AJP - Renal AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 275: F164-F172, 1998;
0363-6127/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robert, B.
Right arrow Articles by Abrahamson, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robert, B.
Right arrow Articles by Abrahamson, D. R.
Vol. 275, Issue 1, F164-F172, July 1998

Direct visualization of renal vascular morphogenesis in Flk1 heterozygous mutant mice

Barry Robert, Patricia L. St. John, and Dale R. Abrahamson

Departments of Comparative Medicine and Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 35294-0019

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Flk1, a receptor tyrosine kinase for vascular endothelial growth factor (VEGF), is the earliest known marker for endothelial precursors (angioblasts). We examined heterozygous mice in which the Flk1 gene was partially replaced by a promoter-less LacZ insert and used beta -galactosidase histochemistry to view cells transcribing Flk1. In day 10 (E10) embryos, a Flk1-positive network surrounded the metanephric blastema, and, at E11, a vessel entered the metanephros from its ventral aspect alongside the ingrowing ureteric bud. However, aortic branches did not engage embryonic kidneys at these time points. In newborns, beta -galactosidase was localized exclusively and intensely to endothelial cells of all vessels and glomeruli. In contrast, when E12 kidneys grown in organ culture for 6 days were examined, only scattered Flk1-positive cells were seen, glomeruli were unlabeled, and vessels were absent. When organ-cultured kidneys were then grafted into wild-type anterior eye chambers, numerous Flk1-positive endothelial cells in vessels and glomeruli were found, all stemming from the graft. Image analysis showed that grafts with the most abundant glomerulo- and tubulogenesis were also those with the richest expression of Flk1. We conclude that 1) kidney microvessels precede renal artery development, 2) angioblast differentiation is arrested in organ culture but released on grafting when vasculogenesis resumes, and 3) nephrogenesis and microvessel assembly are tightly coupled in vivo.

angiogenesis; nephrogenesis; vasculogenesis

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE EARLIEST VASCULATURE of the mammalian embryo forms by vasculogenesis, which involves the in situ differentiation of mesodermally derived endothelial precursors called angioblasts that then coalesce into vessels (20). Blood vessels also form in the embryo by angiogenesis, which represents the sprouting of new vessels from those already present. Both vasculogenesis and angiogenesis occur throughout embryogenesis, whereas blood vessel growth in adults apparently occurs only by angiogenesis (19).

A number of growth factors that initiate and control embryonic vascular morphogenesis have recently been identified (6, 8, 21). Targeted mutations of vascular endothelial cell growth factor (VEGF) and two of its receptor tyrosine kinases, Flk1 (VEGFR2) and Flt1 (VEGFR1), have shown that these three proteins are especially crucial for embryonic blood vessel development in mice (2, 5, 7, 27). Flk1 and Flt1 homozygous null mutants both die at approximately embryonic day 8.5 (E8.5) (7, 27). In Flk1 mutants, there is complete failure of development of endothelial and hematopoietic cells from mesodermal precursors (27). By contrast, angioblasts are present in Flt1 null mutants, but these cells form abnormal, disorganized blood vessels (7). Flk1 expression therefore appears to be important for initial differentiation of endothelial cells, whereas Flt1 mediates somewhat later stages of blood vessel assembly. Both VEGF homozygous and heterozygous mutants die in utero by E12 because of vascular insufficiencies, indicating that expression of both VEGF alleles are required for normal blood vessel development (2, 5). Another endothelial-specific receptor tyrosine kinase, Tie1, is also expressed in endothelial precursors, but the ligand for this receptor has not yet been identified. The exact role Tie1 plays in early endothelial differentiation processes is also unclear, and homozygous null mutants have been reported to die as early as E13 (18) and with extensive hemorrhages around the time of birth (25).

Targeted mutations of VEGF and genes encoding its two high-affinity receptors, Flk1 and Flt1, have been very informative, but their embryonic lethality prior to the onset of metanephrogenesis has limited their usefulness to investigate kidney blood vessel formation specifically. Nonetheless, these regulators of vascular development have been localized to the developing metanephros, and expression of VEGF, Flk1, and Flt1 mRNAs and proteins has been identified by in situ hybridization and immunocytochemistry, respectively (11, 17, 22, 28, 30). Because of the relatively low resolution inherent with many in situ hybridization procedures and the sensitivity of the Flk1 receptor to even modest fixation, these earlier investigations have generally provided imprecise morphological definitions. In the present study, we used heterozygous Flk1tm1Jrt transgenic mice, in which the first coding exon of the Flk1 gene has been replaced by a promoter-less LacZ insert (27), which encodes the beta -galactosidase enzyme. As mentioned earlier, homozygous Flk1 null mutants die at ~E8.5, but heterozygous mice develop normally. By processing tissues from heterozygotes histochemically for beta -galactosidase activity, we directly and clearly visualized cells expressing Flk1 before, during, and after metanephrogenesis. Our results show that the first metanephric vascular connections are not made with the aorta but instead with a peripheral vascular network that forms around the blastema at E10. We also provide further evidence that angioblasts are capable of establishing the entire renal microvasculature in vivo by vasculogenesis.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Animals. All mice for these experiments were taken from colonies of Flk1tm1Jrt and C57BL/6J mice that we founded in stocks obtained from the Jackson Laboratory (Bar Harbor, ME). To identify animals carrying the LacZ insert in the Flk1 gene, offspring of Flk1tm1Jrt mice were genotyped at weaning by PCR using 3' CTTATGGGAGAGGTRGGGCTT and 5' AGGTGAGATGACAGGAGATC as primers, which amplified the neomycin resistance gene insert. The colony was maintained as heterozygotes (Flk1 +/-).

beta -Galactosidase development procedures. Timed pregnant mice were anesthetized and killed by cervical dislocation at the indicated gestational day (date of the vaginal plug, day 0). Whole embryos were collected and placed in 0.2% paraformaldehyde in 0.1 M piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.9, at 4°C overnight. To examine metanephric development in E10 and E11 animals, the anterior halves were discarded, and gastrointestinal tissues were removed from the posterior body cavities. For E12 embryos, isolated preparations consisting of paired mesonephroi and metanephroi with attached aorta were dissected free of surrounding tissues. Dissected embryos and tissues were rinsed three times in phosphate-buffered saline (PBS) containing 2 mM MgCl2 and incubated in detergent rinse (0.1 M phosphate buffer, pH 7.3, 2 mM MgCl2, 0.01% sodium deoxycholate, and 0.02% Nonidet P-40) for 10 min on ice. Color development was carried out overnight at 37°C in color development solution [detergent rinse, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 20 mM tris(hydroxymethyl)aminomethane, pH 7.3, and 1 mg/ml 5-bromo-4-chloro-3-indolyl-D-galactopyranoside (X-gal; Sigma Chemical, St. Louis, MO)] (9). Tissues were washed three times in PBS with 2 mM MgCl2 and refixed in Karnovsky's fixative (1.6% paraformaldehyde and 3% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.4). Tissues were washed, dehydrated through graded ethanol series, and embedded in epoxy, using standard procedures. Serial sections, 2-3 µm thick, were cut and examined by light microscopy using Nomarski optics. Kidneys from newborn and adult Flk1 +/- mice were processed for microscopy as described below for metanephric organ cultures and anterior chamber grafts.

Organ culture of metanephric kidneys. Metanephric kidneys were aseptically microdissected from E12 embryos, and pairs of metanephroi from individual embryos were placed in separate chambers of 12-well tissue culture dishes (Falcon, Oxnard, CA) containing sterile ice-cold Tyrode salts (Sigma). To determine genotypes of embryos, nonrenal tissue was developed for beta -galactosidase. For metanephric organ culture, Tyrode salts were replaced with 1:1 Dulbecco's modified Eagle's medium/Ham's F-12 medium (GIBCO-BRL; Life Technologies, Grand Island, NY), supplemented with 5% fetal calf serum, penicillin G sodium (1,000 U/ml), streptomycin sulfate (1,000 U/ml), and amphotericin B (250 ng/ml). Organ cultures were incubated at 37°C in humidified air with 5% CO2. Media was replaced 24 h later and every 48 h thereafter. After 6 days in organ culture, kidneys were washed with sterile ice-cold PBS, pH 7.3, and one kidney of each pair was removed from the dish for grafting into anterior eye chambers. The other kidney was processed for beta -galactosidase development by first fixing in 0.2% paraformaldehyde in 0.1 M PIPES, pH 6.9, at 4°C. Tissues were then cryoprotected by incubating overnight in 30% sucrose in PBS containing 2 mM MgCl2 at 4°C, placed in optimal cutting temperature compound (OCT; Miles, Elkhart, IN), and frozen in isopentane chilled in a dry ice-acetone bath. Cryostat sections (~6 µm) were cut, air dried, and postfixed in 0.2% paraformaldehyde in 0.1 M PIPES, pH 6.9, at 4°C for 10 min. Sections were washed three times in PBS plus 2 mM MgCl2, incubated in detergent rinse for 10 min on ice, and placed in color development solution overnight as described above. Slides were postfixed in 4% paraformaldehyde in PBS, dehydrated through graded ethanol, cleared in xylene, and coverslipped.

Grafting procedures. Anterior eye chamber allografts of fetal kidneys grown in organ culture were established as described previously (22). In brief, adult C57BL/6J hosts were anesthetized by intraperitoneal injection of a ketamine/xylazine combination (100 mg/15 mg per kg body wt). Once anesthetized, tropicamide was applied to the eye to dilate the iris. The cornea was incised with a 27-gauge needle, and the incision extended ~2 mm with Vannas scissors. Organ-cultured Flk1 +/- kidneys previously freed from tissue culture dishes were transferred into the anterior chamber via the corneal incision and positioned over the iris. Antibiotic ophthalmic ointment was applied to the eye, and grafts were allowed to develop in oculo for 7 days. Grafts were then processed for beta -galactosidase histochemistry and microscopy, as described above for organ-cultured kidneys.

Image analysis of anterior chamber grafts. Cryostat sections taken at ~120-µm intervals from eight separate anterior chamber grafts of organ-cultured kidneys were developed for beta -galactosidase histochemistry, and microscopic images were digitized, using a CH-250 charge-coupled device camera (Photometrics, Tucson, AZ). Areas of the sections occupied by glomeruli and tubules and areas occupied by Flk1-positive vascular structures and cells were measured with IPLab Spectrum 3.0 software (Signal Analytics, Vienna, VA). Measurements were then expressed as a percentage of total graft area for each section and averaged for each graft. Data were statistically analyzed by calculation of a correlation coefficient using Lotus 123 Release 5 software (Lotus Development, Cambridge, MA).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Flk1 expression in E10 Flk1tm1Jrt mice. As seen previously (27), mice that were homozygous for the Flk1 mutation died in utero at ~E8.5, due to failure of endothelial and hematopoietic development. However, heterozygous mutants, which expressed LacZ instead of Flk1 in one allele, developed normally. Figure 1 illustrates three E10 littermates processed for beta -galactosidase histochemistry. A homozygous null mutant (Flk1 -/-), in which development was arrested at ~E8.5, is much smaller than its heterozygote (Flk1 +/-) and wild-type (Flk1 +/+) counterparts (Fig. 1).


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 1.   Embryonic day 10 (E10) littermates were taken from crosses between heterozygous Flk1tm1Jrt (Flk1 +/-) mice and processed for beta -galactosidase histochemistry. Nonviable Flk1 -/- embryo (A) is much smaller than the Flk1 +/- embryo (B) or wild-type counterpart (C), due to developmental arrest at ~E8.5. Note that both Flk1 -/- and Flk1 +/- express beta -galactosidase and hence are intensely blue.

Flk1 expression in embryonic kidneys. We examined three different stages in early kidney development for the presence and distribution of cells expressing Flk1. Shown in Fig. 2A is a cross section at the posterior third of the hindlimb bud of a mid-E10 Flk1 +/- embryo. At this time, the right metanephric blastema consists of a group of densely packed round to oval-shaped mesenchymal cells, surrounded by an outer layer of elongated spindle-shaped cells. Cells expressing Flk1 were found intermittently within this outer layer (Fig. 2A) but were not present within central regions of the metanephric blastema itself at this stage. Also shown on the left of Fig. 2A is the ureteric bud, which is sprouting from the ventrally located nephric duct and has begun to penetrate the metanephric blastema. Endothelia of the aorta and numerous cells in the developing limb buds also expressed Flk1 in the mid-E10 embryo (Fig. 2A).


View larger version (163K):
[in this window]
[in a new window]
 
Fig. 2.   Sections through E10 (A) and E11 (B) Flk1 +/- embryos color developed with X-gal. A: Flk1 expression (blue) is seen in intermittent cells (arrows) surrounding but not within the metanephric blastemata (MB). In left MB of this E10 section, the ureteric bud (UB) is beginning to sprout from the nephric duct (ND). Also note Flk1 expression in the endothelium of the dorsal aorta (A) and in cells of the limb bud (LB). HG, hindgut. B: Flk1-positive cells are seen intermittently surrounding the metanephroi and near the ureteric bud (UB). A small Flk1-positive vessel (arrows) entering the right metanphros at its ventral aspect lies lateral to the ureteric bud. Note the nephric duct (ND), which is ventral to the left metanephros. Endothelium of the dorsal aorta (A) and cardinal veins (CV) also express Flk1.

Cells expressing Flk1 were first seen within metanephroi at E11 (Fig. 2B). These internal Flk1-positive cells were usually seen near the unbranched ureteric bud, and continuities among these cells and those of the peripheral network encapsulating the metanephroi could be clearly discerned (Fig. 2B). These earliest vascular connections between intra- and extra-metanephric sites took place in ventromedial and ventrolateral regions of the developing kidney, near the site of ingress of the ureteric bud from the underlying nephric duct (Fig. 2B). A vessel that directly connected the aorta with the metanephros was not seen in any of the two E10 or three E11 embryos examined.

By E12, more cells expressing Flk1 were present within the metanephroi proper (Fig. 3). In some cases, an apparent capillary network of Flk1-positive cells could be seen near the ureteric bud, and some of these vessels contained obvious lumens (Fig. 3). In addition to this internal Flk1-positive microvasculature, cells expressing Flk1 surrounded the E12 metanephros as seen in earlier stages (Fig. 3).


View larger version (148K):
[in this window]
[in a new window]
 
Fig. 3.   Section through metanephros dissected from an E12 Flk1 +/- embryo. A capillary network (arrows), in which a lumen is present, is seen developing adjacent to both the medial and lateral aspects of the ureteric bud (UB). A Flk1-positive vascular network (arrowheads) still surrounds the developing kidney.

Flk1 expression in newborn kidney. In the nephrogenic zone immediately beneath the newborn kidney capsule, numerous Flk1-positive cells were seen in the vascular clefts of the early comma- and S-shaped nephric figures (Fig. 4, A and B). Flk1 was also highly expressed in endothelial cells of capillary-loop stage glomeruli and in developing vessels throughout the immature outer cortex (Fig. 4, A and C). In more mature, inner cortical regions of the newborn kidney, Flk1 was still highly expressed in glomerular capillaries, afferent and efferent arterioles, and arteries (Fig. 4A). Weaker expression of Flk1 was evident in peritubular capillary endothelium and isolated cells throughout the cortical interstitium (Fig. 4). Flk1 expression was not detected, however, in any glomerular or tubular epithelial cells at any stage of nephron development. Likewise, mesangial areas of late capillary loop and maturing stage glomeruli did not contain Flk1-positive cells (Fig. 4, A and C).


View larger version (162K):
[in this window]
[in a new window]
 
Fig. 4.   Color-developed section through newborn Flk1 +/- mouse kidney. A: Flk1-positive endothelium is seen throughout the cortex. Below the kidney capsule (C) in the subcapsular nephrogenic zone (NZ), Flk1-positive cells are seen in assembling capillaries (arrows). In the more mature inner cortex, endothelium of capillary loop (CL) and maturing glomeruli (G), as well as afferent and efferent arterioles (A), all express Flk1. B: higher-magnification view of the nephrogenic zone shows isolated Flk1-positive cells (arrowheads) in the subcapsular cortex and others in vascular clefts of comma- and S-shaped glomeruli (arrows). C: higher-magnification view of capillary loop stage glomeruli (CL) shows intense Flk1 expression by glomerular endothelium. However, mesangial areas do not express Flk1.

Flk1 expression in the adult kidney. In comparison with the newborn kidney, Flk1 expression was downregulated in the adult (Fig. 5). All glomerular capillaries still expressed Flk1, although the intensity of beta -galactosidase reaction product was less than that seen in the capillaries of maturing glomeruli in newborn kidney (compare Fig. 4, A and C, with Fig. 5). The mesangium in adult glomeruli did not contain Flk1-positive cells. Peritubular capillary endothelium and possibly some interstitial cells were weakly positive for Flk1, whereas arterioles, arteries, and other vessels of the adult kidney no longer expressed Flk1 (Fig. 5).


View larger version (186K):
[in this window]
[in a new window]
 
Fig. 5.   Flk1 expression in adult Flk1 +/- mouse. Expression is limited to glomerular and peritubular capillary endothelium (arrowheads). Mesangial cells (M) do not express Flk1, and endothelium of arterioles (arrows) are now negative.

Flk1 expression in organ-cultured metanephroi. Sections from E12 kidneys that had been maintained for 6 days in organ culture and then color developed with X-gal are shown in Fig. 6. Expression of Flk1 was occasionally seen in cells located within and under the capsule of organ-cultured rudiments, but no expression was detected in the avascular "glomeruli" that developed in vitro (Fig. 6). A few individual cells expressing Flk1 were also seen within mesenchymal areas, but the presence of Flk1-positive cells within defined vascular structures was not observed in kidneys maintained under standard organ culture conditions (Fig. 6).


View larger version (121K):
[in this window]
[in a new window]
 
Fig. 6.   E12 Flk1 +/- metanephroi that were maintained in organ culture for 6 days and then color developed for beta -galactosidase histochemistry. A few Flk1-positive cells (arrowheads) are seen just beneath the capsule and within mesenchymal areas. Note avascular glomeruli (G, inset) that do not express Flk1.

Flk1 expression in anterior chamber grafts of organ-cultured kidneys. We previously reported that, although vessels did not form in organ-cultured kidneys in vitro, when these cultured kidneys were grafted into anterior eye chambers, microvessels were quickly established, and their endothelia originated from the engrafted kidneys (22). To evaluate this process further, E12 Flk1 +/- kidneys that had been maintained in organ culture for 6 days were grafted into anterior eye chambers of wild-type hosts. Grafts were removed 7 days after implantation and processed for beta -galactosidase histochemistry. Shown in Fig. 7A is a section through a well-developed graft that is virtually indistinguishable from a typical section through a newborn Flk1 +/- kidney (Fig. 4A). Numerous glomeruli, ranging from S-shaped, capillary-loop, and maturing stages, were present within grafts, and the pattern of Flk1 expression in endothelial cells appeared identical to that seen in the newborn kidney. On the other hand, some grafts did not develop so extensively (Fig. 7B). In such grafts, relatively few tubules and glomeruli developed, but when present, these structures were always found in regions that also contained Flk1-positive vasculature (Fig. 7B). In contrast, areas within grafts that contained large amounts of undifferentiated mesenchyme were poorly vascularized (Fig. 7B).


View larger version (191K):
[in this window]
[in a new window]
 
Fig. 7.   Section from E12 Flk1 +/- kidneys that had been maintained for 6 days in organ culture before grafting into the anterior eye chambers of C57BL/6J hosts. Grafts were removed 7 days after implantation and processed for beta -galactosidase histochemistry. A: well-developed graft, which is morphologically very similar to the newborn Flk1 +/- kidney (Fig. 4A) has extensive glomerular (G) and tubular development and abundant Flk1-positive vasculature. B: less well-developed graft contains few glomeruli (G) and tubules and much less Flk1-positive vasculature. Note large area of undifferentiated mesenchyme (M, bottom) that is poorly vascularized.

To determine whether there was a relationship between nephrogenesis and vascular development, areas of graft sections occupied by glomeruli and tubules and areas occupied by Flk1-positive vasculature were measured. The mean percentage of areas occupied by nephric structures and vessels, respectively, are shown in Table 1. A correlation of these means, depicted graphically in Fig. 8, indicates a positive linear relationship between glomerulo- and tubulogenesis within grafts and vascular development.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Mean percentages of areas occupied by glomeruli and tubules and Flk1-positive vasculature, respectively, in anterior chamber grafts


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   Linear relationship of mean percentages of graft areas occupied by glomeruli and tubules and Flk1-positive vasculature, respectively, of values shown in Table 1. Symbols correspond with grafts 1-8 in Table 1.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In this study, we used heterozygous Flk1tm1Jrt transgenic mice to visualize directly Flk1 expression by differentiating endothelial cells in the developing kidney. First, we found that, beginning at E10, a Flk1-positive vascular plexus surrounded the metanephric blastema. On E11, a metanephric microvascular network assembled around the ureteric bud, and this occurred before a distinguishable renal artery connected the metanephros directly with the aorta. Second, Flk1 expression was ubiquitous in endothelium of the newborn kidney, including cells of forming capillaries, developing glomeruli, and larger blood vessels. In the adult kidney, however, Flk1 expression was diminished and found only in glomerular and peritubular capillary endothelium. Third, when E12 metanephroi were placed in organ culture, Flk1-positive cells were arrested from further development, and neither formed vessels nor contributed to "glomeruli" that developed in vitro. However, on grafting organ-cultured kidneys into anterior eye chambers of adult mice, Flk1-positive cells were released from arrest and vascularized engrafted kidneys in an organotypic manner. Finally, there was a positive linear relationship between renal epithelial differentiation and vascular development within these grafts, suggesting a strong interdependence between metanephrogenesis and vascularization in vivo.

The metanephric blastema begins as a cord of mesenchymal cells, which is derived from the intermediate mesoderm of the urogenital ridge. At E11 the ureteric bud, a branch of the nephric duct, grows into the blastema, and metanephrogenesis begins (12, 26). We first observed Flk1 expression in a loose network of cells surrounding the blastema at E10, and, by E11, cells expressing Flk1 were present within the metanephros and located near the ureteric bud. By E12, these Flk1-positive cells had assembled into a more complex capillary network and patent microvessels were observed. Overall, these findings agree with a previous study using anti-erythrocyte immunofluorescence staining that demonstrated a similar network surrounding the E11 metanephros and noted that erythrocytes were found within metanephroi by E11.5 (24). The cells expressing Flk1 in the E11 and E12 metanephroi also correspond with binding studies using the alpha -D-galactose-specific lectin, Bandeiraea simplicifolia isolectin B4 (BSLB4) (10), which specifically labels embryonic mouse endothelium (3).

Surprisingly, the first vascular connections with metanephroi were not via a direct branch from the dorsal aorta. Instead, initial vascular entry came from the Flk1-positive plexus surrounding the metanephroi, and a vessel projected into the metanephros from its ventral aspect alongside the ingressing ureteric bud. Earlier three-dimensional reconstructions of dissected E11 kidney serial sections suggested that a BSLB4-positive microvascular network stemmed from sites near the ureteric bud (10), which is therefore in agreement with the Flk1 expression patterns shown here. The sections from intact E10 and E11 embryos also illustrate some unexpected anatomical relationships. As illustrated in Fig. 2, paired metanephroi of E10 and E11 embryos occupy the posterior third of the abdomen at the level of the hindlimb buds. The ureteric buds enter metanephroi at their ventral aspects, as do the first metanephric vessels (Fig. 2B), whereas the aorta is dorsomedial to the metanephroi at this time. In other words, kidneys begin development in the posterior abdominal cavity overlying the future ureter, and our findings show that initial vascular connections enter the metanephroi ventrally. In the adult mouse, however, the kidneys are dorsally positioned in the anterior third of the abdomen, and the renal artery and ureter enter kidneys at their medial aspects or hili and project laterally. Therefore, as embryonic development progresses, the kidneys move anteriorly, and their hili pivot to assume their final orientation in the postnatal animal. Presumably, the perimetanephric vascular network seen here also declines as the intrarenal vasculature becomes established and linked to the renal artery.

Whether the initial solitary capillary seen alongside the ureteric bud (Fig. 2B) subsequently branches repeatedly to generate all vessels of the kidney by angiogenesis also remains to be determined. We favor alternative possibilities, however. First, metanephric blastemal mesenchymal cells located near the ureteric bud might differentiate in situ into angioblasts, which then proliferate and form an internal vascular network by vasculogenesis. Alternatively, invasive angioblasts from surrounding mesoderm might migrate into metanephroi, proliferate, and assemble into vascular structures near the ureteric bud. Such invasive angioblasts have been identified previously in quail chick chimeras, in which migratory endothelial precursors move from transplanted mesoderm into host embryonic mesenchyme to form hybrid vessels (14, 16). Similarly, when we implanted E12 metanephroi from wild-type mice into kidneys of newborn ROSA26 transgenic mice and vice versa, we found that host endothelium contributed significantly to glomerular microvasculature of the graft and that chimeric vessels formed in both the engrafted kidney and adjacent host tissue (22). Clearly, endothelial precursors migrated between the graft and host, demonstrating that, at least in this intrarenal graft system, cells behaving as invasive angioblasts are indeed present in E12 and newborn kidneys. Our results from anterior chamber grafts of organ-cultured E12 kidneys, discussed further below, also point to the existence of angioblasts within metanephroi. Nevertheless, none of our experiments can define whether these angioblasts originated from the metanephric blastema exclusively or came from the surrounding extrarenal mesoderm.

When we examined the newborn mouse kidney cortex for Flk1, the receptor was expressed intensely by all vascular endothelial cells, particularly those in arterioles and glomeruli. Scattered cells in the cortical mesenchyme, probably representing angioblasts, also expressed Flk1. Generally in agreement with previous in situ hybridization experiments (28) and our earlier immunolocalization results (22), Flk1 was downregulated in the adult, and its expression was maintained only in glomerular and peritubular capillaries. The persistent expression of Flk1 specifically in these sites indicates a role for the receptor in these but not other vascular structures of the mature kidney. Others have speculated that the expression of Flk1 in glomeruli and coordinate expression of VEGF in podocytes may be responsible for maintenance of the specialized fenestrated phenotype of glomerular endothelium (28). Along these lines, VEGF has been shown to induce fenestrations in vivo in normally nonfenestrated venular and capillary endothelium of cremaster muscle and skin (23).

To evaluate the capacities of metanephric angioblasts further, we maintained E12 Flk1 +/- kidneys in organ culture and evaluated the expression of the receptor in vitro. Our results show that although limited tubulogenesis and glomerular epithelial tuft formation progressed in vitro, proliferation of Flk1-positive cells and differentiation of endothelium was arrested. We observed a few cells expressing Flk1 in organ culture, but they did not assemble into recognizable vascular structures nor were they found within the glomerular epithelial tufts. Virtually identical results on failure of metanephric vascular growth in vitro have been reported recently on organ culture of embryonic kidneys from Tie1/LacZ transgenic mice (15). Using simple morphologic criteria, a number of other investigators have also shown that, when embryonic kidneys are maintained under typical organ culture conditions, tubulogenesis proceeds, but vascular development does not occur (1, 4). Nonetheless, when we grafted organ-cultured Flk1 +/- kidneys into anterior eye chambers of normal mice, cells expressing Flk1 quickly proliferated and differentiated into microvascular and glomerular endothelia of engrafted kidneys. These cells could only have come from the graft, because the wild-type host animals lacked the LacZ transgene. We can safely conclude, therefore, that microvessels that formed after grafting organ-cultured kidneys did not arise from angiogenic sprouts originating within engrafted kidneys or in the host. Instead, our studies show that intrinsic angioblasts assembled the graft microvasculature by vasculogenesis. These vasculogenic angioblasts within the grafts were either derived 1) directly from the relatively few cells expressing Flk1 that were already present at the time of grafting or 2) from metanephric mesenchymal derivatives that began expressing Flk1 only after grafting. Of course, both possibilities may have occurred concurrently, and future studies limiting the survival of Flk1-positive cells in organ culture should clarify this question.

When we measured the areas within grafts occupied by Flk1-positive cells and vessels and areas occupied by glomeruli and tubules, respectively, we obtained a correlation coefficient of +0.89. In other words, extensive vascular development corresponded with extensive glomerulo- and tubulogenesis, whereas poor vessel development coincided with a lack of epithelial differentiation. This strongly positive, linear relationship between formation of Flk1-positive vasculature and glomerular and tubular development within anterior chamber grafts therefore suggests an interdependence between these processes in vivo. Although at first glance this is hardly a profound finding, the hemodynamic and other biophysical factors potentially important for organotypic renal vascular development in situ in the abdomen are likely to be considerably different than those in oculo. In addition, when rat metanephroi are organ cultured under hypoxic (3% O2) conditions, VEGF mRNA has been shown to be upregulated, and this is accompanied by some vessel development and increased tubular epithelial differentiation compared with explants grown at normoxia (29). Moreover, these hypoxic effects can be prevented by addition of anti-VEGF antibodies to the cultures (29), implicating VEGF as a mediator of epithelial tubulogenesis in vitro. The VEGF-mediated effects in hypoxic organ cultures must also be independent of hemodynamic and humoral factors, because endothelial development in vitro can neither restore normoxia nor deliver blood to the explant. Administration of anti-VEGF antibodies to newborn mice in vivo has also been shown to impair glomerulogenesis and tubulogenesis in the intact kidney (13). Because VEGF receptors have not been observed in renal epithelial cells previously (11, 28) and we did not detect Flk1 expression in kidney epithelium at any stage of development, we suspect that VEGF probably facilitates tubular development in vitro and in vivo by promoting endothelial cell differentiation. Taken together, these data strongly suggest that nephron epithelial development is, among other things, reliant on paracrine signals from differentiating endothelial cells.

In summary, examination of heterozygous Flk1tm1Jrt mice enabled us to view directly some of the early morphogenetic events in assembly of the renal microvasculature. The results from the anterior chamber grafts of organ-cultured kidneys also provide additional evidence for the presence of vasculogenic angioblasts within the metanephros, but whether these cells stem from 1) metanephric mesenchyme, 2) invasive angioblasts, or 3) the initial metanephric vessels that connect to the perimetanephric vascular plexus, is undefined.

    ACKNOWLEDGEMENTS

We thank Dr. Juan M. Navia for advice on the statistical analysis of anterior chamber grafts.

    FOOTNOTES

Funds came from National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-34972 and DK-52483. B. Robert received a Suzanne Oparil Fellowship from the American Heart Association, Alabama Affiliate.

Address for reprint requests: D. R. Abrahamson, Dept. of Cell Biology, 6th Floor Volker Hall, 1670 Univ. Blvd., Univ. of Alabama at Birmingham, Birmingham, AL 35294-0019.

Received 12 December 1997; accepted in final form 5 March 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Bernstein, J., F. Cheng, and J. Roszka. Glomerular differentiation in metanephric culture. Lab. Invest. 45: 183-190, 1981[Medline].

2.   Carmeliet, P., V. Ferreira, G. Breier, S. Pollefeyt, L. Kieckens, M. Gertsenstein, M. Fahrig, A. Vandenhoeck, K. Harpal, C. Eberhardt, C. Declerq, J. Pawling, L. Moons, D. Collen, W. Risau, and A. Nagy. Abnormal blood vessel development, and lethality in embryos lacking a single VEGF allele. Nature 380: 435-438, 1996[Medline].

3.   Coffin, J. D., J. Harrison, S. Schwartz, and R. Heimark. Angioblast differentiation and morphogenesis of the vascular endothelium in the mouse embryo. Dev. Biol. 148: 551-562, 1991.

4.   Ekblom, P. Formation of basement membranes in the embryonic kidney: an immunological study. J. Cell Biol. 91: 1-10, 1981[Abstract/Free Full Text].

5.   Ferrara, N., K. Carver-Moore, H. Chen, M. Dowd, L. Lu, K. O'Shea, L. Powell- Braxton, K. J. Hillan, and M. W. Moore. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380: 439-442, 1996[Medline].

6.   Ferrara, N., and T. Davis-Smyth. The biology of vascular endothelial growth factor. Endocr. Rev. 18: 4-25, 1997[Abstract/Free Full Text].

7.   Fong, G., J. Rossant, M. Gerstenstein, and M. L. Breitman. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376: 66-70, 1995[Medline].

8.   Hanahan, D. Signaling vascular morphogenesis and maintenance. Science 277: 48-50, 1997[Free Full Text].

9.   Hogan, B., R. Beddingtton, F. Constantini, and E. Lacy. Manipulating the Mouse Embryo: A Laboratory Manual (2nd. ed.). Plainview, NY: Cold Spring Harbor Laboratory, 1994.

10.   Hyink, D. P., D. C. Tucker, P. L. St. John, V. Leardkamolkarn, M. A. Accavitti, C. K. Abrass, and D. R. Abrahamson. Endogenous origin of glomerular endothelial and mesangial cells in grafts of embryonic kidneys. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F886-F899, 1996[Abstract/Free Full Text].

11.   Kaipainen, A., J. Korhonen, K. Pajusola, O. Aprelikova, M. G. Persico, B. I. Terman, and K. Alitalo. The related FLT4, FLT1, and KDR tyrosine kinases show distinct expression patterns in human fetal endothelial cells. J. Exp. Med. 178: 2077-2088, 1993[Abstract/Free Full Text].

12.   Kanwar, Y. S., F. A. Carone, A. Kumar, J. Wada, K. Ota, and E. I. Wallner. Role of extracellular matrix, growth factors and proto-oncogenes in metanephric development. Kidney Int. 52: 589-606, 1997[Medline].

13.   Kitamoto, Y., H. Tokunga, and K. Tomita. Vascular endothelial growth factor is an essential molecule for mouse kidney development: glomerulogenesis and nephrogenesis. J. Clin. Invest. 99: 2351-2357, 1997[Medline].

14.   Kurz, H., T. Gärtner, P. S. Eggli, and B. Christ. First blood vessels in the avian neural tube are formed by a combination of dorsal angioblast immigration and ventral sprouting of endothelial cells. Dev. Biol. 173: 133-147, 1996[Medline].

15.   Loughna, S., P. Hardman, E. Landels, L. Jussila, K. Alitalo, and A. S. Woolf. A molecular and genetic analysis of renal glomerular capillary development. Angiogenesis 1: 84-101, 1997.

16.   Noden, D. W. Embryonic origins and assembly of blood vessels. Am. Rev. Respir. Dis. 140: 1097-1103, 1989[Medline].

17.   Peters, K. G., C. De Vries, and L. T. Williams. Vascular endothelial growth factor receptor expression during embryogenesis and tissue repair suggests a role in endothelial differentiation and blood vessel growth. Proc. Natl. Acad. Sci. USA 90: 8915-8919, 1993[Abstract/Free Full Text].

18.   Puri, M. C., J. Rossant, K. Alitalo, A. Bernstein, and J. Partanen. The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells. EMBO J. 14: 5884-5891, 1995[Medline].

19.   Risau, W. Embryonic angiogenesis factors. Pharmacol. Ther. 51: 371-376, 1991[Medline].

20.   Risau, W., and I. Flamme. Vasculogenesis. Ann. Rev. Cell Dev. Biol. 11: 73-91, 1995.[Medline]

21.   Risau, W. Mechanisms of angiogenesis. Nature 386: 671-674, 1997[Medline].

22.   Robert, B., P. L. St. John, D. P. Hyink, and D. R. Abrahamson. Evidence that embryonic kidney cells expressing flk-1 are intrinsic, vasculogenic angioblasts. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F744-F753, 1996[Abstract/Free Full Text].

23.   Roberts, W. G., and G. E. Palade. Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor. J. Cell Sci. 108: 2369-2379, 1995[Abstract].

24.   Sariola, H., P. Ekblom, and L. Saxén. Restricted developmental options of the metanephric mesenchyme. In: Embryonic Development. Part B. Cellular Aspects, edited by M. Burger, and R. Weber. New York: Liss, 1982, p. 425-431.

25.   Sato, T. N., Y. Tozawa, U. Deutsch, K. Wolburg-Buchholz, Y. Fujiwara, M. Gendron- Maguire, T. Gridley, H. Wolburg, W. Risau, and Y. Qin. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376: 70-74, 1995[Medline].

26.   Saxén, L. Organogenesis of the Kidney. Cambridge, UK: Cambridge University, 1987.

27.   Shalaby, F., J. Rossant, T. P. Yamaguchi, M. Gertsenstein, X. F. Wu, M. L. Breitman, and A. C. Schuh. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 376: 62-66, 1995[Medline].

28.   Simon, M., H.-J. Gröne, O. Jöhren, J. Kullmer, H. Plate, W Risau, and E. Fuchs. Expression of vascular endothelial growth factor and its receptors in human renal ontogenesis and in adult kidney. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F240-F250, 1995[Abstract/Free Full Text].

29.   Tufro-McReddie, A., V. F. Norwood, K. W. Aylor, S. J. Botkin, R. M. Carey, and R. A. Gomez. Oxygen regulates vascular endothelial growth factor-mediated vasculogenesis and tubulogenesis. Dev. Biol. 183: 139-149, 1997[Medline].

30.   Yamaguchi, T. P., D. J. Dumont, R. A. Conlon, M. L. Breitman, and J. Rossant. flk-1 and flt-related receptor tyrosine kinase is an early marker for endothelial precursors. Development 118: 489-498, 1993[Abstract].


Am J Physiol Renal Physiol 275(1):F164-F172
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
P. L. St. John and D. R. Abrahamson
LacZ Transgenic Mice and Immunoelectron Microscopy: An Ultrastructural Method for Dual Localization of {beta}-Galactosidase and Horseradish Peroxidase
J. Histochem. Cytochem., December 1, 2007; 55(12): 1207 - 1211.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Saito, Y. Guan, Z. Qi, L. S. Davis, M. Komhoff, Y. Sugimoto, S. Narumiya, R. M. Breyer, and M. D. Breyer
Expression of the prostaglandin F receptor (FP) gene along the mouse genitourinary tract
Am J Physiol Renal Physiol, June 1, 2003; 284(6): F1164 - F1170.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
J. M. Ricono, Y.-C. Xu, M. Arar, D.-c. Jin, J. L. Barnes, and H. E. Abboud
Morphological Insights into the Origin of Glomerular Endothelial and Mesangial Cells and Their Precursors
J. Histochem. Cytochem., February 1, 2003; 51(2): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Schneider, Y. Zhang, Y. Guan, L. S. Davis, and M. D. Breyer
Differential, inducible gene targeting in renal epithelia, vascular endothelium, and viscera of Mx1Cre mice
Am J Physiol Renal Physiol, February 1, 2003; 284(2): F411 - F417.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. A. Oliver, J. Barasch, J. Yang, D. Herzlinger, and Q. Al-Awqati
Metanephric mesenchyme contains embryonic renal stem cells
Am J Physiol Renal Physiol, October 1, 2002; 283(4): F799 - F809.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. Takahashi, K. Takahashi, S. Gerety, H. Wang, D. J. Anderson, and T. O. Daniel
Temporally Compartmentalized Expression of Ephrin-B2 during Renal Glomerular Development
J. Am. Soc. Nephrol., December 1, 2001; 12(12): 2673 - 2682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Hu, J. A. Oliver, M. R. Goldberg, and Q. Al-Awqati
LRP: a new adhesion molecule for endothelial and smooth muscle cells
Am J Physiol Renal Physiol, October 1, 2001; 281(4): F739 - F750.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. L. S. Sequeira Lopez, E. S. Pentz, B. Robert, D. R. Abrahamson, and R. A. Gomez
Embryonic origin and lineage of juxtaglomerular cells
Am J Physiol Renal Physiol, August 1, 2001; 281(2): F345 - F356.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. P. Gunningham, M. J. Currie, C. Han, K. Turner, P. A. E. Scott, B. A. Robinson, A. L. Harris, and S. B. Fox
Vascular Endothelial Growth Factor-B and Vascular Endothelial Growth Factor-C Expression in Renal Cell Carcinomas: Regulation by the von Hippel-Lindau Gene and Hypoxia
Cancer Res., April 1, 2001; 61(7): 3206 - 3211.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. L. St. John, R. Wang, Y. Yin, J. H. Miner, B. Robert, and D. R. Abrahamson
Glomerular laminin isoform transitions: errors in metanephric culture are corrected by grafting
Am J Physiol Renal Physiol, April 1, 2001; 280(4): F695 - F705.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. Robert, X. Zhao, and D. R. Abrahamson
Coexpression of neuropilin-1, Flk1, and VEGF164 in developing and mature mouse kidney glomeruli
Am J Physiol Renal Physiol, August 1, 2000; 279(2): F275 - F282.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. TAKAHASHI, K. TAKAHASHI, R. MERNAUGH, V. DROZDOFF, C. SIPE, H. SCHOECKLMANN, B. ROBERT, D. R. ABRAHAMSON, and T. O. DANIEL
Endothelial Localization of Receptor Tyrosine Phosphatase, ECRTP/DEP-1, in Developing and Mature Renal Vasculature
J. Am. Soc. Nephrol., October 1, 1999; 10(10): 2135 - 2145.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robert, B.
Right arrow Articles by Abrahamson, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robert, B.
Right arrow Articles by Abrahamson, D. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online