker for proliferation (PCNA) in cortical tubules was unaffected by treatment of rats with losartan at 24 and 72 h after reperfusion, times when tubular cell mitosis is increased after ischemic injury (7, 35). The percentage of PCNA-positive tubular cells in renal cortex in our study (14.9-21.3%) is consistent with values reported in rats with unilateral renal artery occlusion for 40 min (35). Our data do not exclude the possibility, however, that AT₁ receptors may affect proliferation in specific segments such as the S3 segment of proximal tubule in the cortex or the outer stripe of the outer medulla.

Effect of losartan on serum creatinine. Our results reveal that daily losartan treatment caused a significant reduction in serum creatinine levels at 72 h after reperfusion. We selected both the 24- and 72-h time points for analysis, as our earlier studies revealed significant elevations of serum creatinine at these times (Fig. 1), signifying impaired glomerular filtration rate. As discussed above, this effect of losartan was unlikely to be due to modulation of tubular cell proliferation. Rather, we speculate that AT₁ receptor blockade has beneficial effects on intrarenal hemodynamics. Postischemic acute renal failure is associated with an increase in afferent arteriolar tone, at least partly due to impaired autoregulation (12), enhanced sensitivity to sympathetic nervous stimulation and local ANG II (24), and activation of tubuloglomerular feedback (31). Increased afferent arteriolar resistance results in reduction in glomerular perfusion pressure and contributes to filtration failure. Because we observed increased intrarenal levels of ANG II at 24 h after reperfusion, associated with preservation of glomerular ANG II binding by histoautoradiography, it is possible that the protective effect of losartan is due to reduction in afferent arteriolar tone and improved filtration.

AT₂ receptors in the postischemic kidney. A significant finding in the present studies is that new expression of AT₂ receptor mRNA occurs in proximal tubules and outer medulla in the postischemic kidney. AT₂ receptor mRNA was detected inconsistently in renal cortex from sham rats and at low levels in outer medulla. It is possible that S3 segments of proximal tubules are the source of AT₂ receptor mRNA in the postischemic outer medulla, since these segments are extensively injured in this model (35). Although we could not demonstrate AT₂ binding sites by histoautoradiography, this method may not be sensitive enough to detect AT₂ receptor protein on tubular cells. Previous studies revealed that AT₂ receptors are abundant in fetal kidney and that expression decreases rapidly after birth (28). The function of intrarenal AT₂ receptors remains unclear. Activation of AT₂ receptors has been linked to apoptosis in other cell types (38). The possible role of induction of AT₂ receptor mRNA in the postischemic kidney in mediating tubular cell apoptosis is unknown, although it is of interest that apoptosis is present in rat kidneys up to 4 mo after ischemic injury (29). Increased AT₂ receptor mRNA has been reported in the infarcted rat heart after 7 days (21) and in rat skin wounds after 3 days (34), suggesting involvement in remodeling. Because the intermediate filament protein vimentin, present in mesenchymal cells but not epithelial cells, is expressed in proximal tubule after ischemic injury (35), new expression of AT₂ receptor mRNA in proximal tubule may also signify dedifferentiation and recapitulation of developmental stages.