|
|
||||||||
Department of Physiology, Dartmouth Medical School, Lebanon, New Hampshire 03756
| |
ABSTRACT |
|---|
|
|
|---|
AE2 mRNA and protein is expressed in several
nephron segments, one of which is the cortical collecting duct (CCD).
However, the distribution of AE2 among the different cell types of the CCD and the function of AE2 in the kidney are not known. The purpose of
this study was to determine the distribution of AE2 mRNA among the
three CCD cell types and to examine the effects of changes in acid/base
balance on its expression. Following
NH4Cl (acid) or
NaHCO3 (base) loading of rabbits
for ~18 h, CCD cells were isolated by immunodissection. AE2 mRNA
levels were determined by RT-PCR and were normalized for
-actin
levels. We found that CCD cells express high levels of AE2 mRNA (~500
copies/cell). AE2 mRNA levels were significantly higher in CCD cells
originating from base-loaded than acid-loaded rabbits, with an average
increase of 3.7 ± 1.07-fold. The effect of pH on AE2 mRNA levels
was also tested directly using primary cultures of CCD cells. CCD cells incubated in acidic media expressed significantly lower levels of AE2
mRNA than those in normal or alkaline media. Experiments with isolated
principal cells,
-intercalated cells, and
-intercalated cells
(separated by fluorescence-activated cell sorting) demonstrated that
AE2 mRNA levels are comparable in the three collecting duct cell
subtypes and are similarly regulated by changes in acid/base balance.
Based on these results, we conclude that adaptation to changes in
extracellular H+ concentration is
accompanied by opposite changes in AE2 mRNA expression. The
observations that AE2 mRNA is not expressed in a cell-type-specific
manner and that changes in acid/base balance have similar effects on
each CCD cell subtype suggest that AE2 might serve a housekeeping
function rather than being the apical anion exchanger of
-intercalated cells.
anion exchanger; chloride/bicarbonate transport; intercalated cells; principal cells; reverse transcription-polymerase chain reaction
| |
INTRODUCTION |
|---|
|
|
|---|
THE CORTICAL COLLECTING duct (CCD) of the kidney
contains at least two types of intercalated cells that transport
HCO3 in opposite directions.
HCO3 reabsorption takes place in
the
-type intercalated cells, which express a
Cl/HCO3 exchanger on the
basolateral membrane (for review, see Ref. 20). This exchanger is the
product of the anion exchanger 1 (AE1) or band 3 gene. There is strong functional evidence indicating that
HCO3 secretion occurs in the
-intercalated cells, via a
Cl/HCO3 exchanger located in the
apical membrane (22), but the molecular identity of this exchanger remains to be established. Both the basolateral and the apical Cl/HCO3 exchangers are regulated
by acid/base balance. The expression of AE1 mRNA and protein is
upregulated in acidosis (8, 13, 18), and functional studies indicate
that the activity of the apical exchanger in
-intercalated cell is
downregulated by acidosis (22).
Recently, it was reported that AE2 mRNA and protein is present along
the entire collecting duct system (4); however, its distribution among
the different cell types of the collecting duct and its role in
acid/base homeostasis are unknown. Several lines of indirect evidence
raise the possibility that the apical exchanger of
-intercalated
cells might be a product of the AE2 gene. First, previous studies
suggest that the inhibitor sensitivity and the kinetic properties of
the apical Cl/HCO3 exchanger are somewhat similar to those of AE2 (1, 15). In addition, AE2 is present
in the apical membrane in another
HCO3-secreting epithelium, i.e.,
the rabbit ileum (7). If indeed AE2 would function as the apical
Cl/HCO3 exchanger of
-intercalated cells, then one would expect AE2 expression to be high
in these cells and to be upregulated in alkalosis to facilitate
stimulated HCO3 secretion. To test
these hypotheses, we examined the effects of in vivo acid load or
alkali load on AE2 mRNA expression in CCD cells and the distribution of
AE2 mRNA among the three cell types of the collecting duct. We also
tested the direct effects of changes in medium pH on AE2 expression in
cultured CCD cells. Our results show that AE2 mRNA expression in CCD
cells is significantly lower following acid load than alkali load both
in vivo and in vitro, and this phenomenon can be observed in all three
CCD cell subtypes.
| |
METHODS |
|---|
|
|
|---|
Animals. Male New Zealand White rabbits, weighing 1.5-2.0 kg, were used. The animals were kept on standard diet and had access to water ad libitum. Alkali load was performed by intravenous infusion of 15 mmol/kg of NaHCO3, 16-20 h before death. Metabolic acidosis was achieved by an intragastric load of 15 mmol/kg of NH4Cl. To keep the amount of Na+ load in the two groups constant, this latter group also received 15 mmol/kg NaCl iv. For the last 12 h before the experiments, the rabbits were on restricted food intake (3 oz). Urine samples were taken from the bladder immediately before death for the determination of urinary pH. Plasma pH, PCO2, and HCO3 levels were measured using an automated blood-gas analyzer.
Cell isolation. CCD cells were
isolated from the renal cortex by solid-phase immunoadsorption, using a
monoclonal antibody against an ectoantigen on these cells, as described
previously (9, 17). In some experiments, the immunodissected CCD cells were further fractionated into the three collecting duct cell types
(i.e.,
- and
-intercalated cells and principal cells) by
fluorescence-activated cell sorting using cell-specific markers as
described (10-12). Principal cells were identified with a
FITC-conjugated antibody that reacts specifically with these cells
(DT.17; Ref. 10);
-intercalated cells were identified with peanut
lectin agglutinin (PNA) coupled to phycoerythrin, as described in
detail elsewhere (10-12), whereas
-intercalated cells were
operationally defined as the DT.17- and PNA-negative population. To aid
in the discrimination between live and dead cells, CCD cell
preparations were also stained with 4',6-diamidino-2-phenylindole
(0.1 µg/ml), which is excluded from viable cells. The purity of the
sorted cells was determined by immunocytochemistry, using other
cell-specific markers as described (10-12) and was
~96% for
-cells, ~94% for principal cells, and ~82% for
-intercalated cells.
CCD cell culture. CCD cells were
seeded on porous bottom dishes with a surface area of 0.6 cm2 (Millicell HA; Millipore,
Bedford, MA) at a saturating density of 6-8 × 105
cells/cm2. The filter cups were
placed into the central wells of organ culture dishes and incubated
with 0.4 ml of medium at the apical (inner) and 0.8 ml at the
basolateral (outer) side. The cultures were grown in PC1 medium
(Ventrex) supplemented with 5% decomplemented fetal bovine serum
(Hyclone) and antibiotics (10) in an incubator containing 5%
CO2. After reaching confluence,
the cultures were incubated in regular PC1 medium for 24 h. At this
stage, ~40-45% of cells express markers specific for principal
cells, ~60% is positive for PNA (
-cell marker), ~25% for band
3, and 85% for an antibody reacting with both CCD and connecting
tubule cells (ST.12; Ref. 9). The medium was changed at
both sides of the monolayers to media with different pH values ranging
from 6.1 to 8.1. Media of different pH were generated by the addition
of NaOH or HCl, and appropriate amounts of NaCl were added to the control medium (pH 7.4) to keep osmolality constant. Cultures were
maintained in media with different pH for another 24 h before RNA
isolation.
RNA isolation and AE2 RT-PCR. Total
RNA was isolated using TRI Reagent (Molecular Research Center), and RNA
concentrations were calculated from the optical densities at 260 nm. cDNA was synthesized using 0.5-2 µg of total
RNA as described (13). Sense and antisense PCR primers were designed
based on the sequence of rabbit ileal AE2 (7). The
sequences for primers were as follows: primer
U1 (sense), 5' GGCGTGGAGCGGTTTGAAGA 3';
primer L1 (antisense), 5'
TTGGTGGGGCAGCAGTGTAG 3'; primer
U2 (sense), 5' GGAGCCACCCCCACCATTGA 3';
primer L2 (anti-sense), 5'
CAGGAGACTGCGGAACGACA 3'. Primers
U1 and L1 anneal to
nucleotides 216-235 and 610-629, respectively, on the rabbit
ileal AE2 and bracket a 414-bp sequence; primers
U2 and L2 anneal at
nucleotides 435-454 and 1180-1199, respectively. Reactions
were performed in a 20-µl total volume containing 10 mM
Tris · HCl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, 75 µM dNTP, 200 nM of
each primer, 0.1 U Taq polymerase
(Perkin-Elmer), and 1 µCi
[32P]dCTP (NEN, 3,000 Ci/mmol) with four different amounts (1-30 ng) of template cDNA.
Each sample was overlaid with 20 µl of Chill-Out (MJ Research) to
prevent evaporation. After an initial 2-min denaturation at 96°C,
PCR was carried out for 25 cycles with denaturation at 95°C for 1 min, annealing at 61°C for 1 min, and extension at 72°C for 1 min, then a final extension was carried out at 72°C for 8 min. The
relative abundance of
-actin mRNA in each CCD cell sample was
determined using primers and conditions as described (13). cDNA samples
derived from pairs of rabbits (one acidotic, the other alkalotic) were
always amplified simultaneously.
To determine the copy number of AE2 mRNA, in several experiments known amounts of an internal standard cDNA were included in the PCR reaction. This internal standard was generated as follows. First, the 414-bp PCR product, amplified using primers U1 and L1, was digested with Ban I at 37°C for 3 h, which generated the expected 91-, 128-, and 196-bp fragments. These DNA fragments were separated on 4% NuSieve GTG agarose by electrophoresis, and fragments of 128 bp and 196 bp were religated at 16°C for 18 h. Amplification of the resulting DNA with primers U1 and L1 yielded a 324-bp PCR product. This amplicon was used as an internal standard using four different amounts (80, 20, 5, and 1.25 fg).
After amplification, 4 µl loading buffer was added to each sample, and 20 µl was run on a 6% polyacrylamide gel. Gels were dried, and the amount of radioactivity in the PCR products determined using a model 425 PhosphorImager (Molecular Dynamics).
To determine the relative abundance of AE2 mRNA, AE2 PCR product levels
were compared with the levels of
-actin PCR product obtained from
the same sample. AE2 and
-actin cDNA was amplified from 1-30 ng
cDNA and 0.03-1 ng cDNA, respectively. Products were quantitated
using a PhosphorImager, and slopes derived by linear regressions were
compared.
Northern analysis. Northern blotting was carried out using standard protocols (3). In brief, 5-10 µg total RNA originating from CCD cells was fractionated on a 1.2% agarose gel containing 1.1% formaldehyde. RNA was transferred to a nylon membrane (0.45 µm; MSI, Westborough, MA) and probed with a gel-purified PCR fragment generated with primers U1 and L1 and labeled with 32P using a random priming kit (DECAprime II; Ambion, Austin, TX). Prehybridization was performed at 42°C for 1 h in 5× SSC, 5× Denhardt's solution, 50% formamide, 100 µg/ml salmon sperm DNA, and 0.5% SDS. Hybridization was done using the same conditions as for prehybridization for 12 h. Two washes were carried out at room temperature for 15 min each, with 1× SSC and 0.1% SDS, followed by two washes with 0.25× SSC and 0.1% SDS. After a final wash at 45°C for 15 min with 0.1× SSC and 0.1% SDS, the blot was visualized using a PhosphorImager.
| |
RESULTS |
|---|
|
|
|---|
Effect of metabolic acidosis and alkali load on expression of AE2 mRNA in rabbit CCD cells. First we established that AE2 mRNA is expressed in rabbit CCD cells, using RT-PCR and primers based on the published sequence of the rabbit ileal AE2 (7). Using primers U1 and L1, a product of the expected size, i.e., 414 bp, was amplified (Fig. 1A, lane 2). The identity of this PCR product as AE2 was verified by nested PCR, and by digestion with Ban I. In both cases products of the expected sizes were obtained (Fig. 1A, lanes 1 and 3). To examine the relative abundance of AE2 mRNA expression in CCD cells, PCR amplifications were carried out in the presence of a competitive control template, which is a DNA that is 94 bp shorter than the AE2 PCR product. These experiments revealed that AE2 mRNA is an abundant message in CCD cells with ~500 copies per cell.
|
To examine whether changes in acid/base balance result in changes in the steady-state levels of AE2 mRNA, pairs of rabbits were acid or alkali loaded. Urinary pH averaged 5.4 ± 0.4 in acidotic vs. 8.3 ± 0.2 in alkali-loaded rabbits (P < 0.001). Plasma pH was 7.2 ± 0.1 in acidotic vs. 7.48 ± 0.02 in alkali-loaded rabbits (P < 0.05). Plasma HCO3 concentration was 18.1 ± 2.7 and 32.1 ± 1.7 meq/l (P < 0.05), and PCO2 was 31.1 ± 1.5 and 37.9 ± 1. 5 mmHg (P < 0.005), in acidotic and alkali-loaded rabbits, respectively.
AE2 mRNA levels were determined by quantitative RT-PCR using different
amounts of cDNA derived from CCD cells of acid- or alkali-loaded
rabbits. The amount of the AE2 PCR product increased linearly with the
amount of starting CCD cDNA (Fig. 2,
left). Similarly, PCR amplification
was in the linear range for the internal standard, as shown in Fig. 2,
right, where a standard amount (10 ng)
of CCD cDNA and varying amounts (0-80 fg) of the AE2 internal standard were amplified simultaneously. AE2 mRNA levels were normalized for
-actin mRNA levels, which, as found previously, are not affected by changes in acid/base balance (13). As illustrated in Fig. 3, the relative abundance of AE2 mRNA,
calculated from the ratio of
[32P]dCTP incorporated
into the 414-bp AE2 PCR product and into the 350-bp
-actin PCR
product, was significantly higher in alkali-loaded than in acidotic
animals. The average ratio of AE2 mRNA levels in alkali-loaded vs.
acid-loaded CCD cells, calculated from the paired treatments, was 3.7 ± 1.07-fold (Fig. 4).
|
|
|
To determine whether the observed differences between acidotic and
alkali-loaded animals were due a reduction in AE2 expression caused by
acidosis or due to an increase caused by alkalosis, in a separate group
of experiments, mRNA levels of AE2 were determined in CCD cells
isolated from control (nontreated) rabbits as well as from rabbits with
metabolic acidosis achieved by the same
NH4Cl loading as used in the
previous set of experiments (except that these animals did not receive
extra NaCl). The results are summarized on Fig. 4. These data
demonstrate that AE2 mRNA levels are significantly decreased in
metabolic acidosis compared with those of CCD cells from control
rabbits. The average ratio of AE2 mRNA levels (normalized for
-actin) in normal vs. acidotic CCDs was 1.93 ± 0.7 (n = 5). This is a smaller
reduction (P < 0.05) than the
difference (3.7-fold) observed in acidotic vs. alkali-loaded rabbits.
Effect of medium pH on the expression of AE2 mRNA in
primary cultures of CCD cells. These experiments were
aimed to determine whether changes in extracellular pH directly alter
expression of AE2 mRNA. Primary cultures of rabbit CCD cells were
incubated in media with different pH values both in the basolateral and the apical compartments, for 24 h, then RNA was isolated, and AE2 mRNA
levels were determined by RT-PCR. As illustrated on Fig. 5, the levels of AE2 mRNA were much higher
in alkaline medium (pH 7.9) than in normal or acidic
medium (pH 6.6). In a separate group of cultures, the effect of extreme
pH changes was studied. The increase in AE2 mRNA levels (normalized for
-actin mRNA levels) was particularly high at pH 8.1 (4,632 ± 2,356% of the value obtained at pH 7.4;
n = 3), whereas incubation in a medium
with very low pH (pH 6.1) markedly reduced the level of AE2 mRNA
compared with cultures grown at pH 7.4 (33.5 ± 13% of values
obtained at pH 7.4; n = 3). These
results suggest that the higher levels of AE2 mRNA seen in CCD cells
from alkali-loaded vs. acidotic rabbits were probably brought about
directly by changes in extracellular pH and not by secondary changes in
hormonal levels or imbalances of other electrolytes.
|
Northern analysis. The levels of expression of AE2 mRNA were also determined by Northern analysis using total RNA from CCD cells maintained on acidic, normal, and alkaline media for 24 h. As shown in Fig. 6, the amount of AE2 mRNA was much higher in CCD cells maintained in a medium with alkaline pH (7.8 and 8.1) than those at control pH (7.4) or at acidic pH (6.1 and 6.6).
|
Distribution of AE2 mRNA in principal and intercalated
cells. The above results were compatible with the idea
that AE2 plays a role in bicarbonate secretion by the CCD. If AE2 were
the apical Cl/HCO3 exchanger, then
one would expect its mRNA preferentially expressed in
-intercalated
cells. To examine this possibility, we isolated principal,
-, and
-intercalated cells by fluorescence-activated cell sorting and
determined AE2 mRNA levels by RT-PCR. The results of these experiments,
however, did not reveal a preferential expression of AE2 in
-intercalated cells. As shown in Fig. 7,
AE2 mRNA levels are comparable in all three subtypes of CCD cells. In
addition, in all three cell types, AE2 mRNA levels were higher in
alkali-loaded than in acidotic rabbits, although the differences did
not reach statistical significance. It should be noted that both the
comparable levels of AE2 mRNA among CCD cell subtypes, and the trend of
AE2 mRNA levels to increase in alkali-loaded animals are in strong contrast with changes occurring in AE1 mRNA levels. AE1 is
expressed almost exclusively in
-intercalated cells, and its levels
are markedly increased in acidosis (13).
|
| |
DISCUSSION |
|---|
|
|
|---|
Despite strong functional evidence for the existence of an apical
Cl/HCO3 exchanger in
-intercalated cells (22), the molecular identity of this exchanger
is still unknown. Although the possibility that the apical and
basolateral exchangers are both encoded by the AE1 (band 3) gene was
raised (23), the bulk of the evidence indicates that the two exchangers
are separate proteins. First, no apical staining can be demonstrated in
the CCD with AE1 antibodies that recognize the basolateral exchanger
(1, 21). Second, there is little AE1 mRNA in sorted
-intercalated
cells compared with
-intercalated cells (13). Third, the inhibitor
sensitivity and the kinetic properties of the apical exchanger do
not match those of AE1 (1, 19). On the other hand, these
pharmacological data raised the possibility that another member of the
AE family, AE2, could be a candidate for the apical exchanger of
-intercalated cells. The observation that AE2 is present in the
apical membrane in another
HCO3-secreting epithelium, i.e.,
the rabbit ileum (7), also supports this possibility. In addition, AE2
was shown to be expressed in rat CCD cells (4).
If AE2 were to function as the apical
Cl/HCO3 exchanger, then its
expression is expected to be elevated following alkali load to
facilitate bicarbonate secretion by the CCD. Certain findings of the
present study seem to be compatible with this hypothesis. First, AE2 is
a relatively abundant message in
-intercalated cells, with ~500
copies/cell, and such high values are likely to be biologically
relevant. Second, AE2 mRNA expression was found to be higher in CCD
cells originating from alkali-loaded rabbits than in CCD cells from
acidotic animals, and similar results were obtained in vitro in
cultured CCD cells, suggesting that
H+ (or bicarbonate) concentrations
could directly regulate expression of AE2 mRNA in CCD cells. The
direction of these changes in AE2 mRNA expression, both in vivo and in
culture, is opposite to those observed in the expression of AE1. As we
recently reported, AE1 mRNA and protein levels were significantly
higher in CCD cells of acidotic than alkalotic rabbits (13).
If AE2 plays a role in bicarbonate secretion, then it is expected to be
preferentially expressed in
-intercalated cells. However, our
results obtained with sorted cells do not support this idea. We found
that AE2 mRNA levels are comparable in the three collecting duct cell
types. Furthermore, our data also indicate that regulation of AE2
expression by acidosis and alkali load is not cell-type-specific within
the CCD, as AE2 levels tended to be higher in all three cell types of
alkali-loaded vs. acidotic animals (Fig. 7). These results suggest that
AE2 might have a more general role in renal cells than functioning as
the apical exchanger of
-intercalated cells. For instance, AE2 could
participate in the regulation of intracellular pH. The wide
distribution of AE2 along the nephron (4) is also more compatible with
a function in cellular homeostasis than in a specific transcellular
transport event. Nevertheless, the observations that AE2 can occur with either basolateral (6, 14, 16) or apical (7) polarization in other
tissues, coupled with the fact that some membrane components occur with
opposite polarities in
- vs.
-intercalated cells (5), still leave
the possibility open that polarization of AE2 is cell-type dependent.
Immunohistochemical determination of the membrane localization of AE2
in
-intercalated cells should yield definitive answer to this
question.1
In conclusion, the present data demonstrate that AE2 is a relatively
abundant message in CCD cells, and its levels are significantly higher
following both in vivo and in vitro alkali load than acid load.
However, the findings that AE2 mRNA is not expressed in a
cell-type-specific manner and that changes in acid/base balance have
similar effects on each CCD cell subtype suggest that AE2 might serve a
housekeeping function rather than being the apical anion exchanger of
-intercalated cells. Thus the identity of the apical exchanger
remains unknown, although preliminary data indicating that different
isoforms of AE3 could be localized either basolaterally or apically in
intercalated cells (2) raise the possibility that the apical anion
exchanger may be an isoform of AE3.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-39523 and DK-41841.
| |
FOOTNOTES |
|---|
1 During the review of this report, Alper et al. reported that in the rat kidney, AE2 immunostaining is basolateral in non-A-type intercalated cells, and there is no evidence for apical AE2 staining of any cell type in the rat kidney [S. L. Alper, A. K. Stuart-Tilley, D. Biemesderfer, B. E. Shmukler, and D. Brown. Am. J. Physiol. 273 (Renal Physiol. 42): F601-F614, 1997].
Address reprint requests to G. Fejes-Tóth.
Received 3 July 1997; accepted in final form 18 December 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alper, S. L.
The band 3-related anion exchanger (AE) gene family.
Annu. Rev. Physiol.
53:
549-564,
1991[Medline].
2.
Alper, S. L.,
A. Stuart-Tilley,
D. Yannoukakos,
and
D. Brown.
AE3 anion exchanger immunolocalization in rodent kidney: evidence for apical and basolateral isoforms (Abstract).
J. Am. Soc. Nephrol.
6:
372,
1995.
3.
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith,
and
K. Struhl.
Current Protocols in Molecular Biology. New York: Green, Wiley-Interscience, 1989, chapt. 2, p. 4.9.1.
4.
Brosius, F. C., III,
K. Nguyen,
A. Stuart-Tilley,
J. P. Briggs,
and
S. L. Alper.
Regional and segmental localization of AE2 anion exchanger mRNA and protein in rat kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F461-F468,
1995
5.
Brown, D.,
S. Hirsch,
and
S. Gluck.
An H+-ATPase in opposite plasma membrane domains in kidney epithelial cell subpopulations.
Nature
331:
622-624,
1988[Medline].
6.
Brown, D.,
J. Lydon,
M. McLaughlin,
A. Stuart-Tilley,
R. Tyszkowski,
and
S. L. Alper.
Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate.
Histochem. Cell Biol.
105:
261-267,
1996[Medline].
7.
Chow, A.,
J. W. Dobbins,
P. S. Aronson,
and
P. Igarashi.
cDNA cloning and localization of band 3-related protein from ileum.
Am. J. Physiol.
263 (Gastrointest. Liver Physiol. 26):
G345-G352,
1992
8.
Da Silva, J.,
R. D. Perrone,
C. A. Johns,
and
N. E. Madias.
Rat kidney band 3 mRNA modulation in chronic respiratory acidosis.
Am. J. Physiol.
260 (Renal Fluid Electrolyte Physiol. 29):
F204-F209,
1991
9.
Fejes-Tóth, G.,
and
A. Náray-Fejes-Tóth.
Differentiated transport functions in primary cultures of rabbit collecting ducts.
Am. J. Physiol.
253 (Renal Fluid Electrolyte Physiol. 22):
F1302-F1307,
1987
10.
Fejes-Tóth, G.,
and
A. Náray-Fejes-Tóth.
Differentiation of renal
-intercalated cells to
-intercalated and principal cells in culture.
Proc. Natl. Acad. Sci. USA
89:
5487-5491,
1992
11.
Fejes-Tóth, G.,
and
A. Náray-Fejes-Tóth.
Fluorescence activated cell sorting of principal and intercalated cells of the renal collecting duct.
J. Tissue Cult. Meth.
13:
173-178,
1991.
12.
Fejes-Tóth, G.,
and
A. Náray-Fejes-Tóth.
Isolated principal and intercalated cells: hormone responsiveness and Na+-K+-ATPase activity.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F742-F750,
1989
13.
Fejes-Tóth, G.,
E. Rusvai,
T. Moser,
W. R. Chen,
and
A. Náray-Fejes-Tóth.
Differential expression of AE1 (band 3) mRNA in renal HCO3 secreting and reabsorbing intercalated cells.
J. Biol. Chem.
269:
26717-26721,
1994
14.
He, X.,
C. M. Tse,
M. Donowitz,
S. L. Alper,
S. E. Gabriel,
and
B. J. Baum.
Polarized distribution of key membrane transport proteins in the rat submandibular gland.
Pflügers Arch.
433:
260-268,
1997[Medline].
15.
Humphreys, B. D.,
L. Jiang,
M. N. Chernova,
and
S. L. Alper.
Functional characterization and regulation by pH of murine AE2 anion exchanger expressed in Xenopus oocytes.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1295-C307,
1994
16.
Lindsey, A. E.,
K. Schneider,
D. M. Simmons,
R. Baron,
B. S. Lee,
and
R. R. Kopito.
Functional expression and subcellular localization of an anion exchanger cloned from choroid plexus.
Proc. Natl. Acad. Sci. USA
87:
5278-5282,
1990
17.
Náray-Fejes-Tóth, A.,
and
G. Fejes-Tóth.
Immunoselection and culture of rabbit cortical collecting duct cells.
J. Tiss. Cult. Meth.
13:
179-184,
1991.
18.
Saboli
, I.,
D. Brown,
S. L. Gluck,
and
S. L. Alper.
Regulation of AE1 anion exchanger and H(+)-ATPase in rat cortex by acute metabolic acidosis and alkalosis.
Kidney Int.
51:
125-37,
1997[Medline].
19.
Schuster, V. L.
Cyclic adenosine monophosphate stimulated bicarbonate secretion in rabbit cortical collecting tubule.
J. Clin. Invest.
75:
2056-2064,
1985.
20.
Schuster, V. L.
Function and regulation of collecting duct intercalated cells.
Annu. Rev. Physiol.
55:
267-288,
1993[Medline].
21.
Schuster, V. L.,
S. M. Bonsib,
and
M. L. Jennings.
Two types of collecting duct mitochondria-rich (intercalated) cells: lectin and band 3 cytochemistry.
Am. J. Physiol.
251 (Cell Physiol. 20):
C347-C355,
1986
22.
Schwartz, G. J.,
J. Barasch,
and
Q. Al-Awqati.
Plasticity of functional epithelial polarity.
Nature
318:
368-371,
1985[Medline].
23.
van Adelsberg, J. S.,
J. C. Edwards,
and
Q. Al-Awqati.
The apical Cl/HCO3 exchanger of
intercalated cells.
J. Biol. Chem.
268:
11283-11289,
1993
This article has been cited by other articles:
![]() |
J. L. Turi, I. Jaspers, L. A. Dailey, M. C. Madden, L. E. Brighton, J. D. Carter, E. Nozik-Grayck, C. A. Piantadosi, and A. J. Ghio Oxidative stress activates anion exchange protein 2 and AP-1 in airway epithelial cells Am J Physiol Lung Cell Mol Physiol, October 1, 2002; 283(4): L791 - L798. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Schafer Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct Am J Physiol Renal Physiol, August 1, 2002; 283(2): F221 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Naray-Fejes-Toth, C. Canessa, E. S. Cleaveland, G. Aldrich, and G. Fejes-Toth sgk Is an Aldosterone-induced Kinase in the Renal Collecting Duct. EFFECTS ON EPITHELIAL Na+ CHANNELS J. Biol. Chem., June 11, 1999; 274(24): 16973 - 16978. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |