|
|
||||||||
Department of Pediatrics, Ohio State University and the Wexner Institute for Pediatric Research, Children's Hospital, Columbus, Ohio 43205
| |
ABSTRACT |
|---|
|
|
|---|
Somatostatin modulates several renal tubular cell functions, including gluconeogenesis and proliferation. In this study, we demonstrate that cultured human proximal tubular epithelial cells (PTEC) express somatostatin. We also demonstrate positive and negative regulation of PTEC somatostatin production. We found that PTEC derived from 14 different human donors consistently expressed somatostatin mRNA and/or peptide as detected by RT-PCR and enzyme-linked immunoassay. Furthermore, Northern blot analysis revealed that PTEC express the same size mRNA transcript (750 nucleotides) as human thyroid carcinoma (TT) cells. The PTEC mitogens, epidermal growth factor (EGF) and hydrocortisone, inhibit PTEC somatostatin secretion, whereas forskolin (a direct stimulator of adenylate cyclase) and fetal bovine serum stimulate secretion. These findings raise the possibility that renal-derived somatostatin modulates tubular cell function in an autocrine/paracrine manner. Manipulation of this pathway may lead to novel methods with which to alter tubular cell proliferation and function in vivo.
somatotropin release inhibitory factor; epidermal growth factor; hydrocortisone; kidney; paracrine
| |
INTRODUCTION |
|---|
|
|
|---|
SOMATOSTATIN is well recognized for its role as a neuropeptide, a hypothalamic inhibitor of growth hormone release, and a paracrine inhibitor of gut peptide secretion (25). Although not commonly thought of as a renal regulatory peptide, somatostatin also modulates renal cell function and growth. Somatostatin inhibits proliferation of opossum kidney (OK) proximal tubular cells (10) and rat mesangial cells (34), contraction of human mesangial cells (6, 7), vasopressin-induced water permeability of microperfused rat papillae (28), and cAMP production in cultured rat renal collecting tubule cells (13). Somatostatin also stimulates gluconeogenesis in rat proximal tubules (3).
The biological effects of somatostatin are mediated by specific somatostatin receptors (26, 29). The fact that somatostatin modulates proximal tubular cell proliferation and gluconeogenesis suggests that proximal tubular cells express functional somatostatin receptors. Somatostatin receptors have been detected on proximal tubule cells in human kidney tissue sections by in vitro receptor autoradiography (30) and in opossum (OK) proximal tubular cells by radioligand binding assays (10). Somatostatin receptors have also been detected on renal cell carcinomas (31), which are predominately of proximal tubular origin (37).
Because proximal tubules express somatostatin receptors and somatostatin modulates proximal tubular cell function, we hypothesized that proximal tubular cells produce somatostatin and thereby modulate proximal tubular cell proliferation and function in an autocrine/paracrine manner. Herein we demonstrate that cultured human proximal tubular epithelial cells (PTEC) express somatostatin mRNA and peptide. We also demonstrate that fetal bovine serum (FBS) and cAMP stimulate, whereas epidermal growth factor (EGF) and hydrocortisone inhibit, secretion of somatostatin peptide.
| |
METHODS |
|---|
|
|
|---|
Cell culture. Primary cultures of
human PTEC were generated from normal human cadaveric kidneys
unsuitable for renal transplantation as previously described (8, 39).
Tissue was provided by the Ohio State University and Children's
Hospital Cooperative Human Tissue Network. PTEC growth medium consisted
of GIBCO MEM
(Life Technologies) with 10%
heat-inactivated FBS, 5 µg/ml hydrocortisone (Collaborative Research,
Bedford, MA), 10 ng/ml recombinant human EGF (GIBCO), 100 U/ml
penicillin/streptomycin, and ITS (Collaborative Research). ITS consists
of 6.25 µg/ml insulin, 6.25 µg/ml transferrin, 6.25 ng/ml selenous
acid, and 1.25 mg/ml bovine serum albumin. We have previously (39)
characterized these tubular cells as being uniformly positive for
cytokeratin,
-glutamyl transferase, alkaline phosphatase, and URO-3
(Signet Laboratories, Dedham, MA), indicating that these cells are of
proximal tubular origin and retain proteins expressed by PTEC in vivo
(2, 8). Cells were plated at ~1 × 105 cells/ml and split 1:3 or 1:4
when confluent. Cells used for experiments were between passages 3 and
8.
The human neuroblastoma cell line, SKNSH, and the human thyroid medullary carcinoma cell line, TT, were purchased from the American Type Culture Collection (Manassas, VA). SKNSH cells were cultured and maintained as previously described (20) in MEM with L-glutamine, Earle's salts, nonessential amino acids, and 15% FBS. TT cultures were maintained in RPMI 1640 with 15% FBS and L-glutamine, as recommended by the American Type Culture Collection.
Reverse transcription and polymerase chain
reaction. Reverse transcription-polymerase chain
reaction (RT-PCR) was performed with previously described
oligonucleotide primers (40). These primers were designed from
published gene and cDNA sequences for somatostatin (35) (accession no.
J00306); the constitutively expressed protooncogene, c-abl (36) (no.
M14752); human
-actin (19) (no. M10277); neuropeptide Y (NPY) (18)
(no. M14752); and vasoactive intestinal peptide (VIP) (38) (no.
M11552). Each primer pair amplifies across an intron/exon splice site
such that products derived from mRNA can be easily differentiated from products derived from genomic DNA. We have previously used the somatostatin primers to detect somatostatin mRNA in cadaveric kidney
specimens and cultured human mesangial cells (40) and human
neuroblastoma tumors (1). The VIP and NPY primers have been used to
detect VIP and NPY mRNA in SKNSH human neuroblastoma cells (40) and VIP
mRNA in megakaryocytes (24).
Total RNA was isolated from PTEC using the RNAzol method as described by manufacturer (Cinna/Biotex, Friendswood, TX). Total RNA (1 µg) was reverse transcribed with random hexamer primers followed by amplification of cDNA by polymerase chain reaction (GeneAmp kit; Perkin-Elmer Cetus, Norwalk, CT). Reaction mixtures were subjected to 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min for 33 cycles followed by 72°C for 9 min. RT-PCR products were resolved by electrophoresis at 100 V through 1.75% agarose in 1× TAE (0.04 M Tris acetate, 0.001 M EDTA, pH 8.0) and visualized with ethidium bromide.
Southern hybridization of somatostatin RT-PCR products. Southern analysis with a 42-residue oligonucleotide complementary to somatostatin cDNA was used to confirm that somatostatin RT-PCR products contained somatostatin-specific sequence as previously described (40). This probe (5' CTGGGACAGATCTTCAGGTTCCAGGGCATCATTCTCCGTCTG 3') is complementary to a region of somatostatin cDNA nested in between the binding sites for somatostatin RT-PCR primers. The RT-PCR products were transferred to a nylon membrane and hybridized with the 42-nucleotide somatostatin probe, which was 32P-labeled with T4 polynucleotide kinase. Hybridization was performed in 50% formamide at 42°C overnight. The membranes were washed sequentially with 2× SSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0) at room temperature, 2× SSC with 1% sodium dodecyl sulfate at 65°C, and then 0.1× SSC at room temperature. Bound 32P-labeled probe was detected by autoradiography. To control for nonspecific hybridization, c-abl RT-PCR products were also included on all blots.
DNA sequencing of PTEC somatostatin RT-PCR products. To confirm that PTEC-derived somatostatin RT-PCR products were identical to the published somatostatin cDNA sequence (35), we sequenced RT-PCR products after cloning into pGEM-T (Promega, Madison, WI). pGEM-T contains a 3' thymidine residue to facilitate ligation of PCR products. Somatostatin inserts from pGEM-T clones were sequenced in both directions with M13 forward and reverse primers complementary to sites on either side of the somatostatin insert. Sequencing was performed with an ABI Prism Automatic DNA sequencer (Perkin-Elmer, Foster City, CA).
Northern blot analysis. Total RNA was isolated from cadaveric human renal cortex specimens, TT cells, and PTEC as described above. PTEC were exposed to 10 µM forskolin for 16 h before RNA was isolated. Poly(A)+ mRNA was isolated from PTEC and renal cortex RNA using an Oligotex Poly(A)+ purification kit as described by the manufacturer (Qiagen, Chatsworth, CA). After electrophoresis through a 1.3% agarose gel, RNA was transferred to nylon membranes and hybridized with 32P-labeled somatostatin insert from a cloned and sequenced somatostatin RT-PCR product derived from PTEC RNA. Blots were hybridized in 50% formamide at 42°C overnight. After washing, bound 32P-labeled probe was detected by autoradiography. Size of transcripts was estimated by ethidium bromide staining of RNA standards.
Enzyme-linked immunoassay for
somatostatin. Confluent monolayers of PTEC were
incubated in MEM
with 10% FBS for 48 h. The somatostatin
immunoreactive material in this "conditioned medium" was
partially purified by C18 Sep-Pak
(Millipore, Milford, MA) chromatography. Sep-Pak columns were prepared
with 5 ml of 70% ethanol, 10 ml of 2-propanolol, and 10 ml of deionized water. After application of 10 ml of conditioned or
untreated control medium, columns were washed with 10 ml of deionized
water. Adherent molecules were then eluted with 100% ethanol. Phenol
red-free medium was used, because phenol red coelutes with peptides
from the Sep-Pak column during ethanol elution and interferes with the
enzyme-linked immunoassay (EIA). Samples were dried without heat in a
DNA Speed-Vac (Savant Instruments, Farmingdale, NY). The resulting
pellets were stored frozen at
70°C until assayed. To control
for somatostatin immunoreactivity in serum or other supplements in
medium, untreated "control" medium (i.e., medium not exposed to
PTEC) was processed in an identical manner as conditioned medium and
tested for somatostatin immunoreactivity by EIA.
Cells were extracted by the acid ethanol procedure (22). Cell extracts were assayed for total protein by the method of Lowry et al. (17).
Samples were resuspended in EIA buffer (10 mM Tris, 0.15 M NaCl, pH 7.4 with 0.1% Tween-20, 0.1% bovine serum albumin and 0.02% thimerosal). Somatostatin was measured with a commercially available EIA as directed by manufacturer (Peninsula Laboratories, Belmont, CA). Briefly, sample, somatostatin antiserum and biotinylated somatostatin were added to wells of a 96-well plate precoated with protein A. After incubation for 2 h at room temperature, unbound material was removed, and the plates were washed. Wells were then incubated with streptavidin-horseradish peroxidase conjugate followed by substrate solution (hydrogen peroxide and 3,3',5,5'-tetramethylbenzidine dihydrochloride). After stopping the reaction with 2 N HCl, absorbance at 450 nM was measured with an EIA plate reader.
According to the manufacturer, the somatostatin antiserum used for this assay does not cross-react with substance P, NPY, VIP, insulin, glucagon, or amylin amide. The linear range for the somatostatin EIA is 10 to 2,000 pg/ml. The intra-assay and interassay variation is <5% and <14%, respectively.
Radioimmunoassay for NPY and VIP. RIAs for NPY and VIP were performed by the Core Peptide Laboratory of the General Clinical Research Center (RR-34) at the Ohio State University using assays subjected to rigorous quality control as previously published (5, 21, 22, 27). Characteristics of the antisera used for these assays have been published previously (21, 22, 40). The lower limit of sensitivity of the VIP RIA is 5 pg/ml (5) and 20 pg/ml for the NPY RIA (personal communication, T. M. O'Dorisio, Ohio State University). Samples were prepared for RIA as previously described (40).
Measurement of cellular cAMP content.
PTEC were exposed to MEM
or MEM
with 10 µM forskolin (Sigma,
St. Louis, MO) and/or 1 mM IBMX (Sigma). After
incubation at 37°C for 20 min, cells were extracted as described
(41) for 2 h at 4°C with ice-cold acid-ethanol (100% ethanol
brought to pH 3.0 with hydrochloric acid). Extracts were dried at
37°C under nitrogen and then assessed for cAMP content with the
Titerfluor Dual Range cAMP fluorescence immunoassay (PerSeptive
Biosystems, Framingham, MA) as described by manufacturer.
Data analysis. For immunoassays, data are expressed as means ± SE. Results of independent experiments were pooled and groups were compared by one-way ANOVA or t-test, as appropriate. For ANOVA, post hoc analysis between groups was performed using the Student-Newman-Keuls test. Significance was defined as P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Proximal tubular cells express somatostatin mRNA. RT-PCR of PTEC RNA with somatostatin-specific primers resulted in a single product ~356 bp in size (Fig. 1). This corresponds to the expected size of an RT-PCR product derived from somatostatin mRNA, whereas amplification of the somatostatin gene from genomic DNA results in a 1,233-bp fragment. Somatostatin RT-PCR products were detected with PTEC RNA derived from six of six different donors. No products were obtained when reverse transcriptase was omitted from the reaction mixture (Fig. 1).
|
Because somatostatin serves as a neuropeptide in the nervous system, we also tested PTEC for expression of other neuropeptides in addition to somatostatin. When PTEC RNA was subjected to RT-PCR with VIP- or NPY-specific oligonucleotides, no RT-PCR products were obtained (Fig. 1). Previously, we demonstrated that, with these same primers, SKNSH neuroblastoma cells express NPY and VIP mRNA, but not somatostatin mRNA (40), confirming the adequacy and specificity of these primers. Thus our current results demonstrate that cultured human PTEC specifically produce somatostatin mRNA but do not produce detectable NPY or VIP transcripts.
Somatostatin RT-PCR products from PTEC RNA derived from two different donors were analyzed by Southern blot analysis to confirm that they contained somatostatin-specific nucleotide sequences. To control for nonspecific hybridization, c-abl RT-PCR products were also included on the blot. 32P-labeled somatostatin probe hybridized specifically to the somatostatin RT-PCR products, but not to c-abl RT-PCR products (Fig. 2). The ability of somatostatin-specific probe to hybridize specifically to somatostatin RT-PCR products confirms that the somatostatin RT-PCR products are not amplification artifacts.
|
To determine whether the 356-bp somatostatin RT-PCR product from PTEC is identical to the published somatostatin cDNA sequence in its entirety, somatostatin RT-PCR products from three different donors were cloned into pGEM-T, and the insert was sequenced. The sequences of all three inserts from cloned RT-PCR products were identical to the published somatostatin cDNA sequence (35).
Northern blot analysis of PTEC somatostatin mRNA. Poly(A)+ RNA from PTEC and whole cadaveric human renal cortex, as well as total RNA from human thyroid carcinoma (TT) cells, were blotted and hybridized with a 32P-labeled somatostatin cDNA probe. TT human thyroid carcinoma cells express an abundant 750-nucleotide somatostatin mRNA transcript (33) and were used as a positive control. An ~750-nucleotide somatostatin transcript was detected for all three sources of RNA (Fig. 3). These results confirm that PTEC and whole kidney express somatostatin mRNA and indicate that renal-derived somatostatin mRNA is the same size as in human thyroid carcinoma cells.
|
PTEC express somatostatin peptide. To determine whether PTEC translate somatostatin mRNA into peptide, PTEC culture supernatants were tested for somatostatin immunoreactivity. Medium that overlaid PTEC cultures for 48 h (conditioned medium) contained significantly greater quantities of somatostatin (1,385 ± 316 pg/ml, means ± SE) than untreated control medium that had not been exposed to cells (72 ± 3 pg/ml) (Fig. 4). FBS contains a small amount of somatostatin, which accounts for the small amount of somatostatin detected in untreated medium. The amount of somatostatin secreted from PTEC derived from different donors varied considerably, ranging from 266 to 4,439 pg/ml. PTEC cellular extracts had no detectable somatostatin. Dilution of somatostatin from PTEC culture supernatants paralleled the dilution curve for synthetic somatostatin standard, indicating that PTEC-derived somatostatin has the same immunodilution properties as synthetic somatostatin standard (14).
|
To determine whether PTEC secrete neuropeptides other than somatostatin, PTEC cell extracts and conditioned medium were analyzed by RIA for NPY and VIP. Neither PTEC-conditioned medium nor cellular extracts contained NPY or VIP immunoreactivity (data not shown). These results indicate that PTEC synthesize and secrete somatostatin, but not NPY or VIP.
To confirm that medium conditioned by other cell types does not contain somatostatin immunoreactivity, SKNSH human neuroblastoma cells, which do not express somatostatin mRNA (40), were tested for somatostatin immunoreactivity. Medium conditioned by exposure to SKNSH cells for 48 h contained no detectable somatostatin peptide beyond that present in untreated control medium (data not shown).
Somatostatin expression by PTEC derived from different donors. PTEC derived from 14 different donors were tested for expression of somatostatin mRNA and/or peptide by RT-PCR, Northern blot analysis, and EIA. PTEC from all 14 donors expressed somatostatin mRNA and/or peptide. The identity of the somatostatin RT-PCR products was confirmed by either Southern blot analysis or by DNA sequencing for products derived from five of six donors. PTEC derived from 12 of 12 donors expressed somatostatin peptide as detected by EIA of culture supernatants. There was 100% concurrence in five cases in which PTEC derived from a single donor were tested for both somatostatin mRNA and peptide expression. These results indicate that PTEC consistently produce somatostatin.
Regulation of PTEC somatostatin
expression. PTEC secrete substantial amounts of
somatostatin when cultured in the presence of MEM
with 10% FBS
(Fig. 4). To determine whether the various components of complete PTEC
growth medium influence somatostatin secretion, we assessed the ability
of individual medium components to alter PTEC somatostatin production
(Fig. 5). To control for variability in
somatostatin secretion by PTEC derived from different donors, each
donor served as its own control for these experiments. Thus
somatostatin secretion is expressed as percent of that obtained with
MEM
medium with 10% FBS (M + FBS) and no other
supplements. In the presence of unsupplemented MEM
without serum,
PTEC secrete only 15% as much somatostatin as in the presence of 10%
FBS. Addition of the nonserum supplements of complete growth medium
(i.e., EGF, hydrocortisone, and ITS) to MEM
decreased somatostatin
secretion to a lower level than that obtained in the presence of MEM
alone. Furthermore, the nonserum growth supplements
decreased serum-stimulated somatostatin secretion markedly when added
to M + FBS. These results indicate that FBS stimulates,
whereas the nonserum growth supplements inhibit, PTEC somatostatin
secretion.
|
To determine which growth supplements inhibit FBS-stimulated
somatostatin secretion, PTEC were incubated with individual supplement components in addition to FBS (Fig. 5). Addition of the ITS supplement or insulin alone did not alter somatostatin secretion. However, EGF and
hydrocortisone decreased somatostatin secretion to 53 ± 3% and 44 ± 13%, respectively, compared with that obtained in the presence
of MEM
with 10% FBS. These results indicate that EGF and
hydrocortisone inhibit FBS-stimulated PTEC somatostatin secretion.
The inhibitory effects of EGF and hydrocortisone on somatostatin
secretion were dose dependent (Figs. 6,
A and
B, respectively). EGF and
hydrocortisone maximally inhibited somatostatin secretion at 10 to 50 ng/ml and 10
6 M,
respectively.
|
In other somatostatin-producing cells, factors that increase intracellular cAMP increase somatostatin transcription, because the somatostatin gene contains a cAMP response element (9, 25). Therefore, increasing intracellular cAMP levels would be expected to induce somatostatin expression by PTEC. To increase intracellular cAMP levels, PTEC were exposed to forskolin, which directly activates adenylate cyclase, and IBMX, which decreases degradation of cAMP by inhibiting phosphodiesterase. To determine whether cAMP induction correlates with increased somatostatin secretion, PTEC were incubated with forskolin and/or IBMX for 24 h, and then somatostatin content of culture supernatants was assessed. Incubation with forskolin or with forskolin plus IBMX increased somatostatin secretion 45-fold and 71-fold above basal levels, respectively (Fig. 7). Correspondingly, incubation of PTEC with forskolin or with forskolin plus IBMX increased cAMP content 38-fold and 85-fold above basal levels, respectively (data not shown). These results indicate that PTEC somatostatin secretion is greatly augmented by agents that increase intracellular cAMP.
|
| |
DISCUSSION |
|---|
|
|
|---|
We previously demonstrated that somatostatin mRNA is expressed in samples of cadaveric human renal cortex and in cultured human mesangial cells (40). We also demonstrated that mesangial cells secrete somatostatin peptide (40). Because proximal tubular cells express somatostatin receptors (10, 30), we hypothesized that PTEC also express somatostatin, providing an autocrine/paracrine mechanism for somatostatin to regulate PTEC function and growth. In this study we confirm this hypothesis. Several methods were used to verify that PTEC consistently express authentic somatostatin mRNA and peptide. Results of Southern blot analysis and sequencing of PTEC somatostatin RT-PCR products disprove the possibility that somatostatin-specific PTEC RT-PCR products were amplification artifacts. Northern blot analysis further confirms expression of somatostatin mRNA in PTEC. Northern blot analysis also demonstrates that PTEC somatostatin transcripts are processed to the same size as somatostatin mRNA in other cells types, indicating that PTEC somatostatin transcripts do not undergo alternative splicing.
Authenticity of PTEC somatostatin peptide was confirmed by the ability of PTEC-derived somatostatin to bind to somatostatin-specific antiserum and to parallel the immunodilution curve of synthetic somatostatin standard. Furthermore, cAMP, a known inducer of somatostatin in other cell types, greatly stimulates PTEC somatostatin secretion.
Somatostatin expression was detected in PTEC derived from 14 of 14 different donors, indicating that PTEC consistently express somatostatin. The fact that PTEC do not produce NPY or VIP and that SKNSH cells do not produce somatostatin attests to the cellular specificity of expression of these neuropeptides and the specificity of the assays used to detect these products. Thus our results establish that cultured human PTEC express somatostatin.
PTEC cultured in medium with fetal bovine serum contained, on average, 1,385 pg/ml of somatostatin, corresponding to 0.8 nM (Fig. 4). In the presence of forskolin and IBMX, somatostatin content of medium increased to 56,700 pg/ml (35 nM) (Fig. 7). Most somatostatin receptors have affinity constants for somatostatin in the nanomolar range (26, 29). By radioligand binding assays, the affinity constant for somatostatin receptors on opossum kidney (OK) proximal tubular-like cells is 24.5 nM (10). Thus PTEC produce physiologically significant amounts of somatostatin. In the in vivo microenvironment of the proximal tubule, local concentrations of PTEC-derived somatostatin could reach even higher concentrations than in culture supernatants. Because proximal tubular cells express somatostatin receptors (10, 30) and physiological relevant amounts of somatostatin, we speculate that locally produced somatostatin modulates proximal tubular cell proliferation and function in an autocrine/paracrine manner.
The physiological role of somatostatin in the kidney and for proximal tubules is currently unknown. Somatostatin inhibits proliferation of opossum kidney OK proximal tubular cells (10) and rat mesangial cells (34). In a human pancreatic cell line (MIA PaCa-2), somatostatin inhibits EGF-induced proliferation by activating a phosphotyrosine phosphatase activity that dephosphorylates and inactivates EGF receptor (23). In light of the ability of somatostatin to inhibit EGF-induced proliferation, our observation that EGF inhibits PTEC somatostatin secretion is especially interesting. We speculate that the ability of EGF to inhibit PTEC somatostatin production provides an autocrine/paracrine feedback mechanism for EGF to overcome somatostatin-mediated inhibition of PTEC proliferation.
As with EGF, hydrocortisone is mitogenic for PTEC (2) and inhibits
somatostatin secretion (Figs. 5 and 6). In human thyroid medullary
carcinoma cells, a low concentration of dexamethasone (10
10 M) stimulates
somatostatin expression; however, higher concentrations (10
8-10
5
M) decrease somatostatin production by accelerating somatostatin transcript degradation (15, 16). The concentration of hydrocortisone in
PTEC growth medium (5 µg /ml, or 1.4 × 10
5 M) corresponds to the
glucocorticoid activity of ~5.3 × 10
7 M dexamethasone,
indicating that this concentration inhibits somatostatin secretion by
PTEC as for thyroid carcinoma cells. In contrast, we did not detect
stimulation of PTEC somatostatin secretion with concentrations of
hydrocortisone as low as
10
11 M (corresponding to 4 × 10
13 M
dexamethasone).
In addition to inhibition of proliferation, PTEC-derived somatostatin may modulate other physiological functions of PTEC. Depending on the somatostatin receptor subtype and G proteins expressed in various cells, binding to somatostatin receptors can lead to inhibition of adenylate cyclase, activation of guanylate cyclase, or to modulation of calcium or potassium flux (7, 23, 26, 32). Because of the diverse secondary signaling mechanisms that somatostatin influences, somatostatin or somatostatin analogs may have many interesting and potentially clinically useful effects on proximal tubule cells. Currently, somatostatin analogs are used for a wide variety of clinical settings, including inhibition of myointimal thickening in chronic allograft rejection (4, 11), inhibition of restenosis after coronary balloon angioplasty (4), visualization and treatment of a wide variety of tumors (12, 31), and for chronic secretory diarrhea and other gastrointestinal disorders (12).
Future studies defining the somatostatin receptor subtypes expressed by PTEC and the intracellular signaling pathways triggered by binding to these receptors will be critical for our understanding of how renal-derived somatostatin may modulate proximal tubular cell growth and function. As such studies unfold, novel methods to manipulate intrarenal somatostatin expression or novel uses for somatostatin analogs in the management of renal disease will become evident.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. M. Sue O'Dorisio for extensive help and support with this project. We also wish to thank Thomas M. O'Dorisio, Dawn Wray, Dorothy Hill, Brent Howe, and the Core Peptide Laboratory of the General Clinical Research Center (RR-34) at The Ohio State University for performing the RIA for NPY and VIP.
| |
FOOTNOTES |
|---|
This work was supported by grants from Genentech Foundation (95-155), The Ohio State University Seed Grant Program, Children's Hospital Research Foundation, and the Central Ohio Diabetes Association (CODA; CODA is an independent diabetes association not affiliated with the American Diabetes Association).
Address for reprint requests: M. A. Turman, Section of Nephrology, Children's Hospital, 700 Children's Drive, Columbus, OH 43205.
Received 29 September 1997; accepted in final form 19 February 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Albers, A. R.,
M. S. O'Dorisio,
and
A. J. Yates.
Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis of somatostatin receptor (SST) expression in neuroblastoma (Abstract).
Soc. Neurosci. Abstr.
21:
2133,
1995.
2.
Detrisac, C. J.,
M. A. Sens,
A. J. Garvin,
S. S. Spicer,
and
D. A. Sens.
Tissue culture of human kidney epithelial cells of proximal tubule origin.
Kidney Int.
25:
383-390,
1984[Medline].
3.
Dileepan, K. N.,
and
S. R. Wagle.
Somatostatin: a metabolic regulator.
Life Sci.
37:
2335-2343,
1985[Medline].
4.
Foegh, M. L., and P. W. Ramwell.
Angiopeptin: experimental and clinical studies of inhibition of
myointimal proliferation. Kidney Int.
48, Suppl. 52: S18-S22, 1995.
5.
Gaginella, T. S.,
H. S. Mekhjian,
and
T. M. O'Dorisio.
Vasoactive intestinal peptide: quantification by radioimmunoassay in isolated cells, mucosa, and muscle of the hamster intestine.
Gastroenterology
74:
718-721,
1978[Medline].
6.
Garcia-Escribano, C.,
M. L. Diez-Marques,
M. Gonzalez-Rubio,
M. Rodriguez-Puyol,
and
D. Rodriguez-Puyol.
Somatostatin antagonizes angiotensin II effects on mesangial cell contraction and glomerular filtration.
Kidney Int.
43:
324-333,
1993[Medline].
7.
Garcia-Escribano, C.,
M. L. Diez-Marques,
J. Medina-Alonso,
M. Rodriguez-Puyol,
and
D. Rodriguez-Puyol.
Somatostatin activates particulate guanylate cyclase in cultured rat mesangial cells.
Kidney Int.
46:
1611-1615,
1994[Medline].
8.
Gibson-D'Ambrosio, R. E.,
M. Samuel,
C. C. Chang,
J. E. Trosko,
and
S. M. D'Ambrosio.
Characteristics of long-term human epithelial cell cultures derived from normal human fetal kidney.
In Vitro Cell. Dev. Biol.
23:
279-287,
1987[Medline].
9.
Goodman, R. H.,
R. P. Rehfuss,
M. Verhave,
R. Ventimiglia,
and
M. J. Low.
Somatostatin gene regulation: an overview.
Metabolism
39:
2-5,
1990[Medline].
10.
Hatzoglou, A.,
E. Bakogeorgou,
E. Papakonstanti,
C. Stournaras,
D. S. Emmanouel,
and
E. Castanas.
Identification and characterization of opioid and somatostatin binding sites in the opossum kidney (OK) cell line and their effect on growth.
J. Cell. Biochem.
63:
410-421,
1996[Medline].
11.
Hayry, P.,
A. Raisanen,
J. Ustinov,
A. Mennander,
and
T. Paavonen.
Somatostatin analog lanreotide inhibits myocyte replication and several growth factors in allograft arteriosclerosis.
FASEB J.
7:
1055-1060,
1993[Abstract].
12.
Hofland, L. J.,
H. A. Visser-Wisselaar,
and
S. W. J. Lamberts.
Somatostatin analogs: clinical application in relation to human somatostatin receptor subtypes.
Biochem. Pharmacol.
50:
287-297,
1995[Medline].
13.
Ishikawa, S.,
T. Saito,
and
T. Kuzuya.
Reversal of somatostatin inhibition of AVP-induced cAMP by pertussis toxin.
Kidney Int.
33:
536-542,
1988[Medline].
14.
Kronheim, S.,
M. Berelowitz,
and
B. L. Pimstone.
The characterization of growth hormone release inhibiting hormone-like immunoreactivity in normal urine.
Clin. Endocrinol. (Oxf.)
7:
343-347,
1977[Medline].
15.
Liu, J. L.,
D. N. Papachristou,
and
Y. C. Patel.
Glucocorticoids activate somatostatin gene transcription through co-operative interaction with the cyclic AMP signalling pathway.
Biochem. J.
301:
863-869,
1994.
16.
Liu, J. L.,
and
Y. C. Patel.
Glucocorticoids inhibit somatostatin gene expression through accelerated degradation of somatostatin messenger ribonucleic acid in human thyroid medullary carcinoma (TT) cells.
Endocrinology
136:
2389-2396,
1995[Abstract].
17.
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr,
and
R. J. Randall.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:
265-275,
1951
18.
Minth, C. D.,
P. C. Andrews,
and
J. E. Dixon.
Characterization, sequence, and expression of the cloned human neuropeptide Y gene.
J. Biol. Chem.
261:
11974-11979,
1986
19.
Ng, S. Y.,
P. Gunning,
R. Eddy,
P. Ponte,
J. Leavitt,
T. Shows,
and
L. Kedes.
Evolution of the functional human beta-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes.
Mol. Cell. Biol.
5:
2720-2732,
1985
20.
O'Dorisio, M. S.,
F. Chen,
T. M. O'Dorisio,
D. Wray,
and
S. J. Qualman.
Characterization of somatostatin receptors on human neuroblastoma tumors.
Cell Growth Differ.
5:
1-8,
1994[Abstract].
21.
O'Dorisio, M. S.,
D. J. Fleshman,
S. J. Qualman,
and
T. M. O'Dorisio.
Vasoactive intestinal peptide: autocrine growth factor in neuroblastoma.
Regul. Pept.
37:
213-226,
1992[Medline].
22.
O'Dorisio, T. M.,
H. S. Mekhjian,
E. C. Ellison,
M. S. O'Dorisio,
T. S. Gaginella,
and
E. A. Woltering.
Role of peptide radioimmunoassay in understanding peptide-peptide interactions and clinical expression of gastroenteropancreatic endocrine tumors.
Am. J. Med.
82:
60-67,
1987[Medline].
23.
Pan, M. G.,
T. Florio,
and
P. J. Stork.
G protein activation of a hormone-stimulated phosphatase in human tumor cells.
Science
256:
1215-1217,
1992
24.
Park, S. K.,
T. A. Olson,
N. Ercal,
M. Summers,
and
M. S. O'Dorisio.
Characterization of vasoactive intestinal peptide receptors on human megakaryocytes and platelets.
Blood
87:
4629-4635,
1996
25.
Patel, Y. C.
General aspects of the biology and function of somatostatin.
In: Somatostatin, edited by C. Weil,
E. E. Muller,
and M. O. Thorner. New York: Springer-Verlag, 1992, p. 1-16.
26.
Patel, Y. C.,
M. T. Greenwood,
R. Panetta,
L. Demchyshyn,
H. Niznik,
and
C. B. Srikant.
The somatostatin receptor family.
Life Sci.
57:
1249-1265,
1995[Medline].
27.
Qualman, S. J.,
M. S. O'Dorisio,
D. J. Fleshman,
H. Shimada,
and
T. M. O'Dorisio.
Neuroblastoma. Correlation of neuropeptide expression in tumor tissue with other prognostic factors.
Cancer
70:
2005-2012,
1992[Medline].
28.
Ray, C.,
S. Carney,
T. Morgan,
and
A. Gillies.
Somatostatin as a modulator of distal nephron water permeability.
Clin. Sci. (Colch.)
84:
455-460,
1993[Medline].
29.
Raynor, K.,
W. A. Murphy,
D. H. Coy,
J. E. Taylor,
J. P. Moreau,
K. Yasuda,
G. I. Bell,
and
T. Reisine.
Cloned somatostatin receptors: identification of subtype-selective peptides and demonstration of high affinity binding of linear peptides.
Mol. Pharmacol.
43:
838-844,
1993[Abstract].
30.
Reubi, J. C.,
U. Horisberger,
U. E. Studer,
B. Waser,
and
J. A. Laissue.
Human kidney as target for somatostatin: high affinity receptors in tubules and vasa recta.
J. Clin. Endocrinol. Metab.
77:
1323-1328,
1993[Abstract].
31.
Reubi, J. C.,
and
L. Kvols.
Somatostatin receptors in human renal cell carcinomas.
Cancer Res.
52:
6074-6078,
1992
32.
Ribalet, B.,
and
G. T. Eddlestone.
Characterization of the G protein coupling of a somatostatin receptor to the K+ATP channel in insulin-secreting mammalian HIT and RIN cell lines.
J. Physiol. (Lond.)
485:
73-86,
1995
33.
Rogers, D. G.,
G. J. Cote,
E. S. Huang,
and
R. F. Gagel.
1,25-Dihydroxyvitamin D3 silences 3',5'-cyclic adenosine monophosphate enhancement of somatostatin gene transcription in human thyroid C cells.
Mol. Endocrinol.
3:
547-551,
1989
34.
Ruiz-Torres, P.,
F. J. Lucio,
M. Gonzalez-Rubio,
M. Rodriguez-Puyol,
and
D. Rodriguez-Puyol.
A dual effect of somatostatin on the proliferation of cultured rat mesangial cells.
Biochem. Biophys. Res. Commun.
195:
1057-1062,
1993[Medline].
35.
Shen, L. P.,
R. L. Pictet,
and
W. J. Rutter.
Human somatostatin I: sequence of the cDNA.
Proc. Natl. Acad. Sci. USA
79:
4575-4579,
1982
36.
Shtivelman, E.,
B. Lifshitz,
R. P. Gale,
B. A. Roe,
and
E. Canaani.
Alternative splicing of RNAs transcribed from the human abl gene and from the bcr-abl fused gene.
Cell
47:
277-284,
1986[Medline].
37.
Storkel, S.,
and
E. van den Berg.
Morphological classification of renal cancer.
World J. Urol.
13:
153-158,
1995[Medline].
38.
Tsukada, T.,
S. J. Horovitch,
M. R. Montminy,
G. Mandel,
and
R. H. Goodman.
Structure of the human vasoactive intestinal polypeptide gene.
DNA (NY)
4:
293-300,
1985[Medline].
39.
Turman, M. A.,
C. M. Bates,
A. Mathews,
and
S. E. Haun.
Effect of extracellular calcium on survival of human proximal tubular cells exposed to hypoxia.
Ren. Fail.
17:
421-435,
1995[Medline].
40.
Turman, M. A.,
M. S. O'Dorisio,
T. M. O'Dorisio,
C. A. Apple,
and
A. R. Albers.
Somatostatin expression in human renal cortex and mesangial cells.
Regul. Pept.
68:
15-21,
1997[Medline].
41.
Zink, A.,
H. Scherubl,
D. Kliemann,
M. Hoflich,
R. Ziegler,
and
F. Raue.
Inhibitory effect of somatostatin on cAMP accumulation and calcitonin secretion in C-cells: involvement of pertussis toxin-sensitive G-proteins.
Mol. Cell. Endocrinol.
86:
213-219,
1992[Medline].
This article has been cited by other articles:
![]() |
G. Elberg, D. Elberg, T. V. Lewis, S. Guruswamy, L. Chen, C. J. Logan, M. D. Chan, and M. A. Turman EP2 receptor mediates PGE2-induced cystogenesis of human renal epithelial cells Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1622 - F1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. N. Jonassen, S. Christensen, N. Marcussen, and J. S. Petersen Intrarenal octreotide treatment prevents sodium retention in liver cirrhotic rats: evidence for direct effects within the thick ascending limb of Henle's loop Am J Physiol Renal Physiol, September 1, 2006; 291(3): F537 - F545. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Balster, M. S. O'Dorisio, M. A. Summers, and M. A. Turman Segmental expression of somatostatin receptor subtypes sst1 and sst2 in tubules and glomeruli of human kidney Am J Physiol Renal Physiol, March 1, 2001; 280(3): F457 - F465. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |