|
|
||||||||
Second Department of Internal Medicine, Tokyo Medical and Dental University, School of Medicine, 1-5-45 Yushima Bunkyo-ku, Tokyo 113, Japan
| |
ABSTRACT |
|---|
|
|
|---|
The rat ClC-K1 chloride channel is a
kidney-specific member of the ClC chloride channel family found
exclusively in the thin ascending limb of Henle's loop in the kidney.
To gain insight into the mechanism(s) of kidney-specific expression of
ClC-K1, a genomic clone that contains the 5'-flanking region of
the rat ClC-K1 gene was isolated. A single transcription start site was located 84 bp upstream of the start codon. The sequence of the proximal
5'-flanking region contained an activator protein (AP)-3 site, a
glucocorticoid-responsive element, several AP-2 sites, and several
E-boxes, but it lacked a TATA box. To functionally express
the promoter, the ~2.5-kb pair 5'-flanking region was ligated
to a luciferase reporter gene and transfected into inner medullary (IM)
cells, a stable ClC-K1-expressing cell line derived from the inner
medulla of simian virus 40 transgenic mouse, and ClC-K1-nonexpressing
cell lines. Luciferase activity was 7- to 24-fold greater in IM cells
than those in nonexpressing cell lines, suggesting that the ~2.5-kb
fragment contained cis-acting
regulatory elements for cell-specific expression of the ClC-K1 gene.
Deletion analysis revealed that this cell-specific promoter activity in IM cells was still present in the construct containing 51 bp of the
5'-flanking region but was lost in the
29 construct,
clearly demonstrating that the 22 bp from
51 to
30 have a
major role in the cell-specific activity of the ClC-K1 promoter. These
22 bp consist of purine-rich sequence (GGGGAGGGGGAGGGGAG), and
gel-retardation analysis demonstrated the existence of a specific
protein(s) binding to this element in IM cells. These results suggest
that the novel purine-rich element may play a key role in the activity
of the ClC-K1 gene promoter.
reporter gene assay; transfection; cis elememt; gel-retardation assay; rat kidney
| |
INTRODUCTION |
|---|
|
|
|---|
A CHLORIDE CHANNEL, ClC-K1, found exclusively in the thin ascending limb of Henle's loop (tAL), is one of the nine currently known members of the mammalian ClC chloride channel family (1, 2, 11, 13, 23, 26, 27, 31, 32). ClC-1 is a skeletal muscle-specific chloride channel that accounts for the majority of membrane conductance of plasma membrane in skeletal muscle (26). Mutations of the ClCN1 gene have been reported in dominant and recessive types of myotonia (15). Among the ClC family, the only members other than ClC-1 that are expressed in a tissue-specific fashion are ClC-K1 (32) and ClC-K2 (1). ClC-K1 and ClC-K2 are very homologous to each other, with an amino acid identity of ~80% in rat K1 and K2 (1, 32) and ~90% in human K1 and K2 (14, 30). Recently, we determined chromosomal localization of human ClC-K1 and K2 genes (CLCNKA and CLCNKB, respectively) using the two-color fluorescence in situ hybridization (FISH) method (22). Both loci were found to be closely linked at 1p34-36 (22), suggesting that both genes arose from a common ancestor gene by gene duplication. Although they are very similar in structure, their intrarenal localizations are completely different: ClC-K1 is present in the thin ascending limb of Henle's loop (tAL) in the inner medulla (34), and ClC-K2 is present in the thick ascending limb of Henle's loop and collecting ducts (1). The tAL has the highest transepithelial chloride permeability among nephron segments (10), and in vitro perfusion studies (38) have suggested the presence of chloride channels within it. The functional characteristics of ClC-K1 expressed in Xenopus oocytes very closely matched those of chloride transport in tAL (34), and immunohistochemistry revealed that ClC-K1 is present in both the apical and basolateral plasma membranes of tAL (34). Based on these observations, ClC-K1 has been identified as a major chloride channel that mediates transepithelial chloride transport in tAL (34). Chloride transport in tAL constitutes a countercurrent system in the inner medulla and is thought to be important for the urinary concentration mechanisms (10). In fact, the expression of ClC-K1 is augmented in dehydrated rats (32), suggesting its involvement in urinary concentration mechanisms.
Little is known about the molecular mechanism(s) of tissue-specific expression of genes in the kidney. Recently, several cDNAs such as aquaporin-2 (6), V2 vasopressin receptor, Na-K-Cl cotransporter (8), and Na-glucose cotransporter (SGLT2; see Ref. 12) were found to be expressed exclusively in the kidney. The 5'-flanking regions of the aquaporin-2 gene (33), V2 vasopressin receptor gene (16), and Na-K-Cl cotransporter gene (9) have all been isolated, but no common sequence or mechanism(s) of cell-specific expression has been identified. We have examined the rat ClC-K1 gene as a model for kidney-specific gene expression. The 5'-flanking region of the ClC-K1 gene was isolated to commence examination of the molecular basis for kidney-specific expression of the rat ClC-K1 gene. The ~2.5-kb pair 5'-flanking region of the rat ClC-K1 gene was isolated, and its kidney cell-specific promoter activity was demonstrated. A regulatory element required for cell-specific and maximal promoter activity in the 5'-flanking region was further determined by deletion analysis and gel retardation assay. We found that a purine-rich element located ~40 bp upstream of the transcription start site was required for maximal promoter activity of the rat ClC-K1 gene, and the cell-specific promoter activity demonstrated in the ClC-K1-expressing cell line (IM cells) suggested this purine-rich element's involvement in the kidney-specific expression of ClC-K1 in vivo.
| |
METHODS |
|---|
|
|
|---|
Library screening. A rat genomic
library in
DASHII was purchased from Stratagene and was screened by
filter hybridization with a
32P-labeled rat ClC-K1 cDNA (32).
Positive clones were plaque purified, and the genomic inserts were
restiction mapped using Sal I,
EcoR I, and
Xba I. Restriction fragments were
transferred to nylon membrane, and exon-containing fragments were
identified by hybridization using various parts of ClC-K1 cDNA as
32P-labeled probes.
Primer extension analysis. Primer
extension analysis was performed using an antisense oligonucleotide
(5'-ACGCAGTCCCACGAGTTCTTCCAT) that was complementary to the
ClC-K1 cDNA [nucleotide (nt) 44-67; see Ref. 32]. This
oligonucleotide was end labeled with
[
-32P]ATP using
polynucleotide kinase. Ten micrograms of
poly(A)+ RNA from rat kidney were
hybridized with 5 × 105
counts/min (cpm) probe at 30°C for 3 h in 250 mM KCl, 10 mM
tris(hydroxymethyl)aminomethane (Tris) · Cl, pH 8.0, and 1 mM EDTA, and the sample was reacted with 500 units of Superscript
II reverse transcriptase (Life Technologies) in 75 mM KCl, 10 mM
MgCl2, 0.25 mM EDTA, 20 mM
Tris · Cl, pH 8.0, 10 mM dithiothreitol, 0.25 mM
dNTP, and 100 µg/ml actinomycin D. The sample was quenched with EDTA,
extracted with phenol-chloroform, and precipitated with ethanol.
Reaction products were analyzed on 6% polyacrylamide sequence gel.
5'-Rapid amplification of cDNA ends of rat ClC-K1 cDNA. 5'-Rapid amplification of cDNA ends (RACE)-Ready cDNA (Clontech, Palo Alto, CA) was used to clone more of the 5'-end portion of the rat ClC-K1 cDNA. Two ClC-K1 gene-specific primers [gene-specific primer 1, 5'-AACCTCCCCGGTATAGCCATTTGTG from nt 275-298 of rat ClC-K1 cDNA (32); gene-specific primer 2, 5'-TTCTGACACCTCGGCGGATCGGT from nt 121-143] were prepared, and the first polymerase chain reaction (PCR) was performed with gene-specific primer 1 and the anchor primer provided in the kit. Nested PCR was then performed using the first PCR product as a template with the gene-specific primer 2 and the anchor primer. PCR products were subcloned into pSPORT1 vector and sequenced.
Ribonuclease protection assay. To
determine the transcriptional start site of the rat ClC-K1 gene in
vivo, a 192-bp genomic fragment containing a putative transcription
start site determined by primer extension analysis (from
125 to
+64) was amplified by PCR and cloned into pSPORT1 vector at
EcoR I and
BamH I sites. Riboprobe in antisense
orientation was synthesized using SP6 RNA polymerase and hybridized
with 10 µg of poly(A)+ RNA from
rat kidney [1 × 105
cpm probe in hybridization solution (80% formamide, 40 mM
piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.4, 400 mM sodium acetate, and 1 mM EDTA)]. After
overnight incubation, the reaction was treated with ribonuclease
(RNase) A (0.5 U/ml) and T1 (10 U/ml), precipitated, and analyzed by
electrophoresis in a 10% denaturing polyacrylamide gel.
To determine the transcriptional start site of a reporter gene
construct in transient transfection experiments, a 289-bp DNA fragment
covering the portions of ClC-K1 promoter (from nt
128 to +64)
and pGL2 basic (a 97-bp fragment from
Bgl II site) was cloned into pSPORT1
vector. Riboprobe in antisense orientation was synthesized using T7 RNA
polymerase and hybridized with 10 µg of total RNA from IM cells
transfected with 20 µg of pLuc-128.
To measure the abundance of mouse ClC-K1 mRNA level in cultured cells, a 294-bp fragment encoding 98 amino acids from the first methionine of mouse ClC-K1 was cloned into pSPORT1 vector. Riboprobe in antisense orientation was synthesized using T7 RNA polymerase and hybridized with 10 µg of total RNA from IM cells and NIH-3T3 cells.
Cell culture. Inner medulla of the kidney from a transgenic mouse harboring temperature-sensitive simian virus 40 (SV40) large T antigen gene (a generous gift from Dr. M. Obinata, Tohoku University) was minced and treated with 1 mg/ml collagenase B (Boehringer Mannheim) for 30 min at 37°C, plated on standard culture dishes in RITC80-7 medium (Kyokuto Pharmaceutical Industrial, Tokyo, Japan) supplemented with 5% fetal bovine serum, 10 µg/ml transferrin, 1 µg/ml insulin, and 10 ng/ml epidermal growth factor, and cultured at 34°C. Each colony was cloned using a cloning cylinder, and the ClC-K1 mRNA abundance in each cell line was measured by RNase protection assay. The outer medullary collecting duct (OMCD) cells (5), kindly provided by Dr. H. Endoh (Kyorin University, Tokyo, Japan), were cultured under the same condition as used for the IM cells. NIH-3T3 cells and LLC-PK1 cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum.
Construction of reporter plasmids. After various 5'-flanking regions of rat ClC-K1 gene were synthesized by PCR using various 5'-primers containing Mlu I site and a common 3'-primer (ccagatctCAGTCCACCCTGCAGAGGTCCTGCGTGGCTG, nt +45 to +75) containing the Bgl II site, they were ligated into pGL2 basic vector at Mlu I and Bgl II sites. A pGL2 control containing a luciferase gene driven by the SV40 early region promoter/enhancer was used as positive control, and empty pGL2 basic was used as negative control. The sequences of 5'-flanking regions obtained by PCR were verified by sequencing. A reporter gene constuct containing the ~2.5-kb 5'-flanking region was generated as follows: a 5-kb Xba I-Kpn I (Fig. 1) fragment was subcloned into pSPORT1, and an Mlu I-BstX I fragment in this vector was then converted to a pLuc-495 construct cut with Mlu I and BstX I.
|
Transient transfection and reporter gene
assay. Luciferase reporter plasmids were introduced
into cultured mammalian cells by electroporation. When cells plated on
150-mm plastic dishes reached 60-70% confluency, they were
detached with 0.25% trypsin/EDTA, neutralized by complete medium,
pelleted by brief centrifugation, resuspended in 500 µl of buffer
(30.8 mM NaCl, 120.7 mM KCl, 1.46 mM
KH2PO4,
8.1 mM
Na2HPO4,
10 mM MgCl2) containing 20 µg
of pGL2 vectors and 5 µg of pSV-
-galactosidase vector (Promega),
transferred to a cuvette (0.4 mm width), and electroporated at settings
of 370 V and 960 µF. Ten minutes after electroporation, the cells were resuspended in prewarmed complete medium and seeded in a 60-mm
dish. Forty-eight hours after transfection, the cells were harvested
for luciferase and
-galactosidase assay (Promega). Transfection
efficiency was corrected using
-galactosidase activity.
Electrophoretic mobility shift assay.
Synthesized sense and antisense oligonucleotides were annealed and
radiolabeled at the 5'-end with polynucleotide kinase and
[
-32P]ATP. Nuclear
extracts from IM and NIH-3T3 cells were prepared as described
previously (3). After the nuclear extracts were incubated with 0.5 ng
of radiolabeled DNA at room temperature for 30 min in a buffer
containing 25 mM
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid-KOH (pH 7.9), 90 mM KCl, 0.5 mM EDTA-NaOH (pH 8.0), 0.5 mM dithiothreitol, 0.5 mM phenylmethylsufonyl fluoride, 10% glycerol, 1 µg poly(dI-dC), and, if indicated, competitors, they were
electrophoresed through 6% nondenaturing polyacrylamide gels (19:1
acrylamide-bisacrylamide) containing 10% glycerol in TGE buffer (50 mM
Tris · HCl, pH 8.5, 380 mM glycin, and 2 mM
EDTA-NaOH, pH 8.0) for 2 h at 4°C. Upon completion of
electrophoresis, the gels were dried, and the protein-DNA complexes
were visualized by autoradiography.
Statistical analysis. Multiple comparisons were performed using analysis of variance, and P < 0.01 was considered to be statistically significant.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the rat ClC-K1 gene and identification of
the transcription start site. A rat genomic library in
DASHII vector was screened with rat ClC-K1 cDNA (32), and a clone
(GK1-2) of ~18 kb was obtained. Southern blot analysis using
various portions of rat ClC-K1 cDNA and subcloning of various
restriction fragments and their partial sequencing revealed that
GK1-2 contained sequences at the 5'-end of the rat ClC-K1
cDNA. These results suggested that GK1-2 was likely to contain the
5'-flanking promoter region of rat ClC-K1 gene (Fig.
1A).
The transcription initiation site was determined using primer extension analysis, ligation-anchored PCR, and RNase protection assay. The results of ligation-anchored PCR using 5'-RACE-Ready cDNA revealed the presence of more 5'-end sequences of ClC-K1 cDNA than was found in the original cDNA (Fig. 1B; see Ref. 32). Furthermore, the sequences newly identified by 5'-RACE were also observed just upstream of the 5'-end of the original cDNA sequence in the isolated genomic clone, clearly demonstrating that the genomic clone isolated in this study contained the 5'-flanking region of the rat ClC-K1 gene. As shown in Fig. 1B, the longest 5'-RACE clone contained 20-bp more of the 5'-untranslated region. As shown in Figs. 1A and 2A, cloning of 5'-RACE products also revealed the existence of another exon (85 bp) not present in the original cDNA, suggesting the existence of two types of ClC-K1 mRNAs.
|
The result of primer extension is shown in Fig. 2B. An end-labeled antisense oligonucleotide complementary to the 5'-untranslated region of rat ClC-K1 cDNA (nt 44-67; see Ref. 32) was annealed to poly(A)+ RNA from rat kidney and elongated with Moloney murine leukemia virus reverse transcriptase (SuperScript II; Life Technologies). A 108-bp major extended product and a 193-bp product were obtained, indicating that the 5'-end of the rat ClC-K1 gene was located 41 bp upstream of the 5'-end of the original cDNA. Because the difference of nucleotide length between long and short products matched the length of exon 2 (Figs. 1A and 2A), the longer product probably corresponded to the mRNA containing exon 2.
To confirm the initiation site, RNase protection assay was performed. A 192-bp riboprobe covering the initiation site was prepared and hybridized with poly(A)+ RNA from rat kidney. After digestion with RNase A and T1, the protected probe was analyzed by a denaturing polyacrylamide gel. As shown in Fig. 2C, a 64-bp protected fragment and several shorter fragments were detected. Because the 3'-end of the riboprobe corresponded to nt 23 of the original cDNA, the existence of a 64-bp protected fragment indicated that the transcription start site was present 41 bp upstream of the 5'-end of the original cDNA. Thus the transcription start site determined by the primer extension was confirmed by an independent method.
To check whether the transcription of a hybrid reporter gene was also
initiated properly in the transient expression in IM cells, RNase
protection assay was performed using the mRNA from pLuc-128-transfected
IM cells. The length of the protected RNA probe was 160 nt (Fig.
2D, lane
2) after hybridization and RNase treatment,
indicating that the transcriptional start site of a hybrid reporter
gene was present 129 nt downstream of
128, i.e., at +2 in Fig.
1B. This is close enough to the native
transcriptional start site.
Sequence of the proximal 5'-flanking region of
the rat ClC-K1 gene. A fragment of GK1-2 clone from
exon 1 to the Bgl II site was
subcloned and sequenced (Fig. 1B).
The transcription start site, the 5'-ends of various
5'-RACE products, and the 5'-ends of various reporter gene
constructs are visible on Fig. 1. Although the
5'-flanking region lacked a TATA box and SpI
site, it contained an AP-3 site at position
20, a consensus
binding site for heat shock factor at
82, and several AP-2 sites
(at
174,
225,
235,
290, and
316) and
E-boxes (at
10,
174,
201, and
242). At positions
22,
426, and
446, the sequences matched
the consensus binding site (TKNNGNAAK) for CCAAT/enhancer binding
proteins. There was no adenosine 3',5'-cyclic monophosphate
(cAMP)-responsive element, and none of the sequences were similar to
osmotic-responsive elements (4, 21, 29). Purine-rich sequences were
found at positions
40,
225, and
286. The sequence
of the rat ClC-K1 promoter was aligned with the sequences of other
cloned kidney-specific promoters of human aquaporin-2 (33), rat
V2 vasopressin receptor (16), and
murine Na-K-Cl cotransporter (9), but no significant regions of
homology were identified.
Cell-specific activity of the rat ClC-K1
promoter. To determine whether the 5'-flanking
region of ClC-K1 gene had a functional promoter, reporter gene assay
was performed using ClC-K1-expressing and -nonexpressing cells. Because
none of the established kidney-derived cell lines, which included OMCD
cells and LLC-PK1 cells, expressed ClC-K1 (data not shown), tubular cell lines were established from transgenic mice harboring temperature-sensitive SV40 large T antigen gene as described previously (37). The established cell lines were
screened for the expression of ClC-K1 message. Figure
3 shows the result of RNase protection
assay performed to measure ClC-K1 message in NIH-3T3 fibroblasts and
one of the established cell lines, i.e., IM cells. IM cells expressed
ClC-K1 mRNA, which had an mRNA abundance (at 34°C) of
~
of that in the whole mouse kidney. In NIH-3T3 cells, no
ClC-K1 message was detected. We picked the IM cells as
ClC-K1-expressing recipient cells in reporter gene assay. The ~2.5-kb
fragment of the 5'-flanking region cloned upstream to a
promoterless luciferase reporter gene in pGL2 basic (pLuc-2500) was
transfected into IM cells, OMCD cells, NIH-3T3 cells, and
LLC-PK1 cells using the
electroporation method. Promoter activity was inferred from light
output normalized for differences in transfection efficiency. Because
there were no significant differences in the luciferase activities of a
positive control vector, pGL2 control, in any of the cell lines (data
not shown), the promoter activity of each construct in various cell lines was expressed as percent of pGL2 control to average the results
of five experiments. Figure 4 shows the
normalized light output after transfection. Transfection with pGL2
basic produced low levels of luciferase activity in all cell lines (343 ± 21 light units in IM, 289 ± 30 light units in OMCD,
326 ± 18 light units in NIH-3T3, and 350 ± 18 light units in
LLC-PK1 vs. 156 ± 12 in blank, mean ± SD, n = 3). As
shown in Fig. 4, the luciferase activity resulting from transfection
with pLuc-2500 plasmid into IM cells (~30% of pGL2 control) was much
higher (P < 0.01) than the
luciferase activities resulting from transfection into other cell lines
(1-5% of pGL2 control). These results clearly demonstrated that the
reporter gene assay using the ~2.5-kb 5'-flanking region of the
ClC-K1 gene reflected the level of endogenous expression of ClC-K1 gene
in each cell line, thus indicating that the ~2.5-kb 5'-flanking
region of the ClC-K1 gene contained
cis-acting regulatory elements for
cell-specific expression of the ClC-K1 gene.
|
|
Deletion analysis of the 5'-flanking region of
rat ClC-K1 gene promoter and identification of elements involved in
cell-specific transcription. To identify the regulatory
elements required for ClC-K1 gene promoter in IM cells, deletion
analysis was performed. The plasmid constructs containing nested
deletions of the 5'-flanking region were introduced into IM
cells. As shown in Fig. 5, deletion from
2.5 to
128 kb resulted in a 1.3-fold increase of
luciferase activity in IM cells. Further deletion to
51 did not
affect luciferase activity in IM cells, but further deletion to
29 resulted in an ~90% reduction of luciferase activity. The
promoter activity of the
29 construct in IM cells (3.6 ± 1.8% of pGL2b control, mean ± SD,
n = 5) was significantly higher
(P < 0.01) than the value for pGL2
basic (0.1 ± 0.02% of pGL2 control). Further deletion to +15 led
to a complete loss of the minimal promoter activity. These results
indicated that the 29-bp 5'-flanking region (from 0 to
29)
had minimal promoter activity and that the element from
29 to
51 was required for the maximal activity of ClC-K1 promoter in
IM cells. This 22-bp region was characterized by purine-rich sequence
GGGGAGGGGGAGGGGAG.
|
To determine whether the IM cell-specific promoter activity in
pLuc-2500 resulted from the 22-bp purine-rich element, the promoter
activities of pLuc-29 and pLuc-51 in various cell lines were measured.
As shown in Table 1, luciferase activities
of pLuc-29 in various cell lines were low but significantly
(P < 0.01) higher than those of pGL2
basic and pLuc+15, suggesting that the minimal promoter activity in
pLuc-29 was present even in ClC-K1 nonexpressing cell lines. In
contrast, the promoter activities of pLuc-51 in various cell lines
showed a pattern of cell specificity similar to that observed in
pLuc-2500. Although the promoter activity of pLuc-51 in each cell line
was significantly (P < 0.01) higher
than that of pLuc-29, the magnitude of increase was largest (~10-fold
increase) in the IM cells. These results suggest that the region from
29 to
51 has a major role in the IM cell-specific
promoter activity of the ClC-K1 gene.
|
Electrophoretic gel shift assay. To
identify protein(s) binding to the 22-bp purine-rich element,
electrophoretic mobility shift assay was performed using nuclear
extracts from IM cells and NIH-3T3 cells. Figure
6 shows that nuclear extract from IM cells
gave rise to four protein-DNA complexes (lane
2). All four bands were competed with a 100-fold
excess of unlabeled double-strand probe (Fig. 6, lane
3, competitor 1).
However, two lower bands could also be competed with 100-fold excess of
the antisense single-strand DNA used for preparation of the
double-strand DNA probe (lane 6,
competitor 4), thus suggesting that
both complexes were single-strand DNA-binding proteins. Furthermore,
although incubation with a 100-fold excess of cold mutant probe
(competitor 2) where four Gs in the
wild-type probe were mutated to T (GGGGAGGGGGAGGGGAGGG to
GA
GG
GG
G)
had no effect on the formation of the upper band, it did compete
with the wild-type probe to form the lower band (Fig. 6). These results
indicated that the protein(s) forming the upper band with the probe
could be important for the ClC-K1 promoter. To confirm this, reporter
gene assay was performed to measure enhancer activity of G to T mutant
promoter, which could not form the upper band. As shown in Fig.
7, the mutant construct did not increase
the minimal promoter activity (2.5 ± 0.5-fold increase,
n = 3) as much as the wild-type
construct (10 ± 1.5-fold, n = 3),
confirming that the protein(s) forming the upper band was the most
important for the promoter activity of the ClC-K1 gene.
Subsequently, we tested the role of several G residues in forming the
upper complex with nuclear extract from IM cells. Each mutant
double-strand probe was end labeled, and gel mobility shift assay was
performed. As shown in Fig. 8, the single
mutation of G to T either at position 1 (lane
2), 2 (lane 3), or
3 (lane 4) abolished the formation
of the upper band as well as the mutations at all four sites
(lane 1). On the other hand, the
mutation at position 4 (lane 5) had
no effect on the formation of the upper band. Taken together, these
results suggest that the sequence GGAGGGGGAGG between sites 1 and 3 may
at least have some involvement in the formation of the DNA-protein
complex.
|
|
|
Finally, we investigated whether or not the protein binding to the purine-rich element was specifically present in ClC-K1-expressing IM cells. As shown in Fig. 9, although nuclear extract from the NIH-3T3 cells could also form the upper band, the intensity of this band was much fainter than that formed by the nuclear extract from the IM cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this report, we describe the isolation and transcriptional analysis of the rat kidney-specific ClC-K1 chloride channel gene promoter. The 5'-flanking region of the rat ClC-K1 gene does not contain a TATA box, CAAT box, or any SpI sites. Promoters lacking a TATA box were first found in housekeeping genes and have more recently been found in various gene promoters involved in cell-specific transcription (16, 28). Among the cloned promoters of other kidney-specific genes, aquaporin-2 water channel and Na-K-Cl cotransporter promoter have a TATA box, but V2 vasopressin receptor promoter lacks one. There were no extended regions of sequence similarity among these kidney-specific promoters, including ClC-K1 gene promoter. This suggests that each type of kidney cell is more likely to possess its own mechanism(s) of cell-specific expression rather than a common mechanism that governs all kidney-specific genes. In a promoter lacking a TATA box, GC-rich elements usually play an important role in transcriptional activation. In the ClC-K1 promoter, however, Sp1 sites and other GC-rich elements are not present. In contrast, several GA-rich clusters are found. Other recognition sequences of transcription factors found in the ClC-K1 promoter are AP-3, AP-2, and binding sites for heat shock factor and basic helix-loop-helix proteins (Fig. 1B). Because ClC-K1 expression is increased in dehydration in vivo (32), cAMP signal from vasopressin via V2 receptor was speculated to enhance ClC-K1 gene transcription. Although there is no cAMP responsive element, several AP-2 sites known to regulate gene transcription in response to phorbol ester or cAMP are present in the ClC-K1 promoter (Fig. 1B). However, when we performed tests to determine the effects of these two agents on the ClC-K1 promoter activity in reporter gene assay, we could observe any (data not shown). The roles of other putative binding sites for transcription factors in the ClC-K1 promoter activity have not been examined.
The transcriptional start site of the rat ClC-K1 gene was determined by
three independent methods in this study. Sequencing of several clones
obtained by 5'-RACE revealed that some of them contained more
5'-end sequences of the gene compared with the initially isolated
rat ClC-K1 cDNA (32). Furthermore, these sequences were found in the
genomic clone isolated in this study just upstream of the 5'-end
of the cDNA sequence, clearly identifying the genomic clone that we
isolated as the ClC-K1 gene. The existence of another splice variant of
ClC-K1 mRNA was also revealed by 5'-RACE. As shown in Figs.
1A and
2A, there is an 85-bp exon 2 that was
not present in the original cDNA. Although primer extension analysis
also confirmed the existence of this variant in the rat kidney, the
physiological significance of this variant is not clear at present. The
RACE clone that had the most 5'-end portion of the ClC-K1 gene
had 20 more base pairs than the original cDNA. However, the primer
extension experiment suggested that the real transcription start site
was present 21 bp further upstream. Accordingly, we performed RNase
protection assay to determine the exact transcriptional start site.
Although several protected fragments were observed, the longest
fragment was 64 bp, confirming that the transcriptional start site was
41 bp upstream of the 5'-end of the initial cDNA. The results of
reporter gene assay were consistent with the result of the
transcriptional start site. Although the construct (+15 to +75) not
containing the transcriptional start site showed no significant
promoter activity over pGL2 basic, the construct (
29 to +75)
containing the transcriptional start site showed minimal promoter
activity, thus supporting the existence of the transcriptional start
site in this region. RNase protection assay (Fig.
2D) also confirmed the proper
initiation of transcription in reporter gene assay.
A 29-bp region from the transcription start site contains AP-3 consensus sequence (GTGGWWWG). AP-3 was shown to be an important element for SV40 promoter (17), but its binding protein has yet to be identified. As shown in Table 1 and Fig. 5, this region had minimal non-cell-specific promoter activity of the ClC-K1 gene. In contrast, the addition of purine-rich sequence to this minimal promoter enhanced the promoter activity in a cell-specific manner. As shown in Table 1, the minimal promoter activity was increased about two- to threefold by the purine-rich sequence in ClC-K1-nonexpressing cell lines. In contrast, in ClC-K1-expressing IM cells, the purine-rich sequence increased the minimal promoter activity ~10-fold. This enhancer activity was accompanied by the binding of specific protein to this element. As shown in Fig. 9, the specific protein binding to the purine-rich sequence was present much more abundantly in the IM cells than in the NIH-3T3 cells. Furthermore, the correlation between the enhancer activity and the binding of a specific protein was clearly demonstrated in Figs. 7 and 8 in which the mutant enhancer, which did not form the specific DNA-protein complex, did not show enhancer activity in IM cells. Thus the purine-rich motif and its binding protein have an essential role in the IM cell-specific activity of the ClC-K1 gene promoter. Because the level of endogenous expression of the ClC-K1 gene in the IM cells was much lower than that in vivo, the physiological relevance of these results to kidney-specific expression of ClC-K1 gene must be verified by further experiments utilizing transgenic mice. However, the cell-specific enhancer activity of purine-rich element observed only in the ClC-K1-expressing cell line could possibly be one of the important determinants of nephron-specific expression of the ClC-K1 gene in vivo.
Purine-rich sequences were found in the 5'-flanking region of
several genes, especially in the neuron-specific gene promoters. In the
promoter of
-aminobutyric acid A receptor
-subunit gene, the
conserved purine-rich sequences were present, and the brain-specific protein (BSF1) binding to the AGAGGAGAGGGGAGAGGGGGGAG element was
reported to be involved in the neuron-specific expression of the gene
(19). In human neurofilament heavy gene promoter, the GGGAGGAGG element
was identified to be important in brain-specific enhancement of
transcription (25). Similar purine-rich elements were also observed in
synapsin I gene promoter (AGAGAGGGGGAGGGGAAA; see Ref. 24) and Na-K
ATPase
3-subunit promoter
(AGGGTGAAGGGGGAAGGGGGAG; see Ref. 20). The sequence found in the ClC-K1
gene promoter in this study is GGGGAGGGGGAGGGGAGGG, which is similar
but not identical to these brain-specific enhancer elements. It is
highly likely that a family of purine-rich DNA-binding proteins is
present and involved in the tissue-specific expression of genes. It is also possible that these proteins are related to known transcription factors such as ETS family proteins and
C2H2
zinc finger genes. ETS proteins recognize various sequences with the
GGAA core sequence (36), and the expression of most of the known ETS
proteins is cell specific (36). Some
C2H2
zinc finger genes, for example, c-Krox and myeloid zinc finger gene 1 (MZF1), were shown to bind to GA-rich sequences (7,18). c-Krox was
found to bind the GGGAGGG motif in the type I collagen gene promoter
(7), and its predominant expression in skin raises the possibility that
c-Krox is involved in the control of type I collagen gene expression in
skin. MZF1, a transcriptional fator shown to bind AGTGGGGA and
CGGGnGAGGGGGAA sequences (18), plays a key role in regulating
hematopoiesis (18). It is of particular interest that a similar
transcription factor, Kid-1, was isolated from rat kidney (35). Kid-1
contains 13 zinc fingers and posesses 45% homology within zinc finger
domains with MZF1. Expression of mRNA for both Kid-1 and MZF1 is
developmentally regulated and restricted to specific tissues. Thus a
zinc finger gene similar to Kid-1 and MZF1 may bind to the purine-rich
element in the ClC-K1 promoter. Isolation of a protein binding to this element will elucidate the mechanisms of kidney-specific expression of
the ClC-K1 gene. Although the purine-rich sequence
(GGGGAGGGGGAGGGGAGGG) determined in the ClC-K1 gene promoter is not
exactly the same as purine-rich sequences found in the Na-K-Cl
cotransporter, V2 vasopressin
receptor promoter, and aquaporin-2 water channel promoter, the Na-K-Cl
cotransporter gene promoter contains GA repeats, and V2 vasopressin receptor promoter
and the aquaporin-2 water channel promoter contain several purine-rich
regions such as AGGGAAAAGGAGGGGGGAAG at
110 (16) and
GAGAAAGAGAG at +10 (33), respectively. If these sequences are found
to be important in the cell-specific expression of each gene, similar
transcription factors may be involved in the kidney-specific
expression.
In conclusion, we have cloned the rat ClC-K1 gene promoter and observed that the promoter exhibits ClC-K1 expressing cell-specific activity. This cell-specific activity results from the purine-rich element ~40-bp upstream of the transcription start site.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by grants-in-aid from the Ministry of Education, Science, Sports, and Culture of Japan and the Uehara Memorial Foundation.
| |
FOOTNOTES |
|---|
Address reprint requests to S. Uchida.
Received 23 May 1997; accepted in final form 25 November 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adachi, S.,
S. Uchida,
H. Ito,
M. Hata,
M. Hiroe,
F. Marumo,
and
S. Sasaki.
Two isoforms of a chloride channel predominantly expressed in thick ascending limb of Henle's loop and collecting ducts of rat kidney.
J. Biol. Chem.
269:
17677-17683,
1994
2.
Brandt, S.,
and
T. J. Jentsch.
ClC-6 and ClC-7 are two novel broadly expressed members of the CLC chloride channel family.
FEBS Lett.
377:
15-20,
1995[Medline].
3.
Dignam, H.,
R. M. Lebovitz,
and
R. G. Roeder.
Accurate transcription initiation by RNA polymerase II in a soluble extract from from isolated mammalian nuclei.
Nucleic Acids Res.
11:
1475-1489,
1983
4.
Ferraris, J. D.,
C. K. Williams,
K.-Y. Jung,
J. J. Bedford,
M. B. Burg,
and
A. Garcia-Perez.
ORE, a eukaryotic minimal essential osmotic respomse element.
J. Biol. Chem.
271:
18318-18321,
1996
5.
Furuno, M.,
S. Uchida,
F. Marumo,
and
S. Sasaki.
Repressive regulation of the aquaporin-2 gene.
Am. J. Physiol.
271 (Renal Fluid Electrolyte Physiol. 40):
F854-F860,
1996
6.
Fushimi, K.,
S. Uchida,
Y. Hara,
Y. Hirata,
F. Marumo,
and
S. Sasaki.
Cloning and expression of apical membrane water channel of rat kidney collecting tubule.
Nature
361:
549-552,
1993[Medline].
7.
Galera, P.,
R.-W. Park,
P. Ducy,
M.-G. Mattei,
and
G. Karsenty.
c-Krox binds to several sites in the promoter of both mouse type I collagen genes. Structure/function study and developmental expression analysis.
J. Biol. Chem.
271:
21331-21339,
1996
8.
Gamba, G.,
A. Miyanoshita,
M. Lombardi,
J. Lytton,
W.-S. Lee,
M. A. Hediger,
and
S. C. Hebert.
Molecular cloning, primary structure, and characterization of two members of the mammalian electroneutral sodium-(potassium)-chloride cotransporter family expressed in kidney.
J. Biol. Chem.
269:
17713-17722,
1994
9.
Igarashi, P.,
D. A. Whyte,
K. Li,
and
G. T. Nagami.
Cloning and kidney cell-specific activity of the promoter of the murine renal Na-K-Cl cotransporter gene.
J. Biol. Chem.
271:
9666-9674,
1996
10.
Imai, M.
Function of the thin ascending limb of Henle of rats and hamsters perfused in vitro.
Am. J. Physiol.
232 (Renal Fluid Electrolyte Physiol. 1):
F201-F209,
1977
11.
Jentsch, T. J., W. Günther, M. Pusch, and B. Schwappach. Properties of voltage-gated chloride channels of the
ClC gene family. J. Physiol. (Lond.)
482, Suppl. P: 19S-25S, 1995.
12.
Kanai, Y.,
W.-S. Lee,
G. You,
D. Brown,
and
M. A. Hediger.
The human kidney low affinity Na+/glucose cotransporter SGLT2. Delineation of the major renal reabsorptive mechanism for D-glucose.
J. Clin. Invest.
93:
397-404,
1994.
13.
Kawasaki, M.,
S. Uchida,
T. Monkawa,
A. Miyawaki,
K. Mikoshiba,
F. Marumo,
and
S. Sasaki.
Cloning and expression of a protein kinase C-regulated chloride channel abundantly expressed in rat brain neuronal cells.
Neuron
12:
597-604,
1994[Medline].
14.
Kieferle, S.,
P. Fong,
M. Bens,
A. Vandewalle,
and
T. J. Jentsch.
Two highly homologous members of the ClC chloride channel family in both rat and human kidney.
Proc. Natl. Acad. Sci. USA
91:
6943-6947,
1994
15.
Koch, M. C.,
K. Steinmeyer,
C. Lorenz,
K. Ricker,
F. Wolf,
M. Otto,
B. Zoll,
F. Lehmann-Horn,
K.-H. Grzeschik,
and
T. J. Jentsch.
The skeletal muscle chloride channel in dominant and recessive human myotonia.
Science
257:
797-800,
1992
16.
Mandon, B.,
A.-C. Bellanger,
and
J.-M. Elalouf.
Inverse PCR-mediated cloning of the promoter for the rat vasopressin V2 receptor gene.
Pflügers Arch.
430:
12-18,
1995[Medline].
17.
Mercurio, F.,
and
M. Karin.
Transcription factors AP-3 and AP-2 interact with the SV40 enhancer in a mutually exclusive manner.
EMBO J.
8:
1455-1460,
1989[Medline].
18.
Morris, J. F.,
R. Hromas,
and
F. R. Rauscher Iii.
Characterization of the DNA-binding properties of the myeloid zinc finger protein MZF1: two independent DNA-binding domains recognizing two DNA consensus sequences with a common G-rich core.
Mol. Cell. Biol.
14:
1786-1795,
1994
19.
Motejlik, K.,
R. Hauselmann,
S. Leitgeb,
and
B. Luscher.
BSF1, a novel brain-specific DNA-binding protein recognizing a tandemly repeated purine DNA element in the GABAA receptor g subunit gene.
J. Biol. Chem.
269:
15265-15273,
1994
20.
Pathak, B. G.,
J. C. Neumann,
M. L. Croyle,
and
J. B. Lingrel.
The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na, K-ATPase a3 subunit gene are required for brain expression in transgenic mice.
Nucleic Acids Res.
22:
4748-4755,
1994
21.
Ruepp, B.,
K. M. Bohren,
and
K. H. Gabbay.
Characterization of the osmotic response element of the human aldose reductase gene promoter.
Proc. Natl. Acad. Sci. USA
93:
8624-8629,
1996
22.
Saito-Ohara, F.,
S. Uchida,
Y. Takeuchi,
S. Sasaki,
A. Hayashi,
F. Marumo,
and
T. Ikeuchi.
Assignment of the genes encoding the human chloride channels, CLCNKA and CLCNKB, to 1p36 and of CLCN3 to 4q32-q33 by in situ hybridization.
Genomics
36:
372-374,
1996[Medline].
23.
Sakamoto, H.,
M. Kawasaki,
S. Uchida,
S. Sasaki,
and
F. Marumo.
Identification of a new outwardly rectifying Cl
channel that belongs to a subfamily of the ClC Cl
channels.
J. Biol. Chem.
271:
10210-10216,
1996
24.
Schoch, S.,
G. Cibelli,
and
G. Thiel.
Neuron-specific gene expression of synapsin I. Major role of a negative regulatory mechanism.
J. Biol. Chem.
271:
3317-3323,
1996
25.
Schwartz, M. L.,
C. Katagi,
J. Bruce,
and
W. W. Schlaepfer.
Brain-specific enhancement of the nouse neurofilament heavy gene promoter in vitro.
J. Biol. Chem.
269:
13444-13450,
1994
26.
Steinmeyer, K.,
C. Ortland,
and
T. J. Jentsch.
Primary structure and functional expression of a developmentally regulated skeletal muscle chloride channel.
Nature
354:
301-304,
1991[Medline].
27.
Steinmeyer, K.,
B. Schwappach,
M. Bens,
A. Vandewalle,
and
T. J. Jentsch.
Cloning and functional expression of rat CLC-5, a chloride channel related to kidney disease.
J. Biol. Chem.
270:
31172-31177,
1995
28.
Takenaka, M.,
S. M. Bagnasco,
A. S. Preston,
S. Uchida,
A. Yamauchi,
H. M. Kwon,
and
J. S. Handler.
The canine betaine gamma-amino-n-butyric acid transporter gene: diverse mRNA isoforms are regulated by hypertonicity and are expressed in a tissue-specific manner.
Proc. Natl. Acad. Sci. USA
92:
1072-1076,
1995
29.
Takenaka, M.,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress.
J. Biol. Chem.
269:
29379-29381,
1994
30.
Takeuchi, Y.,
S. Uchida,
F. Marumo,
and
S. Sasaki.
Cloning, tissue distribution, and intrarenal localization of ClC chloride channels in human kidney.
Kidney Int.
48:
1497-1503,
1995[Medline].
31.
Thiemann, A.,
S. Gründer,
M. Pusch,
and
T. J. Jentsch.
A chloride channel widely expressed in epithelial and non-epithelial cells.
Nature
356:
57-60,
1992[Medline].
32.
Uchida, S.,
S. Sasaki,
T. Furukawa,
M. Hiraoka,
T. Imai,
Y. Hirata,
and
F. Marumo.
Molecular cloning of a chloride channel that is regulated by dehydration and expressed predominantly in kidney medulla.
J. Biol. Chem.
268:
3821-3824,
1993
33.
Uchida, S.,
S. Sasaki,
K. Fushimi,
and
F. Marumo.
Isolation of human aquaporin-CD gene.
J. Biol. Chem.
269:
23451-23455,
1994
34.
Uchida, S.,
S. Sasaki,
K. Nitta,
K. Uchida,
S. Horita,
H. Nihei,
and
F. Marumo.
Localization and functional characterization of rat kidney-specific chloride channel, ClC-K1.
J. Clin. Invest.
95:
104-113,
1995.
35.
Witzgall, R.,
E. O'Leary,
R. Gessner,
A. J. Ouellette,
and
J. V. Bonventre.
Kid-1, a putative renal transcription factor: regulation during ontogeny and in response to ischemia and toxic injury.
Mol. Cell. Biol.
13:
1933-1942,
1993
36.
Xin, J. H.,
A. Cowie,
P. Lachancw,
and
J. A. Hassell.
Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells.
Genes Dev.
6:
481-496,
1992
37.
Yanai, N.,
T. Satoh,
S. Kyo,
K. Abe,
M. Suzuki,
and
M. Obinata.
A tubule cell line established from transgenic mice harboring temperature-seneitive simian virus 40 large T-antigen gene.
Jpn. J. Cancer Res.
82:
1344-1348,
1991[Medline].
38.
Yoshitomi, K.,
Y. Kondo,
and
M. Imai.
Evidence for conductive Cl pathways across the cell membranes of the thin ascending limb of Henle's loop.
J. Clin. Invest.
82:
866-871,
1988.
This article has been cited by other articles:
![]() |
L. Adler, E. Efrati, and I. Zelikovic Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, J. Yoshino, M. Hayashi, and T. Saruta Identification of a Renal Proximal Tubular Cell-Specific Enhancer in the Mouse 25-Hydroxyvitamin D 1{alpha}-Hydroxylase Gene J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1455 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik Molecular Structure and Physiological Function of Chloride Channels Physiol Rev, April 1, 2002; 82(2): 503 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, J. Cheng, J. Gao, H. Lepor, Z.-T. Zhang, J. Pak, and X.-R. Wu Isolation of mouse THP gene promoter and demonstration of its kidney-specific activity in transgenic mice Am J Physiol Renal Physiol, April 1, 2002; 282(4): F608 - F617. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. WALDEGGER and T. J. JENTSCH From Tonus to Tonicity: Physiology of CLC Chloride Channels J. Am. Soc. Nephrol., July 1, 2000; 11(7): 1331 - 1339. [Abstract] [Full Text] |
||||
![]() |
E. Scandella, U. O. Nagl, B. Oehl, F. Bergmann, M. Gschwentner, J. Furst, A. Schmarda, M. Ritter, S. Waldegger, F. Lang, et al. The Promoter for Constitutive Expression of the Human ICln Gene CLNS1A J. Biol. Chem., May 19, 2000; 275(21): 15613 - 15620. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Whyte, C. Li, R. B. Thomson, S. L. Nix, R. Zanjani, S. L. Karp, P. S. Aronson, and P. Igarashi Ksp-cadherin gene promoter. I. Characterization and renal epithelial cell-specific activity Am J Physiol Renal Physiol, October 1, 1999; 277(4): F587 - F598. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Stricklett, R. D. Nelson, and D. E. Kohan The Cre/loxP system and gene targeting in the kidney Am J Physiol Renal Physiol, May 1, 1999; 276(5): F651 - F657. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Taniyama, K. Sato, A. Sugawara, A. Uruno, Y. Ikeda, M. Kudo, S. Ito, and K. Takeuchi Renal Tubule-specific Transcription and Chromosomal Localization of Rat Thiazide-sensitive Na-Cl Cotransporter Gene J. Biol. Chem., July 6, 2001; 276(28): 26260 - 26268. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |