AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 275: F518-F526, 1998;
0363-6127/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, H.
Right arrow Articles by Bomsztyk, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, H.
Right arrow Articles by Bomsztyk, K.
Vol. 275, Issue 4, F518-F526, October 1998

Inducible transcriptional activity of bcn-1 element from laminin gamma 1-chain gene promoter in renal and nonrenal cells

Hideaki Suzuki, Oleg N. Denisenko, Yu Suzuki, Daniel S. Schullery, and Karol Bomsztyk

Department of Medicine, University of Washington, Seattle, Washington 98195

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Laminin is a major component of the extracellular matrix whose expression is regulated by growth factors. The laminin gamma 1-chain promoter contains a newly identified transcriptional element denoted bcn-1 that is both active and inducible in mesangial cells. In this study, we explored activation of the bcn-1 element in other renal and nonrenal cells. Treatment of rat glomerular epithelial cells (GEC) with phorbol 12-myristate 13-acetate (PMA) increased activity of the bcn-1 transcriptional element, within the context of the native laminin gamma 1-chain promoter or when cloned upstream of a heterologous promoter. Treatment of GEC with PMA induced nuclear DNA-binding activity, BCN-1, which was recognized by the bcn-1 motif in a gel shift assay. These results provide evidence that the bcn-1 motif and its cognate BCN-1 factor(s) may regulate transcription of the laminin gamma 1-chain in GEC. The bcn-1 element and its cognate BCN-1 DNA-binding activity were also inducible in monkey kidney COS-7 and in human T cell Jurkat lines. SDS-PAGE of in situ ultraviolet cross-linked nucleoproteins from GEC, COS, and Jurkat cells revealed one major 110-115 kDa adduct in all three cell lines. These results demonstrate that the bcn-1 element is active in renal and nonrenal cells from different mammalian species where the same protein contributes to the inducible BCN-1 DNA-binding activity.

glomerular epithelial cells; BCN-1

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

LAMININ is a high-molecular-weight multifunctional protein present in extracellular matrix. It is made up of three polypeptide chains held together by disulfide bonds, forming a cruciform structure (8). The list of known laminin isoforms continues to expand, and a new nomenclature has recently been adapted (5). Although the laminin isoforms share similarities, their properties and distribution can differ significantly both in normal and diseased organs (8, 10-13, 19, 28). Basement membranes contain laminin gamma 1 (B2) chain in combination with either laminin alpha 1 (A) or alpha 2 (merosin) chain and either beta 1 (B1) or beta 2 (S) chain. Because laminin gamma 1-chain appears to be an invariant component of glomerular basement membrane (GBM), it may play a particularly important role in defining specific properties of the glomerular filtration barrier (8, 10, 19, 28). The biological importance of the laminin gamma 1-chain is further underscored by an observation that deficiency of this chain results in early lethality of embryos and a double knockout of the laminin gamma 1-chain in embryonic stem cells abrogates laminin production (31).

A number of growth factors increase laminin gamma 1-chain mRNA levels in glomerular cells grown in culture (26, 30), and transcriptional control of this gene is beginning to be deciphered. Cloning of the 5' region of the laminin gamma 1-chain gene revealed that the human and rodent promoters of these genes do not have TATA or CAAT boxes, but contain several GC boxes and a number of potential Sp1-binding sites, an arrangement commonly seen in TATA-less promoters (4, 17, 21, 22). In mesangial cells, induction of the laminin gamma 1-chain promoter depends on the highly conserved bcn-1 transcriptional element, 5' CCCCGCCCACCTCGCGCGC 3'. The bcn-1 motif recognizes, in a highly sequence-specific manner, a DNA-binding activity that appears in the nucleus in response to treatment of rat mesangial cells by a number of inducing agents (30). In this study, we examined activation of the bcn-1 element in other renal, as well as nonrenal, cells from different species. The results suggest that the transcriptional factor(s) that activates the bcn-1 motif may have a widespread tissue distribution.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell lines. Glomerular epithelial cell (GEC) lines were established as previously described (16, 24). They were maintained on a collagen matrix (Vitrogen-100) in K-1-3T3 media through the 8th passage. Thereafter, they were maintained in K-1 media alone. Studies were performed on cultures of GEC after the 8th passage. GEC were previously characterized by light and transmission electron microscopy, sensitivity to aminonucleoside puromycin, positive staining for cytokeratin and podocalyxin, negative staining for factor VIII, and positive staining for Fx1A (16). Cells were maintained at 37°C in 5% CO2 in air and were passaged every 5-7 days by scraping.

The monkey kidney COS-7 cells (15) were grown in DMEM supplemented with 10% fetal calf serum.

The human leukemia T Jurkat cells (14) were grown in suspension in complete RPMI 1640 medium supplemented with 10% fetal calf serum.

Northern blot analyses. Total RNA was extracted essentially as previously described (7) with some modifications. Briefly, after treatment of GEC, COS, and Jurkat cells (~1.0 × 106 cells) with inducing agents, cells were directly lysed and denatured in 2.0 ml of RNAzol B (Cinna Scientific, Friendswood, TX) to isolate RNA. RNA was analyzed as described previously (16). A total of 15 µg of RNA was electrophoresed through a 1.0% agarose gel containing 2.2 M formaldehyde and 0.2 M MOPS, pH 7.0. The gels were run for 2 h at 100 V, and RNA was transferred overnight to a nylon membrane (Hybond-N nylon membrane; Amersham, Arlington Heights, IL) in 10× standard saline citrate (1× SSC is 10 mM NaCl, 15 mM sodium citrate) by a rapid downward transfer system (Turboblotter; Schleicher & Schuell, Keene, NH). RNA was fixed to the membrane by shortwave ultraviolet (UV) cross-linking (120,000 µJ/cm2). The murine (28) and human (17) laminin gamma 1-chain cDNAs were labeled with 50 µCi of [32P]dCTP using the Klenow fragment of Escherichia coli DNA polymerase I. Hybridization was conducted at 68°C for 24 h using 10 ml of Quick Hyb Solution (Stratagene, Menasha, WI) per blot, 100 µg/ml of salmon sperm DNA, and 2.0 × 106 cpm/ml of labeled cDNA probe. After hybridization, the membrane was washed three times for 5 min in 2× standard sodium phosphate-EDTA (1× SSPE is 150 mM NaCl, 10 mM NaHPO4, and 1 mM EDTA, pH 7.4) with 0.1% SDS at room temperature and for at least 30 min until the background disappeared in 0.1× SSPE/0.1% SDS at 60°C. The membrane was autoradiographed for 3-7 days at -70°C with intensifying screens.

Preparation of nuclear protein extracts. Nuclear extracts were prepared essentially as described (9) with some modifications (2). Briefly, after treatment of cells (~2.0 × 106 cells) with inducing agents, cells were washed with 1.0 ml of lysis buffer [10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 10 mg/ml leupeptin, 0.1 mM sodium molybdate, 10 mM beta -glycerol phosphate, 10 mM sodium fluoride, 0.1 mM sodium orthovanadate, and 30 mM p-nitrophenylphosphate]. Cells were lysed in 60 µl of lysis buffer containing 0.1% Nonidet P-40 for 15 min, and nuclei were isolated. Nuclear proteins were extracted with 60 µl of extraction buffer (20 mM HEPES pH 7.9, 420 mM NaCl, 1.5 mM MgCl2, 0.5 mM DTT, 0.2 mM EDTA, 25% glycerol, 0.5 mM PMSF, 10 mg/ml leupeptin, 0.1 mM sodium molybdate, 10 mM beta -glycerol phosphate, 10 mM sodium fluoride, 0.1 mM sodium orthovanadate, and 30 mM p-nitrophenylphosphate) for 15 min. The protein concentration was measured by the Micro BCA Protein Assay (Pierce, Rockford, IL), and samples were stored at -70°C.

Electrophoretic mobility shift assay. Electrophoretic mobility gel shift assay was performed as previously described (2), with some modifications. The double-stranded oligonucleotide probe used in gel shift assay was end-labeled with a total of 1.0 × 106 cpm/sample of [gamma -32P]ATP and 0.2 U/µl T4 polynucleotide kinase (GIBCO-BRL; Life Technologies, Gaithersburg, MD). Binding reactions were carried out in a total volume of 20 µl with 30 µg of nuclear protein extract, 8-16 ng of oligonucleotides, and 4 µg of poly(dI-dC) at room temperature for 30 min. The 4% polyacrylamide gel (19:1, acrylamide:bis-acrylamide) electrophoresis was performed at 180 V for 2 h in 0.5× TBE (45 mM Tris-borate and 1 mM EDTA, pH 8.0).

The double-stranded (ds) synthetic oligonucleotides containing the bcn-1 element used in gel shift assays had the following sequence
ds-bcn-1 <AR><R><C>5′ CCCCGCCCACCTCGCGCGCCCCTCCC 3′(sense)</C></R><R><C>3′ GGGGCGGGTGGAGCGCGCGGGGAGGG 5′(antisense)</C></R></AR>
Plasmid constructs. Synthetic bcn-1 oligonucleotide was used to construct reporter plasmid containing a dimer of wild-type and mutated bcn-1 oligonucleotides. The bcn-1 dimer inserts were subcloned in the Bgl II and Mlu I sites of pGL3 control vector (Promega, Madison, WI), and the nucleotide sequence of the inserts was confirmed by dideoxy sequencing with Sequenase (US Biochemical, Cleveland, OH) (27).

For site-directed mutagenesis of the bcn-1 motif, the rat laminin gamma 1-chain gene promoter (-1107 to -239 relative to the first codon) was subcloned into a luciferase reporter gene, pGL3 enhancer (Promega). Mutagenesis of the five base pairs (see boldface letters below) required for protein binding was performed using QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with oligonucleotides mut-bcn-1-BamH I sense 5' CCACCGCCCCTGGATCCTCGCGCCCTTCCC 3' and antisense 5' GGGAAGGGCGCGAGGATCCAGGGGCGGTGG 3'. The mutation was verified by restriction analysis (a new BamH I site was created by the mutagenesis) and by direct dideoxy nucleotide sequencing with Sequenase (US Biochemical).

pSV-beta -galactosidase control reporter plasmid (Promega) was used to control for transfection efficiency in COS and Jurkat cells.

Transient transfections and luciferase reporter gene assay. GEC were transiently transfected using the DEAE-dextran method (29). GEC were exposed to DEAE-dextran at a final concentration of 200 µg/ml complexed with 7.5 µg DNA per 100-mm-diameter dish for 4 h. The media was then removed, and the cells were shocked with 10% DMSO. The cells were washed three times with PBS, and K-1 medium containing 2% NuSerum was added. After 24-h incubation, the cells were treated with 1 × 10-7 M phorbol 12-myristate 13-acetate (PMA) for 24 h, and cell extracts were prepared for luciferase assays (Promega). After treatment with or without an inducing agent, cells were pelleted and resuspended in 150 µl of reporter lysis buffer (Promega). Luciferase assay was carried out as described (3). Luciferase activity was quantitated for 30 s using a bioluminometer (LB9502; Wallac, Gaithersburg, MD), and light units were adjusted for protein content.

COS cells grown in 35-mm diameter dishes at ~60-70% confluence were cotransfected with pGL3 luciferase and pSV-beta -galactosidase reporter plasmids, using SuperFect transfection reagent (Qiagen, Santa Clarita, CA) according to the manufacturer's protocol. After 24 h, transfected cells were washed once with PBS, scraped, and spun down in a microcentrifuge. Cell lysates were prepared and luciferase activity was determined as described above for GEC. beta -Galactosidase activities in cell lysates were determined by chemiluminescent reporter assay using Galacto-Light Plus kit (TROPIX, Bedford, MA). beta -Galactosidase activity was measured using bioluminometer for 5 s. For each sample, luciferase light units were divided by beta -galactosidase light units to obtain relative luciferase reporter gene activity to account for transfection efficiency.

Jurkat cells grown in 2.5 ml medium at 0.5 × 106 cells/ml were cotransfected with pGL3 luciferase and pSV-beta -galactosidase reporter plasmids using SuperFect transfection reagent as described above for COS cells. Luciferase and beta -galactosidase activities were measured in a bioluminometer, and relative luciferase activity was calculated as described above for COS cells.

UV cross-linking. The UV cross-linking was done as previously described by Molitor et al. (20). Photo-reactive 32P-radiolabeled DNA probe was prepared by annealing a complementary 10-base primer (5' CCCCGCCCAC 3') to the negative strand (noncoding strand) of bcn-1 and by filling in the overhang with the Klenow fragment of DNA polymerase I in the presence of dATP, [gamma -32P]dCTP, dGTP, and equimolar amount of 5-bromo-2'-deoxyuridine 5'-triphosphate (BrdU). DNA binding reaction was performed by mixing 30 µg of nuclear extracts with the [32P]BrdU-substituted probe (1.0 × 106 cpm/lane) as described above for the standard binding reaction. DNA-nucleoprotein protein complexes were first resolved by a gel shift assay, and after UV irradiation in situ, the excised gel slices containing selected complexes were analyzed by 10% SDS-PAGE and autoradiography. UV irradiation was performed at 302 nm for 20 min (4°C) using a UV transilluminator.

Statistical analysis. The means were compared by ANOVA using the Fisher's test (32).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Northern blot analysis of the laminin gamma 1-chain mRNA levels in renal and nonrenal cells treated with PMA. We have previously shown that the laminin gamma 1 promoter contains a transcriptional element denoted bcn-1 that is active and PMA inducible in mesangial cell culture, in cells where PMA activates laminin gamma 1-chain gene expression. This motif is conserved in the human, mouse, and rat promoters and is likely to play a key role in the regulation of laminin gamma 1 gene transcription (22, 30). To explore the role of the bcn-1 element further and correlate it with laminin gamma 1-chain gene expression, we extended these studies into other renal and nonrenal cells.

GEC synthesize laminin and may play a prominent role in forming and maintaining GBM. To test whether laminin gamma 1-chain gene is inducible in GEC, we examined the expression of laminin gamma 1-chain mRNA levels in response to treatment of these cells with PMA. Figure 1A illustrates an autoradiograph of a Northern blot of total RNA isolated from untreated (Control, lane 1) and PMA-treated (lanes 2-4) GEC probed with either 32P-labeled murine laminin gamma 1-chain cDNA (28) (top) or 32P-labeled 28S probe (bottom) as a loading control. PMA (lanes 2-4) induced a transient increase in the level of laminin gamma 1-chain mRNA; the peak laminin gamma 1-chain mRNA response was seen after 4 h of stimulation, and after 6 h of treatment the mRNA levels returned nearly to baseline. As in rat GEC (Fig. 1A), PMA treatment of monkey kidney COS cells also induced a transient increase in laminin gamma 1-chain mRNA levels (Fig. 1B), with a peak level observed at 4 h of treatment (Fig. 1B, top, lane 3). The results obtained in rat GEC (Fig. 1A) and monkey COS (Fig. 1B) cells are analogous to the PMA-induced transient increase in laminin gamma 1-chain levels in mesangial cells (30). These results are also similar to the interleukin-1beta (IL-1beta ) effects seen in GEC where IL-1beta also induced a transient increase in laminin gamma 1-chain mRNA levels, but with IL-1beta , the peak effect was seen after 2 h of treatment (26). Unlike the renal cells, in untreated and PMA-treated Jurkat T cell line, laminin gamma 1-chain message could not be detected (data not shown). These results show that PMA activates laminin gamma 1 gene expression in some but not all cell types. In glomerular and COS cells, the kinetics of PMA-inducible laminin gamma 1-chain message are very similar.


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 1.   Analysis of laminin gamma 1-chain mRNA in glomerular epithelial cells (GEC) and COS cells treated with phorbol 12-myristate 13-acetate (PMA). A: GEC grown on plates were treated with either media alone (lane 1) or 10-7 M PMA (lanes 2-4). At given time points, total RNA was isolated, electrophoresed on a formaldehyde-agarose gel (15 µg total RNA/lane), and blotted to a nitrocellulose membrane. Blot was hybridized with a 32P-labeled murine laminin gamma 1-chain cDNA (28) probe and was autoradiographed (top). The same membrane was then stripped, rehybridized with a 32P-labeled 28S probe as a loading control, and was autoradiographed (bottom). B: COS cells grown on plates were treated with media alone (lane 1) or 10-7 M PMA (lanes 2-4). At given time points, total RNA was isolated, electrophoresed on a formaldehyde-agarose gel (15 µg total RNA/lane), and blotted to a nitrocellulose membrane. Blot was hybridized with a 32P-labeled human laminin gamma 1-chain cDNA (17) probe and was autoradiographed (top). The same membrane was then stained with methylene blue and 28S RNA is shown (bottom).

The bcn-1 motif is transcriptionally active and inducible in renal and nonrenal cells. PMA-induced increase in laminin gamma 1-chain mRNA levels in GEC (Fig. 1A) might reflect enhanced transcription mediated by the bcn-1 element. Thus we compared the transcriptional activity of the wild-type and mutated bcn-1 dimer motif cloned into pGL3-control vector bearing the luciferase reporter gene (Promega). This mutation of the bcn-1 element renders it unresponsive to treatment of mesangial cells with PMA (30). Relative luciferase activity of the pGL3-control vector containing the wild-type bcn-1 dimer transiently expressed in untreated GEC was 106.6 ± 12.7% (Fig. 2A, lane 1) and increased to 193.8 ± 26.5% (Fig. 2A, lane 2) after 24 h of treatment of cells with PMA (n = 6, P < 0.01). In contrast, luciferase activity of the pGL3-control vector containing the mutant-type bcn-1 dimer in untreated GEC was 41.5 ± 11.4% (Fig. 2A, lane 3) and 24.7 ± 3.3% (Fig. 2A, lane 4) after 24 h of PMA stimulation, a 16.8% decrease that was not statistically significant (n = 6, P = 0.54). This result indicates that the enhanced luciferase reporter gene expression, in response to PMA, reflected the activity of the bcn-1 transcriptional element.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 2.   Assessment of bcn-1 transcriptional activity in GEC. After transfection with the DEAE-dextran method (29) and 24-h incubation with media, GEC were treated with or without 10-7 M PMA for 24 h. Following this treatment, the cells were pelleted and lysed in reporter lysis buffer (Promega). Luciferase assay was carried out as described (3) using a bioluminometer. Light units were adjusted for total protein content in the samples, as relative luciferase activity. A: GEC (~5.0 × 105 cells) were transiently transfected with 7.5 µg of pGL3 luciferase control plasmid (Promega) bearing either the wild-type (lanes 1 and 2) or mutated (lanes 3 and 4) bcn-1-dimer insert. Data are shown as means ± SE of relative luciferase activity (n = 6). B: GEC were transiently transfected with 7.5 µg of pGL luciferase plasmid containing a fragment (-1104 to -24 relative to the first codon) of the rat laminin gamma 1-chain promoter bearing either the wild-type (lanes 1 and 2) or a mutated (lanes 3 and 4) bcn-1 motif. Data are shown as means ± SE of relative luciferase activity (n = 6). Mutated nucleotides are shown in bold.

To evaluate the transcriptional activity of the bcn-1 motif within the context of the laminin gamma 1 promoter, a fragment of the rat promoter containing the bcn-1 motif was cloned upstream of a luciferase reporter gene (22). Mutagenesis of the five bcn-1 bases that are required for protein binding (30) was performed using sense and antisense synthetic oligonucleotides that were designed to contain mutated bcn-1 motif and a BamH I site (see MATERIALS AND METHODS). Relative luciferase activity of the pGL3-enhancer vector containing the wild-type laminin gamma 1-chain promoter transiently expressed in GEC was 123.8 ± 6.7% (Fig. 2B, lane 1) and increased to 190 ± 11.4% (Fig. 2B, lane 2) (n = 6, P < 0.05) after 24 h of PMA stimulation. In contrast, luciferase activity of the pGL3-enhancer vector containing the laminin gamma 1-chain promoter with a mutated bcn-1 site was 123.0 ± 16.2% (Fig. 2B, lane 3) in untreated cells and 113.0 ± 13.9% (Fig. 2B, lane 4) after 24 h of treatment of cells with PMA, a decrease that was not statistically significant (n = 6, P = 0.85). These results demonstrate that the bcn-1 motif from the laminin gamma 1-chain gene promoter is transcriptionally active and PMA responsive in GEC. Moreover, in this fragment of the promoter, the induction by PMA was entirely dependent on the intact bcn-1 motif.

The above series of experiments (Fig. 2), along with previously published observations (30), demonstrate that the bcn-1 element is active in rat glomerular cells. To test the activity of the bcn-1 element in renal cells of another species, we next used the monkey kidney COS-7 cells grown in culture (15), where treatment with PMA also induced a transient increase in laminin gamma 1-chain mRNA levels (Fig. 1B). COS cells were transfected with luciferase reporter gene, pGL3-control vector, driven by a heterologous promoter with either wild-type or mutated bcn-1 dimer. The promoter activities were assessed by measuring relative luciferase activity. A beta -galactosidase reporter plasmid was cotransfected as a control for transfection efficiency. The results from these transfection experiments are illustrated in Fig. 3A. In PMA-treated COS cells, the activity of the heterologous promoter containing the wild-type bcn-1 dimer increased to 208.0 ± 40.3% of untreated control cells (Fig. 3A, compare lanes 1 and 2) (n = 4, P < 0.001). In contrast, the relative luciferase activity generated by the pGL3-control vector containing the mutant-type bcn-1 dimer in untreated and PMA-treated COS cells did not differ significantly: 25.2 ± 5.5% (Fig. 3A, lane 3) and 33.3 ± 4.0% (Fig. 3A, lane 4), respectively (n = 6, P = 0.78).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 3.   Assessment of bcn-1 transcriptional activity in COS and Jurkat cells. A: subconfluent COS cells in 35-mm dishes were transiently transfected using SuperFect (Qiagen) transfection reagent. pGL3 luciferase control plasmid (0.5 µg/dish, Promega) bearing either the wild-type (lanes 1 and 2) or mutated (lanes 3 and 4) bcn-1-dimer insert was cotransfected with pSV-beta -galactosidase control reporter plasmid (1.0 µg/dish, Promega). Twelve hours after transfection, cells were treated with (+) or without (-) 10-7 M PMA for another 8 h. Cells were washed with PBS, scraped, pelleted, and lysed. Luciferase and beta -galactosidase activities in cell lysates were measured using a bioluminometer, and luciferase/beta -galactosidase activity ratios were calculated from luciferase activity. Results are expressed as percentage of the specific luciferase activity measured in untreated COS cells transfected with the wild-type promoter (lane 1). Data are shown as means ± SE of relative luciferase activity (n = 4). B: Jurkat cells at 0.5 × 106 cells/ml in 2.5 ml medium were transiently transfected using SuperFect transfection reagent (60 µl). pGL3 luciferase control plasmid (0.25 µg) bearing either wild-type (lanes 1 and 2) or mutated (lanes 3 and 4) bcn-1-dimer insert was cotransfected with pSV-beta -galactosidase control reporter plasmid (0.5 µg). Immediately following transfection, cells were treated with (+) or without (-) 10-7 M PMA, and cell lysates were prepared after 24 h. Relative luciferase activities were determined as in A. Data are shown as means ± SE of the normalized relative luciferase activity (n = 6).

Next we used the T cell Jurkat line to determine whether the bcn-1 element is active and PMA inducible in nonrenal cells, where the laminin gamma 1-chain gene promoter is not expressed. This cell line also provided a way to extend these studies to human cells. As in other cells, in PMA-treated Jurkat cells, the activity of the heterologous promoter harboring the wild-type bcn-1 dimer increased to 308.0 ± 34.8% (n = 4) of control untreated cells (Fig. 3B, lane 2). As before, this increase was critically dependent on the bcn-1 motif because mutation of this motif prevented the PMA responsiveness; relative luciferase activity generated by the plasmid bearing mutated bcn-1 motif averaged 24.8 ± 11.2% (Fig. 3B, lane 3) and 28.2 ± 6.6% (Fig. 3B, lane 4) in untreated and PMA-treated Jurkat cells, respectively (n = 4, P = 0.89). These results demonstrate that as in the other cell lines tested, the bcn-1 element is active and PMA inducible in Jurkat cells. But, unlike in GEC (Fig. 1A), mesangial (30), or COS cells (Fig. 1B), inducibility of the bcn-1 element by PMA is not sufficient for this agent to activate laminin gamma 1 gene expression in Jurkat cells. This suggests that, in Jurkat cells, the laminin gamma 1-chain gene is silenced.

Treatment of rat GEC, COS, and Jurkat cells with PMA enhances nuclear DNA-binding activity recognized by the bcn-1 motif. To test whether PMA activates BCN-1 DNA-binding activity in the nucleus of GEC, nuclear extracts prepared from PMA-treated GEC were analyzed by a gel shift assay using a 32P-labeled double-stranded synthetic oligonucleotide containing the bcn-1 motif. As illustrated in Fig. 4A, treatment of GEC with 10-7 M PMA induced a transient increase in one major DNA-binding activity recognized by the bcn-1 oligonucleotide. The pattern of the shifted bands is identical to the one seen in rat mesangial cells (30). Based on previous studies in mesangial cells, the PMA-responsive band is likely to be specific for the bcn-1 motif and was previously denoted as BCN-1 (30). The BCN-1 DNA-binding activity peaked after 1 h of treatment with PMA (compare lane 1 to lane 2 in Fig. 4), decreased after 2 h (compare lane 3 to lane 2), and returned to baseline after 4 h (compare lanes 4 and 5 to lane 1). There were also other shifted bands (BCN-1a, b, and c), but their intensity in nuclear extracts from untreated and PMA-treated cells was similar.


View larger version (59K):
[in this window]
[in a new window]
  		Fig. 4.   Time course of nuclear BCN-1 DNA-binding activity in GEC (A), COS (B), and Jurkat (C) cells treated with PMA. A-C: cells were treated with 10-7 M PMA. At given time points, nuclear protein was extracted as described in the text. Binding to the 32P-labeled oligonucleotide containing the bcn-1 motif was analyzed by electrophoretic gel shift assay and autoradiographed. DNA-binding reaction was carried out in 20 µl containing 30 µg of nuclear protein extracts. D: nuclear extracts from PMA-treated COS cells were incubated with 32P-labeled oligonucleotide containing the wild-type bcn-1 motif in the absence (control) or presence of 500-fold molar excess of unlabeled competitor containing either wild-type or mutated bcn-1 motif. Free probe (Free bcn-1) and different complexes of bcn-1 with its cognate proteins (BCN-1) are indicated by arrows. The sequence of the sense strand of the synthetic oligonucleotide containing the wild-type and mutated bcn-1 motif are at bottom.

An autoradiograph from an electrophoretic gel shift assay of DNA-binding activities recognized by the bcn-1 motif in nuclear extracts from untreated and PMA-treated COS cells is shown in Fig. 4B. There was one distinct PMA-inducible band that resembled the electrophoretic mobility of BCN-1 seen in GEC (Fig. 4A) and mesangial cells (30). As in GEC, there were other shifted bands including one prominent PMA-inducible DNA-binding activity (BCN-1a) that was faster than BCN-1 and two distinct PMA-unresponsive DNA-binding activities (BCN-1b and c). Figure 4C illustrates an autoradiograph of an electrophoretic mobility shifts of the 32P-labeled bcn-1 probe by proteins extracted from nuclei of untreated and PMA-treated Jurkat cells. Overall, the bcn-1-binding proteins identified in human Jurkat cells resemble the pattern seen in the monkey COS cells (Fig. 4B). There were two PMA-responsive bands. The slower migrating PMA-responsive band has an electrophoretic mobility identical to the DNA-sequence-specific bcn-1-binding activity observed in the renal cells, denoted BCN-1.

To confirm that the slow PMA-inducible band is the DNA-sequence-specific BCN-1 activity, we carried out binding reactions of nuclear extracts from PMA-treated COS cells to the 32P-labeled bcn-1 probe in the presence of 500-fold molar excess of double-stranded synthetic nucleotide containing either the wild-type or mutated bcn-1 motif and tested DNA-protein complexes in a gel shift assay as before. The results showed (Fig. 4D) that the faster migrating PMA-responsive band, BCN-1a, was abrogated by either the wild-type (lane 2) or mutated competitor (lane 3), whereas the slower PMA-responsive band, BCN-1, was competed away by an excess of the wild-type (lane 2) but not by an excess of the mutated bcn-1 (lane 3) competitor. Therefore, the slower PMA-responsive band (BCN-1) is likely the same bcn-1-specific DNA-binding protein or protein complex activity seen previously in mesangial cells (30) and might be responsible for the PMA-inducible transcriptional activity of the bcn-1 element (Figs. 2-3).

The induction of nuclear BCN-1 DNA-binding activity by PMA in GEC, COS, and Jurkat cells is similar to the induction reported for PMA in mesangial cells (30). The relatively slow induction in all the cell lines tested may be accounted for by the finding that activation of BCN-1 DNA-binding activity depends on new protein synthesis (30).

UV cross-linking analysis of GEC, COS, and Jurkat cell nuclear protein(s) recognized by the bcn-1 motif. The above results show that treatment of GEC, COS, and Jurkat cells with PMA induces similar BCN-1 DNA-binding activity (Fig. 4), suggesting that in all of the three cell lines tested the same protein or protein complex is recognized by the bcn-1 motif. To test that further, nuclear extracts from untreated or from PMA-treated (1 h) GEC, COS, or Jurkat cells were incubated with [32P]BrdU-substituted bcn-1 probe, and DNA-nucleoprotein complexes were resolved by electrophoretic gel shift assay as before. An autoradiograph of this gel shown in Fig. 5A confirms the nearly identical PMA-inducible pattern of DNA-binding activities in nuclear extracts derived from these cells. The gel strips containing the uninduced and PMA-induced BCN-1 DNA-binding activity (BCN-1) were cut out, and after UV cross-linking, the DNA-nucleoprotein complexes were analyzed by SDS-PAGE and autoradiography (Fig. 5B). In all of the three cell lines, there was one major [32P]DNA-nucleoprotein adduct ("A" in Fig. 5B), of ~110-115 kDa size in nuclear extracts from PMA-treated (lanes 2, 4, and 6) but not in extracts from untreated cells (lanes 1, 3, and 5). This 32P-labeled complex was not detected if the gel strip was not exposed to UV light (lanes 7-8), indicating that the 32P-labeled band is a DNA-protein complex. There was also a weaker intensity 32P-labeled PMA-inducible adduct ("B" in Fig. 5B) that was the strongest in COS cells, and although weak, it could also be detected in GEC and Jurkat cells. This UV cross-linking analysis demonstrates that in rat GEC, monkey COS, and human Jurkat cells, the same protein or a protein complex is responsible for the PMA-inducible BCN-1 DNA-binding activity. These results show that the BCN-1 transcription factor is not restricted to renal cells and is expressed in rodents as well as in primates.


View larger version (46K):
[in this window]
[in a new window]
  		Fig. 5.   UV cross-linking analysis of DNA-protein complexes formed with the bcn-1 element. A: COS, Jurkat, and GEC cells grown in serum-free media overnight were treated without (-) or with (+) 10-7 M PMA for 60 min. Cells were harvested, and nuclear extracts (30 µg) were incubated with 32P-labeled 5-bromo-2'-deoxyuridine-substituted bcn-1 probe. DNA-protein complexes were resolved as before (see Fig. 4) by native gel electrophoresis (4% PAGE), and BCN-1-bcn-1 complexes (BCN-1, BCN-1a-c) were visualized by autoradiography. B: after native gel electrophoresis, the gel strips containing the BCN-1-bcn-1 complex (BCN-1), were either UV cross-linked in situ ("YES," lanes 1-6) or not ("NO," lanes 7 and 8). DNA-protein complexes from the cutout gel strips were then analyzed by SDS-PAGE (10%) and autoradiography. Molecular mass markers are shown in kDa on right.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The bcn-1 motif was recently identified in the laminin gamma 1-chain gene promoter and has been shown to recognize an inducible DNA-binding activity in rat mesangial cells. The nucleic acid sequence of the bcn-1 motif does not resemble any of the previously identified known transcriptional elements, and antibodies to such PMA-inducible transcriptional factors as NF-kappa B, Sp1, AP-1, and AP-2 do not recognize BCN-1. These results suggest that BCN-1 may be a novel transcriptional factor. In this study we extended the observations on the bcn-1 element and its cognate BCN-1 protein into other cell types.

Like in the mesangial cell (30), in rat GEC the bcn-1 dimer was PMA responsive and had a baseline activity that was higher than that observed with the mutated bcn-1 dimer, which, in addition, was not responsive to PMA at all. In GEC in the setting of the native rat laminin gamma 1 promoter fragment, the bcn-1 motif was not constitutively active but was critical for the PMA response of this promoter. In these cells, the bcn-1 motif recognized a PMA-inducible nuclear BCN-1 DNA-binding activity (Fig. 4A). Although overall the rodent and human laminin gamma 1-chain promoters have only low sequence similarity, the bcn-1 motif is identical in these species (22). Taken together, these observations and considerations suggest that, at least in part, the PMA-inducible increase in laminin gamma 1-chain mRNA levels seen in GEC is mediated by the bcn-1 element (Fig. 1A).

In the monkey COS cells, the bcn-1 motif was also transcriptionally active (Fig. 3A) and recognized the BCN-1 DNA-binding activity (Fig. 4B). Since evolutionarily the monkey species are much closer to human than are rodents, and since the rodent and human laminin gamma 1-chain promoters contain identical bcn-1 motifs (22), it is conceivable that the monkey laminin gamma 1-chain promoter also contains a bcn-1 or bcn-1-like sequence. If so, the bcn-1 element may likewise play a role in the regulation of laminin gamma 1-chain gene expression in COS cells where PMA induces a transient increase in the levels of laminin gamma 1-chain mRNA (Fig. 1B).

Although in Jurkat cells PMA was a potent activator of BCN-1 DNA-binding activity (Figs. 4-5) and it activated the bcn-1 element (Fig. 3), laminin gamma 1-chain mRNA could not be detected in these cells with or without PMA stimulation. This suggests that in Jurkat cells, laminin gamma 1-chain gene is silenced. What is, therefore, the biological significance of BCN-1 activation in Jurkat and other cells where laminin gamma 1 gene is not expressed? Data base searches revealed that the bcn-1 motif (5' CCCCGCCACCTCGCGCGC 3') contains a transcriptionally active element from the ApoE B1 gene promoter, 5' (G/C)CCCCACCT 3' (23). Moreover, motifs similar to bcn-1 were also found in the human complement receptor 2 (CD21) (5' CCCCGCCCACCTCG<UNL>t</UNL>GC 3') (25), rat insulin-like growth factor I receptor (5' CCCCGCCCACC<UNL>g</UNL>CGC<UNL>c</UNL>C 3') (33), and human L-plastin (5' CCGCCACCTCGCGtGC 3') (18) gene promoters. Considering the high degree of sequence similarity to the bcn-1 sequence, one can see that these related motifs may well be targets for BCN-1. If so, BCN-1 would regulate transcription of different genes in a diversity of cell types.

The electrophoretic mobility shift of nuclear extracts from GEC, COS, and Jurkat cells revealed indistinguishable PMA-inducible BCN-1 DNA-binding activity (BCN-1, Figs. 4 and 5A), suggesting that in these cell lines this binding activity corresponds to the same protein(s). This was confirmed by UV cross-linking analysis, which identified a major PMA-inducible 110- to 115-kDa adduct (Fig. 5B, DNA-nucleoprotein A). Taking into account the molecular mass of a single-stranded bromoreactive bcn-1 (9.1 kDa), the size of the protein or protein complex is in the range 100-110 kDa. There was also another adduct of 140-150 kDa (Fig. 5, DNA-nucleoprotein B) that was PMA inducible and found in all three cell lines, but interestingly, relative to the complex A, it had the highest level in COS cells. As in the case of UV cross-linking analysis of kappa B-binding nucleoproteins that identified several members of the NF-kappa B family of factors (20), the A and B adducts may correspond to inducible bcn-1-binding proteins that are encoded by the same or related genes. Regardless of whether the two adducts are related, each may consist of a protein monomer, dimer, or less likely, a higher order structure. The observation that the same mutations that abrogate transcriptional activity of the bcn-1 motif also block the PMA-inducible DNA-binding activity of BCN-1 suggests that the BCN-1 protein or protein complex that is detected in gel shift assays (Figs. 4-5) is the transcriptional factor responsible for the PMA-inducible bcn-1 transcriptional activity.

Although it is 1 of more than 10 known laminin chains, the laminin gamma 1-chain is emerging as one of the most important components of the laminin heterotrimeric assembly (5, 31). Therefore, great interest has been generated in studying transcriptional regulation of this laminin chain. The laminin gamma 1-chain gene promoter activity is regulated by a number of sequence-specific transcriptional factors, but among them BCN-1 appears to play a particularly critical role in the PMA-induced response. In addition to transcriptional elements contained in the laminin gamma 1 promoter (17, 21), it has recently been shown that the first intron also contains key elements that regulate laminin gamma 1 gene expression (6). Therefore, the bcn-1 element may potentially cooperate with the intron enhancer elements to yield the high PMA-induced laminin gamma 1-chain mRNA levels seen in glomerular cells (Fig. 1). In fact, it is conceivable that there is another bcn-1 or bcn-1-like element in the laminin gamma 1-chain gene that may allow BCN-1 to contribute to the synergistic promoter-intronic enhancer action. For example, such a role has previously been described for the TFE3 transcription in the activation of the IgH gene transcription (1).

We have previously shown that IL-1beta also increases laminin gamma 1-chain mRNA levels in GEC (26), but we have not seen consistent induction of the BCN-1 DNA-binding activity in GEC by IL-1beta . Because the laminin gamma 1-chain promoter is IL-1beta inducible (22) in GEC, the induction of laminin gamma 1 mRNA by IL-1beta in these cells must be mediated primarily by an element(s) other than bcn-1. These observations provide evidence that although the laminin gamma 1-chain gene expression can be activated by a number of different inducing agents, including PMA, IL-1beta , transforming growth factor-beta , and retinoic acid (6, 21, 26, 30), the transcriptional elements and factors mediating the induction by these agents may be different.

In summary, the bcn-1 element newly identified in the laminin gamma 1 promoter is active and recognizes a specific DNA-binding BCN-1 activity in a variety of renal and nonrenal cells from rodent, monkey, and human species. These results indicate that the BCN-1 transcriptional factor is expressed and activates the bcn-1 element in different tissues. Thus BCN-1 may not only control transcription of laminin gamma 1-chain gene in glomerular cells, but it may also regulate the expression of other genes that contain bcn-1 or bcn-1-like motifs.

    ACKNOWLEDGEMENTS

We thank Dr. William Couser and Prof. Seibu Mochizuki for encouragement.

    FOOTNOTES

This work was supported by National Institutes of Health Grants DK-45978 and GM-45134 and by the Northwest Kidney Foundation. H. Suzuki was supported by a postdoctoral fellowship from the American Heart Association, Washington Affiliate.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: K. Bomsztyk, Dept. of Medicine, Box 356521, Univ. of Washington, Seattle, WA 98195.

Received 14 January 1998; accepted in final form 22 July 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Artandi, S. E., C. Cooper, A. Shrivastava, and K. Calame. The basic helix-loop-helix-zipper domain of TFE3 mediates enhancer-promoter interaction. Mol. Cell. Biol. 14: 7704-7716, 1994[Abstract/Free Full Text].

2.   Bomsztyk, K., B. Toivola, D. W. Emery, J. W. Rooney, S. K. Dower, N. A. Rachie, and C. H. Sibley. Role of cAMP in interleukin-1-induced kappa light chain gene expression in murine B cell line. J. Biol. Chem. 265: 9413-9417, 1990[Abstract/Free Full Text].

3.   Brasier, A. R., J. E. Tate, and J. F. Habener. Optimized use of the firefly luciferase assay as a reporter gene in mamamalian cell lines. Biotechniques 7: 1116-1122, 1989[Medline].

4.   Briggs, M. R., J. T. Kadonaga, S. P. Bell, and R. Tjian. Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234: 47-52, 1986[Abstract/Free Full Text].

5.   Burgeson, R. E., M. Chiquet, R. Deutzmann, P. Ekblom, J. Engel, H. Kleinman, G. R. Martin, G. Meneguzzi, M. Paulsson, J. Sanes, R. Timpl, K. Tryggvason, Y. Yamada, and P. D. Yuechenco. A new nomenclature for the laminins. Matrix Biol. 14: 209-211, 1994[Medline].

6.   Chang, H. S., N. B. Kim, and S. L. Philips. Positive elements in the laminin gamma 1 gene synergize to activate high level transcription during cellular differentiation. Nucleic Acids Res. 24: 1360-1368, 1996[Abstract/Free Full Text].

7.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

8.   Deutzmann, R. Laminin. In: Molecular Nephrology: Kidney Function in Health and Disease, edited by D. Schlondorff, and J. V. Bonventre. New York: Dekker, 1995, p. 41-59.

9.   Dignam, J. D., R. M. Lebovitz, and R. Roeder. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11: 1475-1489, 1983[Abstract/Free Full Text].

10.   Ehrig, K., I. Leivo, W. S. Argraves, E. Ruoslahti, and E. Engvall. Merosin, a tissue-specific basement membrane protein, is a laminin-like protein. Proc. Natl. Acad. Sci. USA 87: 3264-3268, 1990[Abstract/Free Full Text].

11.   Ekblom, P., G. Klein, M. Ekblom, and L. Sorokin. Laminin isoforms and their receptors in the developing kidney. Am. J. Kidney Dis. 17: 603-605, 1991[Medline].

12.   Floege, J., C. E. Alpers, M. W. Burns, P. Pritzl, K. Gordon, W. G. Couser, and R. J. Johnson. Glomerular cells extra-cellular matrix accumulation and the development of glomerular sclerosis in the remnant kidney model. Lab. Invest. 66: 485-497, 1992[Medline].

13.   Floege, J., R. J. Johnson, K. Gordon, P. Pritzl, A. Yoshimura, C. Campbell, C. E. Alpers, and W. G. Couser. Increased synthesis of extracellular matrix in mesangial proliferative nephritis. Kidney Int. 40: 477-488, 1991[Medline].

14.   Gillis, S., and J. Watson. Biochemical and biological characterization of lymphocyte regulatory molecules. V. Identification of an interleukin 2-producing human leukemia T cell line. J. Exp. Med. 152: 1709-1719, 1980[Abstract/Free Full Text].

15.   Gluzman, Y. SV-40-transformed simian cells support the replication of early SV40 mutants. Cell 23: 175-182, 1981[Medline].

16.   Johnson, R. J., H. Yamabe, Y. P. Chen, C. Campbell, K. Gordon, P. Baker, D. Lovett, and W. G. Couser. Glomerular epithelial cells secrete a glomerular basement membrane-degrading metalloproteinase. J. Am. Soc. Nephrol. 2: 1388-1397, 1992[Abstract].

17.   Kallunki, T., J. Ikonen, L. T. Chow, P. Kallunki, and K. Tryggvanson. Structure of the human laminin B2 chain gene reveals extensive divergence from the laminin B1 chain gene. J. Biol. Chem. 266: 221-228, 1991[Abstract/Free Full Text].

18.   Lin, C. S., Z. P. Chen, T. Park, K. Ghosh, and J. Leavitt. Characterization of the human L-plastin gene promoter in normal and neoplastic cells. J. Biol. Chem. 268: 2793-2801, 1993[Abstract/Free Full Text].

19.   Martin, G. R., and R. Timpl. Laminin and other basement membrane components. Annu. Rev. Cell Biol. 3: 57-85, 1987.

20.   Molitor, J. A., W. H. Walker, S. Doerre, D. W. Ballard, and W. C. Greene. NF-kappa B: a family of inducible and differentially expressed enhancer-binding proteins in human T cells. Proc. Natl. Acad. Sci. USA 87: 10028-10032, 1990[Abstract/Free Full Text].

21.   Ogawa, K., P. D. Burbelo, M. Sasaki, and Y. Yamada. The laminin B2 chain promoter contains unique repeat sequences and is active in transient transfection. J. Biol. Chem. 263: 8384-8389, 1988[Abstract/Free Full Text].

22.   O'Neill, B. O., H. Suzuki, W. P. Loomis, O. Denisenko, and K. Bomsztyk. Cloning of the rat laminin gamma 1-chain gene promoter reveals motifs for recognition of multiple transcription factors. Am. J. Physiol. 273 (Renal Physiol. 42): F411-F420, 1997[Abstract/Free Full Text].

23.   Paik, Y. K., D. J. Chang, C. A. Reardon, M. D. Walker, E. Taxman, and J. M. Taylor. Identification and characterization of transcriptional regulatory regions associated with expression of the human apolipoprotein E gene. J. Biol. Chem. 263: 13340-13349, 1988[Abstract/Free Full Text].

24.   Quigg, R. J., A. V. Cybulsky, J. B. Jacobs, and D. J. Salant. Anti-Fx1A produces complement dependent cytotoxicity of glomerular epithelial cells. Kidney Int. 34: 43-52, 1988[Medline].

25.   Rayhel, E. J., M. H. Dehoff, and V. M. Holers. Characterization of the human complement receptor 2 (CR2, CD21) promoter reveals sequences shared with regulatory regions of other developmentally restricted B cell proteins. J. Immunol. 146: 2021-2026, 1991[Abstract].

26.   Richardson, C. A., K. L. Gordon, W. G. Couser, and K. Bomsztyk. IL-1 increases laminin B2 chain mRNA levels and activates NF-kappa B in rat glomerular epithelial cells. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F273-F278, 1995[Abstract/Free Full Text].

27.   Sanger, F., S. Nicken, and A. R. Coulson. DAN-sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467, 1977[Abstract/Free Full Text].

28.   Sasaki, M., and Y. Yamada. The laminin B2 chain has a multidomain structure homologous to the B1 chain. J. Biol. Chem. 262: 17111-17117, 1987[Abstract/Free Full Text].

29.   Sompayrac, L. M., and K. J. Danna. Efficient infection of monkey cells with DNA of simian virus 40. Proc. Natl. Acad. Sci. USA 78: 7575-7578, 1981[Abstract/Free Full Text].

30.   Suzuki, H., B. C. O'Neill, Y. Suzuki, O. N. Denisenko, and K. Bomsztyk. Activation of a nuclear DNA-binding protein recognized by a transcriptional element, bcn-1, from the laminin B2 chain gene promoter. J. Biol. Chem. 271: 18981-18988, 1996[Abstract/Free Full Text].

31.   Timpl, R. Macromolecular organization of basement membranes. Curr. Opin. Cell Biol. 8: 618-624, 1996[Medline].

32.   Wallenstein, S., C. L. Zucker, and J. L. Fleiss. Some statistical methods useful in circulation research. Circ. Res. 47: 1-9, 1980[Abstract/Free Full Text].

33.   Werner, H., B. Stannard, M. Bach, A. D. LeRoith, and C. T. Roberts. Cloning and characterization of the proximal promoter region of the rat insulin-like growth factor I (IGF-I) receptor gene. Biochem. Biophys. Res. Commun. 169: 1021-1027, 1990[Medline].

Am J Physiol Renal Physiol 275(4):F518-F526
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
Y. Higaki, D. Schullery, Y. Kawata, M. Shnyreva, C. Abrass, and K. Bomsztyk
Synergistic activation of the rat laminin {gamma}1 chain promoter by the gut-enriched Kruppel-like factor (GKLF/KLF4) and Sp1
Nucleic Acids Res., June 1, 2002; 30(11): 2270 - 2279.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, H.
Right arrow Articles by Bomsztyk, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, H.
Right arrow Articles by Bomsztyk, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online