AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 276: F237-F245, 1999;
0363-6127/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campbell, W. G.
Right arrow Articles by Cain, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, W. G.
Right arrow Articles by Cain, B. D.
Vol. 276, Issue 2, F237-F245, February 1999

H-K-ATPase in the RCCT-28A rabbit cortical collecting duct cell line

W. Grady Campbell1, I. David Weiner2, Charles S. Wingo2, and Brian D. Cain1

1 Department of Biochemistry and Molecular Biology, and Division of Nephrology, Hypertension, and Transplantation, University of Florida College of Medicine, Gainesville 32610; and 2 Gainesville Veterans Affairs Medical Center, Gainesville, Florida 32608


    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

In the present study, we demonstrate that the rabbit cortical collecting duct cell line RCCT-28A possesses three distinct H-K-ATPase catalytic subunits (HKalpha ). Intracellular measurements of RCCT-28A cells using the pH-sensitive dye 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF) indicated that the mechanism accounting for recovery from an acid load exhibited both K+ dependence and sensitivity to Sch-28080 characteristic of H-K-ATPases. Recovery rates were 0.022 ± 0.005 pH units/min in the presence of K+, 0.004 ± 0.002 in the absence of K+, and 0.002 ± 0.002 in the presence of Sch-28080. The mRNAs encoding the HKalpha 1 subunit and the H-K-ATPase beta -subunit (HKbeta ) were detected by RT-PCR. In addition, two HKalpha 2 species were found by RT-PCR and 5' rapid amplification of cDNA ends (5'-RACE) in the rabbit renal cortex. One was homologous to HKalpha 2 cDNAs generated from other species, and the second was novel. The latter, referred to as HKalpha 2c, encoded an apparent 61-residue amino-terminal extension that bore no homology to reported sequences. Antipeptide antibodies were designed on the basis of this extension, and these antibodies recognized a protein of the appropriate mass in both rabbit renal tissue samples and RCCT-28A cells. Such findings constitute very strong evidence for expression of the HKalpha 2c subunit in vivo. The results suggest that the rabbit kidney and RCCT-28A cells express at least three distinct H-K-ATPases.

renal cell line; potassium homeostasis; acid-base balance; alternative splicing


    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THE KIDNEY IS THE PRINCIPAL organ responsible for K+ homeostasis and plays a major role in maintenance of the acid-base balance of the body. The renal collecting duct is the primary site for regulation of both the excretion of potassium and the acidification of urine. The renal H-K-ATPases participate in these processes by secreting H+ in an electroneutral exchange for K+ (for review, see Refs. 46 and 47).

H-K-ATPases consist of two subunits, alpha  and beta . The H-K-ATPase alpha -subunits (HKalpha ) house both catalytic activity and the ion translocation mechanism (for review, see Refs. 27 and 43). The H-K-ATPase beta -subunit (HKbeta ) associates with the HKalpha 1 subunit and functions in trafficking of the enzyme to the plasma membrane (28), its recovery from the membrane (17), and modulation of activity (13). Expression of the gastric HKbeta subunit has been localized in the kidney from the connecting segment through the medullary collecting duct (10, 11). Recently, it has been demonstrated that the Na-K-ATPase beta 1 subunit is associated with the HKalpha 2 subunits in both colon and kidney (14, 31).

Transcripts for three distinct HKalpha subunits have been reported in the rat kidney. In general, the localization of mRNA encoding the rat gastric HKalpha 1 subunit was similar to the distribution of the HKbeta subunit (1). The mRNA for colonic HKalpha 2a subunit was also detected in whole kidney tissue samples (18). Moreover, the mRNA for a possible human homolog of the HKalpha 2a subunit, ATP1AL1, was also found in the kidney (24, 36). Recently, rapid amplification of 5' cDNA ends (5'-RACE) has been employed to demonstrate that the rat kidney possesses not only the canonical HKalpha 2a mRNA, but also an alternatively spliced variant that encodes a truncated HKalpha 2b subunit (29). A partial cDNA has been reported for a rabbit cortical collecting duct (CCD) HKalpha 2 (22), but the PCR approach used to generate the cDNA was not designed to differentiate between the HKalpha 2a and other, then unknown, HKalpha 2 isoforms. The importance of identifying the H-K-ATPase isozymes present and their locations in the kidney has been emphasized by suggestions from several investigators that expression of the HKalpha 2 subunits is regulated in response to K+ depletion (3, 21, 29, 30, 34, 38).

The RCCT-28A transformed cell line was derived from immunodissected rabbit CCD by Arend et al. (4). Bello-Reuss (7) reported H-K-ATPase activity in RCCT-28A cells, observing an apical acidification mechanism that was sensitive to K+ removal and to two H-K-ATPase inhibitors, Sch-28080 and omeprazole. She also detected activities consistent with an apical H+-ATPase and a basolateral Cl-/HCO-3 exchanger. Band 3 protein and carbonic anhydrase, markers characteristic of acid-secreting intercalated cells, were present in these cells (39). The plasma membrane exhibited a Cl- conductance, but not Na+ or K+ conductance (20), distinguishing these cells from CCD principal cells. Thus RCCT-28A cells possess numerous characteristics typical of intercalated cells in the CCD.

In the present work, we report the full-length coding sequence of two HKalpha subunits from rabbit kidney and demonstrate their expression in renal cortex and RCCT-28A cells. To demonstrate basal H-K-ATPase activity, we examined the mechanisms of intracellular pH (pHi) recovery from an intracellular acid load. RCCT-28A cells displayed pHi recovery that was both K+ dependent and sensitive to Sch-28080. While generating a complete cDNA for rabbit cortex HKalpha 2a, a putative alternatively spliced variant was found. This rabbit variant differed from the HKalpha 2b alternatively spliced variant reported for rat (29), and we have designated the new subunit HKalpha 2c. RT-PCR detected mRNAs for H-K-ATPase subunits, including HKalpha 1, HKalpha 2a, HKalpha 2c, and HKbeta in both kidney tissues and RCCT-28A cells. An antipeptide antibody specific for the HKalpha 2c isoform was used to detected the subunit. The results establish that multiple isoforms of H-K-ATPase, including the novel HKalpha 2c, reside within a single clonal cell line.


    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cell culture. The RCCT-28A cell line was derived from immunodissected rabbit renal CCD (4). These cells were the kind gift of Dr. William Spielman, and experiments were performed using cells between passages 11 and 31. Cells were grown in DMEM media supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. All media were bubbled overnight with a mixture of 5% CO2-21% O2-74% N2, then filter sterilized by use of a syringe-mounted filter. Cells were maintained in culture in tissue culture flasks at 37°C in a 5% CO2 atmosphere and were plated on Corning Costar Transwell collagen-coated semipermeable inserts for experiments. Cells were plated at a density of 2 × 105/cm2, grown for 2 days in media containing 10% FBS, and then shifted to 0.1% FBS for a period of 24 h prior to the experiment.

Measurement of pHi. The fluorescent, pH-sensitive dye 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF) was used to measure pHi (44). Cells were incubated at room temperature for a period of 30 min in solution 1 (Table 1) with the acetoxymethyl ester of BCECF (BCECF-AM; Molecular Probes, Eugene, OR) at a final concentration of 5 µM. A minimum of 5 min perfusion with solution 1 delivered at 37°C rinsed away BCECF-AM at the beginning of each experiment. Cells were excited at 440 and 490 nm, and emission was measured at 530 nm. Measurements were made at 30-s intervals. Fluorescence was detected by a Videoscope model KS-1381 image intensifier coupled to a Dage model 72 charge-coupled device camera. Images were digitized and stored to the hard disk of a personal computer using commercially available equipment (Image 1/FL software package; Universal Imaging, Westchester, PA), allowing subsequent analysis of single cells.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Solutions

During measurements, cells were constantly perfused at a rate of ~10 ml/min by HEPES-buffered solutions (Table 1) that were continuously bubbled with O2 and preheated to be delivered at a temperature of 37°C. Apical and basolateral sides were perfused simultaneously with identical solutions. Inhibitors were diluted into solutions immediately before experiments were begun. Cells were acid loaded using the NH4Cl prepulse technique. Briefly, cells were incubated with 20 mM ammonium chloride (equimolar substitution for NaCl) for 5 min, then ammonium chloride was removed from the perfused solution. Addition of inhibitors or K+ removal was done at the beginning of the NH4Cl prepulse. At the end of each protocol, ethylisopropylamiloride (EIPA) was removed from the perfusing solutions, and an increased rate of pHi recovery was used as a sign of cell viability. The EIPA stock solution was 1 mM dissolved in DMSO, and Sch-28080 was 10 mM dissolved in DMSO. EIPA was obtained from Research Biochemicals International (Natick, MA), and Sch-28080 was the kind gift of Dr. James Kaminski at Schering (Bloomfield, NJ). Calibration of the pHi measured by BCECF fluorescence was carried out by the high potassium-nigericin calibration technique of Thomas et al. (42). Buffer capacities were calculated according to the method of Boyarsky et al. (8)

Isolation of total RNA. New Zealand White rabbits were killed by decapitation, and the kidneys were removed immediately. Kidneys were sliced coronally, and cortex and medulla were separated. Tissues were Dounce homogenized, and total RNA was prepared from each tissue by the acid phenol method (12).

RT-PCR. RT-PCR was carried out as described by Davis et al. (19). Template for the RT-PCR reaction was 1 µg total RNA from rabbit renal cortex or RCCT-28A cells using random hexamers to prime the reverse transcription. PCR reactions were primed with pairs of oligonucleotides (10 µM) synthesized by the University of Florida Interdisciplinary Center for Biotechnology Research (UF ICBR) DNA Synthesis Core (Table 2). For amplification from rabbit renal cortex using degenerate oligonucleotides, thermal parameters of the PCR reactions included a 5-min 94°C presoak followed by denaturation at 94°C for 40 s, anneal at 55°C for 1 min, and extension at 72°C for 2 min, for a total of 30 cycles followed by a final extension of 5 min. For amplification from RCCT-28A cell RNA, thermal parameters of the reactions included a 2-min 94°C presoak followed by 40 cycles of denaturation at 94°C for 30 s and anneal/extension at 68°C for 1 min, with a final extension of 5 min. PCR products were cloned into the pCR II vector utilizing the TA Cloning Kit (Invitrogen, San Diego, CA). Sequencing of plasmids was carried out by the UF ICBR DNA Sequencing Core.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   PCR primer pairs

Rapid amplification of cDNA ends. 3'-RACE was carried out as described by Davis et al. (19). mRNA was prepared from rabbit renal cortex total RNA using the PolyATtract System (Promega, Madison, WI). Complementary strand was synthesized using the sense primer (TGCGGAAACTCTTCATCAGG, nucleotides 3079-3098 of the rabbit HKalpha 2a sequence). The PCR was performed as before for 40 cycles, and the products were cloned. The library of clones produced in this manner was screened using an oligonucleotide (CTCTACCCTGGCAGCTGGTG, nucleotides 3099-3118 of the rabbit HKalpha 2a sequence) 5' labeled using an enhanced chemiluminescence kit (ECL; Amersham, Arlington Heights, IL).

5'-RACE was performed using the Marathon cDNA Amplification Kit (Clontech, Palo Alto, CA) following manufacturer's instructions except as follows. RT reactions were carried out using 5.5 µg total RNA of rabbit renal cortex, incubated with the rabbit HKalpha 2 gene-specific primer TTGCCATCTCGCCCCTCCTT (nucleotides 121-102) for 30 min at 50°C, then at 55°C for 15 min. PCR reactions were carried out using the anchor primer included in the Marathon kit paired with gene-specific primer TATCTGTAGCTGCATGGTGCTCCAC (nucleotides 93-69).

Northern analysis. Northern blots were carried out following the procedures of Davis et al. (19). mRNA (1 µg per lane) underwent electrophoresis in a 1% agarose, 0.22 M formaldehyde denaturing gel. Following capillary transfer to nylon membrane (Hybond N, Amersham), membranes were probed with 32P-labeled probes prepared using the Megaprime kit (Amersham). The rabbit HKalpha 2a-specific probe corresponded to nucleotides 7-93 of the HKalpha 2a sequence (Table 2). The HKalpha 2c-specific probe corresponded to nucleotides 24-377 of HKalpha 2c. Following hybridization, three 20-min washes were done in 0.2× SSC (0.03 M NaCl, 3 mM sodium citrate), 0.1% SDS at 55°C. Autoradiography was carried out for 6 days using BioMax MS film and screens (Kodak, Rochester, NY).

Western analysis. Antipeptide antibodies were raised in chickens by Lofstrand Laboratories (Bethesda, MD). Peptides were synthesized and conjugated to keyhole limpet hemocyanin (UF ICBR Protein Core). Two peptides were used as immunogens. The first was designed based on a segment found in both HKalpha 2a and HKalpha 2c, and the second was based on a segment unique to HKalpha 2c. The peptide chosen within the common region corresponded to amino acids 18-37 in HKalpha 2a and 79-98 in HKalpha 2c (Fig. 1). The peptide chosen within the HKalpha 2c-specific region corresponded to amino acids 13-25.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   Amino termini of HKalpha 2a and HKalpha 2c proteins. Full sequences are GenBank accession nos. AF023128 and AF023129. For clarity, only the first 39 amino acids of HKalpha 2a and 100 amino acids of HKalpha 2c are shown. Locations of immunogenic peptides used to generate antibodies LLC25 and LLC27 within sequence are underlined and bold.

Membrane proteins were prepared by homogenization of tissue in 50 mM sucrose, 10 mM Tris · HCl, pH 7.4, 1 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride. Homogenate was subjected to centrifugation of 10 min at 1,000 g. The resulting supernatant underwent centrifugation at 10,000 g three times for 20 min each. Final centrifugation was for 1 h at 100,000 g. After discarding supernatant, we resuspended the pellet in 1 mM Tris · HCl, pH 7.4, 10 mM MgCl2, and 150 mM NaCl. Proteins were electrophoresed on 4-20% SDS-polyacrylamide reducing gels (Bio-Rad, Hercules, CA), 10 µg per lane. The proteins were transferred to Hybond nitrocellulose membrane (Amersham) using a Bio-Rad Transblot electrophoretic transfer cell as described by the manufacturer. Membranes were blocked overnight at 4°C in 10 mM Tris · HCl, pH 7.2, 150 mM NaCl, 0.1% Tween-20, and 5% Carnation nonfat dry milk. Primary antibodies were used at a dilution of 1:500, the rabbit anti-chicken horseradish peroxidase-conjugated IgY secondary antibody (Promega) was diluted 1:10,000. Detections of HKalpha 2 proteins were performed using the ECL system (Amersham) by allowing the reaction to run to completion. Immunizing peptide was used at a concentration of 25 µg/ml in peptide competition experiments. Apparent molecular masses were established using the High Range Molecular Weight Standards (Bio-Rad).

Statistical methods. pHi recovery rates for individual cells were calculated using least-squares linear regression. Rates were calculated for the period beginning 2 min after NH4Cl withdrawal. Data were collected for independent experiments involving separate passages of cells. pHi recovery rates for each experimental condition are presented as the means of the rates determined for the individual experiments ± SE. Cells without Na+/H+ exchange activity, defined as an increase in pHi recovery rate with EIPA removal, were classified as nonviable and excluded from analysis. P < 0.05 by Student's unpaired t-test was taken as significant.


    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

K+-dependent pHi regulation. Prior to engaging in the molecular analysis of the H-K-ATPases that exist in RCCT-28A cells, we needed to define the H-K-ATPase activity present in the cells. We examined the extent to which an H-K-ATPase contributed to pHi recovery from an acid load by BCECF fluorescence microscopy with digital video image analysis. An H-K-ATPase activity had been reported previously by other methods (7). The large contribution of the Na+/H+ exchanger to H+ extrusion normally obscures recovery by other mechanisms, so the potent amiloride analog EIPA was used to inhibit the Na+/H+ exchanger in these experiments.

To detect H-K-ATPase activity in RCCT-28A cells, K+-dependent recovery from an acid load was determined. A representative tracing of a cell acid loaded by an NH4Cl prepulse and the pHi recovery that was observed are shown in Fig. 2A. In a majority of RCCT-28A cells, significant EIPA-insensitive pHi recovery was seen using K+-containing solutions. For 136 cells from 6 independent passages of RCCT-28A cells, the mean recovery rate was 0.022 ± 0.005 pH units/min. The absence of K+ during the period following an acid load significantly inhibited pHi recovery (Fig. 2B). In five separate experiments (129 cells), the K+-independent pHi recovery rate averaged 0.004 ± 0.002 pH units/min (P < 0.01 vs. 5 mM K+).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   Intracellular pH (pHi) recovery from an acid load by RCCT-28A cells. A: pHi recovery from an acid load by a K+-dependent, ethylisopropylamiloride (EIPA)-insensitive mechanism. Recovery toward physiological pH is seen in presence of K+ in a representative tracing of pHi in an individual cell. Periods during which solutions contain 20 mM NH4Cl and 1 µM EIPA are indicated. B: pHi recovery from an acid load by a K+-independent, EIPA-insensitive mechanism. Negligible recovery toward physiological pHi is seen in absence of K+ in a representative tracing of pHi in an individual cell. C: pHi recovery from an acid load by a Sch-28080-sensitive, EIPA-insensitive mechanism. Negligible recovery toward physiological pHi is seen in presence of the H-K-ATPase inhibitor Sch-28080 in a representative tracing of pHi in an individual cell.

In the prolonged absence of potassium, a delayed increase in the pHi recovery rate was observed (data not shown), consistent with a delayed stimulation of H+-ATPase. These results are consistent with previous results by Hays and Alpern (26), who described an H+-ATPase activity that was delayed following an NH4Cl prepulse. Bello-Reuss (7) also detected H+-ATPase as well as H-K-ATPase activity in RCCT-28A cells.

pHi recovery rates are influenced by the degree of intracellular acid loading and by buffer capacity. Actual nadir pHi values observed in these experiments in the presence and absence of K+ were not significantly different [6.64 ± 0.06 and 6.59 ± 0.08, respectively; P = not significant (NS)]. No significant difference in buffer capacities in the presence of K+ and absence of K+ was seen (15 ± 1 and 16 ± 1 meq H+ · pHi unit-1 · liter cell volume-1, respectively; P = NS). Consequently, differences in pHi recovery rates found in our experiments indicated differences in H+ extrusion.

To test the hypothesis that K+-dependent pHi recovery from an acid load resulted from H-K-ATPase activity, the effect of the classic H-K-ATPase inhibitor Sch-28080 (10 µM) on RCCT-28A cell pHi regulation was examined (Fig. 2C). Using this protocol, 109 cells from 4 separate cell preparations had a mean recovery rate of 0.002 ± 0.002 pH units/min (P < 0.05 vs. 5 mM K+, P = NS vs. 0 mM K+) in the presence of 10 µM Sch-28080. The buffer capacity of 16 ± 2 meq H+ · pHi unit-1 · liter cell volume-1 and the nadir pHi of 6.54 ± 0.03 were not significantly different from those measured in the absence of Sch-28080 (P = NS).

In summary, either the presence of the H-K-ATPase inhibitor Sch-28080 or the absence of K+ virtually abolished EIPA-insensitive pHi recovery from an acid load in RCCT-28A cells (Fig. 3). These results confirm the presence of H-K-ATPase activity in RCCT-28A cells.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Summary of the rates of pHi recovery from an acid load. Mean rates of recovery are indicated by open (presence of K+), solid (absence of K+), and stippled (in presence of Sch-28080 with K+ present) bars. * P < 0.01 vs. 5 mM K+. ** P < 0.05 vs. 5 mM K+, P = NS vs. 0 K+.

Generation of a rabbit HKalpha 2 cDNA. To define the molecular identity of HKalpha isoforms present in RCCT-28A cells, it was first necessary to find the nucleotide sequence of those isoforms present in rabbit renal cortex. Although a complete sequence for the rabbit HKalpha 1 cDNA was available (5), only a partial nucleotide sequence has been reported for the rabbit HKalpha 2 cDNA (22). Degenerate oligonucleotides designed to prime amplification reactions at sites that are highly conserved among P-type ATPases were used to obtain a cDNA fragment of HKalpha 2 from rabbit renal cortex RNA. These oligonucleotides were specifically designed to yield RT-PCR products from any HKalpha subunit mRNA present in the rabbit renal cortex. Only products representing Na-K-ATPase alpha 1- and HKalpha 2-like messages were found. Thus our next goal was to determine the complete coding sequence for the rabbit HKalpha 2 cDNA. Using the sequence information found in this manner, subsequent RT-PCR reactions were carried out in which one primer of a pair was gene specific and the other was a degenerate primer designed using conserved regions of P-type ATPases. Outside the coding region, conservation between members of the P-type ATPase gene family declines, so 3'- and 5'-RACE was carried out to extend the sequence to the 3' and 5' ends.

Two rabbit renal HKalpha 2 cDNA sequences were found in this manner, having 4,035 bases in common at the 3' end but different at the 5' end. One of the 5' ends had a high degree of homology to the human and rat HKalpha 2a cDNAs, and this clone was designated as the rabbit HKalpha 2a. The other was a novel sequence named HKalpha 2c. These sequences have been submitted to GenBank (accession nos. AF023128 and AF023129). A segment of the shared 3' portion of the sequences was identical to the 1,456-bp sequence obtained by Fejes-Toth et al. (22) except for two single base mismatches (Cright-arrowT at nucleotide 2927, which does not change the primary protein sequence, and Gright-arrowT at nucleotide 3259, in the 3'-untranslated region). The rabbit HKalpha 2a nucleotide sequence was 86% identical to human ATP1AL1 and 83% to rat HKalpha 2 cDNAs, whereas identity of HKalpha 2a to rabbit HKalpha 1 was only 67%. The deduced amino acid sequence shared 93% similarity with human ATP1AL1, 93% similarity with rat HKalpha 2, but merely 80% with rabbit HKalpha 1.

However, the 5' end of the rabbit HKalpha 2c differed dramatically from the rat HKalpha 2a and HKalpha 2b sequences (29). Rabbit HKalpha 2c cDNA lacked the start ATG codon corresponding to that present in the rat and human HKalpha 2a sequences. The new probable start codon was located upstream in frame with the HKalpha 2 open-reading frame. Thus the deduced amino acid sequence of the HKalpha 2c appeared to be 61 amino acids longer at the amino terminal end than the rabbit HKalpha 2a subunit (Fig. 1). This extension and the 5'-untranslated region bore no homology to the comparable segments from the HKalpha 2 cDNA from rat or to any GenBank sequence. It may represent an alternative splicing product; the sequence homology diverges from the human HKalpha 2 sequence at a point known in the human ATP1AL1 gene to be a splice junction (nucleotide 177 of ATP1AL1) (41).

Detection of H-K-ATPase mRNAs in RCCT-28A cells. We examined whether the RCCT-28A cells possessed mRNA for the H-K-ATPase alpha - and beta -subunits. RT-PCR products were generated and sequenced using RCCT-28A cell total RNA as a template. The presence of HKbeta subunit mRNA was observed by amplification of a 570-bp cDNA corresponding to nucleotides 304-873 of the sequence of rabbit gastric HKbeta (37) (Fig. 4). Nucleotide sequencing of the RCCT-28A product confirmed that the amplified product was identical to the rabbit HKbeta subunit mRNA.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4.   HKbeta subunit mRNA in RCCT-28A cells. RT-PCR products amplified from RNA derived from RCCT-28A cells and rabbit renal cortex tissue were separated by agarose gel electrophoresis and stained with ethidium bromide. The -RT lanes depict negative controls in which RT was omitted from reactions to show that the RNA template was free of contaminants; +RT lanes show products amplified using a primer pair designed to amplify a 570-bp fragment of HKbeta subunit mRNA.

A similar strategy was employed to show that HKalpha 1 was present in the RCCT-28A cells. Primers were designed to amplify a 611-bp region of HKalpha 1 mRNA (nucleotides 2537-3147), and again a product of the expected size was observed (Fig. 5). The nucleotide sequence was identical to that reported by Bamberg et al. (5) except for two single base mismatches (Gright-arrowA at nucleotide 2567 and Gright-arrowC at nucleotide 3089; neither affects the deduced amino acid sequence).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   HKalpha 1 subunit mRNA in RCCT-28A cells. RT-PCR products amplified from RNA derived from RCCT-28A cells and rabbit renal cortex tissue were separated by agarose gel electrophoresis and stained with ethidium bromide. The -RT lanes depict negative controls in which RT was omitted from reactions to show that the RNA template was free of contaminants; +RT lanes show products amplified using a primer pair designed to amplify a 611-bp fragment of HKalpha 1 subunit mRNA.

For HKalpha 2 mRNA, a primer pair yielded the anticipated product of 306 bp, which was identical to nucleotides 1264-1569 of the HKalpha 2a sequence, contained in the region common to HKalpha 2a and HKalpha 2c (Fig. 6A). To determine whether HKalpha 2a and HKalpha 2c isoforms are both present in RCCT-28A cells, primer pairs were designed that amplify regions specific to each isoform. HKalpha 2a-specific primers amplify an 87-bp RT-PCR product (nucleotides 7-93 in the HKalpha 2a sequence) from RCCT-28A cellular RNA, and sequencing showed the product to be identical to the sequence of the HKalpha 2a cDNA from rabbit cortex (Fig. 6B). A product of 354 bp (nucleotides 24-377 in the HKalpha 2c sequence) was amplified using both RCCT-28A cell and rabbit renal cortex mRNA as templates (Fig. 6C).


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6.   HKalpha 2 subunit mRNA in RCCT-28A cells. RT-PCR products amplified from RNA derived from RCCT-28A cells and rabbit renal cortex tissue were separated by agarose gel electrophoresis and stained with ethidium bromide. The -RT lanes depict negative controls in which RT was omitted from reactions to show that the RNA template was free of contaminants. +RT lanes show products amplified using a primer pair designed to amplify a 306-bp fragment of HKalpha 2 subunit mRNA (A), an 87-bp fragment of HKalpha 2a subunit mRNA (B), and a 354-bp fragment of HKalpha 2c subunit mRNA (C).

Therefore, RCCT-28A cells contained the mRNAs encoding all three HKalpha subunits and the HKbeta subunit. Since RCCT-28A cells are a clonal cell line, individual cells appear to express at least three different H-K-ATPases.

Detection of H-K-ATPase mRNAs in rabbit distal colon and renal cortex. Northern analysis was used to detect the presence of HKalpha 2 mRNAs in rabbit tissues. A probe specific for the 5'-untranslated region of HKalpha 2a hybridized at high level to distal colonic mRNA and to mRNA derived from renal cortex at a much lower level (Fig. 7A). In fact, it was necessary to overexpose the blot with respect to the colon tissue mRNA lanes to detect any signal in the kidney mRNA lanes. Another probe specific to the HKalpha 2c 5'-untranslated region hybridized to mRNA isolated from distal colon, but any hybridization to mRNA from renal cortex was apparently below detectable levels (Fig. 7B). As shown above (Fig. 6), HKalpha 2c mRNA was detectable by RT-PCR using renal cortex as template.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7.   HKalpha 2 subunit mRNA. mRNA isolated from rabbit distal colon and renal cortex hybridized by probes specific for HKalpha 2a (A) and HKalpha 2c (B). No hybridization was observed when renal cortex mRNA was probed with the HKalpha 2c-specific fragment.

Detection of the HKalpha 2c subunit. Although the HKalpha 2c cDNA indicated a continuous open-reading frame including the amino-terminal extension, the possibility remained that translation might be initiated at the ATG codon homologous to that reported for the rat HKalpha 2b (29). Therefore, to determine whether the upstream ATG served as a translational start site, antipeptide antibodies were generated for peptides corresponding to amino acids 13-25 and 79-98 of the HKalpha 2c subunit. The former (antibody LLC27) was HKalpha 2c specific, whereas the latter (antibody LLC25) recognized a segment common to both HKalpha 2a and HKalpha 2c subunits. Western analyses of rabbit kidney tissues using antibody LLC25 revealed a doublet migrating at an apparent molecular mass of ~90 kDa (Fig. 8A). Experiments using the HKalpha 2c-specific antibody LLC27 indicated a single band with a migration comparable to the upper band of the doublet (Fig. 8B). Although we have not yet achieved separation of HKalpha 2a and HKalpha 2c proteins on immunoblots of membrane proteins from RCCT-28A cells, both antibodies recognize a protein of the correct mobility (Fig. 9). This provides strong evidence that the HKalpha 2c subunit containing the amino-terminal extension was indeed present in both rabbit renal tissue and RCCT-28A cells.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 8.   HKalpha 2 subunit protein in renal cortex. Western analysis of membrane protein fractions derived from rabbit renal cortex was carried out by running all samples on the same gel for optimal comparison. After electrotransfer, the membrane was cut, and A and B were each probed with the antibodies indicated. A: antibody to HKalpha 2 proteins (LLC25) detects a doublet indicating the two expected species of HKalpha 2 protein. B: antibody to HKalpha 2c amino-terminal extension (LLC27) detects a single reactive protein at the same apparent mass as the larger species shown in A. Additional bands were visualized at lower molecular weights. No degradation products were consistently observed with different preparations of antibodies. No reactivity was seen to preimmune serum. Preabsorption with immunizing peptide blocked antibody reactivity.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 9.   HKalpha 2 subunit protein in RCCT-28A cells. Western analysis of membrane protein fractions derived from RCCT-28A cells is shown. A: antibody to HKalpha 2 proteins (LLC25) detects a protein near the predicted mass for HKalpha 2 proteins. B: antibody to HKalpha 2c amino-terminal extension (LLC27) detects a reactive protein at the same apparent mass as the HKalpha 2 common antibody (LLC25).


    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

We have generated complete cDNAs for both the rabbit renal HKalpha 2a and the novel HKalpha 2c subunits. mRNAs corresponding to these cDNAs were detected in rabbit distal colon and renal cortex. Proteins corresponding to both HKalpha 2 isoforms were detected by immunoblot analysis, indicating that the novel HKalpha 2c has the predicted amino-terminal extension. HKalpha 1 protein has been previously detected by immunohistochemistry in CCD intercalated cells (6, 47). We also demonstrated that RCCT-28A cells express the HKbeta subunit, the HKalpha 1 subunit, and both isoforms of the HKalpha 2 subunit. The presence of multiple H-K-ATPase isoforms in a clonal cell line derived from CCD is the first evidence that several isozymes of H-K-ATPase may contribute to net activity in a single cell.

The finding that the three forms of the catalytic subunit are all present in a clonal cell line derived from CCD suggests that multiple H-K-ATPase isoforms exist in a single cell type in the CCD. Presence of mRNA for HKalpha 1, HKalpha 2a, and HKalpha 2c isoforms in the RCCT-28A cell line is consistent with previous studies finding the presence of multiple H-K-ATPase catalytic subunit isoforms in the kidney (1-3, 18, 21, 22, 25, 32, 34). Expression of multiple HKalpha subunits within a cell suggests the possibility of greater complexity associated with formation of hybrid H-K-ATPases containing two different catalytic subunits. Moreover, an additional level of complexity appears with the consideration that HKalpha 2 subunits are capable of forming stable complexes with both the HKbeta and the Na-K-ATPase beta 1-subunits (15).

Our results demonstrate the presence of Sch-28080-sensitive H-K-ATPase activity in RCCT-28A cells. These observations are consistent with the findings of Bello-Reuss (7). Although Sch-28080 inhibits the gastric H-K-ATPase, the inhibition observed in this study using very low concentrations of Sch-28080 does not necessarily indicate that HKalpha 1-containing H-K-ATPases account solely for the activity in RCCT-28A cells. The reported pharmacological properties of the non-gastric H-K-ATPases containing the rat HKalpha 2a and human ATP1AL1 subunits vary widely. For example, studies in heterologous expression systems have reported that the HKalpha 2a-containing H-K-ATPase is insensitive to Sch-28080 (15, 16), whereas the ATP1AL1 pump is sensitive to high concentrations of the inhibitor (35), and both have been reported to be Sch-28080 sensitive at much lower concentrations of Sch-28080 (23, 33). These same studies also report differing results using ouabain. Since the rabbit HKalpha 2a sequence reported here has essentially equivalent homology to both rat HKalpha 2a and human ATP1AL1 cDNAs, there is no basis for predicting the pharmacological properties of the pump in RCCT-28A cells. An interesting study by Buffin-Meyer et al. (9) reported a decrease in sensitivity of H-K-ATPase activity to Sch-28080 in the CCD between rats fed a normal diet and K+-depleted rats. Whether this reflects expression of differing isozymes of H-K-ATPase in the K+-depleted state or mobilization of existing pumps has not yet been defined.

The rabbit renal cortex HKalpha 2 cDNAs reported here have high homology to rat HKalpha 2 and human ATP1AL1 sequences (18, 24). The level of homology is relatively low compared with the homology typically found when comparing HKalpha 1 or Na-K-ATPase alpha -subunits across mammalian species. However, it is much higher than the homology between the rat HKalpha 1 and HKalpha 2 cDNAs (18) or among the different Na-K-ATPase isoforms within a species. If the rat HKalpha 2 isoforms, the human ATP1AL1 protein, and the rabbit HKalpha 2 subunits are products of homologous genes in the different species, then the genes appear to have undergone greater evolutionary divergence than HKalpha 1 or the Na-K-ATPase catalytic isoforms.

Like the rat, the rabbit appears to have alternatively spliced transcripts of HKalpha 2 in the kidney. The organization of the rat alternatively spliced HKalpha 2b cDNA (29) omitted the exon containing the start codon of the sequence previously reported for rat distal colon HKalpha 2a cDNA (18), giving rise to a protein truncated by 108 amino acids at the amino-terminal end. The rabbit HKalpha 2c sequence also omits the start codon present in the HKalpha 2a sequence. However, an upstream 5' ATG codon lies in the same uninterrupted reading frame as the coding sequence for HKalpha 2, so initiation of translation at this position yields a subunit having an extended amino terminus 61 amino acids longer than the HKalpha 2a protein. Western analysis demonstrated that a protein having this extension is present in rabbit kidney and the RCCT-28A cell line.

The HKalpha 2c extension is hydrophilic in nature and lacks any conspicuous membrane-spanning domains. Because the amino terminus of H-K-ATPase catalytic subunits are cytosolic (40), the extension can be expected to have a cytosolic location. Chou-Fasman calculations predict this segment to be predominantly alpha -helical with a turn in a region containing seven prolines between amino acids 26-40. A similarly proline-rich hinge region is found in the band 3 protein, and an ankyrin-binding site has been localized to that site within band 3 (45). The extended portion of the HKalpha 2c protein contains a casein kinase II phosphorylation motif at Thr12, and a cAMP-dependent protein kinase phosphorylation motif at Thr53. These sites impart a potential for differential regulation of H-K-ATPases containing the HKalpha 2a and HKalpha 2c subunits.

Why are there three different H-K-ATPase isozymes in a cell line derived from an intercalated cell from the CCD? One possibility is to provide a means to respond to different signals and signal transduction systems governing H+ and K+ homeostasis. These adjustments might occur at the level of transcription of the HKalpha 2 gene, by intracellular trafficking of the pumps or by differential modification of the HKalpha 2a- and HKalpha 2c-containing H-K-ATPases.


    ACKNOWLEDGEMENTS

We gratefully acknowledge Dr. Bruce C. Kone, University of Texas Medical School, for providing sequence information prior to publication, and Amy E. Milton and April R. Starker, for technical assistance.


    FOOTNOTES

This work was supported by Grant-in-Aid 95011160 from the American Heart Association (to B. D. Cain), by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-45788 (to I. D. Weiner) and DK-49750 (to C. S. Wingo), and by a Merit Review Grant from the Department of Veterans Affairs (to I. D. Weiner).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: B. D. Cain, Dept. of Biochemistry and Molecular Biology, Univ. of Florida, JHMHC 100245, Gainesville, FL 32610.

Received 1 May 1998; accepted in final form 8 October 1998.


    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Ahn, K. Y., and B. C. Kone. Expression and cellular localization of mRNA encoding the "gastric" isoform of H+-K+-ATPase alpha -subunit in rat kidney. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F99-F109, 1995[Abstract/Free Full Text].

2.   Ahn, K. Y., K. Y. Park, K. K. Kim, and B. C. Kone. Chronic hypokalemia enhances expression of the H+-K+-ATPase alpha 2-subunit gene in renal medulla. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F314-F321, 1996[Abstract/Free Full Text].

3.   Ahn, K. Y., P. B. Turner, K. M. Madsen, and B. C. Kone. Effects of chronic hypokalemia on renal expression of the "gastric" H+-K+-ATPase alpha -subunit gene. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F557-F566, 1996[Abstract/Free Full Text].

4.   Arend, L. J., J. S. Handler, J. S. Rhim, F. Gusovsky, and W. S. Spielman. Adenosine-sensitive phosphoinositide turnover in a newly established renal cell line. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F1067-F1074, 1989[Abstract/Free Full Text].

5.   Bamberg, K., F. Mercier, M. A. Reuben, Y. Kobayashi, K. B. Munson, and G. Sachs. cDNA cloning and membrane topology of the rabbit gastric H+/K(+)-ATPase alpha -subunit. Biochim. Biophys. Acta 1131: 69-77, 1992[Medline].

6.   Bastani, B. Colocalization of H-ATPase and H,K-ATPase immunoreactivity in the rat kidney. J. Am. Soc. Nephrol. 5: 1476-1482, 1995[Abstract].

7.   Bello-Reuss, E. Characterization of acid-base transport mechanisms in the kidney cell line RCCT-28A. Kidney Int. 43: 173-181, 1993[Medline].

8.   Boyarsky, G., M. B. Ganz, R. B. Sterzel, and W. F. Boron. pH regulation in single glomerular mesangial cells. I. Acid extrusion in absence and presence of HCO-3. Am. J. Physiol. 255 (Cell Physiol. 24): C844-C856, 1988[Abstract/Free Full Text].

9.   Buffin-Meyer, B., M. Younes-Ibrahim, C. Barlet-Bas, L. Cheval, S. Marsy, and A. Doucet. K depletion modifies the properties of Sch-28080-sensitive K-ATPase in rat collecting duct. Am. J. Physiol. 272 (Renal Physiol. 41): F124-F131, 1997[Abstract/Free Full Text].

10.   Callaghan, J. M., S.-S. Tan, M. A. Khan, K. A. Curran, W. G. Campbell, A. J. Smolka, B.-H. Toh, P. A. Gleeson, C. S. Wingo, B. D. Cain, and I. R. van Driel. Renal expression of the gene encoding the gastric H+-K+-ATPase beta -subunit. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F363-F374, 1995[Abstract/Free Full Text].

11.   Campbell-Thompson, M. L., J. W. Verlander, K. A. Curran, W. G. Campbell, B. D. Cain, C. S. Wingo, and J. E. McGuigan. In situ hybridization of H-K-ATPase beta -subunit mRNA in rat and rabbit kidney. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F345-F354, 1995[Abstract/Free Full Text].

12.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

13.   Chow, D. C., and J. G. Forte. Characterization of the beta -subunit of the H+-K+-ATPase using an inhibitory monoclonal antibody. Am. J. Physiol. 265 (Cell Physiol. 34): C1562-C1570, 1993[Abstract/Free Full Text].

14.   Codina, J., J. T. Delmas-Mata, and T. D. DuBose, Jr. The subunit of the colonic H+,K+-ATPase assembles with beta 1-Na+,K+-ATPase in kidney and distal colon. J. Biol. Chem. 273: 7894-7899, 1998[Abstract/Free Full Text].

15.   Codina, J., B. C. Kone, J. T. Delmas Mata, and T. D. DuBose, Jr. Functional expression of the colonic H+,K+-ATPase alpha -subunit. Pharmacologic properties and assembly with X+,K+-ATPase beta -subunits. J. Biol. Chem. 271: 29759-29763, 1996[Abstract/Free Full Text].

16.   Cougnon, M., G. Planelles, M. S. Crowson, G. E. Shull, B. C. Rossier, and F. Jaisser. The rat distal colon P-ATPase alpha subunit encodes a ouabain-sensitive H+,K+-ATPase. J. Biol. Chem. 271: 7277-7280, 1996[Abstract/Free Full Text].

17.   Courtois-Coutry, N., D. Roush, V. Rajendran, J. B. McCarthy, J. Geibel, M. Kashgarian, and M. J. Caplan. A tyrosine-based signal targets H/K-ATPase to a regulated compartment and is required for the cessation of gastric acid secretion. Cell 90: 501-510, 1997[Medline].

18.   Crowson, M. S., and G. E. Shull. Isolation and characterization of a cDNA encoding the putative distal colon H+,K+-ATPase. Similarity of deduced amino acid sequence to gastric H+,K(+)-ATPase and Na+,K+-ATPase and mRNA expression in distal colon, kidney, and uterus. J. Biol. Chem. 267: 13740-13748, 1992[Abstract/Free Full Text].

19.   Davis, L. G., W. M. Kuehl, and J. F. Battey. Basic Methods in Molecular Biology (2nd ed.). Norwalk, CT: Appleton and Lange, 1994.

20.   Dietl, P., N. Kizer, and B. A. Stanton. Conductive properties of a rabbit cortical collecting duct cell line: regulation by isoproterenol. Am. J. Physiol. 262 (Renal Fluid Electrolyte Physiol. 31): F578-F582, 1992[Abstract/Free Full Text].

21.   DuBose, T. D., Jr., J. Codina, A. Burges, and T. A. Pressley. Regulation of H+-K+-ATPase expression in kidney. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F500-F507, 1995[Abstract/Free Full Text].

22.   Fejes-Toth, G., E. Rusvai, K. A. Longo, and A. Naray-Fejes-Toth. Expression of colonic H-K-ATPase mRNA in cortical collecting duct: regulation by acid/base balance. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F551-F557, 1995[Abstract/Free Full Text].

23.   Grishin, A. V., M. O. Bevensee, N. N. Modyanov, V. Rajendran, W. F. Boron, and M. J. Caplan. Functional expression of the cDNA encoded by the human ATP1AL1 gene. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F539-F551, 1996[Abstract/Free Full Text].

24.   Grishin, A. V., V. E. Sverdlov, M. B. Kostina, and N. N. Modyanov. Cloning and characterization of the entire cDNA encoded by ATP1AL1: a member of the human Na,K/H,K-ATPase gene family. FEBS Lett. 349: 144-150, 1994[Medline].

25.   Guntupalli, J., M. Onuigbo, S. Wall, R. J. Alpern, and T. D. DuBose, Jr. Adaptation to low-K+ media increases H+-K+-ATPase but not H+-ATPase-mediated pHi recovery in OMCD1 cells. Am. J. Physiol. 273 (Cell Physiol. 42): C558-C571, 1997[Abstract/Free Full Text].

26.   Hays, S. R., and R. J. Alpern. Inhibition of Na+-independent H+ pump by Na+-induced changes in cell Ca2+. J. Gen. Physiol. 98: 791-813, 1991[Abstract/Free Full Text].

27.   Hersey, S. J., and G. Sachs. Gastric acid secretion. Physiol. Rev. 75: 155-189, 1995[Free Full Text].

28.   Horisberger, J. D., P. Jaunin, M. A. Reuben, L. S. Lasater, D. C. Chow, J. G. Forte, G. Sachs, B. C. Rossier, and K. Geering. The H,K-ATPase beta-subunit can act as a surrogate for the beta-subunit of Na,K-pumps. J. Biol. Chem. 266: 19131-19134, 1991[Abstract/Free Full Text].

29.   Kone, B. C., and S. C. Higham. A novel N-terminal splice variant of the rat H+-K+-ATPase alpha 2 subunit. J. Biol. Chem. 273: 2543-2552, 1998[Abstract/Free Full Text].

30.   Kraut, J. A., J. Hiura, M. Besancon, A. Smolka, G. Sachs, and D. Scott. Effect of hypokalemia on the abundance of HKalpha 1 and HKalpha 2 protein in the rat kidney. Am. J. Physiol. 272 (Renal Physiol. 41): F744-F750, 1997[Abstract/Free Full Text].

31.   Kraut, J. A., J. Hiura, J. M. Shin, A. Smolka, G. Sachs, and D. Scott. The Na+-K+-ATPase beta 1 subunit is associated with the HKalpha 2 protein in the rat kidney. Kidney Int. 53: 958-962, 1998[Medline].

32.   Kraut, J. A., F. Starr, G. Sachs, and M. Reuben. Expression of gastric and colonic H+-K+-ATPase in the rat kidney. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F581-F587, 1995[Abstract/Free Full Text].

33.   Lee, J., V. M. Rajendran, A. S. Mann, M. Kashgarian, and H. J. Binder. Functional expression and segmental localization of rat colonic K-adenosine triphosphatase. J. Clin. Invest. 96: 2002-2008, 1995.

34.   Marsy, S., J. M. Elalouf, and A. Doucet. Quantitative RT-PCR analysis of mRNAs encoding a colonic putative H,K-ATPase alpha subunit along the rat nephron: effect of K+ depletion. Pflügers Arch. 432: 494-500, 1996[Medline].

35.   Modyanov, N. N., P. M. Mathews, A. V. Grishin, P. Beguin, A. T. Beggah, B. C. Rossier, J. D. Horisberger, and K. Geering. Human ATP1AL1 gene encodes a ouabain-sensitive H-K-ATPase. Am. J. Physiol. 269 (Cell Physiol. 38): C992-C997, 1995[Abstract/Free Full Text].

36.   Modyanov, N. N., K. E. Petrukhin, V. E. Sverdlov, A. V. Grishin, M. Y. Orlova, M. B. Kostina, O. I. Makarevich, N. E. Broude, G. S. Monastyrskaya, and E. D. Sverdlov. The family of human Na,K-ATPase genes. ATP1AL1 gene is transcriptionally competent and probably encodes the related ion transport ATPase. FEBS Lett. 278: 91-94, 1991[Medline].

37.   Reuben, M. A., L. S. Lasater, and G. Sachs. Characterization of a beta subunit of the gastric H+/K(+)-transporting ATPase. Proc. Natl. Acad. Sci. USA 87: 6767-6771, 1990[Abstract/Free Full Text].

38.   Sangan, P., V. M. Rajendran, A. S. Mann, M. Kashgarian, and H. J. Binder. Regulation of colonic H-K-ATPase in large intestine and kidney by dietary Na depletion and dietary K depletion. Am. J. Physiol. 272 (Cell Physiol. 41): C685-C696, 1997[Abstract/Free Full Text].

39.   Schwiebert, E. M., K. H. Karlson, P. A. Friedman, P. Dietl, W. S. Spielman, and B. A. Stanton. Adenosine regulates a chloride channel via protein kinase C and a G protein in a rabbit cortical collecting duct cell line. J. Clin. Invest. 89: 834-841, 1992.

40.   Smolka, A., and K. M. Swiger. Site-directed antibodies as topographical probes of the gastric H,K-ATPase alpha-subunit. Biochim. Biophys. Acta 1108: 75-85, 1992[Medline].

41.   Sverdlov, V. E., M. B. Kostina, and N. N. Modyanov. Genomic organization of the human ATP1AL1 gene encoding a ouabain-sensitive H,K-ATPase. Genomics 32: 317-327, 1996[Medline].

42.   Thomas, J. A., R. N. Buchsbaum, A. Zimniak, and E. Racker. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 18: 2210-2218, 1979[Medline].

43.   Van Driel, I. R., and J. M. Callaghan. Proton and potassium transport by H+/K(+)-ATPases. Clin. Exp. Pharmacol. Physiol. 22: 952-960, 1995[Medline].

44.   Weiner, I. D., and L. L. Hamm. Use of fluorescent dye BCECF to measure intracellular pH in cortical collecting tubule. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F957-F964, 1989[Abstract/Free Full Text].

45.   Willardson, B. M., B. J. Thevenin, M. L. Harrison, W. M. Kuster, M. D. Benson, and P. S. Low. Localization of the ankyrin-binding site on erythrocyte membrane protein, band 3. J. Biol. Chem. 264: 15893-15899, 1989[Abstract/Free Full Text].

46.   Wingo, C. S., and B. D. Cain. The renal H-K-ATPase: physiological significance and role in potassium homeostasis. Annu. Rev. Physiol. 55: 323-347, 1993[Medline].

47.   Wingo, C. S., and A. J. Smolka. Function and structure of H-K-ATPase in the kidney. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F1-F16, 1995[Abstract/Free Full Text].


Am J Physiol Renal Physiol 276(2):F237-F245



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
I. J. Lynch, A. Rudin, S.-L. Xia, L. R. Stow, G. E. Shull, I. D. Weiner, B. D. Cain, and C. S. Wingo
Impaired acid secretion in cortical collecting duct intercalated cells from H-K-ATPase-deficient mice: role of HK{alpha} isoforms
Am J Physiol Renal Physiol, March 1, 2008; 294(3): F621 - F627.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Zhang, X. Xia, L. Zou, X. Xu, G. D. LeSage, and B. C. Kone
In vivo expression profile of a H+-K+-ATPase {alpha}2-subunit promoter-reporter transgene
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1171 - F1177.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
W. Zhang, T. Kuncewicz, S. C. Higham, and B. C. Kone
Structure, Promoter Analysis, and Chromosomal Localization of the Murine H+/K+-ATPase {alpha}2 Subunit Gene
J. Am. Soc. Nephrol., December 1, 2001; 12(12): 2554 - 2564.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Burnay, G. Crambert, S. Kharoubi-Hess, K. Geering, and J.-D. Horisberger
Bufo marinus bladder H-K-ATPase carries out electroneutral ion transport
Am J Physiol Renal Physiol, November 1, 2001; 281(5): F869 - F874.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. A. Kraut, K. G. Helander, H. F. Helander, N. D. Iroezi, E. A. Marcus, and G. Sachs
Detection and localization of H+-K+-ATPase isoforms in human kidney
Am J Physiol Renal Physiol, October 1, 2001; 281(4): F763 - F768.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Fejes-Toth and A. Naray-Fejes-Toth
Immunohistochemical localization of colonic H-K-ATPase to the apical membrane of connecting tubule cells
Am J Physiol Renal Physiol, August 1, 2001; 281(2): F318 - F325.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. W. Verlander, R. M. Moudy, W. G. Campbell, B. D. Cain, and C. S. Wingo
Immunohistochemical localization of H-K-ATPase alpha 2c-subunit in rabbit kidney
Am J Physiol Renal Physiol, August 1, 2001; 281(2): F357 - F365.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Codina, J. Cardwell, J. J. Gitomer, Y. Cui, B. C. Kone, and T. D. Dubose Jr.
Sch-28080 depletes intracellular ATP selectively in mIMCD-3 cells
Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1319 - C1326.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. E. Frank, C. S. Wingo, and I. D. Weiner
Effects of ammonia on bicarbonate transport in the cortical collecting duct
Am J Physiol Renal Physiol, February 1, 2000; 278(2): F219 - F226.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
I. D. Weiner, A. E. Frank, and C. S. Wingo
Apical proton secretion by the inner stripe of the outer medullary collecting duct
Am J Physiol Renal Physiol, April 1, 1999; 276(4): F606 - F613.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. B. Pestov, T. V. Korneenko, G. Adams, M. Tillekeratne, M. I. Shakhparonov, and N. N. Modyanov
Nongastric H-K-ATPase in rodent prostate: lobe-specific expression and apical localization
Am J Physiol Cell Physiol, April 1, 2002; 282(4): C907 - C916.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campbell, W. G.
Right arrow Articles by Cain, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, W. G.
Right arrow Articles by Cain, B. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online