INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

BRADYKININ (BK) [Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg] is generated by the partial hydrolysis of kininogens by plasma and tissue kallikreins. BK is a selective ligand for the B₂ kinin receptor, a member of the heptahelical G protein-coupled receptor family. B₂ receptors mediate the physiological effects of kinins, including the modulation of vascular tone, renal hemodynamics, and cellular growth (for a review, see Ref. 5). Increased BK synthesis occurs during nephrogenesis (17), in sodium depletion (36), and in inflammation (21). In addition, BK accumulates in the kidney and other tissues following treatment with angiotensin I-converting enzyme (ACE, i.e., kininase II) inhibitors (9), a class of antihypertensive drugs frequently used to delay the progression of glomerular diseases such as diabetic nephropathy (8). A recent study showed that rat mesangial cells in culture express kallikrein-like activity and are capable of producing small amounts of BK (34). Furthermore, ACE inhibitors induce a sevenfold increase in the amount of BK in the culture medium and a twofold increase in DNA synthesis that is inhibited by a B₂ receptor antagonist (34). These findings support previous results from our laboratory (18) and by Bascands and colleagues (4) indicating that BK is a mitogen in quiescent mesangial cells. Recent studies by Dixon and Dennis (16) have shown that BK can both activate or inhibit proliferation of arterial smooth muscle cells, depending on the absence or presence of serum in the culture medium.

Although the early signaling events linking kinin B₂ receptors with intracellular pathways [e.g., protein kinase C (PKC), phospholipase A₂, and tyrosine kinases] in various cell types have been thoroughly investigated (3, 12, 19, 27, 35, 38), there remains a large gap in our understanding of the downstream mitogenic signaling of kinins, particularly in renal cells. Three major mitogen-activated protein kinase (MAPK) cascades have been characterized and shown to be activated by growth factors and G protein-linked receptors (6, 32). The most well characterized of these is the extracellular signal regulated kinase (ERK) pathway. Numerous studies have demonstrated that the ERK cascade is critical to the mitogenic response, cellular differentiation, or hypertrophy. The other two MAPK cascades, the SAPK or JUNK pathway and the p38 pathway, are activated by cellular stress and are thought to transduce growth inhibitory or apoptotic signals. Isolated rat glomeruli express all the components of the MAPK pathway (Raf-1, MEK, and ERK), suggesting that the MAPK cascade may play a role in glomerular growth/function (37). Phosphorylation of both Thr¹⁸³ and Tyr¹⁸⁵ residues in mammalian ERK2 has been shown to be required for its full activation. Translocation of activated ERK to the nucleus and subsequent phosphorylation of a variety of transcription factors, including c-Myc, Elk-1, and ATF-2, support the involvement of ERK in transducing cytoplasmic signals into genomic responses (32). Although the end results of ERK substrate phosphorylation are diverse, the most significant effects on cellular proliferation are probably caused by the increased transcriptional activity of the AP-1 complex resulting from increased expression of c-fos (2, 30). Antisense RNA and dominant-negative mutant studies have clearly documented that ERK1/2 are essential for cell cycle progression (31).

Previous investigations in mesangial cells by Bascands et al. (3, 4) have demonstrated that early signaling events after stimulation of BK B₂ receptors involve activation of phospholipase C, phosphoinositide hydrolysis, PKC activation, and intracellular calcium mobilization. In addition to these signals, protein tyrosine kinases have been implicated in the action of BK in fibroblasts, keratinocytes, and endothelial cells (10, 15, 19, 27, 35, 38). There is evidence indicating that the dual activation and association of the cellular tyrosine kinases, Pyk2 and Src, links the BK B₂ receptors with the MAPK cascade in neuronal PC12 cells (15). During the preparation of this manuscript, Jaffa et al. (24) reported that BK stimulates the tyrosine phosphorylation of ERK and its translocation to the nucleus in rat mesangial cells, suggesting that ERK may link the BK B₂ receptor with nuclear mitogenic responses. Since direct evidence for the involvement of tyrosine phosphorylation or ERK in BK-induced gene expression and transcription factors is lacking, the aim of this study was to explore the nuclear mitogenic signaling of BK in cultured mesangial cells of the rat.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Materials. BK, phenylmethylsulfonyl fluoride (PMSF), leupeptin, pepstatin A, aprotinin, bestatin, Nonidet P-40, and spermidine were all purchased from Sigma Chemical (St. Louis, MO). RPMI 1640 and FCS were obtained from GIBCO/BRL Life Technologies (Grand Island, NY). [³H]thymidine was obtained from ICN Pharmaceuticals (Costa Mesa, CA), and poly-dIdC was from Pharmacia Biotech (Piscataway, NJ). The tyrosine kinase inhibitors, genistein and herbimycin A, PKC inhibitors, 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine (H-7), bisindolylmaleimide I, and the inactive control compound bisindolylmaleimide V, calphostin C, and a monoclonal anti-phosphotyrosine antibody (PY20) were all obtained from Calbiochem-Novabiochem (La Jolla, CA). Hoe-140 (Icatibant), a selective BK B₂ receptor antagonist, was a gift from Hoechst Pharmaceuticals (Frankfurt, Germany). A polyclonal ERK1/2 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal phospho-specific ERK1/2 and Elk-1 antibodies were obtained from New England Biolabs (Beverly, MA). Enhanced chemiluminescence (ECL) detection reagents were obtained from Amersham. The MAP kinase substrate, PHAS-I (phosphorylated heat- and acid-stable protein regulated by insulin) was obtained from Stratagene. The phosphorothioate-modified oligodeoxynucleotides (ODNs) were synthesized by Operon Technologies (Alameda, CA). The transfection reagent, lipofectin, was purchased from Life Technologies.

Mesangial cell culture. Mesangial cells were obtained from intact glomeruli of male Sprague-Dawley rats and characterized as previously described (18). Mesangial cells were maintained in RPMI 1640 medium supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2.0 mM L-glutamine at 37°C in 5% CO₂ humidified air. For all experiments, cells at 80% confluence were made quiescent by incubation for 48 h in fresh RPMI 1640 medium containing 0.5% FCS. Cells were used at passages 8-17. Cultured rat mesangial cells express B₂ binding sites and mRNA (4, 18).

Immunoblot analysis. After washing the cells with ice-cold PBS, the cells were lysed in 0.3 ml of cold lysis solution (50 mM Tris · HCl, pH 8.0, 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% Nonidet P-40, and 0.5% deoxycholate) containing a cocktail of enzyme inhibitors added fresh to the lysis buffer (PMSF 100 µg/ml, aprotinin 1 µg/ml, leupeptin 1 µg/ml, and Na₃VO₄ 10 µg/ml, final concentration). Insoluble material was removed by centrifugation for 10 min at 14,000 g at 4°C. SDS sample buffer [0.33 M Tris · HCl, 10% (wt/vol) SDS, 13% (vol/vol) glycerol, and 0.1 M dithiothreitol (DTT) containing 0.13 mg/ml bromophenol blue] was added to each sample (1/3 of sample volume), and proteins were denatured by boiling for 5 min. Proteins were resolved on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Amersham) using an X Cell blot module (Novex). The adequacy of transfer was assessed by Ponceau-S staining of the membranes. Nonspecific binding sites were blocked with a blocking solution (PBS containing 0.1% Tween and 3% bovine serum albumin) at room temperature for 1 h. Membranes were then incubated overnight (4°C) with a monoclonal anti-phosphotyrosine antibody (PY20, diluted 1/1,000), anti-ERK 1/2 antibody (1/1,500), or phospho-specific antibodies to ERK (1/1,200) and Elk-1 (1/1,000) in the blocking solution. After three washes in PBS/Tween, the nitrocellulose membrane was exposed for 1 h at room temperature to the secondary antibody (horseradish peroxidase-linked goat anti-mouse or-rabbit IgG). Immunoreactive bands were visualized using the ECL detection system (Amersham) per manufacturer's recommendations. The immunoblots were exposed to Hyperfilm-ECL films. Signal intensity of phosphorylated ERK1/2 was determined by laser densitometry. Results were expressed as mean percent over control nonstimulated cells.

In-gel protein kinase assay. Extracts from BK-stimulated mesangial cells and purified active p42 MAP kinase (ERK2) were subjected to SDS-PAGE in gels containing PHAS-I (0.33 mg/ml) as a MAPK substrate. PHAS-I (also known as 4E-BP1) is a translational repressor that is phosphorylated by ERK2 on a single serine residue (29). Gels were washed with 20% (vol/vol) propan-2-ol in 50 mM Tris · HCl (pH 8.0) to remove SDS and then in 5 mM 2-mercaptoethanol in 50 mM Tris · HCl (pH 8.0). Proteins were further denatured by washing the gels in 6 M guanidine HCl and then renatured by washing in 50 mM Tris · HCl (pH 8.0) containing 0.04% (vol/vol) Tween 40 and 5 mM 2-mercaptoethanol at 4°C overnight. After equilibration at room temperature for 1 h in 40 mM HEPES, 2 M dithiothreitol, and 10 mM MgCl₂, pH 8.0, in-gel phosphorylation of PHAS-I was performed in 40 mM HEPES, 0.5 mM EGTA, 10 mM MgCl₂, and 40 µM [-³²P]ATP (10 mCi/ml, 133 µCi/gel) at 30°C for 3 h. After extensive washing in 5% (wt/vol) trichloroacetic acid (TCA) and 1% (wt/vol) disodium pyrophosphate, gels were dried, and phosphorylation was detected by autoradiography.

DNA synthesis. Quiescent mesangial cells in 6-well plates (5 × 10⁴ cells/well) were stimulated for 24 h with BK (10⁷ M). The cells were labeled with 1 µCi/ml [methyl-³H]thymidine for the last 8 h of incubation. To stop the incubation, the medium was removed, and the cells were washed with calcium- and magnesium-free cold PBS (3 ml/well) followed by 2 ml of cold TCA. After 2 h at 4°C, the TCA was removed, and the cells were washed once with 2 ml of 95% ethanol. The cells were then lysed in 1 ml of lysis buffer consisting of 2 M Na₂CO₃, 0.1% SDS, and 0.1 M NaOH. Following a 20-min incubation at 37°C, the lysate (solubilized DNA) was pipetted into 9 ml Scintiverse II and counted in a -scintillation counter.

Cationic liposome-mediated ODN transfection. The antisense ODN is a 17-mer (5' GCCGCCGCCGCCGCCAT 3') directed against the translation initiation site of rat p42 ERK2 mRNA. An identical sequence is present in rat p44 ERK1 mRNA. Sense (5' ATGGCGGCGGCGGCGGC 3') and scrambled sequence (5' CGCGCGCTCGCGCACCC 3') were used as controls. All bases were phosphorothioate-modified. The purified lyophilized ODNs were dissolved in sterile water.

Appropriate volumes of 8× final concentration (0.2 µM) of ODNs were prepared in antibiotic- and serum-free DMEM. The ODNs were vortex-mixed with equal volume of DMEM containing 40 µg/ml lipofectin and kept at room temperature for 15 min. Mesangial cells were washed three times in DMEM, and the ODN/lipofectin mixture was added (200 µl for each 22-mm-diameter well) followed by an equal volume of DMEM. The final concentration of lipofectin was 10 µg/ml. Mesangial cells were incubated for 6 h at 37°C in humidified air with 5% CO₂. The medium was then replaced with the same volume of liposome-free DMEM containing the same concentration of ODN and supplemented with 0.5% FCS. After 48 h, cell lysates were prepared, and the downregulation of ERK1/2 protein synthesis was examined by Western blotting. In separate samples, BK was added (10⁷ M) to evaluate the effect of the ERK1/2 antisense ODNs on [³H]thymidine incorporation into DNA, as described above. Controls included sense and scrambled ODNs, as above.

RNA blot analysis. Total cellular RNA was isolated by the guanidinium isothiocyanate protocol of Chomczynski and Sacchi (11). RNA (10 or 20 µg per lane) was size fractionated on 1% (wt/vol) agarose gels containing formaldehyde. RNA was transferred to a positively charged GeneScreen Plus membrane (NEN Research Products, Boston, MA) by vacuum blotting. RNA was cross-linked to the membrane using ultraviolet irradiation (Stratalinker; Stratagene, La Jolla, CA). The integrity of RNA was assessed by observing the 28S and 18S rRNA on the membranes after ultraviolet shadowing at 254 nm. The cDNAs [1.0-kb Pst I fragment of mouse c-fos, and 1.2-kb Pst I fragment of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)] were labeled with [-³²P]dCTP using a random primers labeling kit according to the manufacturer's protocol (GIBCO-BRL, Gaithersburg, MD). The labeled cDNA probes were separated from unincorporated nucleotides by Sephadex G-50 Nick columns (Pharmacia), and membranes were hybridized with 10⁷ cpm/ml probe for 20 h followed by high-stringency washes at 65°C (18). The membranes were then autoradiographed with intensifying screens (DuPont, Wilmington, DE) at 70°C. Blots were then stripped for 30 min at 95°C with 0.01× SSC and 0.01% SDS and rehybridized with a probe for GAPDH to correct for loading and transfer variations. Autoradiographic signals were quantitated with a scanning densitometer (Pharmacia LKB, Ultroscan) and mRNA levels were calculated relative to those of GAPDH.

Electrophoretic gel mobility shift assays. Protein extracts were prepared by sonication of cells at 4°C in 1 ml of buffer [20 mM HEPES (pH 7.8), 125 mM NaCl, 5 mM MgCl₂, 12% glycerol, 0.2 mM EDTA, BSA (1 mg/ml), 0.1% Nonidet P-40, 5 mM dithiothreitol (DTT), 0.5 mM PMSF, leupeptin (0.5 µg/ml), pepstatin (0.7 µg/ml), aprotinin (1 µg/ml), and bestatin (40 µg/ml)]. Extracts were then centrifuged at 15,600 g for 10 min (at 4°C), and the supernatant was collected. Studies by us (18) and others (26) have shown that using whole cell extracts does not affect the specificity of this assay compared with nuclear extracts. The AP-1 consensus oligonucleotide used in the binding reaction was a double-stranded 21-bp oligonucleotide with the sequence 5' CGCTTGATGACTCAGCCGGAA 3' (boldface indicates consensus AP-1 binding site), which binds to AP-1 c-jun homodimer and jun/fos heterodimeric complexes. Oligonucleotides were radiolabeled with [-³²P]ATP and T4 kinase. Binding assays were performed with 5-10 µg of protein extracts, 1.5 µg of poly-d(I-C), 5 µl of buffer [50 mM HEPES (pH 7.8), 5 mM spermidine, 15 mM MgCl₂, 36% glycerol, BSA (3 mg/ml), 0.3% Nonidet P-40, and 15 mM DTT], and 40,000-70,000 cpm of ³²P-labeled oligonucleotide, with water added to a final volume of 25 µl. Reactions were incubated for 15 min on ice before addition of ³²P-labeled oligonucleotide, followed by an additional 15 min at 22°C. For competition with unlabeled oligonucleotide, a 100-fold molar excess of unlabeled oligonucleotide relative to the radiolabeled probe was added to the binding assay. Supershift experiments were performed to determine the composition of the complexes using a c-fos antibody. In these experiments, 1 µg of antibody was added to the reaction 45 min before addition of labeled probe, and the mixture was kept at 4°C overnight. Samples were electrophoresed on 4% nondenaturing polyacrylamide gels, dried, and autoradiographed.

Statistical analysis. Comparisons between the groups were performed by one-way ANOVA. P < 0.05 was considered significant.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

BK stimulates tyrosine phosphorylation and activation of ERK. We first examined the effects of BK on protein tyrosine phosphorylation in quiescent cultures of rat mesangial cells (0.5% FCS for 48 h). Cells were stimulated with BK (10⁷ M) for various times, and the cell lysates were subjected to SDS-PAGE and immunoblotted with anti-phosphotyrosine antibody (PY20). As shown in Fig. 1A, BK caused an increase in phosphotyrosine content of several major proteins with apparent molecular masses of 120-130, 90-95, and 44/42 kDa (arrows). By scanning densitometry, BK increased the phosphotyrosine content of p42 by 3.4 ± 0.3-fold compared with the control state (n = 4 experiments, P < 0.05). Although less evident than tyrosine phosphorylation of p42, an increase in tyrosine phosphorylation of p44 by BK was also observed (Fig. 1A). To confirm the role of tyrosine kinase activation in BK-induced p44/p42 phosphorylation, we blocked cellular tyrosine kinase activity with the tyrosine kinase inhibitor, genistein. Genistein inhibits cellular tyrosine kinases by acting as a competitive inhibitor of ATP binding to the kinase (1). Quiescent mesangial cells were pretreated with genistein for 4 h and then stimulated with BK (10⁷ M). Cell lysates were prepared, and tyrosine phosphorylation was assessed by phosphotyrosine immunoblotting. Figure 1A shows that genistein (15 µM) inhibits BK-stimulated protein tyrosine phosphorylation of p44/p42.

View larger version (51K): [in this window] [in a new window]   Fig. 1.   A: effect of bradykinin (BK) on protein tyrosine phosphorylation. Mesangial cells were stimulated with BK for 5, 10, and 15 min. Proteins (20 µg) from cell lysates were separated by SDS-PAGE, transferred to nitrocellulose membrane and immunoprobed with anti-phosphotyrosine antibody (PY20). Proteins phosphorylated after BK stimulation are identified on right (arrows). B: effect of BK on ERK1/2 tyrosine phosphorylation. Mesangial cells were stimulated with BK for the times indicated. Cell lysates were separated by SDS-PAGE and probed with a polyclonal ERK antibody. Phosphorylation of ERK proteins is indicated by a shift to a slower electrophoretic mobility. C: immunoblots were probed with a phospho-specific ERK antibody. Tyrosine phosphorylation of ERK2 by BK is abolished by pretreatment with genistein. Each assay was carried out in duplicate; n = 4.

Since the tyrosine phosphorylated proteins, p44 and p42, may correspond to MAP kinases ERK1/2, respectively, lysates from BK-stimulated mesangial cells were immunoblotted with anti-ERK1/2 antibody. After stimulation with BK (10⁷ M), we observed partial shifts of p42 bands, and to a lesser extent p44 bands, toward slower electrophoretic mobilities (Fig. 1B). The phosphorylated forms of MAP kinase are known to migrate more slowly in SDS-PAGE gel than the nonphosphorylated forms. The increase in intensity of the band shifts was similar at doses of 10⁸-10⁶ M of BK (n = 4, not shown). ERK1/2 band shift was maximal at 5-10 min and declined thereafter. The electrophoretic mobility shift in ERK1/2 was prevented by pretreatment with the tyrosine kinase inhibitor, genistein. DMSO, the diluent for genistein, had no effect on ERK phosphorylation (Fig. 1B). Thus these results are consistent with BK-induced tyrosine phosphorylation of ERK in mesangial cells.

BK-induced tyrosine phosphorylation of ERK1/2 was further confirmed using a phospho-specific ERK antibody that detects p42 and p44 MAPK (ERK1/2) only when catalytically activated by tyrosine phosphorylation. As shown in Fig. 1C, unstimulated mesangial cells expressed little or no phosphorylated ERK1/2. BK (10⁷ M) stimulated a significant increase (6.2 ± 1.2-fold vs. baseline, P < 0.01) in tyrosine phosphorylation of ERK2 at 5 min. ERK1 phosphorylation was weaker. In agreement with the results obtained using the ERK antibody, BK-stimulated tyrosine phosphorylation of ERK2 was largely blocked by the tyrosine kinase inhibitor, genistein (15 µM) (Fig. 1C). Genistein alone caused a small but inconsistent change in tyrosine- phosphorylated p44.

To examine whether BK-induced ERK2 phosphorylation is accompanied by activation of its kinase (phosphotransferase) activity, we performed an "in-gel kinase assay" in SDS gels containing the MAPK substrate, PHAS-I. Purified activated ERK2 was used as a positive control. As shown in Fig. 2, A and B, treatment of mesangial cells with BK (10⁷ M) increased the kinase activity of a band that comigrated with purified ERK2. ERK2 activation was observed at 2 min following BK treatment, reached a peak at 5-10 min (up to 5-fold vs. control, P < 0.05) and decreased thereafter. Hoe-140 (10⁶ M) partially attenuated by 55 ± 7% (P < 0.05) the intensity of BK-induced ERK2 activation. The inability of Hoe-140 to completely inhibit BK-induced ERK activity may due to its partial agonistic activity (38).

View larger version (36K): [in this window] [in a new window]   Fig. 2.   Effect of BK on ERK activity in mesangial cells. A: cell lysates were prepared from BK-stimulated and control cells, and phosphotransferase activity was assayed by in-gel kinase assay using PHAS-I as a mitogen-activated protein kinase (MAPK) substrate. B: densitometric analysis of the autoradiogram shown in A. This is a representative experiment; similar results were obtained in 3 separate experiments.

Role of tyrosine phosphorylation in BK-stimulated Elk-1 and c-fos/AP-1 complex. Elk-1 is a component of the ternary complex that binds the serum response element and mediates c-fos gene transcription in response to serum and growth factors (32). Elk-1 is a nuclear target for ERK2 phosphorylation at a cluster of serine/threonine motifs at its COOH terminus, and phosphorylation at these sites, particularly Ser³⁸³, is critical for transcriptional activation by Elk-1. We therefore investigated whether ERK2 activation by BK is followed by phosphorylation of Elk-1 utilizing a phospho-specific Elk-1 (Ser³⁸³) antibody. Figure 3 demonstrates that BK (10⁷ M) increases the abundance of phosphorylated Elk-1 by almost threefold compared with baseline (n = 4, P < 0.05). A significant increase in phosphorylated Elk-1 is evident at 5 min and is maximal at 10 min after BK stimulation.

View larger version (26K): [in this window] [in a new window]   Fig. 3.   Effect of BK on Elk-1 phosphorylation in mesangial cells. A: cell lysates were prepared from BK-stimulated and control cells, subjected to SDS-PAGE, and immunoprobed with anti-phospho-Elk-1 antibody (Ser383) (1/750 dilution). B: densitometric analysis of phospho-Elk-1 following BK stimulation (n = 4). Fifteen microliters of purified Elk-1 and phospho-Elk-1 were used as negative and positive controls, respectively. * P < 0.05 vs. other time points.

Since phosphorylated Elk-1 participates in the transactivation of the c-fos promoter in response to mitogenic stimuli, we next examined the effect of BK on c-fos gene expression. As shown in Fig. 4A, BK (10⁷ M) stimulates the expression of c-fos mRNA at 30 min. This increase was abrogated by pretreating the cells with genistein (15 µM). GAPDH expression was relatively stable, indicating that effects of BK or genistein were not the result of nonspecific effects on overall gene expression.

View larger version (63K): [in this window] [in a new window]   Fig. 4.   Northern blot analysis (top) of the effects of tyrosine kinase inhibition with genistein (A) or protein kinase C (PKC) downregulation by phorbol 12-myristate 13-acetate (PMA) pretreatment (B) on c-fos gene expression in BK-stimulated cells. Total RNA (15 µg/sample) was prepared 30 min after stimulation of quiescent mesangial cells with BK. Bottom: corresponding densitometric analysis of the autoradiographic signals for c-fos mRNA factored for the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

BK is a strong activator of PKC in rat mesangial cells (3). Since PKC activation is linked to the induction of c-fos/AP-1, we examined the effects of pharmacological inhibition of PKC (H-7, calphostin C, or bisindolylmaleimide I) or PKC depletion [phorbol 12-myristate 13-acetate (PMA), 0.2 and 2 µM for 24 h] on BK-stimulated c-fos gene expression, AP-1-DNA binding activity, and DNA synthesis. Figure 4B demonstrates that, whereas acute stimulation of phorbol ester-sensitive PKC with PMA results in robust c-fos activation, prolonged PMA treatment to downregulate PKC had no effect on BK-induced c-fos mRNA. Similar results were obtained with calphostin C (not shown).

Fos and Jun proteins dimerize to form the activator protein-1 (AP-1) complex, a transcription factor implicated in the activation of growth factor and cell cycle genes (1, 23). Thus we next examined the role of BK-induced tyrosine phosphorylation in AP-1 complex formation (Fig. 5, A and B). Electrophoretic mobility shift assays (EMSA) revealed that quiescent mesangial cells contain a small amount of preformed AP-1. A marked increase in AP-1-DNA binding activity was observed 30 min after BK stimulation of mesangial cells. The formation of AP-1 complexes was completely inhibited by the addition of excess cold AP-1 consensus DNA sequence, indicating that the DNA-protein interactions were sequence specific (Fig. 5A). To evaluate whether enhanced c-fos expression contributed to AP-1 induction in response to BK, EMSA was performed in the presence of c-Fos antibody (Fig. 5B). The "supershift" demonstrates that the AP-1 complexes formed as a result of BK treatment contain the Fos protein in addition to c-jun or a related jun family member. The remaining AP-1 binding activity in the complexes suggests either incomplete binding of the Fos antibody to AP-1 complexes or that the remaining complexes were composed primarily of jun/jun homodimers. This issue could not be resolved completely, because multiple attempts using c-Jun or pan-Jun antibodies failed to produce a "supershift." Genistein (15 µM) attenuated BK-stimulated AP-1-DNA binding activity (Fig. 5B), indicating the importance of tyrosine phosphorylation in BK-induced gene expression. Neither H-7 (25 mM) nor calphostin C (100 nM) had an effect on BK-induced AP-1 expression (Fig. 6A). Likewise, BK-induced DNA synthesis was unaffected by any of the three PKC inhibitors or PMA pretreatment (Fig. 6B).

View larger version (43K): [in this window] [in a new window]   Fig. 5.   A: electrophoretic gel mobility shift assay of AP-1 DNA binding activity in BK-stimulated mesangial cells. Extracts (5 µg/sample) were incubated with a 32P-labeled consensus AP-1 oligonucleotide, and the mixture was run on 6% nondenaturing polyacrylamide gel. A prominent increase in AP-1 DNA binding activity is observed in BK-stimulated cells. Addition of 100-fold excess unlabeled AP-1 consensus oligonucleotide to the reaction mixture abolished the band shift, indicating the specificity of protein binding to the DNA sequence. B: effect of genistein (G) on AP-1 DNA binding activity. Assay was performed as described in A except that c-fos antibody (Fos Ab) was present in the incubation mixture. BK increased AP-1 DNA binding activity at 30 min. In presence of c-fos antibody, a supershift is observed in these samples, indicating the presence of c-fos protein in the AP-1 complexes. Genistein reduced AP-1 DNA binding activity at 15 µM but not at 0.5 µM.

View larger version (44K): [in this window] [in a new window]   Fig. 6.   Effect of PKC inhibitors on AP-1-DNA binding activity (A) and DNA synthesis (B) in BK-stimulated mesangial cells. Dashed line represents BK-stimulated cells. H-7, 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine.

Role of tyrosine phosphorylation and activation of ERK in BK-induced DNA synthesis. We examined the effect of the tyrosine kinase inhibitors, genistein and herbimycin A, on BK-induced DNA synthesis. Herbimycin A is a tyrosine kinase inhibitor that inactivates cellular tyrosine kinases by interacting with essential sulfhydryl groups (39). Quiescent mesangial cells were pretreated with increasing concentrations of genistein or herbimycin A 4 h before stimulation with 10⁷ M BK for 24 h in the continuous presence of the inhibitor. Figure 7 shows that either inhibitor completely blocked the increase in [³H]thymidine incorporation induced by BK in a dose-dependent manner. Genistein and herbimycin A at the doses used did not affect the basal rate of DNA synthesis.

View larger version (27K): [in this window] [in a new window]   Fig. 7.   Dose response of the effects of tyrosine kinase inhibitors, genistein and herbimycin A, on BK-stimulated DNA synthesis. Cells were stimulated with BK (107 M) in presence or absence of tyrosine kinase inhibitors at indicated doses. [3H]thymidine (1 µCi/ml) was added 16 h after addition of BK, and cells were harvested at 24 h for measurement of [3H]thymidine incorporation into DNA. * P < 0.05 vs. BK-stimulated cells. # P < 0.05 vs. other groups. Dashed line represents control cells (63 ± 8 × 103 cpm). BK alone stimulated an increase by 194 ± 16% in thymidine incorporation over control values.

To further delineate the role of ERK activation in BK-induced DNA synthesis, we adapted an antisense ODN transfection protocol previously shown to be highly effective in downregulation ERK1/2 synthesis in fibroblasts and vascular smooth muscle cells (20, 33). Immunoblotting 48 h after cationic liposomal transfection of antisense ERK1/2 ODN targeted to the translation initiation codon of ERK1/2 mRNAs revealed a significant reduction of ERK1/2 protein levels (Fig. 8A). At a concentration of 0.2 µM, antisense ODNs markedly reduced ERK1/2 protein levels to ~25% of controls. Exposure of mesangial cells to lipofectin at a concentration of 10 µg/ml in the absence of ODNs had no effect on ERK1/2 contents (Fig. 8A). The scrambled ODN sequence at a concentration of 0.2 µM had no effect on relative ERK1/2 content, whereas the sense ODN caused a small but statistically significant enhancement of ERK1/2 protein levels (n = 3 independent experiments in duplicates). Antisense ODN treatment did not affect the expression of another member of the MAPK family, the p38 MAP kinase, indicating that the observed depletion of ERK1/2 was a sequence-specific effect (Fig. 8B). Antisense-mediated downregulation of ERK1/2 synthesis cells inhibited BK-induced thymidine incorporation into DNA, whereas sense and scrambled ODNs had no effect (Fig. 9).

View larger version (33K): [in this window] [in a new window]   Fig. 8.   Effect of antisense oligodeoxynucleotide (ODN, 0.2 µM) treatment on expression of ERK1/2 (A) and p38 (B) in mesangial cells. Lysates from control cells or cells treated with lipofectin (final concentration 10 µg/ml), sense, antisense, and scrambled ODN were subjected to Western blot analysis using specific antibodies to ERK1/2 and p38. C: densitometric analysis of the effect of ERK antisense ODN on ERK1/2 protein levels. * P < 0.05 and ** P < 0.001 vs. other groups.

View larger version (20K): [in this window] [in a new window]   Fig. 9.   Effect of ERK1/2 antisense ODN treatment (0.2 µM) on BK-stimulated DNA synthesis. Lipofectin, where indicated, was added at 10 µg/ml. * P < 0.05 vs. other groups.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The present study explored the mitogenic signaling of BK in rat glomerular mesangial cells. The results demonstrate that BK induces stimulation of: 1) tyrosine phosphorylation of p42/ERK2 and activation of ERK2 kinase activity; 2) phosphorylation of Elk-1 on Ser³⁸³; 3) induction of c-fos mRNA and Fos/AP-1 complexes; and 4) DNA synthesis. Furthermore, antisense targeting of ERK1/2 demonstrated the absolute requirement for ERK1/2 in the mitogenic responses to BK. A schematic representation of the signaling pathways leading to AP-1 activation by BK is shown in Fig. 10.

View larger version (12K): [in this window] [in a new window]   Fig. 10.   Schematic representation of activator protein-1 (AP-1) complex formation mediated by ERK in response to BK stimulation. The signal transduction steps linking the B2 receptor (B2R) with ERK in mesangial cells has yet to be fully elucidated. Steps demonstrated in this study are shown in boxes. Activation of the ERK cascade in mesangial cells requires protein tyrosine phosphorylation. Once activated, ERK translocates to the nucleus and phosphorylates the transcription factor Elk-1, which, together with serum response factor (SRF), binds to serum response element (SRE) in the c-fos promoter, leading to c-Fos transcription. c-Fos dimerizes with Jun proteins to form AP-1 complexes, which can transactivate target genes such as cyclin D1, stimulating G1  S phase progression in the cell cycle. PTK, protein tyrosine kinase.

There is evidence that ERK1/2 can be regulated by G protein-coupled receptor agonists through different mechanisms (6, 30). For G_i-linked receptors (e.g., lysophosphatidic acid, ₂-adrenergic receptors), activation of the MAPK pathway appears to result from -mediated Ras activation. The signaling pathways coupling G_q-linked receptors (e.g., BK, angiotensin II) to ERK1/2 activation are less clear. Because a -subunit of heterotrimeric G proteins interacts with Raf-1, it is possible that -subunits derived from G_q proteins can directly recruit Raf-1 to the plasma membrane. Other possibilities include sequential activation of one or more calcium-dependent cellular tyrosine kinases such as Pyk2 and Src (15). The present study was not designed to investigate the specific tyrosine kinase(s) linking the B₂ receptor with the MAPK pathway; rather, we wished to determine the general contribution of tyrosine phosphorylation in BK-induced mitogenesis in mesangial cells. The findings do support a critical role for protein tyrosine phosphorylation in BK mitogenic signaling and provide the basis for future studies aimed at elucidating the specific signaling molecules linking the BK B₂ receptor with the MAPK pathway in mesangial cells.

G_q-coupled receptors could also activate ERK1/2 through PKC, which can directly phosphorylate and activate Raf-1 (25). Although BK stimulates PKC activity in mesangial cells (3), the role of PKC in BK-induced tyrosine phosphorylation and mitogenic signaling remains unclear (Ref. 27 and this study). In addition, it has been shown that other small peptide mitogens acting through G protein-coupled receptors, such as bombesin and neuromedin B, can stimulate the MAPK pathway via a PKC-independent pathway (10). Similar to our findings, depletion of phorbol ester-sensitive PKC isoforms or PKC inhibition did not affect angiotensin II-induced DNA synthesis in neonatal cardiac fibroblasts (7). However, these findings should be interpreted with caution since atypical PKC isoforms (like PKC-, which does not bind Ca²⁺ and cannot be activated by diacylglycerol or phorbol esters, and most PKC inhibitors do not decrease its activity) have been shown to mediate angiotensin II activation of ERK1/2 (28). Thus, although it appears that BK-stimulated mitogenesis in mesangial cells is PKC independent, the contribution of atypical PKC isoforms remains to be determined.

In the present study, we have gathered several independent lines of evidence to implicate ERK in BK-induced DNA replication in mesangial cells. First, BK stimulates the tyrosine phosphorylation of p44/p42 MAPKs. Second, using in-gel kinase assays, we demonstrated activation of ERK2 by BK. And, third, downregulation of cellular ERK1/2 protein levels by cationic liposome-mediated transfection of antisense ODNs abrogated BK-stimulated DNA synthesis. The controls used in the present study (sense and scrambled ODNs) indicate that ERK1/2 depletion was due to a sequence-specific antisense effect, as neither the sense nor the scrambled ODNs caused ERK1/2 depletion. The "sense" enhancement effect on ERK1/2 has been described previously (33) and appears to be specific for sense ODNs targeted to the ATG translation initiation codon of mRNA molecules (14). We also ruled out a possible sequence-independent effect of the ODNs on protein synthesis, because the expression of p44/p42 ERK was selectively downregulated, whereas that of the MAPK homolog p38 was not affected. The precise molecular mechanisms by which the antisense ODNs inhibited cellular ERK protein levels were not investigated in this study. Although inhibition of mRNA translation has been proposed as a major mechanism responsible for the antisense effect of ODNs, numerous studies have demonstrated that phosphorothioate ODNs function as antisense molecules by forming a duplex with targeted mRNA, which subsequently serves as a substrate for degradation by RNase H (13).

The precise nuclear events linking ERK1/2 activation and DNA synthesis in response to BK remain to be identified. We found that BK-stimulated DNA synthesis in mesangial cells is preceded by induction of c-fos and formation of Fos/AP-1 complexes. After mitogenic stimulation, activated ERK1/2 phosphorylate a number of key nuclear and cytoplasmic factors including Elk-1, Myc, ribosomal S6 kinase, and 4E-BP-1 involved in hypertrophic/hyperplastic growth responses. The phosphorylation of Elk-1 in response to BK stimulation, shown in the present study, is particularly relevant here, as it increases the transcriptional activation of the c-fos promoter, thereby enhancing fos/AP-1 complex formation and the activation of AP-1-regulated growth factor and cell cycle genes. The phosphorylation of Elk-1 by BK suggests that BK nuclear mitogenic signals may be similar to those described for tyrosine kinase growth factors in which tyrosine phosphorylation and activation of ERK2 converge on the c-fos promoter through phosphorylation of Elk-1 (30, 32). At present, the contribution of Fos/AP-1 to BK-induced DNA replication remains speculative, and additional studies are clearly needed.

PHAS-I (also known as 4E-BP-1), is a recently identified protein that binds specifically to the translation initiation factor, eIF4E, and inhibits cap-dependent translation (22, 29). PHAS-I/4E-BP-1 is phosphorylated by ERK2 on Ser⁶⁴ in response to growth factors, and this phosphorylation markedly decreases the affinity of the protein for eIF4E, thereby relieving translational repression. It has thus been proposed that PHAS-I/4E-BP-1 links the MAPK pathway to the translational machinery (29). In the present study, BK stimulated the phosphorylation of PHAS-I/4E-BP-1 by a kinase that comigrated with purified p42/ERK2. These findings raise the possibility that BK may stimulate translation initiation and protein synthesis by inhibiting the activity of the translational repressor, 4E-BP-1.

In summary, our data demonstrate that BK stimulates the ERKElk-1AP-1 pathway in mesangial cells and that protein tyrosine phosphorylation and ERK activation are essential events in the mitogenic signaling cascade of BK. Elucidation of the mechanisms involved in the regulation of gene expression and cell growth by kinins should enhance our understanding of their potential role in glomerular growth and the mechanisms of action of ACE inhibitors in glomerular injury.