|
|
||||||||
Division of Nephrology, The Johns Hopkins School of Medicine, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
We have previously identified a tonicity-responsive enhancer (TonE) in the promoter region of the canine BGT1 gene. TonE mediates hypertonicity-induced stimulation of transcription. Here, we characterize TonE and TonE binding proteins (TonEBPs) to provide a biochemical basis for cloning of the TonEBPs. Mutational analysis applied to both hypertonicity-induced stimulation of transcription and TonEBP binding reveals that TonE is 11 base pairs in length, with the consensus sequence of (C/T)GGAAnnn(C/T)n(C/T). Activity of the TonEBPs increases in response to hypertonicity with a time course similar to that of transcription of the BGT1 gene. Studies with inhibitors indicate that translation, but not transcription, is required for activation of the TonEBPs. Phosphorylation is required for the stimulation of transcription but not for activation of DNA binding by the TonEBPs. In vivo methylation by dimethyl sulfate reveals that the TonE site of the BGT1 gene is protected with a time course like that of activity of the TonEBPs and activation of transcription. Ultraviolet cross-linking indicates that the TonEBPs share a DNA binding subunit of 200 kDa.
compatible osmolytes; betaine/
-aminobutyric acid transporter; in
vivo footprinting
| |
INTRODUCTION |
|---|
|
|
|---|
THE KIDNEY MEDULLA is the only tissue in mammals that is hypertonic under physiological conditions, due to the operation of the urinary concentrating mechanism. The degree of hypertonicity in the renal medulla fluctuates widely depending on the hydration status of the animal. In dehydrated mammals, osmolarity of the renal medulla reaches >1,000 mosM in humans and 3,000 mosM in rats. When exposed to hypertonicity for more than several hours, cells in the renal medulla accumulate small organic molecules such as betaine, myo-inositol, taurine, sorbitol, and glycerophosphorylcholine (6, 23). These compounds are termed "compatible osmolytes" because, in contrast to electrolytes, they do not perturb the function of macromolecules at high intracellular concentrations (33). Accumulation of compatible osmolytes lowers the intracellular concentration of electrolytes toward the isotonic level and thereby protects cells from the stress of hypertonicity (33). Prevention of the accumulation of compatible osmolytes results in necrosis in the renal medulla (29) and inhibition of growth and ultimately death in cultured cells (9, 27, 32).
Some compatible osmolytes are accumulated by specific
Na+-coupled transporters: the
Na+- and
Cl
-coupled
betaine/
-aminobutyric acid transporter (BGT1) for betaine (31), the
Na+- and
Cl
-coupled taurine
transporter (26), and the
Na+-coupled
myo-inositol transporter (SMIT) (14).
Sorbitol is synthesized from glucose in a reaction catalyzed by aldose
reductase (AR) (2). Transcription of all these genes is stimulated by
hypertonicity (reviewed in Ref. 12), leading to increased abundance of
mRNA (15, 16), increased activity of transporter or enzyme (3, 17),
and, finally, accumulation of compatible osmolytes (23). Hypertonicity-induced stimulation of transcription plays the critical role in adaptation of the renal cells to hypertonicity.
We identified a regulatory sequence element named tonicity-responsive enhancer (TonE) within a 13-bp region in the promoter region of the BGT1 gene (24). TonE mediates the transcriptional stimulation in response to hypertonicity. Subsequently, TonE-like regulatory sequences have been found in the 5'-flanking region of the AR gene of several species (4, 5, 10), suggesting that a common mechanism regulates these genes. However, little is known about how mammalian cells recognize hypertonicity and how the signal is conveyed to TonE.
Studies in yeast revealed a signal transduction pathway linking the sensing of hypertonicity to the transcriptional response (reviewed in Ref. 19). Signals from two tonicity sensors in the membrane converge on Pbs2, a homolog of mitogen-activated protein (MAP) kinase kinase. When yeast cells are switched to hypertonic media, Pbs2 and its downstream kinase, Hog1, a MAP kinase homolog, are immediately activated, resulting in the stimulation of transcription of GPD1 (1) in an as yet undetermined way. GPD1 encodes glycerol-3-phosphate dehydrogenase, the rate-limiting enzyme for synthesis of glycerol which is the predominant compatible osmolyte of yeast. In mammalian cells, including those in the kidney medulla, hypertonicity stimulates three cascades of MAP kinase homologs: ERKs, JNK/SAP kinase, and p38. However, preventing activation of these cascades does not interfere with the transcriptional stimulation of BGT1 or AR (11, 13), indicating that MAP kinase homologs are not involved in signaling to TonE.
In this study, we rigorously characterize the nucleotide sequence of TonE and the TonE binding proteins (TonEBPs) that specifically interact with TonE. In vivo footprinting and other data presented here strongly support the idea that TonEBPs are transcription factors that stimulate transcription in response to hypertonicity. Characteristics of TonEBPs revealed in this study provide fundamental information for cloning TonEBPs, whose regulation will in turn provide clues to the hypertonicity signaling pathways in mammals.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture. Madin-Darby canine kidney (MDCK) cells were maintained in a defined medium (30). Cells were grown to a confluent monolayer before they were treated with hypertonicity and other agents. Medium was made hypertonic by adding 200 mM raffinose. For treatment with inhibitors (Fig. 3B), cells grown in isotonic medium were incubated with the inhibitor for 30 min, and then cells were switched to hypertonic medium containing the inhibitor for an additional 6 h.
Preparation of nuclear extracts and electrophoretic mobility shift assay. MDCK cells cultured in isotonic or hypertonic medium were chilled to 4°C, and nuclear extracts were prepared as described (24). To prepare probes for electrophoretic mobility shift assay (EMSA), single-stranded oligonucleotides shown in Figs. 1 and 2 were synthesized and purified (Genetic Core Facility, Johns Hopkins University). To obtain a double-stranded probe, 200 pmol of each complementary oligonucleotide were annealed in 100 µl containing (in mM) 150 NaCl, 10 MgCl2, and 50 Tris hydrochloride, pH 7.9. An aliquot of nuclear extract (4 µg protein) was incubated initially for 10 min at 25°C in 20 µl containing (in mM) 20 HEPES (pH 7.9), 100 KCl, 0.1 EDTA, 10% glycerol, 1 mM dithiothreitol, 1.5 µg poly(dA-dT), and 5 mM MgCl2. The mixture was then incubated for an additional 20 min after 10 fmol of 32P-labeled probe was added. The reaction was electrophoresed on a 4% polyacrylamide gel (79:1, acrylamide-bisacrylamide) in a buffer containing (in mM) 45 Tris, 45 borate, and 1 EDTA. The EMSA gels were dried and radioactivity was visualized and quantitated using a PhosphorImager and the computer program ImageQuant (Molecular Dynamics, Sunnyvale, CA).
|
|
Construction of reporter genes. To
generate a reporter gene construct, a double-stranded TonE nucleotide
was phosphorylated and ligated into the
Spe I site of pBluescript II SK(+)
(Stratagene, La Jolla, CA). Clones containing two copies of the
oligonucleotide were picked and sequenced for verification. The "2
TonE" fragment was moved into the
Kpn
I/Sac I site upstream of the SV40
promoter and the Photinus luciferase gene, using a
commercial vector, pGL2-promoter (Promega, Madison, WI). pRL-CMV
(Promega) containing the Renilla luciferase gene under the
strong promoter of cytomegalovirus served to assess transfection
efficiency. The "
-actin control" construct containing the
Photinus luciferase gene under the control of the promoter
of the
-actin gene (24) was used as a reference (see below).
Transfection and analysis of reporter gene
expression. A half million MDCK cells were seeded onto
a 60-mm tissue culture dish. The next day, they were transfected with 2 µg of a 2 TonE reporter construct along with 0.05 µg of pRL-CMV
using DEAE-dextran (24). For transfection of the
-actin control
plasmid, 0.01 µg was used along with 0.05 µg of pRL-CMV.
Transfected cells were maintained in isotonic medium for 24 h and then
switched to hypertonic medium or maintained in isotonic medium for
another 24 h before analysis. Activity of the Photinus and
Renilla luciferase in extracts of the transfected cells was
determined using a commercial kit, Dual-Luciferase Reporter Assay
System (Promega). For each sample, activity of the Photinus
luciferase is divided by the activity of the Renilla luciferase to correct for transfection efficiency. The corrected Photinus luciferase activity of experimental constructs was
expressed relative to that of the
-actin control plasmid in isotonic
or hypertonic conditions, as described (24). In each experiment, all
transfections were performed in duplicate. Expression of
Photinus luciferase driven by the SV40 promoter alone (pGL2
promoter by itself ) was not affected by hypertonicity (0.98 ± 0.15-fold induction by hypertonicity; means ± SE,
n = 7).
RNA isolation and Northern analysis. RNA was isolated from MDCK cells using Trizol Reagent (Life Technologies, Gaithersburg, MD), and 10 µg of each sample was electrophoresed on a 1% agarose gel containing 2.2 M formaldehyde. In all samples, equal loading of RNA was confirmed by visual inspection of the ethidium staining. RNA was transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH) and hybridized to random-primed BGT1 cDNA (31) in 6× standard sodium citrate (SSC) (1× SSC contains 150 mM NaCl and 15 mM trisodium citrate), 0.5% SDS, 5× Denhardt's solution, and 100 µg/ml of herring sperm DNA at 65°C. Membranes were washed for 30 min at 65°C in 0.5× SSC and 0.1% SDS. Radioactivity was detected and quantified as described for the EMSA gels.
In vivo footprinting. To methylate G
residues of the genomic DNA in vivo, MDCK cells in isotonic or
hypertonic medium were incubated in the same medium containing 0.1%
dimethyl sulfate for 2 min at room temperature. Cells were washed
quickly to remove dimethyl sulfate, and DNA was isolated. As a control
to detect all the G residues, DNA isolated from MDCK cells was treated
with 0.1% dimethyl sulfate for 2 min in vitro. The methylated DNA was converted to the single-stranded form and cleaved at sites immediately 3' to the methylated G residues by treatment with piperidine at 90°C. The cleaved G residues were detected using ligation-mediated polymerase chain reaction (PCR), as described in Ref. 18.
To amplify the "sense" strand of the promoter region of the BGT1 gene, the cleaved DNA was annealed to an anti-sense primer IVF-1 [TGTATGGGGCAGGGTGCAGC: complementary to +67/+86 region where
numbers represent positions of nucleotides in the BGT1 gene and its
5' flanking region. Nucleotides are numbered positively starting from the transcription start site (+1) to the downstream direction, and
they are numbered negatively in the upstream direction starting from
the nucleotide immediately upstream of the transcription start site
(
1) (see below)], which was then extended using Vent DNA
polymerase (New England Biolabs, Beverly, MA). A staggered double-stranded linker (18) was ligated, and 18 cycles of PCR were
performed using a nested primer IVF-2 (CCAGAGCAGTAGGATGGGAGCCACCAA: complementary to +32/+58 region) and the linker primer. Two additional rounds of PCR were performed using IVF-2 end labeled with
32P, and the reaction was
electrophoresed on a sequencing gel to visualize the PCR products.
Radioactivity was visualized and quantified by PhosphorImager, as
described for EMSA (see above). The "anti-sense" strand of the
promoter region was amplified and visualized in the same way using two
primers: IVF-3 (GGTCTGTCTGACGGTAAACTTG, corresponding to
214/
193 region) and IVF-4 (CTAGATAGGCTCCTTGAGGTTTGCTC, corresponding to
184/
159 region).
Ultraviolet cross-linking. Nuclear extract (30 µg of protein) was initially incubated for 10 min at 25°C with 50 fmol of 32P-labeled human TonE (32P-hTonE) or canine TonE (32P-cTonE) (see Fig. 1) and 2.5 µg of poly(dA-dT) in 50 µl containing the same buffer used for EMSA analysis (see above) and then chilled on ice for 10 min. Samples on ice were irradiated with ultraviolet (UV) for 60 min using the Stratalinker apparatus (Stratagene). Samples were boiled for 3 min in Laemmli buffer and then electrophoresed on an SDS-polyacrylamide gel. Radioactivity of dried gels was detected using a PhosphorImager.
| |
RESULTS |
|---|
|
|
|---|
Identification of TonEBPs and delineation of TonE
sequence. We have previously located a TonE sequence of
the canine BGT1 gene within 13 bp in the 5' flanking region,
i.e.,
62/
50 region (24). Using a 35-bp probe
corresponding to
69/
35 region of the gene, we detected
many nuclear proteins that bound to the probe, including those
migrating very slowly in EMSA gels. Although the intensity of the
(very) slowly migrating bands was much weaker than that of other bands,
the binding of the probe to the slowly migrating bands, but not to
others, was specifically competed by oligonucleotides containing the
62/
50 sequence but not by oligonucleotides with mutations
in the
62/
50 region (24). To investigate the slowly
migrating bands further, we prepared a shorter probe of 23 bp, which
contains the TonE region with 5-bp flanking sequences on both sides
(cTonE in Fig. 1; equivalent to
67/
45 region of the BGT1
gene). Unlike the
69/
35 probe described above, cTonE
bound efficiently to the slowly migrating bands while it bound to other
proteins with much less efficiency (Fig.
1B,
left, far
left lane). cTonE binding in the
slowly migrating bands displayed the same specificity as the
69/
35 probe, i.e., the profile of competition by
wild-type and mutant oligonucleotides described (24) was the same for
both probes (not shown). The slowly migrating bands appeared as two
bands when the EMSA gel was electrophoresed for a longer time (Fig.
3A).
|
After we reported the TonE sequence, other investigators reported tonicity-responsive enhancers with sequences similar to TonE, mostly from the promoter region of the AR gene of several species (4, 5, 10, 21). To test whether these enhancers are functionally related to TonE, we prepared rat TonE (rTonE) and hTonE by replacing appropriate portions of cTonE with the 12-bp enhancer from the rabbit AR gene (5) and the 11-bp enhancer from an unknown human gene (10, 21), respectively (Fig. 1A). hTonE was identified from a human genomic clone based on its TonE activity, but the origin of the portion of the clone containing hTonE is not known (21). At any rate, both rTonE (not shown) and hTonE (Fig. 1B, right) formed the slowly migrating bands. The binding by any one of the three probes (cTonE, rTonE, and hTonE) to the slowly migrating bands was competed by all the TonEs, indicating that these three elements interact with the same nuclear proteins, presumably transcription factors (see below for more). Relative affinity of the probes for the slowly migrating bands based on the degree of competition was hTonE > rTonE > cTonE.
To pursue the relationship between the slowly migrating bands and the enhancer activity of TonE further and also to identify the key nucleotides of TonE, 11 hTonE mutants were generated by changing a single base pair, a purine to a pyrimidine and vice versa, in each mutant as shown in Fig. 2A. hTonE was chosen as the founding wild type because it has the highest affinity to the slowly migrating bands (Fig. 1) and very high enhancer activity (see below), making it easier to detect reduction in affinity/enhancer activity of mutants, compared with using cTonE or rTonE as a wild-type TonE. Nucleotides at the 8th and 10th position of TonE were not mutated because they are variable among TonE sequences already reported (see Table 1). We determined the ability of all hTonE mutants, hTonE, and cTonE to bind to the slowly migrating bands and to induce transcription in response to hypertonicity, i.e., tonicity-responsive enhancer (TonE) activity, as described below.
|
To quantify binding (or affinity) of each sequence to the slowly migrating bands, percent reduction (or competition) of 32P-hTonE (0.5 nM) binding to the slowly migrating bands in the presence of 25 nM of the test sequence was determined from the EMSA gels using ImageQuant software, as described in MATERIALS AND METHODS. hTonE competed 96%, while cTonE competed 61% of 32P-hTonE binding to the slowly migrating bands. Mutant hTonEs showed a wide range of competition, from 0 to 95%, as shown in Fig. 2A.
To quantify enhancer activity, two tandem copies of each of the wild-type and mutant sequences were inserted in front of the SV40 promoter and the Photinus luciferase reporter gene, using a commercial vector, pGL2-promoter. These reporter constructs were individually transfected into MDCK cells, and the expression of luciferase under isotonic and hypertonic culture conditions was determined. Multiple-fold induction of luciferase in response to hypertonicity (i.e., TonE activity) was calculated by dividing the luciferase activity in cells in hypertonic medium by the luciferase activity in cells in isotonic medium. As shown in Fig. 2A, hTonE induced the reporter gene expression 21-fold, whereas cTonE induced 2.2-fold in response to hypertonicity.
TonE activity of the tandem cTonE (
67/
45 of the BGT1
gene; see Fig. 1) (above, 2.2-fold) is much lower than that of tandem
69/
50 region of the BGT1 gene, which was over 12-fold in
previous studies (24). We measured the enhancer activity of the tandem
69/
50 region along with the tandem cTonE and
confirmed that the tandem
69/
50 construct induces over
12-fold. Arrangement of the sequences (head to head, tail to tail, head
to tail, and tail to head) did not affect the degree of induction (data
not shown). Because the
69/
50 oligonucleotide was
dimerized with Cla I overhang sequence
(TCGA), whereas cTonE was dimerized with Spe I overhang sequence (CTAG) and the
same commercial vector (pGL2-promoter) was used for both constructs,
differences in sequences around the TonE (
62/52 region, see
below) must have contributed to the differences in luciferase
induction.
Mutant hTonEs that displayed relative binding activity <50, i.e.,
hTonE-m2, hTonE-m3, hTonE-m4, hTonE-m5, hTonE-m8, and hTonE-m9 (see
Table 1 for nomenclature), did not induce luciferase expression by
hypertonicity. hTonE-m1 displayed binding of 55 and luciferase induction of 1.79 ± 0.28 (mean ± SE,
n = 7), whereas hTonE-m6 displayed a
moderate luciferase induction of 7.06, although its binding of 87 was
rather high. The rest, hTonE-m7, hTonE-m10 (C to A in the 12th
position), and hTonE-m11 (G to T in the 13th position), were as active
as hTonE in binding and in luciferase induction. The absence of effects
of mutations in the 12th and 13th position (hTonE-m10 and hTonE-m11)
indicates that these residues are not part of TonE. Other TonE
sequences are 11 bp long as well (4, 5, 10, 21) (see also Table 1). We
conclude that TonE of the BGT1 is 11 bp long, located in
62/
52 region. Based on all the TonE sequences in this
study and those reported by others, we derived a consensus sequence of
TonE: YGGAAnnnYnY (Y is C or T; n is any nucleotide).
Data in Fig. 2A were replotted in Fig. 2B to look for a correlation between binding to the slowly migrating bands and induction of luciferase by hypertonicity. The induction of luciferase increased dramatically as binding exceeded 50. The steepness of the curve may be due to cooperativity in the binding of specific transcription factors to the tandem TonE sites on the reporter constructs, as a result of protein-protein interactions, as in many other regulatory elements and their corresponding transcription factors (25). The relationship between the binding to the slowly migrating bands and the induction of transcription strongly supports the idea that the slowly migrating bands represent the transcription factors specifically interacting with TonE. Accordingly, the proteins in the slowly migrating bands are named TonE binding proteins (TonEBPs).
Regulation of TonEBPs by hypertonicity. Nuclear extracts prepared from hypertonic MDCK cells contain considerably more TonEBP activity (TonEBP activity refers to DNA binding activity, as determined by the radioactivity of the slowly migrating bands in EMSA gels) than those prepared from isotonic cells (24), indicating that hypertonicity increases the activity of TonEBPs. To investigate the temporal relationship of TonEBP activation and transcription of the BGT1 gene, we determined the time course of changes in the activity of TonEBPs and BGT1 mRNA abundance after MDCK cells were switched to hypertonic medium. The mRNA abundance was taken as an indicator of transcription, because we have previously shown that changes in the abundance of BGT1 mRNA closely reflect changes in transcription of the BGT1 gene in this model (28). As shown in Fig. 3A, the activity of TonEBPs increased steadily, reaching ninefold isotonic level at 18 h and then declined to a lower level, a profile that is quite similar to the time course of transcription of the BGT1 gene as determined by nuclear run-on assays (28). The abundance of BGT1 mRNA rose and reached >10-fold isotonic level at 18 h, similar to previous results (28). The data add further evidence that TonEBPs mediate transcriptional stimulation of the BGT1 gene.
To further investigate the relationship between TonEBPs and hypertonicity-induced transcription of BGT1 and also to explore the signaling pathway to activation of TonEBPs, we examined the effect of an inhibitor of transcription (actinomycin D), an inhibitor of protein synthesis (cycloheximide), and an inhibitor of serine/threonine protein kinases (2-aminopurine) (7). To minimize toxic side effects, MDCK cells were treated with these agents at the lowest effective concentrations in reducing the induction of mRNA in response to hypertonicity and only for the initial 6 h after medium tonicity was raised. We did not detect any obvious toxicity by these inhibitors, based on apprearance of cells and yield of protein and RNA. In previous studies, we determined that the increase in mRNA can be reliably detected at 6 h (28). Actinomycin D, as anticipated, prevented the increase in BGT1 mRNA abundance. It did not, however, prevent activation of TonEBP, suggesting that transcription is not required for the initial activation of TonEBPs (Fig. 3B). Cycloheximide, on the other hand, decreased both BGT1 mRNA abundance and TonEBP activity below the isotonic control level. Protein synthesis appears necessary for activation of TonEBPs. The reduction in transcription of the BGT1 gene (as indicated by the decrease in mRNA abundance) by cycloheximide may be due the decreased activity of TonEBPs. 2-Aminopurine prevented the increase in BGT1 mRNA abundance but not the activation of TonEBPs, i.e., DNA binding. It is possible that activation of transcription (transactivation) by TonEBPs involves serine/threonine phosphorylation, as in many transcription factors (8).
The observation that the hypertonicity-induced increase in TonEBP
activity is temporally correlated with the transcription of the BGT1
gene (Fig. 3A) implies that binding
of TonEBPs to the TonE site in vivo should also correlate with the time
course of TonEBP activity seen in EMSA gels. To test this directly, we performed in vivo footprinting analysis of MDCK cells (Fig.
4). The primers used for this analysis
enabled us to examine
160/+70 region of the BGT1 gene. With the
exception of the G residue at
44 position (Fig.
4A) and the complementary G residue
at
40 position (Fig. 4B), all
the bands seen in control (in vitro methylated) lanes were also seen in
experimental (especially isotonic samples) with similar intensity. In
other words, most of the promoter area was quite accessible for
methylation by dimethyl sulfate, indicating that the
promoter/regulatory region is available to receive the signal of
hypertonicity in the form of TonEBP binding. The second and third G
residues of the TonE site of the BGT1 gene were protected from
methylation (Fig. 4A) in a temporal
correlation with the abundance of TonEBPs (Fig.
3A). The G residue complementary to the C residue in the last (11th) position of TonE was also protected by
hypertonicity with a similar time course (Fig.
4B). Because mutations in these
residues affect binding to TonEBPs (Fig.
4C), the protection of these
residues from methylation is likely due to binding of TonEBPs.
|
On the other hand, methylation of the G residue in the 8th position of the sense strand increased by hypertonicity with a time course similar to the TonEBP activity (27% increase at 6 h, 82% increase at 18 h, and 46% increase at 48 h, n = 4; the signal was calibrated to the reference residues as described in Fig. 4A). Because this residue can be changed without affecting binding to TonEBP (Table 1), it is likely that binding of TonEBPs creates a conformational change in TonE sequence, rendering the 8th residue more accessible to dimethyl sulfate. At any rate, all the changes in the methylation described above were localized and limited to the TonE region, supporting the idea that the TonE site is the major point of control in the response to hypertonicity.
Biochemical characterization of TonEBPs. To characterize DNA binding components of TonEBPs, radiolabeled hTonE or cTonE was covalently cross-linked to TonEBPs by UV irradiation. 32P-TonE was incubated with nuclear extracts and then irradiated with short-wavelength UV light. The mixture was denatured in SDS sample buffer and resolved on an SDS polyacrylamide gel. The same results were obtained for hTonE and cTonE (Fig. 5): there was a large polypeptide of 200 kDa, whose abundance is much greater in hypertonic MDCK cells. We have not detected any other band whose intensity increased consistently in the hypertonic cells compared with the isotonic cells. Labeling of the 200-kDa polypeptide was specifically blocked by 100 nM unlabeled hTonE or cTonE but not by 100 nM hTonE-m8, which does not bind TonEBP (see Fig. 2A), indicating that this protein is a DNA binding component of TonEBPs.
|
| |
DISCUSSION |
|---|
|
|
|---|
TonE may be a general enhancer of hypertonicity. The data presented here indicate that the TonE sequences of the BGT1 and AR genes are functionally identical. The sites of expression for these genes are, however, rather distinct in the renal medulla; AR mRNA expression is limited to the inner medulla, i.e., the thin limb of the loop of Henle and the inner medullary collecting duct, whereas BGT1 mRNA is abundantly expressed in the thick ascending limb (outer medulla) and the inner medullary collecting duct (16). Although the regulation by hypertonicity is mediated by the TonE sequences, other factors, such as tissue-specific transcription factors must determine the tissue distribution of expression. At this time, it is not known whether the TonE sequences are involved in the regulation of other genes whose transcription is also stimulated by hypertonicity such as SMIT (14), the taurine transporter (26) and CD9 (22). It would not be surprising to find that TonEs are involved in their regulation.
Based on the consensus sequence presented in Table 1, one would expect
to find an average of one copy of TonE per 2 kb of genomic DNA
sequence. Because only a few genes have been shown to be stimulated by
hypertonicity, there may be requirements in addition to a copy of the
TonE sequence in the promoter region for transcriptional stimulation.
One possibility is that more than one TonE clustered within a short
range may be required. In the human AR gene, three TonEs are present
within 130 bp (located ~1.1 kb upstream of the promoter), and all of
them are required for full regulation of the promoter (10). When the
TonE of BGT1 is placed in front of the promoter of the SMIT gene, one
copy or two tandem copies are not sufficient to stimulate the promoter in response to hypertonicity (20). On the other hand, four tandem copies of the BGT1 TonE stimulate the SMIT promoter over eightfold in
response to hypertonicity (20), indicating that a synergistic action of
multiple TonEs is required for significant stimulation. Although one
TonE at
62/
52 plays the major role in the regulation of
BGT1, there is an unidentified element(s) in
185/
70
region that is required for full regulation of the promoter (24). It is
not known whether this unidentified element is related to TonE.
TonEBPs are transcription factors and targets of hypertonicity signaling pathways. Based on a tight correlation between binding (or affinity) and stimulation of transcription (Fig. 2B) in a panel of mutant TonE sequences, we characterized TonEBPs that are likely to be transcription factors that interact with the RNA polymerase complex at the promoter. This is further supported by the observation that in vivo methylation of the G residues that are critical for TonEBP binding in vitro (Fig. 2A) is specifically protected in a temporal correlation with the TonEBP activity (Fig. 4). Activation of TonEBPs appears to be the critical step in that it correlates well with the occupancy of the TonE site and transcription. TonEBPs should be the target of the signaling pathways by which hypertonicity stimulates transcription of specific genes whose products lead to accumulation of compatible osmolytes. Alternatively, TonEBPs themselves may serve as tonicity sensors.
Studies using inhibitors provide basic clues to the signaling pathways for activation of TonEBPs. It appears that transcription is not required but translation is necessary for stimulation of TonEBPs (Fig. 3B). Interestingly, inhibition of serine/threonine phosphorylation interferes with transactivation but not the activation of binding of TonEBPs, suggesting that there are two different levels of regulating TonEBPs: activation of binding to TonE and activation of the ability of TonEBP to increase transcription (transactivation). Although TonEBPs are seen as two close bands in EMSA gels, UV cross-linking reveals only one DNA binding polypeptide of 200 kDa. This 200-kDa polypeptide may exist in two forms seen in the EMSA gels possibly as a component of multi-subunit complexes.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant PO1-DK-44484.
| |
FOOTNOTES |
|---|
Address for reprint requests: H. M. Kwon, Johns Hopkins Univ., 963 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205.
Received 9 September 1997; accepted in final form 21 January 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Albertyn, J.,
S. Hohmann,
J. M. Thevelein,
and
B. A. Prior.
GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolality glycerol response pathway.
Mol. Cell. Biol.
14:
4135-4144,
1994
2.
Bagnasco, S. M.,
H. R. Murphy,
J. J. Bedford,
and
M. B. Burg.
Osmoregulation by slow changes in aldose reductase and rapid changes in sorbitol flux.
Am. J. Physiol.
254 (Cell Physiol. 23):
C788-C792,
1988
3.
Cowley, B. D.,
J. D. Ferraris,
D. Carper,
and
M. B. Burg.
In vivo osmoregulation of aldose reductase mRNA, protein and sorbitol in renal medulla.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F154-F161,
1990
4.
Daoudal, S.,
C. Tournaire,
A. Halere,
G. Veyssiere,
and
C. Jean.
Isolation of the mouse aldose reductase promoter and identification of a tonicity-responsive element.
J. Biol. Chem.
272:
2615-2619,
1997
5.
Ferraris, J. D.,
C. K. Williams,
K. Jung,
J. J. Bedford,
M. B. Burg,
and
A. Garcia-Perez.
ORE, a eukaryotic minimal essential osmotic response element.
J. Biol. Chem.
271:
18318-18321,
1996
6.
Garcia-Perez, A.,
and
M. B. Burg.
Renal medullary organic osmolytes.
Physiol. Rev.
71:
1081-1115,
1991
7.
Giannini, G.,
L. D. Marcotullio,
F. Zazzeroni,
E. Alesse,
M. Zani,
A. T'Ang,
V. Sorrentino,
I. Screpanti,
L. Frati,
and
A. Gulino.
2-Aminopurine unravels a role for pRB in the regulation of gene expression by transforming growth factor
.
J. Biol. Chem.
272:
5313-5319,
1997
8.
Karin, M.,
and
T. Hunter.
Transcriptional control by protein phosphorylation: signal transmission from the cell surface to the nucleus.
Curr. Biol.
5:
747-757,
1995[Medline].
9.
Kitamura, H.,
A. Yamauchi,
T. Nakanishi,
Y. Takamitsu,
T. Sugiura,
A. Akagi,
T. Moriyama,
M. Horio,
and
E. Imai.
Effects of inhibition of myo-inositol transport on MDCK cells under hypertonic environment.
Am. J. Physiol.
272 (Renal Physiol. 41):
F267-F272,
1997
10.
Ko, B. C. B.,
B. Ruepp,
K. M. Bohren,
K. H. Gabbay,
and
S. S. M. Chung.
Identification and characterization of multiple osmotic response sequences in the human aldose reductase gene.
J. Biol. Chem.
272:
16431-16437,
1997
11.
Kultz, D.,
A. Garcia-Perez,
J. D. Ferraris,
and
M. B. Burg.
Distinct regulation of osmoprotective genes in yeast and mammals.
J. Biol. Chem.
272:
13165-13170,
1997
12.
Kwon, H. M.,
and
J. S. Handler.
Cell volume regulated transporters of compatible osmolytes.
Curr. Opin. Cell Biol.
7:
465-471,
1995[Medline].
13.
Kwon, H. M.,
I. Takahito,
J. S. Rim,
and
J. S. Handler.
The MAP kinase cascade is not essential for transcriptional stimulation of osmolyte transporter genes.
Biochem. Biophys. Res. Commun.
213:
975-979,
1995[Medline].
14.
Kwon, H. M.,
A. Yamauchi,
S. Uchida,
A. S. Preston,
A. Garcia-Perez,
M. B. Burg,
and
J. S. Handler.
Cloning of the cDNA for a Na+/myo-inositol cotransporter, a hypertonicity stress protein.
J. Biol. Chem.
267:
6297-6301,
1992
15.
Martial, S.,
S. R. Price,
and
J. M. Sands.
Regulation of aldose reductase, sorbitol dehydrogenase, and taurine cotransporter mRNA in rat medulla.
J. Am. Soc. Nephrol.
5:
1971-1978,
1995
16.
Miyai, A.,
A. Yamauchi,
T. Moriyama,
T. Kaneko,
M. Takenaka,
T. Sugiura,
H. Kitamura,
A. Ando,
M. Tohyama,
S. Shimada,
E. Imai,
and
T. Kamata.
Expression of betaine transporter mRNA: Its unique localization and rapid regulation in rat kidney.
Kidney Int.
50:
819-827,
1996[Medline].
17.
Moeckel, G. W.,
L. Lai,
W. G. Guder,
H. M. Kwon,
and
Y. H. Lien.
Kinetics and osmoregulation of Na+- and Cl
-dependent betaine transporter in rat renal medulla.
Am. J. Physiol.
272 (Renal Physiol. 41):
F100-F106,
1997
18.
Mueller, P. R.,
P. A. Garrity,
and
B. Wold, B.
Ligation-mediated PCR for genomic sequencing and footprinting.
In: Current Protocols in Molecular Biology, edited by F. M. Ausubel,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith,
and S. Struhl. New York: Wiley, 1992, vol. 2, p. 15.5.1-15.5.26.
19.
Posas, F.,
and
H. Saito.
Osmotic activation of the HOG MAPK pathway via Ste 11p MAPKKK: scaffold role of Pbs2p MAPKK.
Science
276:
1702-1705,
1997
20.
Rim, J. S.,
S. Tanawattanacharoen,
M. Takenaka,
J. S. Handler,
and
H. M. Kwon.
The canine sodium/myo-inositol cotransporter gene: Structural organization and characterization of the promoter.
Arch. Biochem. Biophys.
341:
193-199,
1997[Medline].
21.
Ruep, B.,
K. M. Bohren,
and
K. H. Gabbay.
Characterization of the osmotic response element of the human aldose reductase gene promoter.
Proc. Natl. Acad. Sci. USA
93:
8624-8629,
1995
22.
Sheikh-Hamad, D.,
J. D. Ferraris,
J. Dragolovich,
H. G. Preuss,
M. B. Burg,
and
A. Garcia-Perez.
CD9 antigen mRNA is induced by hypertonicity in two renal epithelial cell lines.
Am. J. Physiol.
270 (Cell Physiol. 39):
C253-C258,
1996
23.
Sone, M.,
A. Ohno,
G. J. Albrecht,
K. Thurau,
and
F. Beck.
Restoration of urine concentrating ability and accumulation of medullary osmolytes after chronic diuresis.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F480-F490,
1995
24.
Takenaka, M.,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress.
J. Biol. Chem.
269:
29379-29381,
1994
25.
Tanaka, M.
Modulation of promoter occupancy by cooperative DNA binding and activation-domain function is a major determinant of transcriptional regulation by activators in vivo.
Proc. Natl. Acad. Sci. USA
93:
4311-4315,
1996
26.
Uchida, S.,
H. M. Kwon,
A. Yamauchi,
A. S. Preston,
F. Marumo, F.,
and
J. S. Handler.
Molecular cloning of the cDNA for an MDCK cell Na+- and Cl
-dependent taurine transporter that is regulated by hypertonicity.
Proc. Natl. Acad. Sci. USA
89:
8230-8234,
1992
27.
Uchida, S.,
T. Nakanishi,
H. M. Kwon,
A. S. Preston,
and
J. S. Handler.
Taurine behaves as an osmolyte in Madin-Darby canine kidney cells.
J. Clin. Invest.
88:
656-662,
1991.
28.
Uchida, S.,
A. Yamauchi,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
Medium tonicity regulates expression of the Na+- and Cl
-dependent betaine transporter in Madin-Darby canine kidney cells by increasing transcription of the transporter gene.
J. Clin. Invest.
91:
1604-1607,
1993.
29.
Weinhold, P. A.,
N. Thanukrishna,
and
L. Anderson.
Antagonistic relationship between myo-inositol and 2-O,C-methylene-myo-inositol in animals.
Proc. Soc. Exp. Biol. Med.
112:
165-168,
1963.
30.
Yamauchi, A.,
H. M. Kwon,
S. Uchida,
A. S. Preston,
and
J. S. Handler.
Myo-inositol and betaine transporters regulated by tonicity are basolateral in MDCK cells.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F197-F202,
1991
31.
Yamauchi, A.,
S. Uchida,
H. M. Kwon,
A. S. Preston,
R. B. Robey,
A. Garcia-Perez,
M. B. Burg,
and
J. S. Handler.
Cloning of a Na+- and Cl
-dependent betaine transporter that is regulated by hypertonicity.
J. Biol. Chem.
267:
649-652,
1992
32.
Yancey, P. H.,
M. B. Burg,
and
S. M. Bagnasco.
Effects of NaCl, glucose, and aldose reductase inhibitors on cloning efficiency of renal medullary cells.
Am. J. Physiol.
258 (Cell Physiol. 27):
C156-C163,
1990
33.
Yancey, P. H.,
M. E. Clark,
S. C. Hand,
R. D. Bowlus,
and
G. N. Somero.
Living with water stress: evolution of osmolyte system.
Science
217:
1214-1222,
1982
This article has been cited by other articles:
![]() |
M. S. Kwon, S. W. Lim, and H. M. Kwon Hypertonic Stress in the Kidney: A Necessary Evil Physiology, June 1, 2009; 24(3): 186 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Hoffmann, I. H. Lambert, and S. F. Pedersen Physiology of Cell Volume Regulation in Vertebrates Physiol Rev, January 1, 2009; 89(1): 193 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rodgaard, K. Schou, M. B. Friis, and E. K. Hoffmann Does the intracellular ionic concentration or the cell water content (cell volume) determine the activity of TonEBP in NIH3T3 cells? Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1528 - C1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Saito, T. Saito, K. Kasono, H. Tamemoto, M. Kawakami, S. Sasaki, and S.-e Ishikawa Hypotonicity reduces the activity of murine aquaporin-2 promoter induced by dibutyryl cAMP Exp Physiol, October 1, 2008; 93(10): 1147 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bissonnette, K. Lahjouji, M. J. Coady, and J.-Y. Lapointe Effects of hyperosmolarity on the Na+-myo-inositol cotransporter SMIT2 stably transfected in the Madin-Darby canine kidney cell line Am J Physiol Cell Physiol, September 1, 2008; 295(3): C791 - C799. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Z. Li, B. W. McDill, P. A. Kovach, L. Ding, W. Y. Go, S. N. Ho, and F. Chen Calcineurin-NFATc signaling pathway regulates AQP2 expression in response to calcium signals and osmotic stress Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1606 - C1616. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Padda, A. Wamsley-Davis, M. C. Gustin, R. Ross, C. Yu, and D. Sheikh-Hamad MEKK3-mediated signaling to p38 kinase and TonE in hypertonically stressed kidney cells Am J Physiol Renal Physiol, October 1, 2006; 291(4): F874 - F881. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Yang, W. Y. Tam, S. Tam, H. Guo, X. Wu, G. Li, J. F. L. Chau, J. D. Klein, S. K. Chung, J. M. Sands, et al. Genetic restoration of aldose reductase to the collecting tubules restores maturation of the urine concentrating mechanism Am J Physiol Renal Physiol, July 1, 2006; 291(1): F186 - F195. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rojek, J. Nielsen, H. L. Brooks, H. Gong, Y.-H. Kim, T.-H. Kwon, J. Frokiaer, and S. Nielsen Altered expression of selected genes in kidney of rats with lithium-induced NDI Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1276 - F1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, W. Tian, J. N. Lindsley, T. T. Oyama, J. M. Capasso, C. J. Rivard, H. T. Cohen, S. M. Bagnasco, S. Anderson, and D. M. Cohen EphA2: expression in the renal medulla and regulation by hypertonicity and urea stress in vitro and in vivo Am J Physiol Renal Physiol, April 1, 2005; 288(4): F855 - F866. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kempson, V. Parikh, L. Xi, S. Chu, and M. H. Montrose Subcellular redistribution of the renal betaine transporter during hypertonic stress Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1091 - C1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, J. D. Ferraris, H. L. Brooks, I. Brisc, and M. B. Burg Expression of osmotic stress-related genes in tissues of normal and hyposmotic rats Am J Physiol Renal Physiol, October 1, 2003; 285(4): F688 - F693. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, W. Tian, C. Tai, and D. M. Cohen Hypertonic induction of COX-2 expression in renal medullary epithelial cells requires transactivation of the EGFR Am J Physiol Renal Physiol, August 1, 2003; 285(2): F281 - F288. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Na, S. K. Woo, S. D. Lee, and H. M. Kwon Silencing of TonEBP/NFAT5 Transcriptional Activator by RNA Interference J. Am. Soc. Nephrol., February 1, 2003; 14(2): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Storm, E. Klussmann, A. Geelhaar, W. Rosenthal, and K. Maric Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells Am J Physiol Renal Physiol, January 1, 2003; 284(1): F189 - F198. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Jung, Y.-H. Kim, J.-H. Cha, K.-H. Han, M.-K. Kim, K. M. Madsen, and J. Kim Expression of aldose reductase in developing rat kidney Am J Physiol Renal Physiol, September 1, 2002; 283(3): F481 - F491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Woo, S. D. Lee, K. Y. Na, W. K. Park, and H. M. Kwon TonEBP/NFAT5 Stimulates Transcription of HSP70 in Response to Hypertonicity Mol. Cell. Biol., August 15, 2002; 22(16): 5753 - 5760. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. CHA, S. K. WOO, K. H. HAN, Y. H. KIM, J. S. HANDLER, J. KIM, and H. M. KWON Hydration Status Affects Nuclear Distribution of Transcription Factor Tonicity Responsive Enhancer Binding Protein in Rat Kidney J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2221 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuzaki, T. Suzuki, and K. Takata Hypertonicity-induced expression of aquaporin 3 in MDCK cells Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Tian and D. M. Cohen Urea inhibits hypertonicity-inducible TonEBP expression and action Am J Physiol Renal Physiol, May 1, 2001; 280(5): F904 - F912. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Dahl, J. S. Handler, and H. M. Kwon Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP Am J Physiol Cell Physiol, February 1, 2001; 280(2): C248 - C253. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Trama, Q. Lu, R. G. Hawley, and S. N. Ho The NFAT-Related Protein NFATL1 (TonEBP/NFAT5) Is Induced Upon T Cell Activation in a Calcineurin-Dependent Manner J. Immunol., November 1, 2000; 165(9): 4884 - 4894. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity Am J Physiol Renal Physiol, June 1, 2000; 278(6): F1006 - F1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Hoffert, V. Leitch, P. Agre, and L. S. King Hypertonic Induction of Aquaporin-5 Expression through an ERK-dependent Pathway J. Biol. Chem., March 17, 2000; 275(12): 9070 - 9077. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Woo, D. Maouyo, J. S. Handler, and H. M. Kwon Nuclear redistribution of tonicity-responsive enhancer binding protein requires proteasome activity Am J Physiol Cell Physiol, February 1, 2000; 278(2): C323 - C330. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Tian, G. R. Boss, and D. M. Cohen Ras signaling in the inner medullary cell response to urea and NaCl Am J Physiol Cell Physiol, February 1, 2000; 278(2): C372 - C380. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, X.-Y. Yang, S. P. Soltoff, and D. M. Cohen PI3K signaling in the murine kidney inner medullary cell response to urea Am J Physiol Renal Physiol, January 1, 2000; 278(1): F155 - F164. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bai, J. F. Collins, Y. L. Muller, H. Xu, P. R. Kiela, and F. K. Ghishan Characterization of cis-elements required for osmotic response of rat Na+/H+ exchanger-2 (NHE-2) gene Am J Physiol Regulatory Integrative Comp Physiol, October 1, 1999; 277(4): R1112 - R1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Yang, Z. Zhang, and D. M. Cohen ERK activation by urea in the renal inner medullary mIMCD3 cell line Am J Physiol Renal Physiol, August 1, 1999; 277(2): F176 - F185. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iwata, S. Sato, J. Jimenez, M. McGowan, M. Moroni, A. Dey, N. Ibaraki, V. N. Reddy, and D. Carper Osmotic Response Element Is Required for the Induction of Aldose Reductase by Tumor Necrosis Factor-alpha J. Biol. Chem., March 19, 1999; 274(12): 7993 - 8001. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Miyakawa, S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity PNAS, March 2, 1999; 96(5): 2538 - 2542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Ferraris, C. K. Williams, A. Ohtaka, and A. Garcia-Perez Functional consensus for mammalian osmotic response elements Am J Physiol Cell Physiol, March 1, 1999; 276(3): C667 - C673. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Rim, M. G. Atta, S. C. Dahl, G. T. Berry, J. S. Handler, and H. M. Kwon Transcription of the Sodium/myo-Inositol Cotransporter Gene Is Regulated by Multiple Tonicity-responsive Enhancers Spread over 50 Kilobase Pairs in the 5'-Flanking Region J. Biol. Chem., August 7, 1998; 273(32): 20615 - 20621. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakayama, T. Peng, J. M. Sands, and S. M. Bagnasco The TonE/TonEBP Pathway Mediates Tonicity-responsive Regulation of UT-A Urea Transporter Expression J. Biol. Chem., December 1, 2000; 275(49): 38275 - 38280. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, W. Tian, and D. M. Cohen Rottlerin inhibits tonicity-dependent expression and action of TonEBP in a PKCdelta -independent fashion Am J Physiol Renal Physiol, April 1, 2002; 282(4): F710 - F717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |