|
|
||||||||
Departments of Medicine, Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York 10461
| |
ABSTRACT |
|---|
|
|
|---|
Conserved from
fish to mammals, renal proximal tubule organic anion secretion plays an
important role in drug and xenobiotic elimination. Studies with the
model substrate p-aminohippurate (PAH)
have suggested that a basolateral PAH/
-ketoglutarate exchanger imports diverse organic substrates into the proximal tubule prior to
apical secretion. cDNAs encoding PAH transporters have been cloned
recently from rat and flounder. Here we report the cloning of a highly
similar human PAH transporter (hPAHT) from human kidney. By Northern
blot analysis and EST database searching, hPAHT mRNA was detected in
kidney and brain. PCR-based monochromosomal somatic cell hybrid mapping
placed the hPAHT gene on chromosome 11. When expressed transiently in
vitro, hPAHT catalyzed time-dependent and saturable
[3H]PAH uptake
(Km of ~5
µM). Preincubation with unlabeled
-ketoglutaric or with glutaric
acid stimulated tracer PAH uptake, and preincubation with unlabeled PAH
stimulated tracer
-ketoglutarate uptake, results that are consistent
with PAH/
-ketoglutarate exchange. Several structurally diverse
organic anions cis-inhibited PAH
uptake. Like rat OAT1 organic anion transporter, hPAHT was
inhibited by furosemide, indomethacin, probenecid, and
-ketoglutarate. Unlike OAT1, hPAHT was not inhibited by
prostaglandins or methotrexate (MTX). Moreover, tracer
PGE2 and MTX were not transported,
indicating that the substrate specificity for transport by hPAHT is not
broad. PAH uptake was inhibited by phorbol 12-myristate 13-acetate
(PMA) in a dose- and time-dependent fashion, but not by the inactive 4
-phorbol-12,13 didecanoate. PMA-induced inhibition was blocked by
staurosporine. Thus the protein kinase C-mediated inhibition of
basolateral organic anion entry previously reported in intact tubules
is likely due, at least in part, to direct modulation of the
PAH/
-ketoglutarate exchanger.
carrier proteins; biological transport; organic anion transport; hormonal control; renal secretion; p-aminohippurate; phorbol ester
| |
INTRODUCTION |
|---|
|
|
|---|
IT HAS BEEN RECOGNIZED since 1874 that the kidney secretes organic anions (13). Observed in almost all nonmammalian vertebrates and in crustaceans (28), secretion occurs in the late proximal tubule (snakes, most mammals), the early and mid-proximal tubule (frogs, pigs), or any portion of the proximal tubule (flounder) (7). Although the prototypical substrate is p-aminohippurate (PAH), many xenobiotics and drugs are also secreted (17, 23). The system has enormous clinical importance; for example, the pharmacokinetics of anionic drugs such as diuretics and penicillins depend in large part on renal tubular secretion (14).
Extensive rat micropuncture studies by Ullrich (36), in
which structurally diverse compounds competed with tracer PAH for peritubular uptake, resulted in a model in which a single transporter carries a broad range of aromatic and aliphatic compounds. Vesicle studies have shown that PAH is brought uphill across the basolateral membrane in exchange for
-ketoglutarate, the outward gradient of
which derives from Na-coupled uptake and the tricarboxylic acid
cycle (29, 33). Experiments using fish tubules indicate that the basolateral organic anion entry step can be downregulated by
protein kinase C (PKC). The apical exit step, less well understood, probably involves PAH/OH exchange (4, 32).
Several groups have recently expression-cloned cDNAs encoding rat (31,
34) and flounder (38) PAH transporters. These appear to function as
PAH/
-ketoglutarate exchangers and are
cis-inhibited by a broad array of
candidate substrates. However, other than PAH (which is transported;
see Refs. 31, 34, and 38), tetraethylammonium (which is not
transported; Ref. 34), and urate [which either is (31) or is not
(38) transported], direct testing of transport has been limited
to the report by Sekine et al. (31), in which cell-associated counts of
tracer methotrexate (MTX), cAMP, cGMP, PGE2, urate, and
-ketoglutarate
were substantially increased in
Xenopus oocytes that express the OAT1
organic ion transporter relative to control oocytes.
To understand further the molecular mechanisms of organic anion secretion in humans, to evaluate further the substrate specificity of the PAH transporter, and to test the hypothesis that the PAH transporter is directly regulated by PKC, we have cloned, expressed, and characterized a human kidney PAH transporter (hPAHT). Although hPAHT shares many characteristics with the rat PAH transporter, it demonstrates a substantially more narrow substrate specificity. Additionally, we provide evidence that hPAHT is acutely downregulated by PKC.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
EST database search, RT-PCR, and construction of a
full-length cDNA. The sequence of the rat PAH
transporter OAT1 (31) was used to find homologous sequences in the
GenBank EST database. Human fetal brain EST 36482, which
appeared to consist of most of the downstream human PAH transporter,
was obtained (Research Genetics). Clonality of the sample was achieved
by plating on LB agar, transferring to Nytran Plus nylon filters
(Schleicher & Schuell), and hybridizing overnight with a
[32P]dATP random
primer-labeled 5' PCR fragment generated as described below. The
final two washes after hybridization consisted of 0.1× SSC and
0.1% SDS at 65°C. Filters were exposed overnight to Kodak Omat
X-AR film at
70°C, and positive colonies were picked and confirmed by sequencing both strands. A corresponding cDNA was then
obtained from adult human kidney mRNA (0.5 µg, Clontech) using RT-PCR
and primers derived from the EST 36482 sequence at the extreme 5'
("P6": 5' CCGATGCCAACCTCAGCAAG) and 3' ("P11": 5' AGATGCTTTCCTGAACCACAACC) ends. PCR was performed using the Expand High-Fidelity system (Boehringer-Mannheim) as follows: initial
denaturation at 94°C for 1 min; 35 cycles of 94°C for 30 s,
60°C for 30 s, and 72°C for 1.5 min; and a final extension at
72°C for 10 min. The resulting 1.6-kb PCR product was subcloned into the TA cloning vector (Invitrogen) and was found to be identical upon sequencing to EST 36482 from human fetal brain.
To obtain the missing 5' region of the kidney cDNA, a forward PCR
primer ("P1") corresponding to the extreme 5' region of rat
OAT1 (5' TGAAAGCTGAGCTGTCCAGACC), was used in RT-PCR with a
reverse primer ("P2") derived from sequence 200 bp from the 5' end of EST 36482 (5' AGTCACGATGGTAGATGGGAAGG) (Fig.
1A). First-strand cDNA was reverse-transcribed from human kidney mRNA (0.5 µg,
Clontech) using a Not I primer-adapter
(SuperScript Plasmid System, GIBCO-BRL). PCR was performed with the
Expand High-Fidelity system as follows: initial denaturation at
94°C for 1.5 min; 35 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 2 min; and a final extension at 72°C for 10 min. A PCR product of the expected size (~625 bp) was subcloned into
the TA cloning vector, and both strands were sequenced.
|
The two fragments comprising the full-length cDNA were generated by
restriction with Sma I and
Not I, gel-purified,
ligated in the pcDNA3 vector (Invitrogen) at the
Not I site, and transformed into
DH5
competent cells. A colony with the expected insert size was
sequenced completely in both directions. This full-length renal cDNA is
called hPAHT. Nucleotide and amino acid sequences were analyzed using
MacVector and GeneWorks software programs.
Transient expression in HeLa cells and transport
assays. Full-length hPAHT was subcloned into the pCDNA3
vector such that the coding strand was downstream of the T7 and
cytomegalovirus promoters and was transiently expressed as
previously described (11, 15). Briefly, HeLa cells in 35-mm dishes were
infected by vaccinia vTF7-3. Subsequently, premixed cDNA (5 µg)
and Lipofectin (10 µg) were added. After ~20 h
incubation, cells were used in influx experiments.
[3H]PAH (0.4 µM) or
14C-labeled
-ketoglutarate (0.6 µM) was added to 1 ml Waymouth buffer (135 mM NaCl, 13 mM HEPES, 2.5 mM CaCl2, 1.2 mM
MgCl2, 0.8 mM
MgSO4, 5 mM KCl, and 28 mM
D-glucose) and timed uptakes were performed, followed by washing. Cells from a single dish (~1 mg
protein) were scraped into scintillation cocktail and counted.
For substrate Km determinations, [3H]PAH uptakes were determined in duplicate on a given transfection in the presence of three concentrations (10 nM, 100 nM, and 1 µM) of unlabeled PAH. Inhibition dose responses were curve fitted, and the Km values were calculated from two separate transfections.
Northern blot analysis. The 625-bp
5' hPAHT PCR product in the TA cloning vector was linearized as a
template for a digoxigenin-labeled antisense RNA probe, which was
hybridized to two human multiple tissue Northern blots (Clontech).
Hybridization was carried out overnight at 65°C in 5× SSC,
2% blocking reagent, 0.1%
N-lauroylsarcosine, 0.02% SDS (Genius
System, Boehringer Mannheim Biochemicals). This was followed by washes
of increasing stringency: twice with 1× SSC, 0.1% SDS; twice
with 0.5× SSC, 0.1% SDS; and twice with 0.1× SSC, 0.1%
SDS; all at 65°C. Detection was performed using a horseradish peroxidase-coupled anti-digoxigenin antibody (Boehringer Mannheim) and
enhanced chemiluminescence (ECL, Amersham), followed by radiography. Blots were then rehybridized with an
[
-32P]dATP random
primer-labeled
-actin DNA probe (Clontech) to assess sample loading.
Chromosomal localization of hPAHT. PCR-based monochromosomal somatic cell hybrid mapping was performed with a set of hPAHT 3'-untranslated region (3'-UTR) primers: 5' TGAAAGCTGAGCTGTCCAGACC and 5' AGTCACGATGGTAGATGGGAAGG. An initial denaturation at 94°C for 1.5 min was followed by 40 cycles: 94°C for 30 s, 65°C for 30 s, 72°C for 30 s, and a final extension of 72°C for 1.5 min. Products were separated on a 12% polyacrylamide gel, stained with ethidium bromide, and photographed.
Reagents.
[3H]MTX, a gift from
Dr. I. David Goldman, was synthesized and purified by HPLC as described
(10). Somatic cell hybrids from Coriell Institute, Camden, NJ (8),
containing individual human chromosomes were a gift from Raju
Kucherlapati (Albert Einstein). The following sources were also used:
[3H]PAH,
14C-labeled
-ketoglutarate, and
[3H]PGE2
were from DuPont-New England Nuclear; Lipofectin was from GIBCO-BRL;
N-(2{[3-(4-bromophenyl)-2-propenyl]-amino}-ethyl)-5-isoquinolinesulfonamide (H-89), staurosporine, phorbol 12-myristate 13-acetate
(PMA), and 4
-phorbol-12,13 didecanoate (4
-PDD) were from
Calbiochem; furosemide was from Molecular Probes; unlabeled
PGF2
was from Cayman; and the
remainder were from Sigma.
| |
RESULTS |
|---|
|
|
|---|
Searching of the human EST database with the rat OAT1 PAH transporter sequence yielded two hits from fetal brain with >60% identity (R25797 and R46796) (Fig. 1A). These corresponded to both ends of a single clone (clone 36482) which, by size, appeared to represent a partial human homolog of rat OAT1/ROAT. The corresponding adult human kidney cDNA was obtained by RT-PCR from human kidney mRNA. The missing 5' region was obtained by RT-PCR of adult human kidney mRNA using an upstream rat OAT1 primer and a downstream primer based on sequence obtained from the kidney clone and from clone 36482 (Fig. 1A).
Together, the full-length hPAHT cDNA has a single long open-reading frame of 1,650 bp encoding a deduced protein of 550 amino acids. In Fig. 1B, hPAHT is aligned with rat OAT1/ROAT (31, 34) and with NKT (19), a similar deduced protein from the mouse that has not yet been shown to transport PAH. The amino acid identities between hPAHT and OAT1/ROAT, NKT, and fROAT are 87%, 85%, and 48%, respectively. The hPAHT deduced protein sequence also has weak homology to the human cation transporters hOCTN2 (29% identity) (39) and hOCT1 (32% identity) (41). The hPAHT protein has 12 predicted transmembrane spans based on Kyte-Doolittle hydropathy analysis (18); PKC phosphorylation consensus sites at Ser271, Ser278, Thr284, Thr334, and Ser521 and PKA phosphorylation consensus sites at Ser276, Thr318, Thr334, and Ser469 (16, 25); and N-linked glycosylation sites at Asn39, Asn56, Asn92, Asn97, and Asn113.
The tissue distribution of hPAHT expression in adult human tissues by Northern blot analysis of poly(A)+ RNA is extremely narrow; a single dominant transcript of ~2.4 kb was observed only in kidney (Fig. 1C). (Not shown is a negative blot containing mRNA for human spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes). Despite the lack of a hybridizing band in the "brain" lane, it seems likely that hPAHT is expressed in the brain, since essentially identical sequences were found in several ESTs derived from two separate human fetal and adult brain cDNA libraries (GenBank ESTs R25797, R46796, AA351031, AA351032). Indeed, the initial EST that forms the basis for the present cloning effort was derived from human brain (see EXPERIMENTAL PROCEDURES). This narrow expression pattern (kidney and brain) is similar to that of OAT1/ROAT in the rat and of NKT in the mouse (19, 31, 34).
To determine the chromosomal localization of the hPAHT gene, PCR-based monochromosomal somatic cell hybrid mapping was performed with a set of 3'-UTR primers. These studies indicated that the hPAHT gene is located on chromosome 11 (Fig. 1D). (Faint bands in the chromosome 15 and Y lanes were not reproducible and appear to represent nonspecific amplification). We note that region 11q13 of the human genome is syntenic with the region of mouse chromosome 19 to which NKT was previously localized (19, 30).
Figure 2A
shows that hPAHT catalyzed the time-dependent uptake of tracer PAH. An
"overshoot" was observed when cells were assayed by rapid
transfer from a
HCO3/CO2
environment to a HEPES-containing buffer. This result, similar to our
findings on prostaglandin uptake mediated by the prostaglandin
transporter, PGT (5), is consistent with
exchange-mediated secondary active transport in which an outwardly
directed gradient for a cytosolic exchange partner (here likely
-ketoglutarate) is depleted during the uptake experiment because of
abundance of the external exchange partner (PAH).
|
Three additional sets of experiments also suggest such an exchange
model. First, preincubation for various times with glutarate, a
substrate of the PAH/
-ketoglutarate exchanger that crosses the
plasma membrane well by nonionic diffusion (26, 27, 34), produced a
time-dependent stimulation of subsequent PAH uptake (Fig. 2,
B and
C). HeLa cells that underwent sham
transfection had very low PAH uptake that could not be stimulated by
preincubation in glutarate (Fig.
2B). Similar results were seen when
a control plasmid was transfected (data not shown).
Second, preincubation with
-ketoglutarate stimulated subsequent
tracer PAH uptake, albeit to a lesser extent than preincubation with
glutarate (Fig. 2C). Although
control HeLa cell monolayers exhibited substantial accumulation of
14C-labeled
-ketoglutarate
(~1 pmol · mg
protein
1 · 10 min
1) compared with the
uptake of [3H]PAH
(~1 fmol · mg
protein
1 · 10 min
1), it is likely that
-ketoglutarate permeates the cells less well by diffusion than
glutarate (34).
Third, preincubation of hPAHT-expressing HeLa cells with
unlabeled PAH produced significant stimulation of subsequent
14C-labeled
-ketoglutarate
uptake (Fig. 2D). Sham-transfected
HeLa cells also exhibited a very small degree of stimulation of
-ketoglutarate uptake by PAH preincubation (Fig.
2D), suggesting that these cells express a low-level background exchanger for these substrates.
We performed kinetic studies using 5-min uptake (0.4 µM [3H]PAH) in the presence or absence of unlabeled PAH (1 µM, 10 µM, or 100 µM). The data could be fit with a single exponential to yield an apparent Km of 5 µM (data not shown).
Various unlabeled organic anions
cis-inhibited hPAHT (Fig.
3A).
Furosemide, probenecid, hippurate,
-ketoglutarate, glutarate, indomethacin, and fluorescein moderately or strongly inhibited [3H]PAH uptake. This
pattern is similar to that of rat OAT1, which is inhibited by
furosemide, indomethacin, probenecid, and
-ketoglutarate (31). In
contrast, aspirin, penicillin G, anandamide, MTX, mercury-cysteine complex, 8-bromo-cAMP, and PGF2
produced minimal or no inhibition. Although reported to stimulate PAH
transport in isolated rabbit proximal tubules (3), we found that bovine
serum albumin produced modest inhibition of hPAHT (Fig.
3A).
|
The weak cis-inhibitory interaction of
both PGF2
and MTX with hPAHT
stands in contrast to the results of similar experiments reported for
rat OAT1, in which PGE2 and MTX
strongly cis-inhibited PAH uptake
(31). In that report, PGE2 and MTX
exhibited "uptake" as defined by an OAT1-induced increase in
cell-associated tracer counts (31). To test directly the substrate
specificity of hPAHT, we measured hPAHT-mediated cell association of
[3H]PGE2
and [3H]MTX and
compared these to
[3H]PAH (Fig.
3B; note that the units of uptake for
PAH and MTX are different from those for
PGE2). As shown at
left, expression of hPAHT resulted in
a substantial increment of cell-associated tracer PAH counts compared
with sham-transfected cells. Furthermore, pretreatment with 5 mM
glutarate increased cell-associated tracer PAH counts by ~40%,
indicating that PAH is well transported by hPAHT. In contrast,
expression of hPAHT caused no increment in cell-associated MTX counts
(middle) or
PGE2 counts
(right), indicating that neither MTX
nor PGE2 is transported. (For
comparison, the 10-min PGE2 uptake
by the prostaglandin transporter PGT at this PGE2 substrate concentration would
be ~250 fmol/mg protein; see Ref. 15).
We tested the hypothesis that hPAHT is regulated by phosphorylation.
Although a variety of activators and/or inhibitors of PKA and
tyrosine kinase pathways had no effect on
[3H]PAH uptake, the
calcium ionophore A23187 produced a small inhibition (Fig.
4), whereas PMA significantly inhibited transport (Fig. 4, A and
C). As shown by a single experiment
(Fig. 4B), phorbol ester inhibited
transport in a time-dependent fashion that was maximal at 30 min.
Half-maximal inhibition was obtained at 80 nM (data not shown). The
phorbol-induced inhibition was reversed by the inhibitor staurosporine
and was not seen with the inactive form of PMA, 4
-PDD (Fig.
4C), confirming that the inhibition is due to PKC activation and not blockade of the transporter by PMA.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study describes the cloning, expression, and
characterization of a human kidney PAH transporter, hPAHT. hPAHT shares
properties with the rat (31, 34) and flounder (38) transporters in that
the mRNA expression is limited, PAH uptake is
trans-stimulated by preincubation with
glutarate and is inhibited strongly by probenecid, and a fair number of
organic anions can cis-inhibit uptake.
In addition, we now show that tracer
-ketoglutarate uptake is
stimulated by preincubation with PAH. However, unlike the rat OAT1
(31), hPAHT is not capable of transporting
PGE2 or MTX. Thus hPAHT has a
seemingly narrow substrate specificity. Another important finding is
that hPAHT-mediated PAH uptake is inhibited by PKC activation,
suggesting that the PKC-mediated inhibition of transepithelial organic
anion secretion described in several preparations is likely due, at
least in part, to direct effects on the basolateral exchanger.
It is unclear whether the "organic anion secretory system"
consists of a single transporter with very broad specificity, analogous to P-glycoprotein, or of multiple proteins with more narrow, but perhaps overlapping, specificities. Ullrich and Rumrich (37) carried out extensive micropuncture studies in which they
assessed the ability of organic compounds to compete for peritubular
PAH uptake. From these studies, they concluded that a typical substrate for this system has the following properties:
1) a hydrophobic domain 4-10
Å long; 2) the strength of
the interaction varies with the ionic charge (i.e.,
pKa varies with
Ki);
3) the transporter accepts
hydrophobic substrates that cannot be ionized, in which case the
carrier does not sense the degree of ionization; and 4) electron-attracting side groups
(Cl, Br, NO2) augment the
interaction with the PAH transporter (9, 36, 37). This definition is extremely inclusive. Their model has been interpreted to mean that a
single protein mediates this broad transport. Indeed, a recent report
on the rat renal PAH exchanger cDNA by Sekine et al. (31) is consistent
with this interpretation, in that cell-associated counts of tracer MTX,
cAMP, cGMP, PGE2, urate, and
-ketoglutarate were all increased in oocytes expressing OAT1
relative to controls.
In contrast, neither tracer PGE2
nor MTX exhibited significant cell-associated counts in
hPAHT-expressing HeLa cells relative to controls. Our negative data are
almost certainly not due to technical problems. We have, for example,
demonstrated high tracer PGE2 and
PGF2
transport rates by the
prostaglandin transporter PGT using the same expression and assay
systems (5, 15, 20). Possible explanations for the discrepancy include
species differences in the transporter cDNAs or differences in the
expression systems (Xenopus oocytes
vs. mammalian cells, although we have seen no differences between these
two expression systems with regard to PGT; Ref. 5). It is also possible
that the hPAHT clone does not correspond exactly to rat OAT1, although
there is a very high degree of amino acid identity between the two. In
this regard, the apparent affinity of hPAHT for PAH (~5 µM) is
substantially lower than that reported for the rat transporter as
reported by Sweet et al. (Ref. 34; 70 µM), but is similar to that of
the rat as reported by Sekine et al. (Ref. 31; 14 µM) and to that of
the flounder homolog (20 µM) (38).
It is of interest that, in rat micropuncture studies, several seemingly generic organic anions fail to block PAH uptake, yet are secreted by the proximal tubule (e.g., 4-aminobenzoate; see Refs. 23 and 37). This indicates that other transporters must exist outside of the "PAH framework." Moreover, Miller and Pritchard (22) have shown that uphill transport of fluorescein-MTX across the killifish proximal tubule basolateral membrane is poorly inhibited by PAH, indicating an alternative entry pathway. Clearly, both the number of systems and their relative contributions to the handling of a given organic anion remain areas of uncertainty (29).
The nephrotoxic effect of several organic anions, including mercury-cysteine conjugates, can be blocked in rats and in isolated renal cells by probenecid, suggesting that these conjugates are transported by the PAH transporter, and there is a correlation between the intracellular concentration and the degree of toxic response (2, 40). We found that a cysteine-mercury complex failed to interact with hPAHT. This makes it unlikely that hPAHT accounts for basolateral inorganic mercury uptake by the proximal tubule. Similarly, although carrier-mediated transport of the cannabinoid receptor agonist anandamide has been proposed (1), the lack of significant inhibition makes it unlikely that hPAHT is this carrier (Fig. 3A).
Transport by hPAHT was acutely inhibited to a small extent by the
calcium ionophore A23187 and strongly by low concentrations of the PKC
activator PMA, but not by maneuvers expected to alter cAMP or tyrosine
phosphorylation. The phorbol ester effect is specific for PKC
activation, and does not appears to be due to direct blockade of the
transporter by PMA itself, since the inhibition was reversed by the PKC
blocker staurosporine and was not replicated by the inactive phorbol
4
-PDD (Fig. 4C). There is clear
evidence (6) that phorbol ester added to HeLa cells under comparable conditions causes translocation from the cytosol to the membrane of PKC
isoforms
,
, and
.
Our findings on PKC are in accord with a number of studies showing that renal tubular organic anion secretion can be acutely downregulated by PKC (see NOTE ADDED IN PROOF). Dopamine was shown to inhibit the vectorial secretion of dichlorophenoxyacetic acid by primary culture monolayers of flounder proximal tubule, an effect that was mimicked by phorbol ester and blocked by staurosporine (12). Vectorial secretion of PAH by monolayers of the opossum kidney (OK) proximal tubule cell line was inhibited by parathyroid hormone (PTH), and the second messenger for PTH was probably PKC (24, 35). Finally, fluorescein secretion by killifish proximal tubules was inhibited by PKC activation (21).
Takano et al. (35) reported that basolateral uptake of PAH in OK cells is almost completely inhibited by PMA (100 nM) treatment for ~3 h, whereas we never achieved full inhibition of PAH uptake by PMA in the present system. Although the exact reason(s) for this quantitative discrepancy is not clear, it is possible that activation of PKC in OK cells causes inhibition of the basolateral PAH uptake exchanger at several levels (e.g., direct phosphorylation of the exchanger plus PKC-mediated exchanger internalization), whereas only one of these pathways may be operative in the heterologous HeLa cell expression system. Further insights into the differences between the degree of inhibition by PKC of OK cells versus the hPAHT transporter must await cloning and expression of the OK PAH transporter cDNA.
In the case of OK cells and killifish tubules, PKC inhibited primarily the basolateral entry step (21, 35). Although we have not yet localized hPAHT in the human kidney, we expect that it will be expressed at the basolateral membrane of the proximal tubule. Our data would therefore suggest that PKC inhibits organic anion secretion by directly modulating the basolateral anion exchanger. Further studies are underway to test directly whether hPAHT can be phosphorylated by PKC.
In summary, we have cloned and functionally expressed a novel human renal PAH transporter, hPAHT, the gene for hPAHT isolated on human chromosome 11. The substrate specificity is narrower than that reported for the rat transporter OAT1. hPAHT is inhibited by PKC activation, suggesting that the basolateral entry step in transepithelial organic anion transport may be regulated by serine-threonine phosphorylation of the exchanger.
| |
NOTE ADDED IN PROOF |
|---|
While this paper was in press, another report of regulation of the rat organic anion transporter OAT1 by phorbal ester appeared (Y. Uwai, M. Tokuda, K. Takami, Y. Hashimoto, and K. Inui. Functional characterization of the rat multispecific organic anion transporter OAT1 mediating basolateral uptake of anionic drugs in the kidney. FEBS Lett. 438: 321-324, 1998).
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. I. David Goldman for the [3H]methotrexate.
| |
FOOTNOTES |
|---|
A portion of the work was supported by grants to V. L. Schuster from the National Institute of Diabetes and Digestive and Kidney Diseases (Grant DK-49688), from Alcon Laboratories, and from the American Heart Association (New York City Affiliate).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: V. L. Schuster, Renal Division, Ullmann 617, 1300 Morris Park Ave., Bronx, NY 10461.
Received 2 June 1998; accepted in final form 22 October 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Beltramo, M.,
N. Stella,
A. Calignano,
S. Y. Lin,
A. Makriyannis,
and
D. Piomelli.
Functional role of high-affinity anandamide transport, as revealed by selective inhibition.
Science
277:
1094-1097,
1997
2.
Berndt, W. O.
Potential involvement of renal transport mechanisms in nephrotoxicity.
Toxicology
46:
77-82,
1989.
3.
Bessseghir, K.,
D. Mosig,
and
F. Roch-Ramel.
Facilitation by serum albumin of renal tubular secretion of organic anions.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F475-F484,
1989
4.
Blomstedt, J. W.,
and
P. S. Aronson.
pH gradient-stimulated transport of urate and p-aminohippurate in dog renal microvillus membrane vesicles.
J. Clin. Invest.
65:
931-934,
1980.
5.
Chan, B.,
J. A. Satriano,
M. Pucci,
and
V. L. Schuster.
Mechanism of PGE2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter "PGT".
J. Biol. Chem.
273:
6689-6697,
1998
6.
Chun, J.-S.,
M.-J. Ha,
and
B. S. Jacobson.
Differential translocation of protein kinase C
during HeLa cell adhesion to a gelatin substratum.
J. Biol. Chem.
271:
13008-13012,
1996
7.
Dantzler, W. H.
Comparative aspects of renal function.
In: The Kidney: Physiology and Pathophysiology (2nd ed.), edited by D. W. Seldin,
and G. Giebisch. New York: Raven, 1992, p. 885-942.
8.
Drwinga, H. L.,
L. H. Toji,
C. H. Kim,
A. E. Greene,
and
R. A. Mulivor.
NIGMS human/rodent somatic cell hybrid mapping panels 1 and 2.
Genomics
16:
311-314,
1993[Medline].
9.
Fritzsch, G.,
G. Rumrich,
and
K. J. Ullrich.
Anion transport through the contralateral cell membrane of renal proximal tubule. The influence of hydrophobicity and molecular charge distribution on the inhibitory activity of organic anions.
Biochim. Biophys. Acta
978:
249-256,
1989[Medline].
10.
Fry, D. W.,
J. C. Yalowich,
and
I. D. Goldman.
Rapid formation of poly-
-glutamyl derivatives of methotrexate and their association with dihydrofolate reductase as assessed by high pressure liquid chromatography in the Ehrlich ascites tumor cell in vitro.
J. Biol. Chem.
257:
1890-1896,
1982
11.
Fuerst, T. R.,
E. G. Niles,
F. W. Studier,
and
B. Moss.
Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:
8122-8126,
1986
12.
Halpin, P. A.,
and
J. L. Renfro.
Renal organic anion secretion: evidence for dopaminergic and adrenergic regulation.
Am. J. Physiol.
271 (Regulatory Integrative Comp. Physiol. 40):
R1372-R1379,
1996
13.
Heidenhain, R.
Versuche über den Vorgang der Harnabsonderung.
Pflügers Arch.
9:
1-27,
1874.
14.
Hook, J. B.,
and
W. R. Hewitt.
Development of mechanisms for drug excretion.
Am. J. Med.
62:
497-506,
1993.
15.
Kanai, N.,
R. Lu,
J. A. Satriano,
Y. Bao,
A. W. Wolkoff,
and
V. L. Schuster.
Identification and characterization of a prostaglandin transporter.
Science
268:
866-869,
1995
16.
Kennelly, P. J.,
and
E. G. Krebs.
Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases.
J. Biol. Chem.
266:
15555-15558,
1991
17.
Kluwe, W. M.,
and
J. B. Hook.
Effects of environmental chemicals on kidney metabolism and function.
Kidney Int.
18:
648-655,
1980[Medline].
18.
Kyte, J.,
and
R. F. Doolittle.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:
105-132,
1982[Medline].
19.
Lopez-Nieto, C. E.,
G. You,
K. T. Bush,
E. J. Barros,
D. R. Beier,
and
S. K. Nigam.
Molecular cloning and characterization of NKT, a gene product related to the organic cation transporter family that is almost exclusively expressed in the kidney.
J. Biol. Chem.
272:
6471-6478,
1997
20.
Lu, R.,
N. Kanai,
Y. Bao,
and
V. L. Schuster.
Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA (hPGT).
J. Clin. Invest.
98:
1142-1149,
1996[Medline].
21.
Miller, D. S.
Protein kinase C regulation of organic anion transport in renal proximal tubule.
Am. J. Physiol.
274 (Renal Physiol. 43):
F156-F164,
1998
22.
Miller, D. S.,
and
J. B. Pritchard.
Dual pathways for organic anion secretion in renal proximal tubule.
J. Exp. Zool.
279:
462-470,
1997[Medline].
23.
Moller, J. V.,
and
M. I. Sheikh.
Renal organic anion transport system: pharmacological, physiological, and biochemical aspects.
Pharmacol. Rev.
34:
315-358,
1983[Medline].
24.
Nagai, J.,
I. Yano,
Y. Hashimoto,
M. Takano,
and
K. Inui.
Inhibition of PAH transport by parathyroid hormone in OK cells: involvement of protein kinase C pathway.
Am. J. Physiol.
273 (Renal Physiol. 42):
F674-F679,
1997
25.
Pearson, R. B.,
and
B. E. Kemp.
Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations.
Methods Enzymol.
200:
62-81,
1991[Medline].
26.
Pritchard, J. B.
Coupled transport of p-aminohippurate by rat kidney basolateral membrane vesicles.
Am. J. Physiol.
255 (Renal Fluid Electrolyte Physiol. 24):
F597-F604,
1988
27.
Pritchard, J. B.
Rat renal cortical slices demonstrate p-aminohippurate/glutarate exchange and sodium/glutarate coupled p-aminohippurate transport.
J. Pharmacol. Exp. Ther.
255:
969-975,
1990
28.
Pritchard, J. B.,
and
D. S. Miller.
Comparative insights into the mechanisms of renal organic anion and cation secretion.
Am. J. Physiol.
261 (Regulatory Integrative Comp. Physiol. 30):
R1329-R1340,
1991
29.
Pritchard, J. B.,
and
D. S. Miller.
Proximal tubular transport of organic anions and cations.
In: The Kidney: Physiology and Pathophysiology (2nd ed.), edited by D. W. Seldin,
and G. Giebisch. New York: Raven, 1992, p. 2921-2945.
30.
Rochelle, J. M.,
M. L. Watson,
R. J. Oakey,
and
M. F. Seldin.
A linkage map of mouse chromosome 19: definition of comparative mapping relationships with human chromosomes 10 and 11 including the MEN1 locus.
Genomics
14:
26-31,
1992[Medline].
31.
Sekine, T.,
N. Watanabe,
M. Hosoyamada,
Y. Kanai,
and
H. Endou.
Expression cloning and characterization of a novel multispecific organic anion transporter.
J. Biol. Chem.
272:
18526-18529,
1997
32.
Steffens, T. G.,
P. D. Holohan,
and
C. R. Ross.
Operational modes of the organic anion exchanger in canine renal brush-border membrane vesicles.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F596-F609,
1989
33.
Sullivan, L. P.,
and
J. J. Grantham.
Specificity of basolateral organic anion exchanger in proximal tubule for cellular and extracellular solutes.
J. Am. Soc. Nephrol.
2:
1192-1200,
1992[Abstract].
34.
Sweet, D. H.,
N. A. Wolff,
and
J. B. Pritchard.
Expression cloning and characterization of ROAT1. The basolateral organic anion transporter in rat kidney.
J. Biol. Chem.
272:
30088-30095,
1997
35.
Takano, M.,
J. Nagai,
M. Yasuhara,
and
K. Inui.
Regulation of p-aminohippurate transport by protein kinase C in OK kidney epithelial cells.
Am. J. Physiol.
271 (Renal Fluid Electrolyte Physiol. 40):
F469-F475,
1996
36.
Ullrich, K. J.
Renal transporters for organic anions and organic cations. Structural requirements for substrates.
J. Membr. Biol.
158:
95-107,
1997[Medline].
37.
Ullrich, K. J.,
and
G. Rumrich.
Contraluminal transport systems in the proximal renal tubule involved in secretion of organic anions.
Am. J. Physiol.
254 (Renal Fluid Electrolyte Physiol. 23):
F453-F462,
1988
38.
Wolff, N. A.,
A. Werner,
S. Burkhardt,
and
G. Burckhardt.
Expression cloning and characterization of a renal organic anion transporter from winter flounder.
FEBS Lett.
417:
287-291,
1997[Medline].
39.
Wu, X.,
P. D. Prasad,
F. H. Leibach,
and
V. Ganapathy.
cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family.
Biochem. Biophys. Res. Commun.
246:
589-595,
1998[Medline].
40.
Zalups, R. K.,
and
D. W. Barfuss.
Participation of mercuric conjugates of cysteine, homocysteine, and N-acetylcysteine in mechanisms involved in the renal tubular uptake of inorganic mercury.
J. Am. Soc. Nephrol.
9:
551-561,
1998[Abstract].
41.
Zhang, L.,
M. J. Dresser,
A. T. Gray,
S. C. Yost,
S. Terashita,
and
K. M. Giacomini.
Cloning and functional expression of a human liver organic cation transporter.
Mol. Pharmacol.
51:
913-921,
1997
This article has been cited by other articles:
![]() |
S. Li, P. Duan, and G. You Regulation of human organic anion transporter 1 by ANG II: involvement of protein kinase C{alpha} Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E378 - E383. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kwon, W.-W. Wang, and S. Miller Renal organic anion transporter 1 is maldistributed and diminishes in proximal tubule cells but increases in vasculature after ischemia and reperfusion Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1807 - F1816. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kwon, S.-M. Hong, and K. Blouch Alteration in Renal Organic Anion Transporter 1 After Ischemia/Reperfusion in Cadaveric Renal Allografts J. Histochem. Cytochem., June 1, 2007; 55(6): 575 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schneider, C. Sauvant, B. Betz, M. Otremba, D. Fischer, H. Holzinger, C. Wanner, J. Galle, and M. Gekle Downregulation of organic anion transporters OAT1 and OAT3 correlates with impaired secretion of para-aminohippurate after ischemic acute renal failure in rats Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1599 - F1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Aslamkhan, D. M. Thompson, J. L. Perry, K. Bleasby, N. A. Wolff, S. Barros, D. S. Miller, and J. B. Pritchard The flounder organic anion transporter fOat has sequence, function, and substrate specificity similarity to both mammalian Oat1 and Oat3 Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1773 - R1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sekine, H. Miyazaki, and H. Endou Molecular physiology of renal organic anion transporters Am J Physiol Renal Physiol, February 1, 2006; 290(2): F251 - F261. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H.E. Smeets, R. A.M.H. van Aubel, A. C. Wouterse, J. J.M.W. van den Heuvel, and F. G.M. Russel Contribution of Multidrug Resistance Protein 2 (MRP2/ABCC2) to the Renal Excretion of p-aminohippurate (PAH) and Identification of MRP4 (ABCC4) as a Novel PAH Transporter J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2828 - 2835. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, C. E. Groves, A. Bahn, W. M. Barendt, M. D. Prado, M. Rodiger, V. Chatsudthipong, G. Burckhardt, and S. H. Wright Relative contribution of OAT and OCT transporters to organic electrolyte transport in rabbit proximal tubule Am J Physiol Renal Physiol, November 1, 2004; 287(5): F999 - F1010. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Soodvilai, V. Chatsudthipong, K. K. Evans, S. H. Wright, and W. H. Dantzler Acute regulation of OAT3-mediated estrone sulfate transport in isolated rabbit renal proximal tubules Am J Physiol Renal Physiol, November 1, 2004; 287(5): F1021 - F1029. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Wright and W. H. Dantzler Molecular and Cellular Physiology of Renal Organic Cation and Anion Transport Physiol Rev, July 1, 2004; 84(3): 987 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ljubojevic, C. M. Herak-Kramberger, Y. Hagos, A. Bahn, H. Endou, G. Burckhardt, and I. Sabolic Rat renal cortical OAT1 and OAT3 exhibit gender differences determined by both androgen stimulation and estrogen inhibition Am J Physiol Renal Physiol, July 1, 2004; 287(1): F124 - F138. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Beyenbach Kidneys sans glomeruli Am J Physiol Renal Physiol, May 1, 2004; 286(5): F811 - F827. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sauvant, D. Hesse, H. Holzinger, K. K. Evans, W. H. Dantzler, and M. Gekle Action of EGF and PGE2 on basolateral organic anion uptake in rabbit proximal renal tubules and hOAT1 expressed in human kidney epithelial cells Am J Physiol Renal Physiol, April 1, 2004; 286(4): F774 - F783. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aslamkhan, Y.-H. Han, R. Walden, D. H. Sweet, and J. B. Pritchard Stoichiometry of organic anion/dicarboxylate exchange in membrane vesicles from rat renal cortex and hOAT1-expressing cells Am J Physiol Renal Physiol, October 1, 2003; 285(4): F775 - F783. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, L. M. S. Chan, R. Walden, X.-P. Yang, D. S. Miller, and J. B. Pritchard Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient Am J Physiol Renal Physiol, April 1, 2003; 284(4): F763 - F769. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Aslamkhan, Y.-H. Han, X.-P. Yang, R. K. Zalups, and J. B. Pritchard Human Renal Organic Anion Transporter 1-Dependent Uptake and Toxicity of Mercuric-Thiol Conjugates in Madin-Darby Canine Kidney Cells Mol. Pharmacol., March 1, 2003; 63(3): 590 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bahn, M. Knabe, Y. Hagos, M. Rodiger, S. Godehardt, D. S. Graber-Neufeld, K. K. Evans, G. Burckhardt, and S. H. Wright Interaction of the Metal Chelator 2,3-Dimercapto-1-propanesulfonate with the Rabbit Multispecific Organic Anion Transporter 1 (rbOAT1) Mol. Pharmacol., November 1, 2002; 62(5): 1128 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takeda, S. Khamdang, S. Narikawa, H. Kimura, M. Hosoyamada, S. H. Cha, T. Sekine, and H. Endou Characterization of Methotrexate Transport and Its Drug Interactions with Human Organic Anion Transporters J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 666 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kobayashi, N. Ohshiro, A. Shibusawa, T. Sasaki, S. Tokuyama, T. Sekine, H. Endou, and T. Yamamoto Isolation, Characterization and Differential Gene Expression of Multispecific Organic Anion Transporter 2 in Mice Mol. Pharmacol., July 1, 2002; 62(1): 7 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. N. Buist, N. J. Cherrington, S. Choudhuri, D. P. Hartley, and C. D. Klaassen Gender-Specific and Developmental Influences on the Expression of Rat Organic Anion Transporters J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 145 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kimura, M. Takeda, S. Narikawa, A. Enomoto, K. Ichida, and H. Endou Human Organic Anion Transporters and Human Organic Cation Transporters Mediate Renal Transport of Prostaglandins J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 293 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kojima, T. Sekine, M. Kawachi, S. H. Cha, Y. Suzuki, and H. Endou Immunolocalization of Multispecific Organic Anion Transporters, OAT1, OAT2, and OAT3, in Rat Kidney J. Am. Soc. Nephrol., April 1, 2002; 13(4): 848 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Motohashi, Y. Sakurai, H. Saito, S. Masuda, Y. Urakami, M. Goto, A. Fukatsu, O. Ogawa, and K.-i. Inui Gene Expression Levels and Immunolocalization of Organic Ion Transporters in the Human Kidney J. Am. Soc. Nephrol., April 1, 2002; 13(4): 866 - 874. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lee, S. Dallas, M. Hong, and R. Bendayan Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Islinger, M. Gekle, and S. H. Wright Interaction of 2,3-Dimercapto-1-propane Sulfonate with the Human Organic Anion Transporter hOAT1 J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 741 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. WOLFF, B. GRUNWALD, B. FRIEDRICH, F. LANG, S. GODEHARDT, and G. BURCKHARDT Cationic Amino Acids Involved in Dicarboxylate Binding of the Flounder Renal Organic Anion Transporter J. Am. Soc. Nephrol., October 1, 2001; 12(10): 2012 - 2018. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, K. T. Bush, and S. K. Nigam The organic anion transporter family: from physiology to ontogeny and the clinic Am J Physiol Renal Physiol, August 1, 2001; 281(2): F197 - F205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Cha, T. Sekine, J.-i. Fukushima, Y. Kanai, Y. Kobayashi, T. Goya, and H. Endou Identification and Characterization of Human Organic Anion Transporter 3 Expressing Predominantly in the Kidney Mol. Pharmacol., April 16, 2001; 59(5): 1277 - 1286. [Abstract] [Full Text] |
||||
![]() |
R. A. M. H. Van Aubel, R. Masereeuw, and F. G. M. Russel Molecular pharmacology of renal organic anion transporters Am J Physiol Renal Physiol, August 1, 2000; 279(2): F216 - F232. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Burckhardt and N. A. Wolff Structure of renal organic anion and cation transporters Am J Physiol Renal Physiol, June 1, 2000; 278(6): F853 - F866. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. You, K. Kuze, R. A. Kohanski, K. Amsler, and S. Henderson Regulation of mOAT-mediated Organic Anion Transport by Okadaic Acid and Protein Kinase C in LLC-PK1 Cells J. Biol. Chem., March 31, 2000; 275(14): 10278 - 10284. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. HO, D. C. LIN, D. B. MENDEL, and T. CIHLAR Cytotoxicity of Antiviral Nucleotides Adefovir and Cidofovir Is Induced by the Expression of Human Renal Organic Anion Transporter 1 J. Am. Soc. Nephrol., March 1, 2000; 11(3): 383 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Cha, T. Sekine, H. Kusuhara, E. Yu, J. Y. Kim, D. K. Kim, Y. Sugiyama, Y. Kanai, and H. Endou Molecular Cloning and Characterization of Multispecific Organic Anion Transporter 4 Expressed in the Placenta J. Biol. Chem., February 11, 2000; 275(6): 4507 - 4512. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. BURCKHARDT, N. A. WOLFF, and G. BURCKHARDT Electrophysiologic Characterization of an Organic Anion Transporter Cloned from Winter Flounder Kidney (fROAT) J. Am. Soc. Nephrol., January 1, 2000; 11(1): 9 - 17. [Abstract] [Full Text] |
||||
![]() |
A. Shuprisha, R. M. Lynch, S. H. Wright, and W. H. Dantzler PKC regulation of organic anion secretion in perfused S2 segments of rabbit proximal tubules Am J Physiol Renal Physiol, January 1, 2000; 278(1): F104 - F109. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Pritchard, D. H. Sweet, D. S. Miller, and R. Walden Mechanism of Organic Anion Transport across the Apical Membrane of Choroid Plexus J. Biol. Chem., November 19, 1999; 274(47): 33382 - 33387. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cihlar, D. C. Lin, J. B. Pritchard, M. D. Fuller, D. B. Mendel, and D. H. Sweet The Antiviral Nucleotide Analogs Cidofovir and Adefovir Are Novel Substrates for Human and Rat Renal Organic Anion Transporter 1 Mol. Pharmacol., September 1, 1999; 56(3): 570 - 580. [Abstract] [Full Text] |
||||
![]() |
M. Gekle, S. Mildenberger, C. Sauvant, D. Bednarczyk, S. H. Wright, and W. H. Dantzler Inhibition of initial transport rate of basolateral organic anion carrier in renal PT by BK and phenylephrine Am J Physiol Renal Physiol, August 1, 1999; 277(2): F251 - F256. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sauvant, H. Holzinger, and M. Gekle Modulation of the Basolateral and Apical Step of Transepithelial Organic Anion Secretion in Proximal Tubular Opossum Kidney Cells. ACUTE EFFECTS OF EPIDERMAL GROWTH FACTOR AND MITOGEN-ACTIVATED PROTEIN KINASE J. Biol. Chem., April 27, 2001; 276(18): 14695 - 14703. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |