Vol. 276, Issue 2, F237-F245, February 1999
H-K-ATPase in the RCCT-28A rabbit cortical collecting duct
cell line
W. Grady
Campbell1,
I. David
Weiner2,
Charles S.
Wingo2, and
Brian D.
Cain1
1 Department of Biochemistry
and Molecular Biology, and Division of Nephrology, Hypertension,
and Transplantation, University of Florida College of Medicine,
Gainesville 32610; and
2 Gainesville Veterans Affairs
Medical Center, Gainesville, Florida 32608
 |
ABSTRACT |
In the present
study, we demonstrate that the rabbit cortical collecting duct cell
line RCCT-28A possesses three distinct H-K-ATPase catalytic subunits
(HK
). Intracellular measurements of RCCT-28A cells using the
pH-sensitive dye
2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF)
indicated that the mechanism accounting for recovery from an acid load
exhibited both K+ dependence
and sensitivity to Sch-28080 characteristic of
H-K-ATPases. Recovery rates were 0.022 ± 0.005 pH units/min in the
presence of K+, 0.004 ± 0.002 in the absence of K+, and 0.002 ± 0.002 in the presence of Sch-28080. The mRNAs encoding the
HK
1 subunit and the H-K-ATPase
-subunit (HK
) were detected by RT-PCR. In addition, two
HK
2 species were found by
RT-PCR and 5' rapid amplification of cDNA ends (5'-RACE) in
the rabbit renal cortex. One was homologous to
HK
2 cDNAs generated from other
species, and the second was novel. The latter, referred to as
HK
2c, encoded an apparent
61-residue amino-terminal extension that bore no homology to reported
sequences. Antipeptide antibodies were designed on the basis of this
extension, and these antibodies recognized a protein of the appropriate
mass in both rabbit renal tissue samples and RCCT-28A cells. Such
findings constitute very strong evidence for expression of the
HK
2c subunit in vivo. The results suggest that the rabbit kidney and RCCT-28A cells express at
least three distinct H-K-ATPases.
renal cell line; potassium homeostasis; acid-base balance; alternative splicing
 |
INTRODUCTION |
THE KIDNEY IS THE PRINCIPAL organ responsible for
K+ homeostasis and plays a major
role in maintenance of the acid-base balance of the body. The renal
collecting duct is the primary site for regulation of both the
excretion of potassium and the acidification of urine. The renal
H-K-ATPases participate in these processes by secreting
H+ in an electroneutral exchange
for K+ (for review, see Refs. 46
and 47).
H-K-ATPases consist of two subunits,
and
. The H-K-ATPase
-subunits (HK
) house both catalytic activity and the ion
translocation mechanism (for review, see Refs. 27 and 43). The
H-K-ATPase
-subunit (HK
) associates with the
HK
1 subunit and functions in
trafficking of the enzyme to the plasma membrane (28), its recovery
from the membrane (17), and modulation of activity (13). Expression of
the gastric HK
subunit has been localized in the kidney from the
connecting segment through the medullary collecting duct (10, 11).
Recently, it has been demonstrated that the Na-K-ATPase
1 subunit is associated with
the HK
2 subunits in both colon
and kidney (14, 31).
Transcripts for three distinct HK
subunits have been reported in the
rat kidney. In general, the localization of mRNA encoding the rat
gastric HK
1 subunit was similar
to the distribution of the HK
subunit (1). The mRNA for colonic
HK
2a subunit was also detected
in whole kidney tissue samples (18). Moreover, the mRNA for a possible
human homolog of the HK
2a
subunit, ATP1AL1, was also found in the kidney (24, 36). Recently,
rapid amplification of 5' cDNA ends (5'-RACE) has been
employed to demonstrate that the rat kidney possesses not only the
canonical HK
2a mRNA, but also
an alternatively spliced variant that encodes a truncated HK
2b subunit (29). A partial
cDNA has been reported for a rabbit cortical collecting duct (CCD)
HK
2 (22), but the PCR approach used to generate the cDNA was not designed to differentiate between the
HK
2a and other, then unknown,
HK
2 isoforms. The importance of
identifying the H-K-ATPase isozymes present and their locations in the
kidney has been emphasized by suggestions from several investigators
that expression of the HK
2
subunits is regulated in response to
K+ depletion (3, 21, 29, 30, 34,
38).
The RCCT-28A transformed cell line was derived from immunodissected
rabbit CCD by Arend et al. (4). Bello-Reuss (7) reported H-K-ATPase
activity in RCCT-28A cells, observing an apical acidification mechanism
that was sensitive to K+ removal
and to two H-K-ATPase inhibitors, Sch-28080 and omeprazole. She also
detected activities consistent with an apical
H+-ATPase and a basolateral
Cl
/HCO
3
exchanger. Band 3 protein and carbonic anhydrase, markers
characteristic of acid-secreting intercalated cells, were present in
these cells (39). The plasma membrane exhibited a
Cl
conductance, but not
Na+ or
K+ conductance (20),
distinguishing these cells from CCD principal cells. Thus RCCT-28A
cells possess numerous characteristics typical of intercalated cells in
the CCD.
In the present work, we report the full-length coding sequence of two
HK
subunits from rabbit kidney and demonstrate their expression in
renal cortex and RCCT-28A cells. To demonstrate basal H-K-ATPase
activity, we examined the mechanisms of intracellular pH
(pHi) recovery from an
intracellular acid load. RCCT-28A cells displayed
pHi recovery that was both
K+ dependent and sensitive to
Sch-28080. While generating a complete cDNA for rabbit cortex
HK
2a, a putative alternatively
spliced variant was found. This rabbit variant differed from the
HK
2b alternatively spliced
variant reported for rat (29), and we have designated the new subunit
HK
2c. RT-PCR detected mRNAs for H-K-ATPase subunits, including
HK
1,
HK
2a,
HK
2c, and HK
in both kidney
tissues and RCCT-28A cells. An antipeptide antibody specific for the HK
2c isoform
was used to detected the subunit. The results establish that multiple
isoforms of H-K-ATPase, including the novel
HK
2c, reside within a single
clonal cell line.
 |
METHODS |
Cell culture. The RCCT-28A cell line
was derived from immunodissected rabbit renal CCD (4). These cells were
the kind gift of Dr. William Spielman, and experiments were performed
using cells between passages 11 and 31. Cells were grown in DMEM media supplemented with 10% fetal bovine serum (FBS) and 1%
penicillin-streptomycin. All media were bubbled overnight with a
mixture of 5% CO2-21% O2-74%
N2, then filter sterilized by use
of a syringe-mounted filter. Cells were maintained in culture in tissue
culture flasks at 37°C in a 5%
CO2 atmosphere and were plated on
Corning Costar Transwell collagen-coated semipermeable inserts for
experiments. Cells were plated at a density of 2 × 105/cm2,
grown for 2 days in media containing 10% FBS, and then shifted to
0.1% FBS for a period of 24 h prior to the experiment.
Measurement of pHi.
The fluorescent, pH-sensitive dye
2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF)
was used to measure pHi (44). Cells were incubated at room temperature for a period of 30 min in
solution 1 (Table
1) with the acetoxymethyl ester of BCECF (BCECF-AM; Molecular Probes, Eugene, OR) at a final concentration of 5 µM. A minimum of 5 min perfusion with solution
1 delivered at 37°C rinsed away BCECF-AM at the
beginning of each experiment. Cells were excited at 440 and 490 nm, and
emission was measured at 530 nm. Measurements were made at 30-s
intervals. Fluorescence was detected by a Videoscope model KS-1381
image intensifier coupled to a Dage model 72 charge-coupled device
camera. Images were digitized and stored to the hard disk of a personal
computer using commercially available equipment (Image 1/FL software
package; Universal Imaging, Westchester, PA), allowing subsequent
analysis of single cells.
During measurements, cells were constantly perfused at a rate of ~10
ml/min by HEPES-buffered solutions (Table 1) that were continuously
bubbled with O2 and preheated to
be delivered at a temperature of 37°C. Apical and basolateral sides
were perfused simultaneously with identical solutions. Inhibitors were
diluted into solutions immediately before experiments were begun. Cells were acid loaded using the NH4Cl
prepulse technique. Briefly, cells were incubated with 20 mM ammonium
chloride (equimolar substitution for NaCl) for 5 min, then ammonium
chloride was removed from the perfused solution. Addition of inhibitors
or K+ removal was done at the
beginning of the NH4Cl prepulse.
At the end of each protocol, ethylisopropylamiloride (EIPA)
was removed from the perfusing solutions, and an increased
rate of pHi recovery was used as a
sign of cell viability. The EIPA stock solution was 1 mM dissolved in
DMSO, and Sch-28080 was 10 mM dissolved in DMSO. EIPA was obtained from
Research Biochemicals International (Natick, MA), and Sch-28080 was the
kind gift of Dr. James Kaminski at Schering (Bloomfield, NJ).
Calibration of the pHi measured by
BCECF fluorescence was carried out by the high potassium-nigericin calibration technique of Thomas et al. (42). Buffer capacities were
calculated according to the method of Boyarsky et al. (8)
Isolation of total RNA. New Zealand
White rabbits were killed by decapitation, and the kidneys were removed
immediately. Kidneys were sliced coronally, and cortex and medulla were
separated. Tissues were Dounce homogenized, and total RNA was prepared
from each tissue by the acid phenol method (12).
RT-PCR. RT-PCR was carried out as
described by Davis et al. (19). Template for the RT-PCR reaction was 1 µg total RNA from rabbit renal cortex or RCCT-28A cells using random
hexamers to prime the reverse transcription. PCR reactions were primed
with pairs of oligonucleotides (10 µM) synthesized by the University of Florida Interdisciplinary Center for Biotechnology Research (UF
ICBR) DNA Synthesis Core (Table 2). For
amplification from rabbit renal cortex using degenerate
oligonucleotides, thermal parameters of the PCR reactions included a
5-min 94°C presoak followed by denaturation at 94°C for 40 s,
anneal at 55°C for 1 min, and extension at 72°C for 2 min, for
a total of 30 cycles followed by a final extension of 5 min. For amplification from RCCT-28A cell RNA, thermal parameters of
the reactions included a 2-min 94°C presoak followed by 40 cycles
of denaturation at 94°C for 30 s and anneal/extension at 68°C
for 1 min, with a final extension of 5 min. PCR products
were cloned into the pCR II vector utilizing the TA Cloning Kit
(Invitrogen, San Diego, CA). Sequencing of plasmids was carried out by
the UF ICBR DNA Sequencing Core.
Rapid amplification of cDNA ends.
3'-RACE was carried out as described by Davis et al. (19). mRNA
was prepared from rabbit renal cortex total RNA using the PolyATtract
System (Promega, Madison, WI). Complementary strand was synthesized
using the sense primer (TGCGGAAACTCTTCATCAGG, nucleotides
3079-3098 of the rabbit HK
2a sequence). The PCR was
performed as before for 40 cycles, and the products were cloned. The
library of clones produced in this manner was screened using an
oligonucleotide (CTCTACCCTGGCAGCTGGTG, nucleotides 3099-3118 of
the rabbit HK
2a sequence)
5' labeled using an enhanced chemiluminescence kit (ECL;
Amersham, Arlington Heights, IL).
5'-RACE was performed using the Marathon cDNA Amplification Kit
(Clontech, Palo Alto, CA) following manufacturer's instructions except
as follows. RT reactions were carried out using 5.5 µg total RNA of
rabbit renal cortex, incubated with the rabbit
HK
2 gene-specific
primer TTGCCATCTCGCCCCTCCTT (nucleotides 121-102) for 30 min at
50°C, then at 55°C for 15 min. PCR reactions were carried out
using the anchor primer included in the Marathon kit paired with
gene-specific primer TATCTGTAGCTGCATGGTGCTCCAC (nucleotides 93-69).
Northern analysis. Northern blots were
carried out following the procedures of Davis et al. (19). mRNA (1 µg
per lane) underwent electrophoresis in a 1% agarose, 0.22 M
formaldehyde denaturing gel. Following capillary transfer to nylon
membrane (Hybond N, Amersham), membranes were probed with
32P-labeled probes prepared using
the Megaprime kit (Amersham). The rabbit
HK
2a-specific probe
corresponded to nucleotides 7-93 of the
HK
2a sequence (Table 2). The
HK
2c-specific probe
corresponded to nucleotides 24-377 of
HK
2c. Following hybridization,
three 20-min washes were done in 0.2× SSC (0.03 M NaCl, 3 mM
sodium citrate), 0.1% SDS at 55°C. Autoradiography was carried out
for 6 days using BioMax MS film and screens (Kodak, Rochester, NY).
Western analysis. Antipeptide
antibodies were raised in chickens by Lofstrand Laboratories (Bethesda,
MD). Peptides were synthesized and conjugated to keyhole limpet
hemocyanin (UF ICBR Protein Core). Two peptides were used as
immunogens. The first was designed based on a segment found in both
HK
2a and
HK
2c, and the second was based
on a segment unique to HK
2c.
The peptide chosen within the common region corresponded to amino acids
18-37 in HK
2a and 79-98 in HK
2c (Fig.
1). The peptide chosen within the
HK
2c-specific region
corresponded to amino acids 13-25.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1.
Amino termini of HK 2a and
HK 2c proteins. Full sequences
are GenBank accession nos. AF023128 and AF023129. For clarity, only the
first 39 amino acids of HK 2a
and 100 amino acids of HK 2c are
shown. Locations of immunogenic peptides used to generate antibodies
LLC25 and LLC27 within sequence are underlined and bold.
|
|
Membrane proteins were prepared by homogenization of tissue in 50 mM
sucrose, 10 mM Tris · HCl, pH 7.4, 1 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride. Homogenate was subjected to centrifugation of 10 min at 1,000 g.
The resulting supernatant underwent centrifugation at 10,000 g three times for 20 min each. Final
centrifugation was for 1 h at 100,000 g. After discarding supernatant, we
resuspended the pellet in 1 mM Tris · HCl, pH 7.4, 10 mM MgCl2, and 150 mM NaCl.
Proteins were electrophoresed on 4-20% SDS-polyacrylamide
reducing gels (Bio-Rad, Hercules, CA), 10 µg per lane. The proteins
were transferred to Hybond nitrocellulose membrane (Amersham) using a
Bio-Rad Transblot electrophoretic transfer cell as described by the
manufacturer. Membranes were blocked overnight at 4°C in 10 mM
Tris · HCl, pH 7.2, 150 mM NaCl, 0.1% Tween-20, and
5% Carnation nonfat dry milk. Primary antibodies were used at a
dilution of 1:500, the rabbit anti-chicken horseradish peroxidase-conjugated IgY secondary antibody (Promega) was
diluted 1:10,000. Detections of
HK
2 proteins were performed
using the ECL system (Amersham) by allowing the reaction to run to
completion. Immunizing peptide was used at a concentration of 25 µg/ml in peptide competition experiments. Apparent molecular masses
were established using the High Range Molecular Weight Standards
(Bio-Rad).
Statistical methods.
pHi recovery rates for individual
cells were calculated using least-squares linear regression. Rates were
calculated for the period beginning 2 min after
NH4Cl withdrawal. Data were
collected for independent experiments involving separate passages of
cells. pHi recovery rates for each
experimental condition are presented as the means of the rates
determined for the individual experiments ± SE. Cells without
Na+/H+
exchange activity, defined as an increase in
pHi recovery rate with EIPA
removal, were classified as nonviable and excluded from analysis.
P < 0.05 by Student's unpaired
t-test was taken as significant.
 |
RESULTS |
K+-dependent
pHi regulation.
Prior to engaging in the molecular analysis of the H-K-ATPases that
exist in RCCT-28A cells, we needed to define the H-K-ATPase activity
present in the cells. We examined the extent to which an H-K-ATPase
contributed to pHi recovery from
an acid load by BCECF fluorescence microscopy with digital video image
analysis. An H-K-ATPase activity had been reported previously by other
methods (7). The large contribution of the
Na+/H+
exchanger to H+ extrusion normally
obscures recovery by other mechanisms, so the potent amiloride analog
EIPA was used to inhibit the
Na+/H+
exchanger in these experiments.
To detect H-K-ATPase activity in RCCT-28A cells,
K+-dependent recovery from an acid
load was determined. A representative tracing of a cell acid loaded by
an NH4Cl prepulse and the
pHi recovery that was observed are
shown in Fig.
2A. In a
majority of RCCT-28A cells, significant EIPA-insensitive
pHi recovery was seen using K+-containing solutions. For 136 cells from 6 independent passages of RCCT-28A cells, the mean recovery
rate was 0.022 ± 0.005 pH units/min. The absence of
K+ during the period following an
acid load significantly inhibited pHi recovery (Fig.
2B). In five separate experiments
(129 cells), the K+-independent
pHi recovery rate averaged 0.004 ± 0.002 pH units/min (P < 0.01 vs. 5 mM K+).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Intracellular pH (pHi) recovery
from an acid load by RCCT-28A cells.
A:
pHi recovery from an acid load by
a K+-dependent,
ethylisopropylamiloride (EIPA)-insensitive mechanism. Recovery
toward physiological pH is seen in presence of
K+ in a representative tracing of
pHi in an individual cell. Periods
during which solutions contain 20 mM
NH4Cl and 1 µM EIPA are
indicated. B:
pHi recovery from an acid load by
a K+-independent, EIPA-insensitive
mechanism. Negligible recovery toward physiological
pHi is seen in absence of
K+ in a representative tracing of
pHi in an individual cell.
C:
pHi recovery from an acid load by
a Sch-28080-sensitive, EIPA-insensitive mechanism. Negligible recovery
toward physiological pHi is seen
in presence of the H-K-ATPase inhibitor Sch-28080 in a representative
tracing of pHi in an individual
cell.
|
|
In the prolonged absence of potassium, a delayed increase in the
pHi recovery rate was observed
(data not shown), consistent with a delayed stimulation of
H+-ATPase. These results are
consistent with previous results by Hays and Alpern (26), who described
an H+-ATPase activity that was
delayed following an NH4Cl
prepulse. Bello-Reuss (7) also detected
H+-ATPase as well as H-K-ATPase
activity in RCCT-28A cells.
pHi recovery rates are influenced
by the degree of intracellular acid loading and by buffer capacity.
Actual nadir pHi values observed
in these experiments in the presence and absence of
K+ were not significantly
different [6.64 ± 0.06 and 6.59 ± 0.08, respectively;
P = not significant (NS)]. No
significant difference in buffer capacities in the presence of
K+ and absence of
K+ was seen (15 ± 1 and 16 ± 1 meq
H+ · pHi
unit
1 · liter
cell volume
1, respectively;
P = NS). Consequently, differences in
pHi recovery rates found in our
experiments indicated differences in
H+ extrusion.
To test the hypothesis that
K+-dependent
pHi recovery from an acid load
resulted from H-K-ATPase activity, the effect of the classic H-K-ATPase
inhibitor Sch-28080 (10 µM) on RCCT-28A cell pHi regulation was examined (Fig.
2C). Using this protocol, 109 cells
from 4 separate cell preparations had a mean recovery rate of 0.002 ± 0.002 pH units/min (P < 0.05 vs. 5 mM K+,
P = NS vs. 0 mM
K+) in the presence of 10 µM
Sch-28080. The buffer capacity of 16 ± 2 meq
H+ · pHi
unit
1 · liter
cell volume
1 and the nadir
pHi of 6.54 ± 0.03 were not
significantly different from those measured in the absence of Sch-28080
(P = NS).
In summary, either the presence of the H-K-ATPase inhibitor Sch-28080
or the absence of K+ virtually
abolished EIPA-insensitive pHi
recovery from an acid load in RCCT-28A cells (Fig.
3). These results confirm the presence of
H-K-ATPase activity in RCCT-28A cells.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Summary of the rates of pHi
recovery from an acid load. Mean rates of recovery are indicated by
open (presence of K+), solid
(absence of K+), and stippled
(in presence of Sch-28080 with K+
present) bars. * P < 0.01 vs.
5 mM K+.
** P < 0.05 vs. 5 mM
K+,
P = NS vs. 0 K+.
|
|
Generation of a rabbit
HK
2 cDNA.
To define the molecular identity of HK
isoforms present in RCCT-28A
cells, it was first necessary to find the nucleotide sequence of those
isoforms present in rabbit renal cortex. Although a complete sequence
for the rabbit HK
1 cDNA was
available (5), only a partial nucleotide sequence has been reported for
the rabbit HK
2 cDNA (22).
Degenerate oligonucleotides designed to prime amplification reactions
at sites that are highly conserved among P-type ATPases were used to
obtain a cDNA fragment of HK
2
from rabbit renal cortex RNA. These oligonucleotides were specifically designed to yield RT-PCR products from any HK
subunit mRNA present in the rabbit renal cortex. Only products representing Na-K-ATPase
1- and
HK
2-like messages
were found. Thus our next goal was to determine the
complete coding sequence for the rabbit
HK
2 cDNA. Using the sequence
information found in this manner, subsequent RT-PCR reactions were
carried out in which one primer of a pair was gene specific and the
other was a degenerate primer designed using conserved regions of
P-type ATPases. Outside the coding region, conservation between members
of the P-type ATPase gene family declines, so 3'- and
5'-RACE was carried out to extend the sequence to the 3'
and 5' ends.
Two rabbit renal HK
2 cDNA
sequences were found in this manner, having 4,035 bases in common at
the 3' end but different at the 5' end. One of the 5'
ends had a high degree of homology to the human and rat
HK
2a cDNAs, and this clone was
designated as the rabbit HK
2a.
The other was a novel sequence named
HK
2c. These sequences have been
submitted to GenBank (accession nos. AF023128 and AF023129). A segment
of the shared 3' portion of the sequences was identical to the
1,456-bp sequence obtained by Fejes-Toth et al. (22)
except for two single base mismatches (C
T at nucleotide 2927, which does not change the primary protein sequence, and G
T at
nucleotide 3259, in the 3'-untranslated region). The rabbit
HK
2a nucleotide sequence was
86% identical to human ATP1AL1 and 83% to rat
HK
2 cDNAs, whereas identity of
HK
2a to rabbit
HK
1 was only 67%. The deduced
amino acid sequence shared 93% similarity with human ATP1AL1, 93%
similarity with rat HK
2, but
merely 80% with rabbit HK
1.
However, the 5' end of the rabbit
HK
2c differed dramatically from
the rat HK
2a and
HK
2b sequences (29). Rabbit
HK
2c cDNA lacked the start ATG
codon corresponding to that present in the rat and human
HK
2a sequences. The new
probable start codon was located upstream in frame with the
HK
2 open-reading frame. Thus
the deduced amino acid sequence of the
HK
2c appeared to be 61 amino
acids longer at the amino terminal end than the rabbit HK
2a subunit (Fig. 1). This
extension and the 5'-untranslated region bore no homology to the
comparable segments from the
HK
2 cDNA from rat or to any
GenBank sequence. It may represent an alternative
splicing product; the sequence homology diverges from the human
HK
2 sequence at a point known
in the human ATP1AL1 gene to be a splice junction (nucleotide 177 of
ATP1AL1) (41).
Detection of H-K-ATPase mRNAs in RCCT-28A
cells. We examined whether the RCCT-28A cells possessed
mRNA for the H-K-ATPase
- and
-subunits. RT-PCR
products were generated and sequenced using RCCT-28A cell total RNA as
a template. The presence of HK
subunit mRNA was observed by
amplification of a 570-bp cDNA corresponding to nucleotides
304-873 of the sequence of rabbit gastric HK
(37) (Fig.
4). Nucleotide sequencing of the RCCT-28A
product confirmed that the amplified product was identical to the
rabbit HK
subunit mRNA.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
HK subunit mRNA in RCCT-28A cells. RT-PCR products amplified from
RNA derived from RCCT-28A cells and rabbit renal cortex tissue were
separated by agarose gel electrophoresis and stained with ethidium
bromide. The RT lanes depict negative controls in which RT was
omitted from reactions to show that the RNA template was free of
contaminants; +RT lanes show products amplified using a primer pair
designed to amplify a 570-bp fragment of HK subunit mRNA.
|
|
A similar strategy was employed to show that
HK
1 was present in the RCCT-28A
cells. Primers were designed to amplify a 611-bp region of
HK
1 mRNA (nucleotides
2537-3147), and again a product of the expected size was observed
(Fig. 5). The nucleotide sequence was
identical to that reported by Bamberg et al. (5) except for two single
base mismatches (G
A at nucleotide 2567 and G
C at
nucleotide 3089; neither affects the deduced amino acid sequence).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
HK 1 subunit mRNA in RCCT-28A
cells. RT-PCR products amplified from RNA derived from RCCT-28A cells
and rabbit renal cortex tissue were separated by agarose gel
electrophoresis and stained with ethidium bromide. The RT lanes
depict negative controls in which RT was omitted from reactions to show
that the RNA template was free of contaminants; +RT lanes show products
amplified using a primer pair designed to amplify a 611-bp fragment of
HK 1 subunit mRNA.
|
|
For HK
2 mRNA, a primer pair
yielded the anticipated product of 306 bp, which was identical to
nucleotides 1264-1569 of the HK
2a sequence, contained in the
region common to HK
2a and
HK
2c (Fig.
6A). To
determine whether HK
2a and
HK
2c isoforms are both present
in RCCT-28A cells, primer pairs were designed that amplify regions
specific to each isoform.
HK
2a-specific primers amplify an 87-bp RT-PCR product (nucleotides 7-93 in the
HK
2a sequence) from RCCT-28A
cellular RNA, and sequencing showed the product to be identical to the
sequence of the HK
2a cDNA from
rabbit cortex (Fig. 6B). A product
of 354 bp (nucleotides 24-377 in the HK
2c sequence) was amplified
using both RCCT-28A cell and rabbit renal cortex mRNA as templates
(Fig. 6C).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6.
HK 2 subunit mRNA in RCCT-28A
cells. RT-PCR products amplified from RNA derived from RCCT-28A cells
and rabbit renal cortex tissue were separated by agarose gel
electrophoresis and stained with ethidium bromide. The RT lanes
depict negative controls in which RT was omitted from reactions to show
that the RNA template was free of contaminants. +RT lanes show products
amplified using a primer pair designed to amplify a 306-bp fragment of
HK 2 subunit mRNA
(A), an 87-bp fragment of
HK 2a subunit mRNA
(B), and a 354-bp fragment of
HK 2c subunit mRNA
(C).
|
|
Therefore, RCCT-28A cells contained the mRNAs encoding all three HK
subunits and the HK
subunit. Since RCCT-28A cells are a clonal cell
line, individual cells appear to express at least three different
H-K-ATPases.
Detection of H-K-ATPase mRNAs in rabbit distal colon
and renal cortex. Northern analysis was used to detect
the presence of HK
2 mRNAs in
rabbit tissues. A probe specific for the 5'-untranslated region
of HK
2a hybridized at high
level to distal colonic mRNA and to mRNA derived from renal cortex at a
much lower level (Fig. 7A). In
fact, it was necessary to overexpose the blot with respect to the colon
tissue mRNA lanes to detect any signal in the kidney mRNA lanes.
Another probe specific to the
HK
2c 5'-untranslated region hybridized to mRNA isolated from distal colon, but any hybridization to mRNA from renal cortex was apparently below detectable levels (Fig. 7B). As shown above
(Fig. 6), HK
2c mRNA was
detectable by RT-PCR using renal cortex as template.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
HK 2 subunit mRNA. mRNA isolated
from rabbit distal colon and renal cortex hybridized by probes specific
for HK 2a
(A) and
HK 2c
(B). No hybridization was observed
when renal cortex mRNA was probed with the
HK 2c-specific fragment.
|
|
Detection of the
HK
2c
subunit.
Although the HK
2c cDNA
indicated a continuous open-reading frame including the amino-terminal
extension, the possibility remained that translation might be initiated
at the ATG codon homologous to that reported for the rat
HK
2b (29). Therefore, to
determine whether the upstream ATG served as a translational start
site, antipeptide antibodies were generated for peptides corresponding
to amino acids 13-25 and 79-98 of the
HK
2c subunit. The former
(antibody LLC27) was HK
2c
specific, whereas the latter (antibody LLC25) recognized a segment
common to both HK
2a and HK
2c subunits. Western analyses
of rabbit kidney tissues using antibody LLC25 revealed a doublet
migrating at an apparent molecular mass of ~90 kDa (Fig.
8A).
Experiments using the
HK
2c-specific antibody LLC27
indicated a single band with a migration comparable to the upper band
of the doublet (Fig. 8B). Although
we have not yet achieved separation of
HK
2a and
HK
2c proteins on immunoblots of
membrane proteins from RCCT-28A cells, both antibodies recognize a
protein of the correct mobility (Fig. 9).
This provides strong evidence that the
HK
2c subunit containing the
amino-terminal extension was indeed present in both rabbit renal tissue
and RCCT-28A cells.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 8.
HK 2 subunit protein in renal
cortex. Western analysis of membrane protein fractions derived from
rabbit renal cortex was carried out by running all samples on the same
gel for optimal comparison. After electrotransfer, the membrane was
cut, and A and
B were each probed with the antibodies
indicated. A: antibody to
HK 2 proteins (LLC25) detects a
doublet indicating the two expected species of
HK 2 protein.
B: antibody to
HK 2c amino-terminal extension
(LLC27) detects a single reactive protein at the same apparent mass as
the larger species shown in A.
Additional bands were visualized at lower molecular weights. No
degradation products were consistently observed with different
preparations of antibodies. No reactivity was seen to preimmune serum.
Preabsorption with immunizing peptide blocked antibody reactivity.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 9.
HK 2 subunit protein in RCCT-28A
cells. Western analysis of membrane protein fractions derived from
RCCT-28A cells is shown. A: antibody
to HK 2 proteins (LLC25) detects
a protein near the predicted mass for
HK 2 proteins.
B: antibody to
HK 2c amino-terminal extension
(LLC27) detects a reactive protein at the same apparent mass as the
HK 2 common antibody (LLC25).
|
|
 |
DISCUSSION |
We have generated complete cDNAs for both the rabbit renal
HK
2a and the novel
HK
2c subunits. mRNAs
corresponding to these cDNAs were detected in rabbit distal colon and
renal cortex. Proteins corresponding to both
HK
2 isoforms were detected by
immunoblot analysis, indicating that the novel
HK
2c has the predicted
amino-terminal extension. HK
1
protein has been previously detected by immunohistochemistry in CCD
intercalated cells (6, 47). We also demonstrated that RCCT-28A cells
express the HK
subunit, the
HK
1 subunit, and both isoforms
of the HK
2 subunit. The
presence of multiple H-K-ATPase isoforms in a clonal cell line derived
from CCD is the first evidence that several isozymes of H-K-ATPase may
contribute to net activity in a single cell.
The finding that the three forms of the catalytic subunit are all
present in a clonal cell line derived from CCD suggests that multiple
H-K-ATPase isoforms exist in a single cell type in the CCD. Presence of
mRNA for HK
1,
HK
2a, and
HK
2c isoforms in the RCCT-28A
cell line is consistent with previous studies finding the presence of
multiple H-K-ATPase catalytic subunit isoforms in the kidney (1-3,
18, 21, 22, 25, 32, 34). Expression of multiple HK
subunits within a
cell suggests the possibility of greater complexity associated with
formation of hybrid H-K-ATPases containing two different catalytic
subunits. Moreover, an additional level of complexity appears with the
consideration that HK
2 subunits
are capable of forming stable complexes with both the HK
and the
Na-K-ATPase
1-subunits
(15).
Our results demonstrate the presence of Sch-28080-sensitive H-K-ATPase
activity in RCCT-28A cells. These observations are consistent with the
findings of Bello-Reuss (7). Although Sch-28080 inhibits the gastric
H-K-ATPase, the inhibition observed in this study using very low
concentrations of Sch-28080 does not necessarily indicate that
HK
1-containing H-K-ATPases
account solely for the activity in RCCT-28A cells. The reported
pharmacological properties of the non-gastric H-K-ATPases containing
the rat HK
2a and human ATP1AL1
subunits vary widely. For example, studies in heterologous expression
systems have reported that the
HK
2a-containing H-K-ATPase is insensitive to Sch-28080 (15, 16), whereas the ATP1AL1 pump is sensitive to high concentrations of the inhibitor (35), and
both have been reported to be Sch-28080 sensitive at much lower
concentrations of Sch-28080 (23, 33). These same studies also report
differing results using ouabain. Since the rabbit HK
2a sequence reported here has
essentially equivalent homology to both rat
HK
2a and human ATP1AL1 cDNAs,
there is no basis for predicting the pharmacological properties of the
pump in RCCT-28A cells. An interesting study by Buffin-Meyer et al. (9)
reported a decrease in sensitivity of H-K-ATPase activity to Sch-28080 in the CCD between rats fed a normal diet and
K+-depleted rats. Whether this
reflects expression of differing isozymes of H-K-ATPase in the
K+-depleted state or mobilization
of existing pumps has not yet been defined.
The rabbit renal cortex HK
2
cDNAs reported here have high homology to rat
HK
2 and human ATP1AL1 sequences
(18, 24). The level of homology is relatively low compared with the
homology typically found when comparing
HK
1 or Na-K-ATPase
-subunits across mammalian species. However, it is much higher than the homology
between the rat HK
1 and
HK
2 cDNAs (18) or among the different Na-K-ATPase isoforms within a species. If the rat
HK
2 isoforms, the human ATP1AL1
protein, and the rabbit HK
2
subunits are products of homologous genes in the different species,
then the genes appear to have undergone greater evolutionary divergence than HK
1 or the Na-K-ATPase
catalytic isoforms.
Like the rat, the rabbit appears to have alternatively spliced
transcripts of HK
2 in the
kidney. The organization of the rat alternatively spliced
HK
2b cDNA (29) omitted the exon
containing the start codon of the sequence previously reported for rat
distal colon HK
2a cDNA (18),
giving rise to a protein truncated by 108 amino acids at the
amino-terminal end. The rabbit
HK
2c sequence also omits the
start codon present in the HK
2a
sequence. However, an upstream 5' ATG codon lies in the same
uninterrupted reading frame as the coding sequence for
HK
2, so initiation of
translation at this position yields a subunit having an extended amino
terminus 61 amino acids longer than the
HK
2a protein. Western analysis demonstrated that a protein having this extension is present in rabbit
kidney and the RCCT-28A cell line.
The HK
2c extension is
hydrophilic in nature and lacks any conspicuous membrane-spanning
domains. Because the amino terminus of H-K-ATPase catalytic subunits
are cytosolic (40), the extension can be expected to have a cytosolic
location. Chou-Fasman calculations predict this segment to be
predominantly
-helical with a turn in a region containing seven
prolines between amino acids 26-40. A similarly proline-rich hinge
region is found in the band 3 protein, and an ankyrin-binding site has
been localized to that site within band 3 (45). The extended portion of
the HK
2c protein contains a
casein kinase II phosphorylation motif at
Thr12, and a cAMP-dependent
protein kinase phosphorylation motif at Thr53. These sites
impart a potential for differential regulation of H-K-ATPases
containing the HK
2a and
HK
2c subunits.
Why are there three different H-K-ATPase isozymes in a cell line
derived from an intercalated cell from the CCD? One possibility is to
provide a means to respond to different signals and signal transduction
systems governing H+ and
K+ homeostasis. These adjustments
might occur at the level of transcription of the
HK
2 gene, by intracellular
trafficking of the pumps or by differential modification of the
HK
2a- and
HK
2c-containing H-K-ATPases.
 |
ACKNOWLEDGEMENTS |
We gratefully acknowledge Dr. Bruce C. Kone, University of Texas
Medical School, for providing sequence information prior to
publication, and Amy E. Milton and April R. Starker, for technical assistance.
 |
FOOTNOTES |
This work was supported by Grant-in-Aid 95011160 from the American
Heart Association (to B. D. Cain), by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-45788 (to I. D. Weiner) and DK-49750 (to C. S. Wingo), and by a Merit Review Grant
from the Department of Veterans Affairs (to I. D. Weiner).
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: B. D. Cain, Dept. of Biochemistry and
Molecular Biology, Univ. of Florida, JHMHC 100245, Gainesville, FL
32610.
Received 1 May 1998; accepted in final form 8 October 1998.
 |
REFERENCES |
1.
Ahn, K. Y.,
and
B. C. Kone.
Expression and cellular localization of mRNA encoding the "gastric" isoform of H+-K+-ATPase
-subunit in rat kidney.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F99-F109,
1995[Abstract/Free Full Text].
2.
Ahn, K. Y.,
K. Y. Park,
K. K. Kim,
and
B. C. Kone.
Chronic hypokalemia enhances expression of the H+-K+-ATPase
2-subunit gene in renal medulla.
Am. J. Physiol.
271 (Renal Fluid Electrolyte Physiol. 40):
F314-F321,
1996[Abstract/Free Full Text].
3.
Ahn, K. Y.,
P. B. Turner,
K. M. Madsen,
and
B. C. Kone.
Effects of chronic hypokalemia on renal expression of the "gastric" H+-K+-ATPase
-subunit gene.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F557-F566,
1996[Abstract/Free Full Text].
4.
Arend, L. J.,
J. S. Handler,
J. S. Rhim,
F. Gusovsky,
and
W. S. Spielman.
Adenosine-sensitive phosphoinositide turnover in a newly established renal cell line.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F1067-F1074,
1989[Abstract/Free Full Text].
5.
Bamberg, K.,
F. Mercier,
M. A. Reuben,
Y. Kobayashi,
K. B. Munson,
and
G. Sachs.
cDNA cloning and membrane topology of the rabbit gastric H+/K(+)-ATPase
-subunit.
Biochim. Biophys. Acta
1131:
69-77,
1992[Medline].
6.
Bastani, B.
Colocalization of H-ATPase and H,K-ATPase immunoreactivity in the rat kidney.
J. Am. Soc. Nephrol.
5:
1476-1482,
1995[Abstract].
7.
Bello-Reuss, E.
Characterization of acid-base transport mechanisms in the kidney cell line RCCT-28A.
Kidney Int.
43:
173-181,
1993[Medline].
8.
Boyarsky, G.,
M. B. Ganz,
R. B. Sterzel,
and
W. F. Boron.
pH regulation in single glomerular mesangial cells. I. Acid extrusion in absence and presence of HCO
3.
Am. J. Physiol.
255 (Cell Physiol. 24):
C844-C856,
1988[Abstract/Free Full Text].
9.
Buffin-Meyer, B.,
M. Younes-Ibrahim,
C. Barlet-Bas,
L. Cheval,
S. Marsy,
and
A. Doucet.
K depletion modifies the properties of Sch-28080-sensitive K-ATPase in rat collecting duct.
Am. J. Physiol.
272 (Renal Physiol. 41):
F124-F131,
1997[Abstract/Free Full Text].
10.
Callaghan, J. M.,
S.-S. Tan,
M. A. Khan,
K. A. Curran,
W. G. Campbell,
A. J. Smolka,
B.-H. Toh,
P. A. Gleeson,
C. S. Wingo,
B. D. Cain,
and
I. R. van Driel.
Renal expression of the gene encoding the gastric H+-K+-ATPase
-subunit.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F363-F374,
1995[Abstract/Free Full Text].
11.
Campbell-Thompson, M. L.,
J. W. Verlander,
K. A. Curran,
W. G. Campbell,
B. D. Cain,
C. S. Wingo,
and
J. E. McGuigan.
In situ hybridization of H-K-ATPase
-subunit mRNA in rat and rabbit kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F345-F354,
1995[Abstract/Free Full Text].
12.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
13.
Chow, D. C.,
and
J. G. Forte.
Characterization of the
-subunit of the H+-K+-ATPase using an inhibitory monoclonal antibody.
Am. J. Physiol.
265 (Cell Physiol. 34):
C1562-C1570,
1993[Abstract/Free Full Text].
14.
Codina, J.,
J. T. Delmas-Mata,
and
T. D. DuBose, Jr.
The subunit of the colonic H+,K+-ATPase assembles with
1-Na+,K+-ATPase in kidney and distal colon.
J. Biol. Chem.
273:
7894-7899,
1998[Abstract/Free Full Text].
15.
Codina, J.,
B. C. Kone,
J. T. Delmas Mata,
and
T. D. DuBose, Jr.
Functional expression of the colonic H+,K+-ATPase
-subunit. Pharmacologic properties and assembly with X+,K+-ATPase
-subunits.
J. Biol. Chem.
271:
29759-29763,
1996[Abstract/Free Full Text].
16.
Cougnon, M.,
G. Planelles,
M. S. Crowson,
G. E. Shull,
B. C. Rossier,
and
F. Jaisser.
The rat distal colon P-ATPase alpha subunit encodes a ouabain-sensitive H+,K+-ATPase.
J. Biol. Chem.
271:
7277-7280,
1996[Abstract/Free Full Text].
17.
Courtois-Coutry, N.,
D. Roush,
V. Rajendran,
J. B. McCarthy,
J. Geibel,
M. Kashgarian,
and
M. J. Caplan.
A tyrosine-based signal targets H/K-ATPase to a regulated compartment and is required for the cessation of gastric acid secretion.
Cell
90:
501-510,
1997[Medline].
18.
Crowson, M. S.,
and
G. E. Shull.
Isolation and characterization of a cDNA encoding the putative distal colon H+,K+-ATPase. Similarity of deduced amino acid sequence to gastric H+,K(+)-ATPase and Na+,K+-ATPase and mRNA expression in distal colon, kidney, and uterus.
J. Biol. Chem.
267:
13740-13748,
1992[Abstract/Free Full Text].
19.
Davis, L. G.,
W. M. Kuehl,
and
J. F. Battey.
Basic Methods in Molecular Biology (2nd ed.). Norwalk, CT: Appleton and Lange, 1994.
20.
Dietl, P.,
N. Kizer,
and
B. A. Stanton.
Conductive properties of a rabbit cortical collecting duct cell line: regulation by isoproterenol.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F578-F582,
1992[Abstract/Free Full Text].
21.
DuBose, T. D., Jr.,
J. Codina,
A. Burges,
and
T. A. Pressley.
Regulation of H+-K+-ATPase expression in kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F500-F507,
1995[Abstract/Free Full Text].
22.
Fejes-Toth, G.,
E. Rusvai,
K. A. Longo,
and
A. Naray-Fejes-Toth.
Expression of colonic H-K-ATPase mRNA in cortical collecting duct: regulation by acid/base balance.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F551-F557,
1995[Abstract/Free Full Text].
23.
Grishin, A. V.,
M. O. Bevensee,
N. N. Modyanov,
V. Rajendran,
W. F. Boron,
and
M. J. Caplan.
Functional expression of the cDNA encoded by the human ATP1AL1 gene.
Am. J. Physiol.
271 (Renal Fluid Electrolyte Physiol. 40):
F539-F551,
1996[Abstract/Free Full Text].
24.
Grishin, A. V.,
V. E. Sverdlov,
M. B. Kostina,
and
N. N. Modyanov.
Cloning and characterization of the entire cDNA encoded by ATP1AL1: a member of the human Na,K/H,K-ATPase gene family.
FEBS Lett.
349:
144-150,
1994[Medline].
25.
Guntupalli, J.,
M. Onuigbo,
S. Wall,
R. J. Alpern,
and
T. D. DuBose, Jr.
Adaptation to low-K+ media increases H+-K+-ATPase but not H+-ATPase-mediated pHi recovery in OMCD1 cells.
Am. J. Physiol.
273 (Cell Physiol. 42):
C558-C571,
1997[Abstract/Free Full Text].
26.
Hays, S. R.,
and
R. J. Alpern.
Inhibition of Na+-independent H+ pump by Na+-induced changes in cell Ca2+.
J. Gen. Physiol.
98:
791-813,
1991[Abstract/Free Full Text].
27.
Hersey, S. J.,
and
G. Sachs.
Gastric acid secretion.
Physiol. Rev.
75:
155-189,
1995[Free Full Text].
28.
Horisberger, J. D.,
P. Jaunin,
M. A. Reuben,
L. S. Lasater,
D. C. Chow,
J. G. Forte,
G. Sachs,
B. C. Rossier,
and
K. Geering.
The H,K-ATPase beta-subunit can act as a surrogate for the beta-subunit of Na,K-pumps.
J. Biol. Chem.
266:
19131-19134,
1991[Abstract/Free Full Text].
29.
Kone, B. C.,
and
S. C. Higham.
A novel N-terminal splice variant of the rat H+-K+-ATPase
2 subunit.
J. Biol. Chem.
273:
2543-2552,
1998[Abstract/Free Full Text].
30.
Kraut, J. A.,
J. Hiura,
M. Besancon,
A. Smolka,
G. Sachs,
and
D. Scott.
Effect of hypokalemia on the abundance of HK
1 and HK
2 protein in the rat kidney.
Am. J. Physiol.
272 (Renal Physiol. 41):
F744-F750,
1997[Abstract/Free Full Text].
31.
Kraut, J. A.,
J. Hiura,
J. M. Shin,
A. Smolka,
G. Sachs,
and
D. Scott.
The Na+-K+-ATPase
1 subunit is associated with the HK
2 protein in the rat kidney.
Kidney Int.
53:
958-962,
1998[Medline].
32.
Kraut, J. A.,
F. Starr,
G. Sachs,
and
M. Reuben.
Expression of gastric and colonic H+-K+-ATPase in the rat kidney.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F581-F587,
1995[Abstract/Free Full Text].
33.
Lee, J.,
V. M. Rajendran,
A. S. Mann,
M. Kashgarian,
and
H. J. Binder.
Functional expression and segmental localization of rat colonic K-adenosine triphosphatase.
J. Clin. Invest.
96:
2002-2008,
1995.
34.
Marsy, S.,
J. M. Elalouf,
and
A. Doucet.
Quantitative RT-PCR analysis of mRNAs encoding a colonic putative H,K-ATPase alpha subunit along the rat nephron: effect of K+ depletion.
Pflügers Arch.
432:
494-500,
1996[Medline].
35.
Modyanov, N. N.,
P. M. Mathews,
A. V. Grishin,
P. Beguin,
A. T. Beggah,
B. C. Rossier,
J. D. Horisberger,
and
K. Geering.
Human ATP1AL1 gene encodes a ouabain-sensitive H-K-ATPase.
Am. J. Physiol.
269 (Cell Physiol. 38):
C992-C997,
1995[Abstract/Free Full Text].
36.
Modyanov, N. N.,
K. E. Petrukhin,
V. E. Sverdlov,
A. V. Grishin,
M. Y. Orlova,
M. B. Kostina,
O. I. Makarevich,
N. E. Broude,
G. S. Monastyrskaya,
and
E. D. Sverdlov.
The family of human Na,K-ATPase genes. ATP1AL1 gene is transcriptionally competent and probably encodes the related ion transport ATPase.
FEBS Lett.
278:
91-94,
1991[Medline].
37.
Reuben, M. A.,
L. S. Lasater,
and
G. Sachs.
Characterization of a beta subunit of the gastric H+/K(+)-transporting ATPase.
Proc. Natl. Acad. Sci. USA
87:
6767-6771,
1990[Abstract/Free Full Text].
38.
Sangan, P.,
V. M. Rajendran,
A. S. Mann,
M. Kashgarian,
and
H. J. Binder.
Regulation of colonic H-K-ATPase in large intestine and kidney by dietary Na depletion and dietary K depletion.
Am. J. Physiol.
272 (Cell Physiol. 41):
C685-C696,
1997[Abstract/Free Full Text].
39.
Schwiebert, E. M.,
K. H. Karlson,
P. A. Friedman,
P. Dietl,
W. S. Spielman,
and
B. A. Stanton.
Adenosine regulates a chloride channel via protein kinase C and a G protein in a rabbit cortical collecting duct cell line.
J. Clin. Invest.
89:
834-841,
1992.
40.
Smolka, A.,
and
K. M. Swiger.
Site-directed antibodies as topographical probes of the gastric H,K-ATPase alpha-subunit.
Biochim. Biophys. Acta
1108:
75-85,
1992[Medline].
41.
Sverdlov, V. E.,
M. B. Kostina,
and
N. N. Modyanov.
Genomic organization of the human ATP1AL1 gene encoding a ouabain-sensitive H,K-ATPase.
Genomics
32:
317-327,
1996[Medline].
42.
Thomas, J. A.,
R. N. Buchsbaum,
A. Zimniak,
and
E. Racker.
Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ.
Biochemistry
18:
2210-2218,
1979[Medline].
43.
Van Driel, I. R.,
and
J. M. Callaghan.
Proton and potassium transport by H+/K(+)-ATPases.
Clin. Exp. Pharmacol. Physiol.
22:
952-960,
1995[Medline].
44.
Weiner, I. D.,
and
L. L. Hamm.
Use of fluorescent dye BCECF to measure intracellular pH in cortical collecting tubule.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F957-F964,
1989[Abstract/Free Full Text].
45.
Willardson, B. M.,
B. J. Thevenin,
M. L. Harrison,
W. M. Kuster,
M. D. Benson,
and
P. S. Low.
Localization of the ankyrin-binding site on erythrocyte membrane protein, band 3.
J. Biol. Chem.
264:
15893-15899,
1989[Abstract/Free Full Text].
46.
Wingo, C. S.,
and
B. D. Cain.
The renal H-K-ATPase: physiological significance and role in potassium homeostasis.
Annu. Rev. Physiol.
55:
323-347,
1993[Medline].
47.
Wingo, C. S.,
and
A. J. Smolka.
Function and structure of H-K-ATPase in the kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F1-F16,
1995[Abstract/Free Full Text].
Am J Physiol Renal Physiol 276(2):F237-F245