|
|
||||||||
Departments of Pediatrics, and Physiology and Biophysics, Case Western Reserve University, Cleveland, Ohio 44106-4948
| |
ABSTRACT |
|---|
|
|
|---|
A conditionally immortalized collecting tubule cell line, mCT1,
was derived from the H-2Kb-ts A58
transgenic mouse (ImmortoMouse), which harbors a temperature-sensitive mutant of the SV40 large T antigen oncogene. Cells maintained under
permissive conditions [33°C with interferon-
(IFN-
)] form epithelial monolayers, express large T antigen,
and proliferate (>50 passages). The cells retain properties
characteristic of the renal collecting tubule (CT) including:
vasopressin (VP)-stimulated cAMP accumulation, aquaporin-2 expression,
high transepithelial electrical resistance, VP-stimulated ion
transport, and amiloride-sensitive sodium absorption. When the cells
are transferred to nonpermissive conditions (39°C without IFN-
),
the steady-state level of large T antigen protein declines (>95%
decrease) and cell proliferation is arrested. This conditionally
immortalized, murine renal cell line should prove useful for studies of
CT physiology and large T antigen biology.
SV40 large T antigen; temperature sensitivity; chloride secretion; sodium absorption; amiloride; vasopressin; aquaporin-2
| |
INTRODUCTION |
|---|
|
|
|---|
THE MAMMALIAN RENAL TUBULE is a highly differentiated epithelium that plays a critical role in body fluid homeostasis (2, 16, 38). In vivo micropuncture and in vitro tubule perfusion experiments helped define segment-specific expression and regulation of ion transport functions in the renal nephron (8, 13, 20). Nonrenal epithelia (e.g., frog skin, urinary bladder, gallbladder) have been exploited as simple model systems that exhibit specific features of the renal epithelium (36). Recently, primary cell culture (5, 14, 21, 31) and immortalized renal cell lines (1, 7, 24, 25, 27, 28, 37, 39, 43) have provided additional insight into renal epithelial function. The renal collecting tubule (CT) is composed of at least two cell types (principal and intercalated) and is characterized by an amiloride-sensitive, aldosterone-regulated electrogenic Na+ absorption, K+ secretion, cAMP-regulated water permeability, and the capacity for either acid or base secretion. Several approaches have been used to generate CT cell lines that retain some of these properties.
Early attempts to generate immortalized renal epithelial cell lines included conferring constitutive expression of large T antigen by in vitro transfection of isolated cells. Two cell lines, RCCT-28A (1) and RC.SV (42), derived from primary cultures of rabbit CT cells transfected with the early region of SV40 were shown to be responsive to receptor agonists [vasopressin (VP), isoproterenol, PGE2] known to mediate CT function. However, in RC.SV cells, these markers were found to be reduced following long-term culture. Furthermore, the cell lines expressed features of both proximal and distal tubule cells. Since neither cell line formed electrically resistive barriers, transepithelial transport function was not evaluated. Recently, a VP-sensitive cortical collecting duct cell line, RCCD, was developed by in vitro transfection of rat CT cells with wild-type SV40 large T antigen (7). The cells formed monolayers and developed a high transepithelial resistance (RT) and exhibited VP-activated short-circuit current (Isc). In an effort to develop a more differentiated renal cell line, Prie et al. (35) transfected rabbit CT cells with a temperature-sensitive mutant of the SV40 large T immortalizing oncogene. The cell line was grown at the permissive temperature and induced to differentiate by a switch to the nonpermissive temperature. Differences in growth, effector-stimulated cAMP production and VP binding consistent with differentiated CT cell function were observed in cultures maintained under nonpermissive conditions; however, no ion transport data were reported (34, 35, 37).
Another approach to generate immortalized epithelial cell lines is the
use of in vivo systems as a source for cells with stable, endogenous
levels of immortalizing oncogenes to avoid the unpredictable characteristics of in vitro transfection. Two renal epithelial cell
model systems have been developed from the CT of mice transgenic for
the early region of wild-type SV40 [Tg(SV40E)Bri/7]. A
cortical CT cell line (M-1) that exhibits amiloride-sensitive
Na+ absorption and is responsive
to arginine vasopressin (AVP) was developed by Stoos et al. (39).
Stanton and coworkers (24) used a similar approach to isolate an inner
medullary collecting duct cell line (mIMCDK-2). Electrophysiological
measurements revealed amiloride-sensitive
Na+ absorption and cAMP-dependent
Cl
conductance in both cell
lines (24, 27).
The advantages of endogenous (transgene) and controlled (temperature
sensitive) expression of large T antigen were recently combined in
studies of Cluzeaud et al. (11). They developed several renal cell
lines from a transgenic mouse (pHu-Vim-878-Tst t) that carries the
temperature-sensitive mutant of SV40 large T antigen controlled by the
mesenchymal tissue-specific vimentin promoter. Temperature-induced
differentiation of cytoskeletal element expression, segment-specific
hormone responsiveness, and enhanced
Na+-K+-ATPase
transport activity were observed in renal cells grown at the
nonpermissive temperature. However, the effect of nonpermissive conditions on transepithelial ion transport was not evaluated in these
cell lines. Jat et al. (22) produced a transgenic mouse line
(H2Kb-tsA58; ImmortoMouse) that
carries the thermolabile mutant of SV40 large T antigen under the
control of a ubiquitous interferon-
(IFN-
)-inducible promoter,
H2Kb. Several
conditionally immortalized cell lines that show tissue-specific differentiation induced by nonpermissive growth conditions were subsequently developed from this mouse line (10, 30, 41).
The goal of this work was to develop (from the ImmortoMouse) a conditionally immortalized CT cell line suitable for studies of transepithelial ion transport. The resulting cell line, mCT1, has properties of native CT cells and, when exposed to nonpermissive conditions, exhibits changes in large T antigen levels and cell proliferation.
| |
METHODS |
|---|
|
|
|---|
Animals. A homozygous male ImmortoMouse (Charles River Laboratories) was bred with a wild-type female mouse, and the offspring were genotyped by PCR analysis of DNA extracts from tail sections. Sections of ~1 cm in length were digested overnight at 55°C with 700 µl proteinase K (Fisher) (10 mg/ml NTES buffer: 100 mM NaCl, 50 mM Tris, pH 8.0, 50 mM EDTA, and 1% SDS). DNA was extracted from the digests by the phenol method, and spooled DNA was rinsed with 70% EtOH and dried. DNA was resuspended in 0.5 ml sterile water. The 5'-3' oligomer sequences used for PCR were as follows: primer 1, AGCGCTTGTGTCGCCATTGTATTA; primer 2, GTCACACCACAGAAGTAAGGTTCC. The PCR reaction parameters were as follows: 30 cycles, 95°C for 1 min, 58°C for 2 min, and 70°C for 3 min yielding a product size of 1 kb.
CT cell isolation and culture. Ten
mice (3-4 wk old) carrying a single copy of the
H-2Kb-tsA58
transgene were killed, and the kidneys were removed, sliced and
digested with collagenase type IV (0.5% wt/vol) in Hanks' balanced
salt solution for 30 min at 37°C. The digest was centrifuged (800 g, 5 min), and the cell pellet was
resuspended in cold culture medium with 10% FBS, centrifuged again,
and resuspended in 5 mM glucose in PBS. The cell suspension was plated
onto tissue culture dishes (Falcon 1058; Falcon-Becton Dickinson,
Lincoln Park, NJ) coated with Dolichos
biflorus agglutinin (DBA; 4°C, 10 µg/ml in 0.1 M
NaHCO3). DBA has been shown to
specifically label the collecting duct (principal and intercalated
cells) of the mouse kidney (26). Cells were allowed to adhere for 45 min at 4°C. Unbound cells were removed by washing three times with
PBS-glucose at 4°C. Lectin-adhered cells were eluted by incubating
in 10 ml of 150 mM galactose in PBS for 5 min. Cells were washed in
glucose-PBS, centrifuged (800 g for 5 min), washed in culture medium, centrifuged (800 g, 5 min), and resuspended and plated
in culture media at a density of 2 × 105 cells/ml. Cells were
maintained as primary cultures at 37°C for 7 days in defined basal
CT media for CT epithelial cells that contained the following: 1:1 mix
of DMEM and Ham's F-12 medium supplemented with 1.3 µg/l sodium
selenite, 1.3 µg/l
3,3',5-triiodo-L-thyronine, 5 mg/l insulin, 5 mg/l transferrin, 25 µg/l
PGE1, 2.5 mM glutamine, and 5 µM
dexamethasone (4, 40). Once colonies were established, recombinant
mouse IFN-
(10 U/ml) was added to the basal CT media, and cultures
were expanded at the 33°C permissive temperature. mCT1 cells were
maintained on plastic tissue culture dishes in CT media in a humidified
33°C incubator with 5% CO2.
Media was changed every other day, and cells were passaged weekly.
Cells used for experiments reported here were between passages 10 and 25.
Morphology. Monolayers of mCT1 cells
were seeded on collagen-coated Millicell-CM filters (12 mm; Millipore,
Bedford, MA) and cultured in CT medium with IFN-
at 33°C. Cell
monolayers were fixed and embedded, and thin sections (80 nm) were cut
normal to the filter. Sections were stained with uranyl acetate and
lead citrate and examined with a JEOL 100 CX transmission electron microscope.
Conditional cell growth experiments.
Cells were seeded at 5 × 104 cells per well in 12-well
plates and maintained at 33°C with IFN-
(permissive conditions).
Once cell number doubled, some plates were moved to 39°C without
IFN-
(nonpermissive conditions). At 24-h intervals thereafter, cells
from triplicate wells were detached and cells were counted using a hemocytometer.
Immunofluorescent imaging microscopy.
Subconfluent mCT1 cultures were grown on chamber slides in basal media
with IFN-
at 33°C or without IFN-
at 39°C. Cells were
fixed in an acidified ethanol solution (95% ethanol, 5% glacial
acetic acid) for 1-2 min, rinsed three times with PBS, and blocked
with 1% BSA for 1 h at room temperature. The cells were rinsed three
times with PBS and incubated with a monoclonal mouse antibody to SV40
large T-antigen (0.2 µg/ml Ab-1; Oncogene Science, Uniondale, NY) in PBS containing 1% BSA for 2 h at room temperature. The PBS rinse was
repeated prior to incubation with the fluorescent secondary antibody
(Cy3-labeled goat anti-mouse IgG, 10 µg/ml; Jackson Laboratories, West Grove, PA) in PBS containing 1% BSA. After repeated rinsing in
PBS, slides were coated with antifade solution (90% glycerol and 0.4%
propyl gallate in H2O). The mCT1
cells were examined using a Zeiss Axiovert model 35 inverted microscope
equipped for epifluorescence, and digital images were acquired by a
cooled charge-coupled device camera (model CH250; Photometrics, Tucson, AZ). Images were processed with Oncor Imaging image analysis program (Oncor Imaging, Rockville, MD) and recorded on an optical disc storage system.
mCT1 cells were seeded onto glass chamber slides (Nunc no. 177399) to
identify DBA- (26), F13- (14, 32,
39), and aquaporin-2-positive (33) cells. The cells were
maintained under permissive conditions for 7 days, washed with PBS, and
fixed for 10 min in methanol (
20°C), then air dried and
fixed for 10 min with paraformaldehyde (4%). The slides
were washed and incubated overnight at 4°C with the appropriate
primary antibody (F13 or
aquaporin-2) or DBA lectin. The slides were brought to
room temperature, washed, and incubated for 90 min with the appropriate
FITC- or Cy3-labeled secondary antibody. Samples examined
for expression of aquaporin-2 were processed without the methanol
permeabilization step. Samples were examined by epifluorescence
microscopy, and representative fields were photographed.
Western blot analysis. Cell lysates
were prepared from confluent culture dishes (60 mm) in lysis buffer
containing 50 mM Tris · HCl (pH 7.5) and 1% SDS.
Protein concentrations were measured by Pierce bicinchoninic acid
protein assay (BCA; Pierce, Rockford, IL). Whole cell protein samples
(25 µg) were denatured in SDS-PAGE sample buffer containing 50 mM
Tris · HCl (pH, 6.8), 2% SDS, 5%
-mercaptoethanol, 10% glycerol, and 0.1% bromphenol blue. Proteins were separated on a 7.5% SDS-PAGE gel and electrophoretically blotted
onto a Immobilon-P polyvinylidene difluoride transfer membrane (PVDF,
Millipore). Membranes were blocked overnight at 4°C in PBS that
contained 5% dried milk (wt/vol) and 0.1% polyoxyethylenesorbitan monolaurate (Tween 20). The membranes were incubated at room
temperature for 1 h with mouse monoclonal antibody, SV40 T Ag
(Ab-1,1:500 dilution; Calbiochem, Cambridge, MA), in PBS/Tween. The
membranes were then incubated with secondary antibody (horseradish
peroxidase-conjugated sheep anti-mouse IgG, 1:2,000 dilution; Jackson
Laboratories). Membranes were rinsed using three changes of washing
buffer (PBS/Tween), once for 15 min and twice for 5 min after blocking
and after each antibody incubation. Peroxidase-labeled membranes were
developed by enhanced chemiluminescence (Amersham, Arlington Heights,
IL). Protein bands were visualized on X-ray film (X-O-Mat; Kodak,
Rochester, NY). Molecular mass estimation of detected bands was
determined using prestained high-molecular mass protein standards
(GIBCO, Life Technologies). Quantitation of the intensity
of the bands on the luminograms was done using a Sci Scan 5000 densitometer. The OS-Scan Image Analyses System density scan program
(Oberlin Scientific) was used to integrate the relevant peak areas in
the protein bands.
Transepithelial electrical
measurements. mCT1 cells were seeded (~200,000
cells/filter) on collagen-coated, permeable supports (Millicell-CM 12 filters, Millipore) cut to a height of 4 mm, with the feet removed
(12). The filter surface was coated with 125 µl/cm2 calf skin collagen
(Sigma) dissolved in acetic acid (7.5 mg/ml of 0.2% glacial acetic
acid) and allowed to dry. The collagen coating was cross-linked to the
filter surface by exposure to ammonium hydroxide vapors (3.5%
solution) for 10 min followed by immersion in glutaraldehyde (2.5%)
for 10 min. This procedure was followed by a thorough rinsing in
distilled water, 70% ethanol, distilled water, and finally, culture
media. Filter-grown cells were cultured in basal CT medium with IFN-
at 33°C. Media was changed every 48 h. Confluent filters were
switched to nonpermissive conditions for some experiments. In all
experiments, mCT1 monolayers were fed fresh media 18-24 h prior to
analysis. Cell monolayers grown on modified supports were clamped
between Lucite flux chambers and bathed on both sides by equal volumes
(usually 6-10 ml) of Krebs-Ringer-bicarbonate solution
(containing, in mM, 115 NaCl, 25 NaHCO3, 5 KCl, 2.5 Na2HPO4,
1.8 CaCl2, 1 MgSO4, and 10 glucose). The
solutions were circulated through the water-jacketed glass reservoir by
gas lifts (95% O2-5%
CO2), to maintain solution
temperature at 37°C and pH. Transepithelial voltage difference
(VT) was
measured between two Ringer-agar bridges, each positioned within 3 mm
of the monolayer surface. Calomel half-cells connected the bridges to a
high-impedance voltmeter. Current from an external direct current
source was passed by silver-silver chloride electrodes and Ringer agar
bridges to clamp the spontaneous
VT to zero. The current required (short-circuit current,
Isc) was
corrected for solution and filter series resistance. Monolayers were
maintained under short-circuit conditions except for brief 3- to 5-s
intervals when the current necessary to clamp the voltage to a nonzero
value (usually +2 mV) was measured to calculate
RT.
Transepithelial electrical measurements were generally made on
monolayers that had been in culture for between 7-21 days.
cAMP analysis. Cells were seeded at a
density of 100,000 cells per filter and maintained under permissive
conditions. On day 6, the cultures
were washed and preincubated in HEPES-buffered Ringer solution at
37°C for 30 min. Epithelial monolayers were exposed on the luminal
and basolateral sides to either IBMX (100 µM), IBMX plus AVP
(10
12-10
8
M), or IBMX plus forskolin (FSK, 10 µM) for 10 min. Incubations were terminated by removal of bathing solution and addition of HCl to
the luminal compartment (0.5 ml, 0.1 N) for 30 min to extract cAMP. The HCl was removed, neutralized, and stored at
70°C
until analyzed for cAMP content. Cellular protein was solubilized by overnight incubation in NaOH (0.5 ml, 0.1 N). Protein content was
measured by Pierce BCA protein assay. Free cAMP levels were assayed by
competitive enzyme immunoassay (EIA; Cayman Chemical, Ann Arbor, MI) of
acetylated samples.
| |
RESULTS |
|---|
|
|
|---|
Cell morphology and
immunocharacterization. CT cells displaced from the
DBA-coated plates formed small islands of epithelial cells within 1 wk
of growth in defined medium without IFN-
at 37°C. The cultures
were switched to permissive conditions (10 U IFN-
/ml at 33°C),
and the cells became confluent within 1 mo. Cultures were passaged
several times and frozen in liquid nitrogen for future studies. The
cells have now been maintained in culture for >50 passages. mCT1
cultures grown on permeable supports at the permissive temperature
(Fig. 1) form a monolayer of cuboidal epithelial cells with junctional complexes, lateral-interdigitation, desmosomes, and microvilli on the apical membrane surface. DBA is known
to bind exclusively to CT cells in the mouse kidney (26) and was used
to isolate the mCT1 cell line. As expected, >95% of the mCT1 cells
are positive for DBA lectin binding, suggesting that nearly all of the
cells are derived from the CT (Fig.
2A). A
monoclonal antibody (F13/0121)
that is specific for the principal cell of the mouse CT (14, 32,
39) labeled ~50% of the mCT1 cells (Fig.
2B). The remaining cells that are
positive for DBA binding but negative for
F13 antibody binding may be
dedifferentiated principal cells that have lost
F13 antigen expression;
alternatively, they may be derived from the intercalated cells of the
CT. The mCT1 cells were also evaluated for expression of aquaporin-2, the cAMP-regulated water channel present in the principal cells of the
CT (33). Approximately one-half of the cells are positive for
aquaporin-2 (Fig. 3). As mentioned above,
the DBA-positive, aquaporin-2-negative cells may be dedifferentiated
principal cells or may represent another CT epithelial cell type. As
illustrated in Fig. 4, the presence of
aquaporin-2 was confirmed by Western blot analysis of cells maintained
under permissive conditions.
|
|
|
|
Immunolocalization of large T antigen protein demonstrated nuclear expression in essentially all cells. Figure 5 illustrates the expression of the large T antigen (monoclonal antibody PAb419) in mCT1 cells maintained under permissive (Fig. 5C) and nonpermissive conditions (Fig. 5D). In all fields observed, nearly 100% of the cells grown in permissive conditions express SV40 large T antigen in their nuclei. After 4 days under nonpermissive conditions, a dramatic decrease in the intensity of the nuclear label is clearly evident, illustrating the instability of the thermolabile large T antigen protein.
|
Bioelectric properties of monolayers maintained under
permissive conditions. mCT1 cells (300,000 cells/cm2) were seeded onto
collagen-coated permeable supports and maintained under permissive
conditions. The cells attached and formed monolayers that were
confluent 2 days later. When the epithelial monolayers were placed in
an Ussing chamber, they generated a lumen-negative VT and exhibited
an Isc value
indicative of net ion transport (anion secretion, cation absorption, or
both). The Isc
and RT values for
a series of monolayers (passages 13-23) maintained under
permissive conditions for 3-12 days were measured. As illustrated in Fig. 6,
Isc increased
between days 3 and
5 and remained steady thereafter,
whereas RT
continued to increase between days 3 and 12. The mean values for
Isc and
RT measured on
day 6 were 13.5 ± 2.0 µA/cm2 and 836 ± 240
· cm2
(n = 12), respectively. All subsequent
bioelectric measurements were made on monolayers maintained in culture
for 5-12 days.
|
Since the renal CT is known to express amiloride-sensitive, electrogenic Na+ absorption, we determined whether mCT1 monolayers grown under permissive conditions retain this property. An example of an Isc trace recorded from a mCT1 monolayer is illustrated in Fig. 7. Addition of amiloride (epithelial sodium channel blocker) to the luminal bathing solution caused a rapid inhibition of Isc. As summarized in Table 1, ~75-85% of the basal Isc was inhibited and RT was increased significantly by addition of amiloride (10 µM) to the luminal bathing solution. Subsequent exposure to FSK (10 µM, to increase intracellular cAMP) elicited a sustained increase in Isc with no significant change in RT (Fig. 7; Table 1).
|
|
Effects of VP on mCT1 cells. Expression of tissue-specific receptors is often used as a measure of cellular differentiation in primary and immortalized cells. VP receptors located on the basolateral plasma membrane of CT cells are coupled to adenylate cyclase (2). Activation of the receptor leads to accumulation of intracellular cAMP and increases ion and water transport across the CT. Since VP-induced cAMP accumulation is a characteristic of CT cells, we sought to determine whether the mCT1 cells express functional receptors. We investigated the effects of AVP on cAMP accumulation and electrogenic ion transport by mCT1 cells maintained under permissive conditions. The dose-response relationships for VP-induced accumulation of cAMP and VP-mediated activation of Isc of mCT1 cells grown on permeable supports are illustrated in Fig. 8. Significant increases in cAMP accumulation and Isc were observed with as little as 10 pM VP.
|
The effect of VP on
Isc was
determined in monolayers pretreated with amiloride to inhibit sodium
absorption; thus the electrogenic response to VP likely represents
cAMP-mediated activation of
Cl
secretion. To test this,
the effects of a
Cl
channel blocker
[N-phenylanthranilic acid
(DPC)] and bilateral Cl
removal were examined.
As illustrated in Fig. 9 and summarized in
Table 2, replacement of bathing solution
Cl
with cyclamate prevented
the VP-stimulated increase in
Isc. Furthermore, DPC (1 mM) added to the luminal bathing solution, inhibited
the VP-stimulated
Isc in
Cl
-replete bathing
solution, but did not affect
Isc of cultures bathed in Cl
-free solution.
These results, in conjunction with the activation of an
amiloride-insensitive
Isc by FSK,
suggest that elevation of cAMP in mCT1 cells activates electrogenic
Cl
secretion.
|
|
Effects of nonpermissive growth conditions on mCT1 cells. The transgenic ImmortoMouse does not develop tumors and exhibits only modest thymic hyperplasia, suggesting that the steady-state levels of the thermolabile large T antigen are sufficiently low in vivo to prevent excessive cellular proliferation. Because the mCT1 cell line that we generated appears to be immortal (>50 passages) when maintained under permissive conditions, we examined the effect of nonpermissive growth conditions on cell proliferation and steady-state large T antigen levels. The effects of either permissive or nonpermissive culture conditions on cell proliferation are illustrated by the growth curves shown in Fig. 10. Cells maintained under permissive conditions enter the log-phase of growth, whereas cells switched to nonpermissive conditions continue to proliferate slowly. After ~4 days in nonpermissive conditions, cell number remains constant. Cell proliferation resumes when mCT1 cultures are returned from nonpermissive conditions (2 days) to permissive conditions (data not shown). The amount of cell-associated large T antigen was assessed by Western blot analysis to determine the time course for the decline in large T antigen following a shift to nonpermissive conditions. A representative Western blot is shown in the top of Fig. 11. The results obtained from three separate experiments are summarized in the bottom of Fig. 11. The data are normalized to the amount of large T antigen present under permissive conditions (day 0). Large T antigen levels progressively decrease during the 4 days after cultures are switched to nonpermissive conditions. A significant decrease in band intensity is observed at each time point. Values for cells grown in nonpermissive conditions are 23 ± 4%, 15 ± 5.0%, 11 ± 2.0%, and 4 ± 2%, for days 1, 2, 3, and 4, respectively.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The purpose of this work was to generate a conditionally immortalized CT cell line in which the influence of the immortalizing factor, large T antigen, can be modulated by culture conditions. We established a renal epithelial cell line from the ImmortoMouse (22), and the results of morphological and functional studies support the conclusion that mCT1 cells are conditionally immortalized and express CT characteristics.
A direct correlation exists between the level of large T antigen
protein and the conditional growth that we observe in culture. mCT1
cells express a high level of immunoreactive nuclear large T antigen at
the 33°C permissive temperature with IFN-
, which is dramatically
decreased after 4 days at the nonpermissive 39°C temperature
without IFN-
. Quantitative evaluation of large T antigen level
demonstrated that after 4 days in nonpermissive conditions, the
steady-state amount of large T antigen fell by more than 95%. We
conclude that the high level of expression of large T antigen in mCT1
cells is consistent with the rapid proliferation observed in permissive
conditions. Uncontrolled cell proliferation is a characteristic of
poorly differentiated cells and is a feature of many SV40 large T
antigen immortalized cell lines (18, 23, 29) and of mCT1 cultures grown
under permissive conditions. The regulation of large T antigen
expression is conditional in mCT1 cells and can be controlled by a
switch to nonpermissive growth conditions. Concurrent with the fall in
steady-state large T antigen level is a slowing of cell proliferation.
Microscopic investigation of the cell morphology of the mCT1 cell line
shows clear evidence of cells with epithelial junctional complexes,
lateral interdigitation, and apical microvilli, which are all hallmarks
of a polarized epithelium. The cobblestone appearance and well-defined
boundaries between adjacent cells of confluent monolayers also confirm
an epithelial morphology. In addition, mCT1 cells stain positive for
epithelial cytokeratins (data not shown). The mCT1 cell line retains
electrophysiological properties typical of epithelium, in particular,
CT epithelium (2, 5, 8, 16, 20, 24, 38, 39). Polarization and
tight junction formation result in a high
RT and asymmetric
electrogenic ion transport. In this regard, mCT1 cells have an
advantage compared with several rabbit renal cell lines generated by in
vitro transfection with either wild-type or temperature-sensitive SV40
large T antigen (1, 35, 42). Those cells do not form tight junctions,
thus precluding the evaluation of transepithelial ion transport
properties. mCT1 cells bind a CT-specific lectin (DBA), and a subset of
the cell line expresses the F13
antigen and aquaporin-2 water channel protein, suggesting that they are
principal cells. The monolayers also express ion transport properties
characteristic of principal cells of the CT. Specifically, the presence
of electrogenic, amiloride-sensitive Na+ absorption and functional AVP
receptors (AVP-induced cAMP production and stimulation of ion
transport) suggest a well-differentiated CT epithelium. Since the
AVP-stimulated increase in
Isc was
Cl
dependent and fully
inhibited by DPC, it likely represents cAMP-activated Cl
secretion. Several
recent studies have provided compelling evidence for expression and
cAMP-mediated activation of cystic fibrosis transmembrane conductance
regulator (CFTR) in CT cells and cell lines (19, 21, 25, 27, 31, 40,
43). Thus our findings obtained from mCT1 cells maintained under
permissive conditions are in accord with similar results from studies
of primary cell cultures (19, 40) and unconditionally immortalized CT
cell lines (25, 27, 39, 40) derived from wild-type SV40 transgenic mice.
Segment-specific hormone stimulation of adenylyl cyclase
is frequently used as a marker to define the origin of
primary cultures of renal epithelial cells and is generally associated
with cellular differentiation (2, 9). AVP-stimulated cAMP accumulation and activation of electrogenic
Cl
secretion by mCT1 cells
further supports a CT origin and suggests that the cells are at least
moderately differentiated even under permissive growth conditions.
The mammalian renal tubule is predominantly an absorptive epithelium;
however, in some species of fish, net fluid secretion driven by
cAMP-stimulated NaCl secretion has been reported (6). Thus the
secretory response observed in immortalized CT cells may represent the
unmasking of a primitive transport pathway. Alternatively, as Kizer et
al. (24) have suggested, Cl
secretion by inner medullary collecting duct cells is physiologically relevant. Polycystic kidney diseases compose a group of renal disorders characterized by fluid-filled cysts lined by
epithelial cells (3, 15). Cyst formation and enlargement are thought to
require increased cellular proliferation and net secretion of salt and
water. Accelerated proliferation results in a dedifferentiated cellular
phenotype of the cells that line renal cysts. Grantham and coworkers
(17, 28) demonstrated ion and fluid secretion in several in vitro
models and suggested that enhanced cAMP-dependent Cl
secretion may be
responsible fluid accumulation by renal cysts. A subsequent study (19)
which reported that CFTR channels are present in cells isolated from
human renal cysts further supports a role for
Cl
secretion in cyst
enlargement. Thus mCT1 cells maintained under permissive and
nonpermissive conditions may serve as a useful model system for studies
of the relationship between differentiation and ion transport by the
renal epithelium.
In conclusion, we developed a conditionally immortalized cell line that forms epithelial monolayers and expresses properties of the CT and in which large T antigen levels and cell proliferation can be modulated by culture conditions.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Mike Haley for expert technical assistance. Antibodies for F13 and for aquaporin-2 were generously provided by Dr. G Fejes-Toth and Dr. W. Harris, respectively.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant R29-DK-43000 (to C. U. Cotton), the Cystic Fibrosis Foundation (C. U. Cotton), and the PKR Foundation (W. E. Sweeney).
Address for reprint requests: C. U. Cotton, Pediatric Pulmonary Division, CWRU, 2109 Adelbert Road, Biomedical Research Bldg., Cleveland, OH 44106-4948.
Received 27 August 1997; accepted in final form 5 August 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arend, L.,
J. Handler,
J. Rhim,
F. Gusovsky,
and
W. Spielman.
Adenosine-sensitive phosphoinositide turnover in a newly established renal cell line.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F1067-F1074,
1989
2.
Ausiello, D. A.,
and
J. Orloff.
Regulation by vasopressin and cyclic nucleotides of water and electrolyte movement in the kidney.
In: Handbook of Experimental Pharmacology, edited by J. W. Kebibian,
and J. A. Nathanson. Berlin: Springer-Verlag, 1982, p. 271-303.
3.
Avner, E. D.
Renal cystic disease.
Nephron
48:
89-93,
1988[Medline].
4.
Avner, E. D.,
and
W. E. Sweeney.
Epidermal growth factor (EGF) receptors expressed on apical cell surfaces in polycystic kidney disease (PKD) exhibit high-affinity ligand binding and intrinsic tyrosine kinase activity (Abstract).
J. Am. Soc. Nephrol.
5:
617,
1994.
5.
Bello-Reuss, E.,
and
M. R. Weber.
Electrophysiological studies of primary cultures of rabbit distal tubule cells.
Am. J. Physiol.
252 (Renal Fluid Electrolyte Physiol. 21):
F899-F909,
1987
6.
Beyenbach, K. W.,
and
W. H. Dantzler.
Comparative kidney tubule sources, isolation, perfusion, and function.
Methods Enzymol.
191:
167-226,
1990[Medline].
7.
Blot-Chabaud, M.,
M. Laplace,
F. Cluzeaud,
C. Capurro,
R. Cassingena,
A. Vandewalle,
N. Farman,
and
J. Bonvalet.
Characteristics of a rat cortical collecting duct cell line that maintains high transepithelial resistance.
Kidney Int.
50:
367-376,
1996[Medline].
8.
Burg, M.,
L. Isaacson,
J. Grantham,
and
J. Orloff.
Electrical properties of isolated perfused rabbit renal tubules.
Am. J. Physiol.
215:
788-794,
1968.
9.
Chabardes, D.,
M. Imbert,
A. Clique,
M. Montegut,
and
F. Morel.
PTH sensitive adenyl cyclase activity in different segments of the rabbit nephron.
Pflügers Arch.
361:
9-15,
1975[Medline].
10.
Chambers, T.,
J. Owens,
G. Hattersley,
P. Jat,
and
M. Noble.
Generation of osteoclast-inductive and osteoclastogenic cell lines from the H-2KbtsA58 transgenic mouse.
Proc. Natl. Acad. Sci. USA
90:
5578-5582,
1993
11.
Cluzeaud, F.,
M. Bens,
M. S. Wu,
Z. Li,
P. Vicart,
D. Paulin,
and
A. Vandewalle.
Relationships between intermediate filaments and cell-specific functions in renal cell lines derived from transgenic mice harboring the temperature-sensitive T antigen.
J. Cell. Physiol.
167:
22-35,
1996[Medline].
12.
Cotton, C. U.,
and
L. Al-Nakkash.
Isolation and culture of bovine pancreatic duct epithelial cells.
Am. J. Physiol.
272 (Gastrointest. Liver Physiol. 35):
G1328-G1337,
1997
13.
Diezi, J.,
P. Michoud,
J. Aceves,
and
G. Giebisch.
Micropuncture study of electrolyte transport across papillary collecting duct of the rat.
Am. J. Physiol.
224:
623-634,
1973.
14.
Fejes-Toth, G.,
and
A. Naray-Fejes-Toth.
Differentiated transport functions in primary cultures of rabbit collecting ducts.
Am. J. Physiol.
253 (Renal Fluid Electrolyte Physiol. 22):
F1302-F1307,
1987
15.
Grantham, J. J.
Polycystic kidney disease: a predominance of giant nephrons.
Am. J. Physiol.
244 (Renal Fluid Electrolyte Physiol. 13):
F3-F10,
1983
16.
Grantham, J. J.,
M. B. Burg,
and
J. Orloff.
The nature of transtubular Na and K transport in the isolated rabbit renal collecting tubule.
J. Clin. Invest.
49:
1815-1826,
1970.
17.
Grantham, J. J.,
M. Ye,
V. H. Gattone,
and
L. P. Sullivan.
In vitro fluid secretion by epithelium from polycystic kidneys.
J. Clin. Invest.
95:
195-202,
1994.
18.
Gruenert, D. C.,
C. B. Basbaum,
M. J. Welsh,
M. Li,
W. E. Finkbeiner,
and
J. A. Nadel.
Characterization of human tracheal epithelial cells transformed by an origin-defective simian virus 40.
Proc. Natl. Acad. Sci. USA
85:
5951-5955,
1988
19.
Hanaoka, K.,
O. Devuyst,
E. M. Schweibert,
P. D. Wilson,
and
W. B. Guggino.
A role for CFTR in human autosomal dominant polycystic kidney disease.
Am. J. Physiol.
270 (Cell Physiol. 39):
C389-C399,
1996
20.
Hanley, M. J.,
J. P. Kokko,
J. B. Gross,
and
H. R. Jacobson.
Electrophysiologic study of the cortical collecting tubule of the rabbit.
Kidney Int.
17:
74-81,
1980[Medline].
21.
Husted, R. F.,
K. A. Volk,
R. D. Sigmund,
and
J. B. Stokes.
Anion secretion by the inner medullary collecting duct. Evidence for involvement of the cystic fibrosis transmembrane conductance regulator.
J. Clin. Invest.
95:
644-650,
1995.
22.
Jat, P. S.,
M. D. Noble,
P. Ataliotis,
Y. Tanaka,
N. Yannoutsos,
L. Larsen,
and
D. Kioussis.
Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse.
Proc. Natl. Acad. Sci. USA
88:
5096-5100,
1991
23.
Jetten, A. M.,
J. R. Yankaskas,
M. J. Stutts,
N. J. Willamsen,
and
R. C. Boucher.
Persistence of abnormal chloride conductance regulation in transformed cystic fibrosis epithelium.
Science
244:
1472-1475,
1989
24.
Kizer, N. L.,
B. Lewis,
and
B. A. Stanton.
Electrogenic sodium absorption and chloride secretion by an inner medullary collecting duct cell line (mIMCD-K2).
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F347-F355,
1995
25.
Kizer, N. L.,
D. Vandorpe,
B. Lewis,
B. Bunting,
J. Russell,
and
B. A. Stanton.
Vasopressin and cAMP stimulate electrogenic chloride secretion in an IMCD cell line.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F854-F861,
1995
26.
Laitinen, L.,
I. Virtanen,
and
L. Saxen.
Changes in the glycosylation pattern during embryonic development of mouse kidney as revealed with lectin conjugates.
J. Histochem. Cytochem.
35:
55-65,
1987[Abstract].
27.
Letz, B.,
and
C. Korbmacher.
cAMP stimulates CFTR-like Cl
channels and inhibits amiloride-sensitive Na+ channels in mouse CCD cells.
Am. J. Physiol.
272 (Cell Physiol. 41):
C657-C666,
1997
28.
Mangoo-Karim, R.,
M. Uchic,
C. Lechene,
and
J. J. Grantham.
Renal epithelial cyst formation and enlargement in vitro: dependence on cAMP.
Proc. Natl. Acad. Sci. USA
86:
6007-6011,
1989
29.
Marino, L. R.,
and
C. U. Cotton.
Immortalization of bovine pancreatic duct epithelial cells.
Am. J. Physiol.
270 (Gastrointest. Liver Physiol. 33):
G676-G683,
1996
30.
Morgan, J. E.,
J. R. Beauchamp,
C. N. Pagel,
M. Peckham,
P. Ataliotis,
P. S. Jat,
M. D. Noble,
K. Farmer,
and
T. A. Partridge.
Myogenic cell lines derived from transgenic mice carrying a thermolabile T antigen: a model system for the derivation of tissue-specific and mutation-specific cell lines.
Dev. Biol.
162:
486-498,
1994[Medline].
31.
Nagy, E.,
A. Naray-Fejes-Toth,
and
G. Fejes-Toth.
Vasopressin activates a chloride conductance in cultures cortical collecting duct cells.
Am. J. Physiol.
267 (Renal Fluid Electrolyte Physiol. 36):
F831-F838,
1994
32.
Naray-Fejes-Toth, A.,
and
G. Fejes-Toth.
Immunoselection and culture of cortical collecting duct cells.
J. Tiss. Cult. Meth.
13:
179-184,
1991.
33.
Nielsen, S.,
S. R. DiGiovanni,
E. I. Christensen,
M. A. Knepper,
and
H. W. Harris.
Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney.
Proc. Natl. Acad. Sci. USA
90:
11663-11667,
1993
34.
Prie, D.,
J. C. Dussaule,
B. Lelongt,
M. Geniteau-Legendre,
F. Chatelet,
R. Cassingena,
A. Vandewalle,
and
P. Ronco.
Principal cell-specific antigen and hormonal regulatory network in the rabbit renal cortical cell line RC.SVtsA58.
Am. J. Physiol.
266 (Cell Physiol. 35):
C1628-C1638,
1994
35.
Prie, D.,
P. M. Ronco,
B. Baudouin,
M. Geniteau-Legendre,
M. Antoine,
R. Piedagnel,
S. Estrade,
B. Lelongt,
P. J. Verroust,
R. Cassingena,
and
A. Vandewalle.
Activation of the simian virus 40 (SV40) genome abrogates sensitivity to AVP in a rabbit collecting tubule cell line by repressing membrane expression of AVP receptors.
J. Cell Biol.
113:
951-962,
1991
36.
Reuss, L.
Ion transport across gallbladder epithelium.
Physiol. Rev.
69:
503-545,
1989
37.
Ronco, P. M.,
D. Prie,
R. Piedagnel,
and
B. Lelong.
Oncogene-transformed renal cell lines: physiological and oncogenetic studies.
News Phyisol. Sci.
9:
208-214,
1994.
38.
Stein, J. H.,
and
H. J. Reineck.
The role of the collecting duct in the regulation of sodium and other electrolytes.
Kidney Int.
6:
1-9,
1974[Medline].
39.
Stoos, B. A.,
A. Naray-Fejes-Toth,
O. A. Carretero,
S. Ito,
and
G. Fejes-Toth.
Characterization of a mouse cortical collecting duct cell line.
Kidney Int.
39:
1168-1175,
1991[Medline].
40.
Todd-Turla, K. M.,
E. Rusvai,
A. Naray-Fejes-Toth,
and
G. Fejes-Toth.
CFTR expression in cortical collecting duct cells.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F237-F244,
1996
41.
Whitehead, R. H.,
P. E. VanEeden,
M. D. Noble,
P. Ataliotis,
and
P. S. Jat.
Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2Kb-tsA58 transgenic mice.
Proc. Natl. Acad. Sci. USA
90:
587-591,
1993
42.
Vandewalle, A.,
B. Lelongt,
M. Geniteau-Legendre,
B. Baudouin,
M. Antoine,
S. Estrade,
F. Chatelet,
P. Verroust,
R. Cassingena,
and
P. Ronco.
Maintenance of proximal and distal cell functions in SV40-transformed tubular cell lines derived from rabbit kidney cortex.
J. Cell. Physiol.
141:
203-221,
1989[Medline].
43.
Vandorpe, D.,
N. Kizer,
F. Ciampollilo,
B. Moyer,
K. Karlson,
W. B. Guggino,
and
B. A. Stanton.
CFTR mediates electrogenic chloride secretion in mouse inner medullary collecting duct (mIMCD-K2) cells.
Am. J. Physiol.
269 (Cell Physiol. 38):
C683-C689,
1995
This article has been cited by other articles:
![]() |
R. Falin, I. E. Veizis, and C. U. Cotton A role for ERK1/2 in EGF- and ATP-dependent regulation of amiloride-sensitive sodium absorption Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1003 - C1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Veizis, C. R. Carlin, and C. U. Cotton Decreased amiloride-sensitive Na+ absorption in collecting duct principal cells isolated from BPK ARPKD mice Am J Physiol Renal Physiol, February 1, 2004; 286(2): F244 - F254. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sinha, Z. Wang, V. R. Price, J. H. Schwartz, and W. Lieberthal Chemical anoxia of tubular cells induces activation of c-Src and its translocation to the zonula adherens Am J Physiol Renal Physiol, March 1, 2003; 284(3): F488 - F497. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Shen and C. U. Cotton Epidermal growth factor inhibits amiloride-sensitive sodium absorption in renal collecting duct cells Am J Physiol Renal Physiol, January 1, 2003; 284(1): F57 - F64. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Yoder, A. Tousson, L. Millican, J. H. Wu, C. E. Bugg Jr., J. A. Schafer, and D. F. Balkovetz Polaris, a protein disrupted in orpk mutant mice, is required for assembly of renal cilium Am J Physiol Renal Physiol, March 1, 2002; 282(3): F541 - F552. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Sweeney Jr., L. Kusner, C. R. Carlin, S. Chang, L. Futey, C. U. Cotton, K. M. Dell, and E. D. Avner Phenotypic analysis of conditionally immortalized cells isolated from the BPK model of ARPKD Am J Physiol Cell Physiol, November 1, 2001; 281(5): C1695 - C1705. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takacs-Jarrett, W. E. Sweeney, E. D. Avner, and C. U. Cotton Generation and phenotype of cell lines derived from CF and non-CF mice that carry the H-2Kb-tsA58 transgene Am J Physiol Cell Physiol, January 1, 2001; 280(1): C228 - C236. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |