|
|
||||||||
1 Section of Pediatric Nephrology, Tulane University School of Medicine, New Orleans, Louisiana 70112; and 2 Eye Care Services, Henry Ford Health System, Detroit, Michigan 48202
| |
ABSTRACT |
|---|
|
|
|---|
Previous studies have shown that the epithelial precursors of the connecting tubule and collecting duct express tissue kallikrein and bradykinin B2 receptors, respectively, suggesting the presence of a local kinin-producing/responsive system in the maturing distal nephron. However, evidence for the existence of kininogen in the developing nephron is still lacking. This study examined the spatiotemporal relationships between segmental nephron differentiation and the ontogeny of kininogen and kinins in the rat. Kininogen immunoreactivity is detectable in the metanephros as early as embryonic day 15. In the nephrogenic zone, the terminal ureteric bud branches are the main kinin-expressing segments. Kininogen is also observed in the stromal mesenchyme. In contrast, proximal ureteric bud branches, metanephrogenic mesenchyme, and pretubular aggregates express little or no kininogen. After completion of nephrogenesis, kininogen distribution assumes its classic "adult" pattern in the collecting ducts. Peak kininogen mRNA and protein expression occur perinatally, corresponding to the period of active nephrogenesis in the rat, and declines gradually thereafter. Estimations made by RT-PCR, Western blotting, and radioimmunoassays indicate that renal kininogen mRNA and protein levels are at least 20-fold higher in newborn than adult rats. Likewise, immunoreactive tissue kinin levels are 2.3-fold higher in newborn than adult kidneys (P < 0.05). In summary, the present study demonstrates the activation of kininogen gene expression and kinin production in the developing kidney. The terminal ureteric bud branches and their epithelial derivatives are the principal kinin-producing segments in the maturing nephron. The results suggest an autocrine/paracrine role for the kallikrein-kinin system in distal nephron maturation.
development; kidney; kallikrein-kinin system; messenger ribonucleic acid; immunohistochemistry
| |
INTRODUCTION |
|---|
|
|
|---|
HIGH- AND LOW-MOLECULAR-weight kininogens (HKG and LKG), the precursors of endogenous kinins, are generated by differential splicing of a primary transcript encoded by a single gene called K-KG (18). HKG is the preferred substrate for plasma kallikrein, whereas LKG is preferentially cleaved by tissue kallikreins, a multigene family of serine proteases (for a review, see Ref. 2). The rat liver also expresses an LKG-related protein of unknown function called T-KG. Unlike LKG, however, T-KG is not cleaved by plasma or tissue kallikreins. Studies in adult kidneys indicate that LKG mRNA is expressed in the collecting ducts (14, 17), suggesting that kinin-producing cells are of ureteric bud origin. However, evidence for the production of kininogen and kinins in the developing kidney remains lacking.
It is now established that endogenous kinins modulate renal hemodynamics and urinary sodium excretion (19, 26, 27). Furthermore, transgenic mice harboring the human tissue kallikrein gene are hypotensive (30). Conversely, mice with targeted disruption of the bradykinin B2 receptor gene manifest decreased renal blood flow and salt-sensitive hypertension (1), thus providing direct evidence for the involvement of kinins in renal function and blood pressure homeostasis.
Although the role of kinins in the adult animal is in great part understood, the role of kinins during early development is virtually unknown. Initial studies by Robillard and colleagues (25) found a significant correlation between the developmental changes in renal blood flow and renal kallikrein activity. Studies from our laboratory utilizing a selective B2-receptor antagonist have shown that endogenous kinins, acting via B2 receptors, counteract angiotensin II-mediated renal vasoconstriction in the developing rat (12). Furthermore, there is evidence that the activation of kinin B2 receptor gene expression in the neonatal kidney is involved in maintaining the high-proliferative activity during the later stages of nephrogenesis (31). Other studies performed in an inbred rat strain with low renal kallikrein have shown that these rats manifest reduced renal growth and poor glomerular development (23). The presence of the mRNAs and proteins for tissue kallikrein (8, 11, 29), kininase II (angiotensin-converting enzyme) (32, 33), and bradykinin B2 receptors (10) in the fetal and newborn kidney provides further support for the involvement of kinins in kidney maturation. However, evidence that the tissue kallikrein substrate, LKG, is expressed in the developing nephron is still lacking. Accordingly, the present study was designed to examine the ontogeny and intrarenal localization of LKG during rat nephrogenesis.
| |
METHODS |
|---|
|
|
|---|
Time-dated pregnant and adult male Sprague-Dawley rats (200-250 g) were purchased from Charles River Breeding Laboratories (Wilmington, MA) and fed regular rat chow (Purina 5012; Ralston-Purina, St. Louis, MO) and tap water until the day of study.
Detection of LKG mRNA by reverse transcription-polymerase chain reaction. Total kidney RNA from fetuses (gestation days 16, 18, and 20), newborn (days 1 and 5), weanling (day 20), and adult rats was extracted by the guanidinium isothiocyanate protocol of Chomczynski and Sacchi (7). LKG mRNA was detected by RT-PCR, and liver RNA served as a positive control. The RT mixture (12 µl) contained 3 µg of total RNA, 1 ng of random hexamers, 1 µl of 10 mM dNTP, 2 µl of 10× RT buffer [200 mM Tris · HCl (pH 8.4), 500 mM KCl, 15 mM MgCl2], and 200 U of Moloney leukemia virus reverse transcriptase Superscript II (GIBCO-BRL, Life Technologies). RT was performed using Perkin-Elmer Gene Amp PCR System 2400 (Cetus Instruments, Norwalk, CT) at 37°C for 50 min, and the RT enzyme was inactivated by heating at 70°C for 10 min. The template mRNA was degraded by incubating the samples with 2 units of Escherichia coli RNase H at 37°C for 20 min. cDNA was amplified from 25% of RT mixture by PCR, using LKG-specific primers (25 pmol of each), 1 unit of thermostable Taq polymerase, 5 µl of 10× PCR buffer, and 1 µl of 10 mM dNTP (35 cycles at 94°C for 5 min, 55°C for 1 min, 72°C for 1 min). This was followed by a 7-min elongation period at 60°C. Exponential amplification of LKG cDNA was documented at 35 cycles of PCR. The primers used were 5' ACATCACAGGTGGTTGCTGGA 3' (upstream), corresponding to nucleotides 918-938 of K-KG mRNA (exon 7), and 5' TGAGAGTCTGCCCTTGTACT 3' (downstream), corresponding to nucleotides 1215-1234 of K-KG mRNA (exon 11) (15). Because the sequence encoded by exon 11 is only present in LKG mRNA, the RT-PCR product (314) is specifically derived from LKG message. This was further confirmed by Southern blot hybridization to a radiolabeled LKG-specific oligonucleotide, 5' TCCGAAAAAGTGAGCTCCACG 3'.
As an internal standard for the efficiency of amplification, one-fifth of the RT product was also used to amplify glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA sequences. The upstream primer (5' AATGCATCCTGCACCACCAACTGC 3') corresponds to nucleotides 524-547, and the downstream primer (5' GGCGGCCATGTAGGCCATCTGGAG 3') is complementary to nucleotides 1055-1078 of rat GAPDH cDNA. PCR conditions were as follows: 94°C for 5 min, 55°C for 1 min, and 72°C for 7 min. The predicted size of the PCR product is 555 bp. Southern blots were hybridized to 32P-labeled GAPDH cDNA. Relative band intensities were determined by scanning densitometry (Ultroscan, LKB Biotechnology).
Western blot analysis. Kidneys from fetal, neonatal, weanling, and adult rats were removed, rinsed thoroughly, and homogenized in PBS (pH 7.2) on ice. Homogenate was centrifuged at 600 g for 20 min (4°C), and the supernatant was treated with deoxycholate (0.5% wt/vol) for 30 min at room temperature and centrifuged at 20,000 g for 30 min at 4°C. The samples were subsequently assayed for protein concentration, according to the method of Lowry et al. (20), using bovine serum albumin (BSA) as a standard. Aliquots of kidney extracts (50 µg total protein) were separated by 3-12% stacking SDS-PAGE [12% acrylamide, 5 mM bis (Bio-Rad Laboratories, Richmond, CA), 0.38 M Tris · HCl, pH 8.8, 0.1% SDS, 0.1% ammonium persulfate, and 0.025% N,N,N',N'-tetramethylethylenediamine (Bio-Rad)]. Rainbow molecular weight markers (14,300-200,000; Amersham, Arlington Heights, IL) were used to determine approximate molecular weights. Electrophoresis was carried out at 60 V for 3 h in duplicate. One gel was stained with 0.1% Coomassie blue stain R250 to visualize the protein bands. The proteins from the second gel were electrophoretically transferred to nitrocellulose in a Genie Electrophoretic Blotter (Idea Scientific, Corvallis, OR) at 20 V for 90 min. Transfer buffer is Tris-glycine (25 mM Tris, 0.2 M glycine), pH 8.3, in 20% methanol. After transblotting, the nitrocellulose was washed in PBS, pH 7.2, and incubated overnight at 4°C in PBS containing 3% BSA as a blocking agent. After rinsing in 0.05% Tween 20 in PBS for 20 min at room temperature, the nitrocellulose was incubated with a polyclonal anti-rat LKG antibody (from Dr. Julie Chao) diluted 1:1,000 in PBS-Tween 20 for 2 h at room temperature. This antibody recognizes LKG but not HKG (5, 6). In other experiments, we used a monoclonal bradykinin-directed anti-KG antibody (1D10), which recognizes the kinin moiety in all KGs (5). The nitrocellulose blots were then washed in PBS-Tween 20, followed by PBS alone, and incubated at room temperature for 1 h with anti-mouse IgG peroxidase conjugate (Sigma Chemical, St. Louis, MO; diluted 1:2,000 in PBS-Tween 20 with 3% BSA). After blots were washed in PBS, visualization of antigen-antibody reaction products was accomplished by enhanced chemiluminescence (ECL, Amersham) per manufacturer's instructions or by 4-chloronaphthol, as previously described (9). Relative band intensities were determined by scanning laser densitometry (Ultroscan, LKB Biotechnology).
Immunohistochemistry. Twenty-four rat fetuses (gestation ages 15 and 17-20 days), eight newborns (days 1 and 5), and four adult rats were examined for the immunolocalization of LKG. Tissues were fixed from 4-12 h in Bouin's fixative (4% paraformaldehyde, 1% picric acid, 5% glacial acetic acid), dehydrated, and embedded in paraffin blocks. Serial 5- to 7-µm sections were immunostained for KG by the immunoperoxidase technique. After deparafinization and hydration, the sections were washed in PBS for 5 min. Quenching of endogenous peroxidase activity was achieved by incubating the sections for 30 min in 0.3% H2O2 in methanol. After washing in PBS for 20 min, the sections were incubated with normal horse serum for 20 min. Thereafter, the sections were incubated for 90 min with LKG antibody diluted 1:2,000 in PBS containing 1% BSA. Sections were rinsed in PBS for 10 min and subsequently incubated with IgG-biotinylated antibody for 30 min. Subsequently, the sections were washed in PBS for 10 min and incubated for 45 min with the avidin-biotinylated horseradish peroxidase complex (Vectastain ABC reagent; Vector Laboratories, Burlingame, CA) and exposed for 3-5 min to 0.1% diaminobenzidine tetrahydrochloride and 0.2% H2O2. The sections were then washed in tap water and counterstained with hematoxylin or periodic acid-Schiff (PAS) as a marker of proximal tubular brush border. As negative controls, the primary antibody was omitted or replaced by nonimmune serum.
Immunostained sections were reviewed by light microscopy at ×100 and ×200 magnifications. The segmental localization of LKG immunoreactivity in developing and adult kidneys was recorded for each age group of rats. In addition a semiquantitative score was obtained for the intensity of staining as follow: 0, no staining; +, weak; ++, moderate; and +++, strong staining. An average of 2-3 sections per animal were examined, and all comparisons were done on tissue sections that were immunostained during the same run.
Tissue kininogen and kinin RIA. Kidney KG levels were measured by a direct RIA (6) on pooled tissue samples from 4-5 animals in each group. The kinin RIA was performed in individual kidney tissue samples, as described by Campbell et al. (3). Briefly, the rats (4 adults, 12 five day old) were killed by decapitation without prior anesthetic, and the kidneys rapidly removed and weighed. The kidneys were immediately homogenized in 4 M guanidine thiocyanate (GTC) and 1% trifluoracetic acid (TFA) in water at room temperature. The time delay between decapitation of the animal and kidney tissue homogenization was less than 60 s. To obtain sufficient kidney tissues from young rats, four pools (3 rats each) were made. Kidneys were homogenized in 20 ml GTC/TFA. Tissue homogenate was sonicated briefly and then centrifuged at 5,000 g for 20 min.
For the extraction of bradykinin from tissues, 10 ml of the supernatant from each homogenate was extracted on a Sep-Pak C18 cartridge (Waters Chromatography Division, Milford, MA). The eluate was collected into a siliconized 13 × 100-mm bortosilicate glass tube and evaporated to dryness in a vacuum centrifuge. Each extract was then dissolved in 1 ml of 1 M hydrochloric acid and was extracted twice with 1 ml diethyl ether. The extracts were then evaporated to dryness again before performing the RIA (3). A rabbit polyclonal COOH-terminal-directed bradykinin (BK)-(1-9) antibody was used in the RIA. It has been shown previously that the predominant BK peptides in kidney are BK-(1-7) and BK-(1-9), with low levels of BK-(1-8) and BK-(4-9) detectable (3). Monoiodinated 125I-tyr-BK-(1-9) was used as a tracer for the COOH-terminal-directed RIA. The standard for the COOH-terminal RIA was BK-(1-9).
Statistical analysis. Comparisons between groups were performed by one-way ANOVA or unpaired t-test. P < 0.05 was considered significant.
| |
RESULTS |
|---|
|
|
|---|
Developmental changes in renal LKG protein and mRNA. As shown in Fig. 1, renal LKG levels, measured by Western blotting and a specific RIA, are elevated in the fetus and newborn and decline postnatally. Peak LKG levels are observed during the perinatal period and are ~40-fold higher than the levels observed in the adult kidney. Western blot analysis also shows that the KG antibody is specific for LKG (68 kDa). Immunoblotting with a BK-directed anti-KG antibody revealed qualitatively similar results (Fig. 1B). The presence of a 68-kDa doublet is probably related to the codetection of LKG and T-KG because the utilized antibodies recognize both molecules.
|
To determine whether LKG is synthesized in the developing kidney, we used a sensitive RT-PCR assay to detect LKG mRNA sequences. The RT-PCR strategy allows the distinction of LKG from HKG and T-KG. As shown in Fig. 2, LKG mRNA is expressed in the fetal kidney as early as embryonic day 16 (E16). The abundance of LKG mRNA increases toward the end of gestation and peaks perinatally only to decline thereafter. The difference in LKG mRNA levels between day 1 or 5 kidneys and adult kidneys varied between 5- and 20-fold (3 separate assays). This temporal pattern of expression parallels that of LKG protein detected by Western blotting and RIA, indicating that the renal KG gene is developmentally regulated.
|
Developmental changes in immunoreactive renal kinin contents. Kidney immunoreactive kinins were measured utilizing a COOH-terminal kinin RIA in 5-day-old newborn and adult male rats (n = 4/group). Renal tissue kinin contents were 2.3-fold higher in the newborn than adult rats (214 ± 9 vs. 93 ± 10 fmol/g; P < 0.05, t-test) (Fig. 3). Addition of carboxypeptidase B to the assay sample, which removes the COOH-terminal arginine of BK, abolished the immunoreactivity indicating that the antibody used in this assay recognizes a true kinin moiety.
|
Intrarenal localization of KG in the developing kidney. Sections of liver and submandibular gland (SMG) from E15 and -17 rat fetuses, respectively, were used as positive controls for the LKG immunostaining. The rat liver synthesizes LKG as early as E11 of gestation (28). LKG immunoreactivity in the fetal liver is observed in the cytoplasm of differentiating hepatocytes in a perinuclear distribution (Fig. 4A). In the SMG, LKG is observed primarily in the ductal epithelial cells and in the developing glandular structures (Fig. 4B). The loose periductal mesenchyme expresses LKG but at lower intensity.
|
In the developing kidney, three temporal stage-specific patterns of LKG expression were identified during nephrogenesis. During early-to-mid-fetal nephrogenesis (E15-17), LKG immunoreactivity is mainly observed in the terminal branches of the ureter (future collecting ducts) (Fig. 4, C and D). Only few LKG-positive cells are observed within the main branches of the ureter. LKG is not observed in the nephrogenic mesenchyme but is expressed at low levels in stromal interstitial cells of the cortex and medulla (Fig. 4D). PAS-counterstained kidney sections at E19 confirmed that PAS-positive maturing proximal tubules are LKG negative (Fig. 5).
|
During the later stages of nephrogenesis (day 5), LKG immunostaining is seen mainly in the collecting ducts (Fig. 6A). Intraglomerular LKG staining decreases in maturing glomeruli where it appears to be predominantly expressed in the capillary loops and in the peritubular capillary network (Fig. 6B). After completion of nephrogenesis, LKG assumes its classic adult-type distribution within the collecting ducts (Fig. 7B). In the adult kidney, higher concentrations of LKG antibody (1:1,000) were needed to reveal immunostaining due to the declining abundance of LKG with age. In addition to the collecting ducts, LKG immunostaining is observed in the peritubular capillary network of the outer and inner medulla (Fig. 7B). No specific staining was observed in control sections incubated with a nonimmune rabbit serum (Fig. 7A) or in the absence of the primary antibody (not shown). We also observed that the overall intensity of LKG immunostaining decreases with postnatal maturation. A summary of the segmental localization and semiquantitative assessment of the intensity of LKG immunostaining are presented in Table 1.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study documents that the developing rat kidney expresses LKG mRNA and protein. The ontogenetic changes in LKG expression are accompanied by significant shifts in the intrarenal segmental localization of LKG. During early nephrogenesis, LKG is mainly expressed in the terminal ureteric bud branches. As glomerulogenesis proceeds, LKG is also observed in capillary loop stage glomeruli but disappears later in fully mature glomeruli. During the later stages of nephrogenesis, LKG assumes its classic adult location in the collecting ducts.
Bradykinin is a short-lived peptide, and therefore it operates in a paracrine manner at or near its site of synthesis and release. In the adult kidney, tissue kallikrein, LKG, and kinin B2 receptors are all expressed in the distal nephron (13, 14, 17). Emerging evidence indicates that the developing kidney may also be endowed with a local kallikrein-kinin system. The genes encoding rat tissue kallikrein and bradykinin B2 receptors are expressed in the upper limb of S-shaped nephrons and maturing collecting ducts, respectively (8, 10). This study presents new evidence that KG gene expression is activated during kidney development, and that LKG is localized to epithelial elements destined to give rise to the collecting duct. Collectively, the results demonstrate the presence of a complete kallikrein-kinin system in the differentiating distal nephron.
The higher levels of immunoreactive kinins in developing than adult kidneys is in agreement with the observation that the intensity of LKG immunostaining is also higher in newborn than adult animals. Kininase II levels are low in the developing rat kidney and do not increase until the end of the 2nd week of postnatal life (32). In addition, there is evidence for the presence of high kininase II levels in the collecting duct, the site of kinin formation (4). Thus the elevated kinin levels in the newborn kidney are likely to result from a combination of increased production and decreased degradation.
The liver is the major source of circulating KG. HKG and LKG are encoded by differentially spliced mRNAs transcribed from a single gene called K-KG (18). The nine exons upstream of the kinin sequence code for the same amino acids in both HKG and LKG; the portion of exon 10 downstream of the kinin sequence is unique to HKG mRNA, whereas exon 11 is expressed in only LKG mRNA. LKG (68 kDa) is the substrate for tissue kallikrein, whereas HKG (100-120 kDa, depending on the species) serves as the substrate for plasma kallikrein. The rat liver expresses an additional unique KG molecule, called T-KG, which displays 90% sequence homology with LKG (2). T-KG is a product of an acute-phase gene that is stimulated by interleukin-6 in inflammatory conditions. The mRNAs encoding LKG and T-KG are differentially regulated. Both transcripts of the K-KG gene (i.e., HKG and LKG) are expressed constitutively during rat liver development (9). On the other hand, T-KG expression is induced immediately after birth (9). The present study shows that the K-KG gene is induced in the developing kidney. Thus the ontogeny of K-KG gene expression is controlled by tissue-specific factors. The molecular basis for the differential tissue-specific and developmental expression of KG is an interesting topic for future investigation. This study focused on LKG, rather than HKG or T-KG, because LKG is the main physiological substrate for renal tissue kallikrein.
The recent availability of highly potent and selective bradykinin receptor antagonists has permitted the evaluation of the role of the kallikrein-kinin system in renal and cardiovascular homeostasis. In the adult, acute kinin B2 receptor blockade decreases renal blood flow and reduces papillary blood flow and the natriuretic response to volume loading (26, 27). The role of kinins in blood pressure regulation is further illustrated by the findings that chronic administration of angiotensin II to kininogen-deficient rats or kinin receptor antagonist-treated rats results in hypertension (22, 24) and that transgenic mice overexpressing human tissue kallikrein are hypotensive (30). In contrast, that targeted disruption of the B2 receptor gene confers salt sensitivity (1).
The functional relevance of intrarenal kinins in the developing animal is not entirely clear. Recent studies using selective B2 receptor antagonists have demonstrated that endogenous kinins tonically oppose angiotensin-mediated renal vasoconstriction in newborn rats (12). Also, kinin B2 receptor blockade in neonatal (but not adult) rats suppresses renal growth and DNA synthesis (31). A role for the renal kallikrein-kinin system during fetal life has also been suggested. Gestational blockade of B2 receptors in salt-treated pregnant rats compromises fetal metanephrogenesis and leads to adult hypertension (21). Ongoing studies in mice with genetic ablation of B2 receptors should be informative with regard to the developmental role of kinins.
There is evidence that the intact LKG molecule may have additional functions independently from kinins. The KG molecules are potent inhibitors of lysosomal cysteine proteases, such as cathepsin B, H, and L (2). During the period of rapid cell growth and proliferation, these enzymes may be released from apoptotic cells and, if activated in an acid microenvironment, can induce substantial injury or extensive remodeling of the extracellular matrix in the immature kidney. We therefore postulate that the developmentally programmed activation of KG gene expression may represent an intrinsic defensive mechanism to protect the differentiating renal epithelial cells against endogenous cysteine proteases released from neighboring apoptotic mesenchymal cells. In support of this hypothesis, preliminary studies by Vattimo et al. (28) have suggested a role for cysteine proteinase activity in growth factor-induced tubulogenesis. Clearly, future studies are needed to test this hypothesis.
In summary, this study demonstrates that LKG is highly expressed during rat nephrogenesis. The differentiating collecting duct, the site of kinin B2 receptor expression, is also the principal LKG-expressing segment in the developing nephron. Based on the infrequent expression of KG in the main ureteric branches or metanephric mesenchyme, we speculate that kinins are not involved in the regulation of branching morphogenesis or early mesenchymal-epithelial differentiation. On the other hand, the spatially restricted expression of LKG (along with B2 receptors, Ref. 10) in the differentiating collecting duct system supports the idea that kinins and/or KGs may be important for distal nephron growth or the acquisition of a differentiated phenotype.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Drs. Julie Chao (Medical University of South Carolina) and Gloria Scicli (Henry Ford Health System) for help in measurement of immunoreactive kininogen and kinins, respectively.
| |
FOOTNOTES |
|---|
The present study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-53595 and Grant-in-Aid 96-008140 from the American Heart Association, National Center (to S. S. El-Dahr). S. S. El-Dahr is a recipient of National Kidney Foundation Clinical Scientist Award.
Address for reprint requests: S. S. El-Dahr, Dept. of Pediatrics, Tulane Univ. School of Medicine, 1430 Tulane Ave., New Orleans, LA 70112.
Received 1 December 1997; accepted in final form 2 April 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alfie, M. E.,
X-P. Yang,
F. Hess,
and
O. A. Carretero.
Salt-sensitive hypertension in bradykinin B2 receptor knockout mice.
Biochem. Biophys. Res. Commun.
224:
625-630,
1996[Medline].
2.
Bhoola, K. D,
C. D. Figueroa,
and
K. Worthy.
Bioregulation of kinins: kallikreins, kininogens, and kininases.
Pharmacol. Rev.
44:
1-80,
1992[Medline].
3.
Campbell, D. J.,
A. Kladis,
and
A.-M. Duncan.
Bradykinin peptides in kidney, blood, and other tissues of the rat.
Hypertension
21:
155-165,
1993
4.
Casarini, D. E.,
M. A. Boim,
R. C. Stella,
M. H. Krieger-Azzolini,
J. E. Krieger,
and
N. Schor.
Angiotensin I-converting enzyme activity in tubular fluid along the rat nephron.
Am. J. Physiol.
272 (Renal Physiol. 41):
F405-F409,
1997
5.
Chao, J.,
C. Swain,
S. Chao,
W. Xiong,
and
L. Chao.
Tissue distribution and kininogen gene expression after acute-phase inflammation.
Biochim. Biophys. Acta
964:
329-339,
1988[Medline].
6.
Chen, L-M.,
P. Chung,
S. Chao,
L. Chao,
and
J. Chao.
Differential regulation of kininogen gene expression by estrogen and progesterone in vivo.
Biochim. Biophys. Acta
1131:
145-151,
1992[Medline].
7.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
8.
El-Dahr, S. S.,
and
J. Chao.
Spatial and temporal expression of kallikrein and its mRNA during nephron maturation.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F705-F711,
1992
9.
El-Dahr, S. S.,
S. Dipp,
and
J. Chao.
Differential developmental expression of the rat kininogen genes.
Pediatr. Res.
32:
649-653,
1992[Medline].
10.
El-Dahr, S. S.,
C. D. Figueroa,
C. B. Gonzalez,
and
W. Müller-Esterl.
Ontogeny of bradykinin B2 receptors in the rat kidney: implications for segmental nephron maturation.
Kidney Int.
51:
739-749,
1997[Medline].
11.
El-Dahr, S. S.,
and
I. V. Yosipiv.
Developmentally regulated kallikrein enzymatic activity and gene transcription rate in maturing rat kidneys.
Am. J. Physiol.
265 (Renal Fluid Electrolyte Physiol. 34):
F146-F150,
1993
12.
El-Dahr, S. S.,
I. V. Yosipiv,
L. Lewis,
and
K. D. Mitchell.
Role of bradykinin B2 receptors in the developmental changes of renal hemodynamics in the neonatal rat.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F786-F792,
1995
13.
Figueroa, C. D.,
C. B. Gonzalez,
S. Grigoriev,
S. Abd Alla,
M. Haasemann,
K. Jarnagin,
and
W. Müller-Esterl.
Probing for the bradykinin B2 receptor in rat kidney by anti-peptide and anti-ligand antibodies.
J. Histochem. Cytochem.
43:
137-148,
1995[Abstract].
14.
Figueroa, C. D.,
A. G. MacIver,
J. C. Mackenzie,
and
K. D. Bhoola.
Localisation of immunoreactive kininogen and tissue kallikrein in the human nephron.
Histochemistry
89:
437-442,
1988[Medline].
15.
Furuto-Kato, S.,
A. Matsumoto,
N. Kitamura,
and
S. Nakanishi.
Primary structures of the mRNAs encoding the rat precursors for bradykinin and T-kinin.
J. Biol. Chem.
260:
12054-12059,
1985
16.
Gelly, J. L.,
J. P. Richoux,
G. Grignon,
J. Bouhnik,
T. Baussant,
F. Alhenc-Gelas,
and
P. Corvol.
Immunocytochemical localization of albumin, transferrin, angiotensinogen, and kininogens during the initial stages of rat liver differentiation.
Histochemistry
96:
7-12,
1991[Medline].
17.
Hermann, A.,
A. Braun,
C. D. Figueroa,
W. Müller-Esterl,
H. Fritz,
and
J. Rehbock.
Expression and cellular localization of kininogens in the human kidney.
Kidney Int.
50:
79-84,
1996[Medline].
18.
Kitamura, N.,
Y. Takagashi,
S. Furuto,
T. Tanaka,
and
S. Nakanishi.
A single gene for bovine high-molecular weight and low molecular weight kininogen.
Nature
305:
545-549,
1983[Medline].
19.
Kon, V.,
A. Fogo,
and
I. Ichikawa.
Bradykinin causes selective efferent arteriolar dilation during angiotensin I converting enzyme inhibition.
Kidney Int.
44:
545-550,
1993[Medline].
20.
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr,
and
R. J. Randal.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:
265-275,
1951
21.
Madeddu, P.,
P. P. Parpaglia,
M. P. Demontis,
M. V. Varoni,
M. C. Fattaccio,
V. Anania,
and
N. Glorioso.
Early blockade of bradykinin B2-receptors alters the adult cardiovascular phenotype in rats.
Hypertension
25:
453-459,
1995
22.
Madeddu, P.,
P. P. Parpaglia,
M. P. Demontis,
M. V. Varoni,
M. C. Fattaccio,
and
N. Glorioso.
Chronic inhibition of bradykinin B2-receptors enhances the slow vasopressor response to angiotensin II.
Hypertension
23:
646-652,
1994
23.
Madeddu, P.,
M. V. Varoni,
M. P. Demontis,
P. Pinna-Parpaglia,
N. Glorioso,
and
V. Anania.
Urinary kallikrein: a marker of blood pressure sensitivity to salt.
Kidney Int.
49:
1422-1427,
1996[Medline].
24.
Majima, M.,
S. Mizogami,
Y. Kuribayashi,
M. Katori,
and
S. Oh-ishi.
Hypertension induced by a nonpressor dose of angiotensin II in kininogen-deficient rats.
Hypertension
24:
111-119,
1994
25.
Robillard, J. E.,
W. J. Lawton,
D. N. Weismann,
and
C. Sessions.
Developmental aspects of the renal kallikrein-like activity in fetal and newborn lambs.
Kidney Int.
22:
594-601,
1982[Medline].
26.
Roman, R. J.,
M. L. Kaldunski,
A. G. Scicli,
and
O. A. Carretero.
Influence of kinins and angiotensin II on the regulation of papillary blood flow.
Am. J. Physiol.
255 (Renal Fluid Electrolyte Physiol. 24):
F690-F698,
1988
27.
Siragy, H. M.
Evidence that intrarenal bradykinin plays a role in the regulation of renal function.
Am. J. Physiol.
265 (Endocrinol. Metab. 28):
E648-E654,
1993
28.
Vattimo, M. F. F.,
A. Pacheca-Silva,
and
O. F. P. Santos.
The role of cysteine proteinases in the tubulogenesis of the embryonic kidney (Abstract).
J. Am. Soc. Nephrol.
8:
367A,
1997.
29.
Velarde, V.,
J. Humphreys,
C. D. Figueroa,
and
C. P. Vio.
Postnatal maturation of tissue kallikrein-producing cells (connecting tubule cells) in the rat kidney: a morphometric and immunohistochemical study.
Anat. Embryol. (Berl.)
192:
407-414,
1995[Medline].
30.
Wang, J.,
W. Xiong,
Z. Yang,
T. Davis,
M. J. Dewey,
J. Chao,
and
L. Chao.
Human tissue kallikrein induces hypotension in transgenic mice.
Hypertension
23:
236-243,
1994
31.
Yosipiv, I. V.,
S. Dipp,
and
S. S. El-Dahr.
Role of bradykinin B2 receptors in neonatal kidney growth.
J. Am. Soc. Nephrol.
8:
920-928,
1997[Abstract].
32.
Yosipiv, I. V.,
S. Dipp,
and
S. S. El-Dahr.
Ontogeny of somatic angiotensin- converting enzyme.
Hypertension
23:
369-374,
1994
33.
Yosipiv, I. V.,
and
S. S. El-Dahr.
Developmental regulation of ACE gene expression by endogenous kinins and angiotensin II.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F172,
1995
This article has been cited by other articles:
![]() |
S. S. El-Dahr, K. Aboudehen, and S. Dipp Bradykinin B2 receptor null mice harboring a Ser23-to-Ala substitution in the p53 gene are protected from renal dysgenesis Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1404 - F1413. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fan, J. Stefkova, and S. S. El-Dahr Susceptibility to metanephric apoptosis in bradykinin B2 receptor null mice via the p53-Bax pathway Am J Physiol Renal Physiol, September 1, 2006; 291(3): F670 - F682. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. V. Yosipiv, S. Dipp, and S. S. El-Dahr Targeted disruption of the bradykinin B2 receptor gene in mice alters the ontogeny of the renin-angiotensin system Am J Physiol Renal Physiol, November 1, 2001; 281(5): F795 - F801. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Patel and F. G. Smith Age-dependent renal responses to the bradykinin B2- receptor antagonist icatibant in conscious lambs Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2001; 281(4): R1311 - R1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. EL-DAHR, L. M. HARRISON-BERNARD, S. DIPP, I. V. YOSIPIV, and S. MELEG-SMITH Bradykinin B2 null mice are prone to renal dysplasia: gene-environment interactions in kidney development Physiol Genomics, September 8, 2000; 3(3): 121 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. El-Dahr, S. Dipp, and W. H. Baricos Bradykinin stimulates the ERKright-arrowElk-1right-arrowFos/AP-1 pathway in mesangial cells Am J Physiol Renal Physiol, September 1, 1998; 275(3): F343 - F352. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |