AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 276: F295-F303, 1999;
0363-6127/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, R.
Right arrow Articles by Schuster, V. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, R.
Right arrow Articles by Schuster, V. L.
Vol. 276, Issue 2, F295-F303, February 1999

Cloning of the human kidney PAH transporter: narrow substrate specificity and regulation by protein kinase C

Run Lu, Brenda S. Chan, and Victor L. Schuster

Departments of Medicine, Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York 10461


    ABSTRACT
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

Conserved from fish to mammals, renal proximal tubule organic anion secretion plays an important role in drug and xenobiotic elimination. Studies with the model substrate p-aminohippurate (PAH) have suggested that a basolateral PAH/alpha -ketoglutarate exchanger imports diverse organic substrates into the proximal tubule prior to apical secretion. cDNAs encoding PAH transporters have been cloned recently from rat and flounder. Here we report the cloning of a highly similar human PAH transporter (hPAHT) from human kidney. By Northern blot analysis and EST database searching, hPAHT mRNA was detected in kidney and brain. PCR-based monochromosomal somatic cell hybrid mapping placed the hPAHT gene on chromosome 11. When expressed transiently in vitro, hPAHT catalyzed time-dependent and saturable [3H]PAH uptake (Km of ~5 µM). Preincubation with unlabeled alpha -ketoglutaric or with glutaric acid stimulated tracer PAH uptake, and preincubation with unlabeled PAH stimulated tracer alpha -ketoglutarate uptake, results that are consistent with PAH/alpha -ketoglutarate exchange. Several structurally diverse organic anions cis-inhibited PAH uptake. Like rat OAT1 organic anion transporter, hPAHT was inhibited by furosemide, indomethacin, probenecid, and alpha -ketoglutarate. Unlike OAT1, hPAHT was not inhibited by prostaglandins or methotrexate (MTX). Moreover, tracer PGE2 and MTX were not transported, indicating that the substrate specificity for transport by hPAHT is not broad. PAH uptake was inhibited by phorbol 12-myristate 13-acetate (PMA) in a dose- and time-dependent fashion, but not by the inactive 4alpha -phorbol-12,13 didecanoate. PMA-induced inhibition was blocked by staurosporine. Thus the protein kinase C-mediated inhibition of basolateral organic anion entry previously reported in intact tubules is likely due, at least in part, to direct modulation of the PAH/alpha -ketoglutarate exchanger.

carrier proteins; biological transport; organic anion transport; hormonal control; renal secretion; p-aminohippurate; phorbol ester


    INTRODUCTION
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

IT HAS BEEN RECOGNIZED since 1874 that the kidney secretes organic anions (13). Observed in almost all nonmammalian vertebrates and in crustaceans (28), secretion occurs in the late proximal tubule (snakes, most mammals), the early and mid-proximal tubule (frogs, pigs), or any portion of the proximal tubule (flounder) (7). Although the prototypical substrate is p-aminohippurate (PAH), many xenobiotics and drugs are also secreted (17, 23). The system has enormous clinical importance; for example, the pharmacokinetics of anionic drugs such as diuretics and penicillins depend in large part on renal tubular secretion (14).

Extensive rat micropuncture studies by Ullrich (36), in which structurally diverse compounds competed with tracer PAH for peritubular uptake, resulted in a model in which a single transporter carries a broad range of aromatic and aliphatic compounds. Vesicle studies have shown that PAH is brought uphill across the basolateral membrane in exchange for alpha -ketoglutarate, the outward gradient of which derives from Na-coupled uptake and the tricarboxylic acid cycle (29, 33). Experiments using fish tubules indicate that the basolateral organic anion entry step can be downregulated by protein kinase C (PKC). The apical exit step, less well understood, probably involves PAH/OH exchange (4, 32).

Several groups have recently expression-cloned cDNAs encoding rat (31, 34) and flounder (38) PAH transporters. These appear to function as PAH/alpha -ketoglutarate exchangers and are cis-inhibited by a broad array of candidate substrates. However, other than PAH (which is transported; see Refs. 31, 34, and 38), tetraethylammonium (which is not transported; Ref. 34), and urate [which either is (31) or is not (38) transported], direct testing of transport has been limited to the report by Sekine et al. (31), in which cell-associated counts of tracer methotrexate (MTX), cAMP, cGMP, PGE2, urate, and alpha -ketoglutarate were substantially increased in Xenopus oocytes that express the OAT1 organic ion transporter relative to control oocytes.

To understand further the molecular mechanisms of organic anion secretion in humans, to evaluate further the substrate specificity of the PAH transporter, and to test the hypothesis that the PAH transporter is directly regulated by PKC, we have cloned, expressed, and characterized a human kidney PAH transporter (hPAHT). Although hPAHT shares many characteristics with the rat PAH transporter, it demonstrates a substantially more narrow substrate specificity. Additionally, we provide evidence that hPAHT is acutely downregulated by PKC.


    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

EST database search, RT-PCR, and construction of a full-length cDNA. The sequence of the rat PAH transporter OAT1 (31) was used to find homologous sequences in the GenBank EST database. Human fetal brain EST 36482, which appeared to consist of most of the downstream human PAH transporter, was obtained (Research Genetics). Clonality of the sample was achieved by plating on LB agar, transferring to Nytran Plus nylon filters (Schleicher & Schuell), and hybridizing overnight with a [32P]dATP random primer-labeled 5' PCR fragment generated as described below. The final two washes after hybridization consisted of 0.1× SSC and 0.1% SDS at 65°C. Filters were exposed overnight to Kodak Omat X-AR film at -70°C, and positive colonies were picked and confirmed by sequencing both strands. A corresponding cDNA was then obtained from adult human kidney mRNA (0.5 µg, Clontech) using RT-PCR and primers derived from the EST 36482 sequence at the extreme 5' ("P6": 5' CCGATGCCAACCTCAGCAAG) and 3' ("P11": 5' AGATGCTTTCCTGAACCACAACC) ends. PCR was performed using the Expand High-Fidelity system (Boehringer-Mannheim) as follows: initial denaturation at 94°C for 1 min; 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min; and a final extension at 72°C for 10 min. The resulting 1.6-kb PCR product was subcloned into the TA cloning vector (Invitrogen) and was found to be identical upon sequencing to EST 36482 from human fetal brain.

To obtain the missing 5' region of the kidney cDNA, a forward PCR primer ("P1") corresponding to the extreme 5' region of rat OAT1 (5' TGAAAGCTGAGCTGTCCAGACC), was used in RT-PCR with a reverse primer ("P2") derived from sequence 200 bp from the 5' end of EST 36482 (5' AGTCACGATGGTAGATGGGAAGG) (Fig. 1A). First-strand cDNA was reverse-transcribed from human kidney mRNA (0.5 µg, Clontech) using a Not I primer-adapter (SuperScript Plasmid System, GIBCO-BRL). PCR was performed with the Expand High-Fidelity system as follows: initial denaturation at 94°C for 1.5 min; 35 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 2 min; and a final extension at 72°C for 10 min. A PCR product of the expected size (~625 bp) was subcloned into the TA cloning vector, and both strands were sequenced.


View larger version (15K):
[in this window]
[in a new window]
 


View larger version (73K):
[in this window]
[in a new window]
 


View larger version (61K):
[in this window]
[in a new window]
 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Human kidney p-aminohippurate (PAH) transporter (hPAHT) cDNA clone and gene localization. A: human expressed sequence tags R25797 and R46796 represent opposite ends of clone 36482, which was aligned to rat OAT1 as shown. Corresponding cDNA was cloned by RT-PCR from human kidney. The missing 5'-UTR and 100 bp of open-reading frame were obtained by RT-PCR of human kidney mRNA using a rat OAT1 primer as described in EXPERIMENTAL PROCEDURES. B: deduced amino acid sequence of hPAHT aligned against the rat PAH transporters (OAT1/ROAT) and against the mouse sequence NKT. Boxes represent identities. C: Northern blot analysis of several human tissues using a 5' hPAHT probe. A single strongly hybridizing band of ~2.4 kb is seen in kidney. D: representative PCR-based monochromosomal somatic cell hybrid mapping of hPAHT. Primers from the 3'-UTR of the hPAHT cDNA were used as described in EXPERIMENTAL PROCEDURES. Lanes 1-22 and the lanes X and Y represent human chromosomes. Lanes A and B represent cell hybrids containing genomic DNA from hamster and mouse, respectively. Lane C represents human genomic DNA. A single product of the expected size was generated from chromosome 11 and human genomic DNA.

The two fragments comprising the full-length cDNA were generated by restriction with Sma I and Not I, gel-purified, ligated in the pcDNA3 vector (Invitrogen) at the Not I site, and transformed into DH5alpha competent cells. A colony with the expected insert size was sequenced completely in both directions. This full-length renal cDNA is called hPAHT. Nucleotide and amino acid sequences were analyzed using MacVector and GeneWorks software programs.

Transient expression in HeLa cells and transport assays. Full-length hPAHT was subcloned into the pCDNA3 vector such that the coding strand was downstream of the T7 and cytomegalovirus promoters and was transiently expressed as previously described (11, 15). Briefly, HeLa cells in 35-mm dishes were infected by vaccinia vTF7-3. Subsequently, premixed cDNA (5 µg) and Lipofectin (10 µg) were added. After ~20 h incubation, cells were used in influx experiments. [3H]PAH (0.4 µM) or 14C-labeled alpha -ketoglutarate (0.6 µM) was added to 1 ml Waymouth buffer (135 mM NaCl, 13 mM HEPES, 2.5 mM CaCl2, 1.2 mM MgCl2, 0.8 mM MgSO4, 5 mM KCl, and 28 mM D-glucose) and timed uptakes were performed, followed by washing. Cells from a single dish (~1 mg protein) were scraped into scintillation cocktail and counted.

For substrate Km determinations, [3H]PAH uptakes were determined in duplicate on a given transfection in the presence of three concentrations (10 nM, 100 nM, and 1 µM) of unlabeled PAH. Inhibition dose responses were curve fitted, and the Km values were calculated from two separate transfections.

Northern blot analysis. The 625-bp 5' hPAHT PCR product in the TA cloning vector was linearized as a template for a digoxigenin-labeled antisense RNA probe, which was hybridized to two human multiple tissue Northern blots (Clontech). Hybridization was carried out overnight at 65°C in 5× SSC, 2% blocking reagent, 0.1% N-lauroylsarcosine, 0.02% SDS (Genius System, Boehringer Mannheim Biochemicals). This was followed by washes of increasing stringency: twice with 1× SSC, 0.1% SDS; twice with 0.5× SSC, 0.1% SDS; and twice with 0.1× SSC, 0.1% SDS; all at 65°C. Detection was performed using a horseradish peroxidase-coupled anti-digoxigenin antibody (Boehringer Mannheim) and enhanced chemiluminescence (ECL, Amersham), followed by radiography. Blots were then rehybridized with an [alpha -32P]dATP random primer-labeled beta -actin DNA probe (Clontech) to assess sample loading.

Chromosomal localization of hPAHT. PCR-based monochromosomal somatic cell hybrid mapping was performed with a set of hPAHT 3'-untranslated region (3'-UTR) primers: 5' TGAAAGCTGAGCTGTCCAGACC and 5' AGTCACGATGGTAGATGGGAAGG. An initial denaturation at 94°C for 1.5 min was followed by 40 cycles: 94°C for 30 s, 65°C for 30 s, 72°C for 30 s, and a final extension of 72°C for 1.5 min. Products were separated on a 12% polyacrylamide gel, stained with ethidium bromide, and photographed.

Reagents. [3H]MTX, a gift from Dr. I. David Goldman, was synthesized and purified by HPLC as described (10). Somatic cell hybrids from Coriell Institute, Camden, NJ (8), containing individual human chromosomes were a gift from Raju Kucherlapati (Albert Einstein). The following sources were also used: [3H]PAH, 14C-labeled alpha -ketoglutarate, and [3H]PGE2 were from DuPont-New England Nuclear; Lipofectin was from GIBCO-BRL; N-(2{[3-(4-bromophenyl)-2-propenyl]-amino}-ethyl)-5-isoquinolinesulfonamide (H-89), staurosporine, phorbol 12-myristate 13-acetate (PMA), and 4alpha -phorbol-12,13 didecanoate (4alpha -PDD) were from Calbiochem; furosemide was from Molecular Probes; unlabeled PGF2alpha was from Cayman; and the remainder were from Sigma.


    RESULTS
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

Searching of the human EST database with the rat OAT1 PAH transporter sequence yielded two hits from fetal brain with >60% identity (R25797 and R46796) (Fig. 1A). These corresponded to both ends of a single clone (clone 36482) which, by size, appeared to represent a partial human homolog of rat OAT1/ROAT. The corresponding adult human kidney cDNA was obtained by RT-PCR from human kidney mRNA. The missing 5' region was obtained by RT-PCR of adult human kidney mRNA using an upstream rat OAT1 primer and a downstream primer based on sequence obtained from the kidney clone and from clone 36482 (Fig. 1A).

Together, the full-length hPAHT cDNA has a single long open-reading frame of 1,650 bp encoding a deduced protein of 550 amino acids. In Fig. 1B, hPAHT is aligned with rat OAT1/ROAT (31, 34) and with NKT (19), a similar deduced protein from the mouse that has not yet been shown to transport PAH. The amino acid identities between hPAHT and OAT1/ROAT, NKT, and fROAT are 87%, 85%, and 48%, respectively. The hPAHT deduced protein sequence also has weak homology to the human cation transporters hOCTN2 (29% identity) (39) and hOCT1 (32% identity) (41). The hPAHT protein has 12 predicted transmembrane spans based on Kyte-Doolittle hydropathy analysis (18); PKC phosphorylation consensus sites at Ser271, Ser278, Thr284, Thr334, and Ser521 and PKA phosphorylation consensus sites at Ser276, Thr318, Thr334, and Ser469 (16, 25); and N-linked glycosylation sites at Asn39, Asn56, Asn92, Asn97, and Asn113.

The tissue distribution of hPAHT expression in adult human tissues by Northern blot analysis of poly(A)+ RNA is extremely narrow; a single dominant transcript of ~2.4 kb was observed only in kidney (Fig. 1C). (Not shown is a negative blot containing mRNA for human spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes). Despite the lack of a hybridizing band in the "brain" lane, it seems likely that hPAHT is expressed in the brain, since essentially identical sequences were found in several ESTs derived from two separate human fetal and adult brain cDNA libraries (GenBank ESTs R25797, R46796, AA351031, AA351032). Indeed, the initial EST that forms the basis for the present cloning effort was derived from human brain (see EXPERIMENTAL PROCEDURES). This narrow expression pattern (kidney and brain) is similar to that of OAT1/ROAT in the rat and of NKT in the mouse (19, 31, 34).

To determine the chromosomal localization of the hPAHT gene, PCR-based monochromosomal somatic cell hybrid mapping was performed with a set of 3'-UTR primers. These studies indicated that the hPAHT gene is located on chromosome 11 (Fig. 1D). (Faint bands in the chromosome 15 and Y lanes were not reproducible and appear to represent nonspecific amplification). We note that region 11q13 of the human genome is syntenic with the region of mouse chromosome 19 to which NKT was previously localized (19, 30).

Figure 2A shows that hPAHT catalyzed the time-dependent uptake of tracer PAH. An "overshoot" was observed when cells were assayed by rapid transfer from a HCO3/CO2 environment to a HEPES-containing buffer. This result, similar to our findings on prostaglandin uptake mediated by the prostaglandin transporter, PGT (5), is consistent with exchange-mediated secondary active transport in which an outwardly directed gradient for a cytosolic exchange partner (here likely alpha -ketoglutarate) is depleted during the uptake experiment because of abundance of the external exchange partner (PAH).


View larger version (14K):
[in this window]
[in a new window]
 


View larger version (13K):
[in this window]
[in a new window]
 


View larger version (19K):
[in this window]
[in a new window]
 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   hPAHT is a PAH/alpha -ketoglutarate exchanger. A: time dependence of [3H]PAH uptake at 23°C. Each point represents the mean of replicate measurements from 2-3 separate transfections. Solid squares: exposure to culture medium up to the start of the tracer uptake period. hPAHT-expressing HeLa cells in DMEM were washed briefly, and 0.4 µM [3H]PAH in Waymouth was added. Two to 120 min later, dishes were washed and scraped for counting (i.e., the total Waymouth exposure varied from 2-120 min). With this method, PAH uptake exhibits an "overshoot" that peaks at 30 min. Solid circles: exposure to Waymouth buffer before the uptake period. Cells in DMEM medium were washed briefly and placed in Waymouth buffer. At various time points 2-118 min later, [3H]PAH in Waymouth was added and tracer uptakes were carried out until a total of 120 min in Waymouth had been achieved. At 120 min, all dishes were washed and scraped for counting. No "overshoot" is observed with this method. B: time-dependent stimulation of subsequent [3H]PAH uptake by glutarate preincubation. Solid squares: hPAHT transfected. Solid circles: sham transfected. HeLa cells expressing hPAHT were washed briefly and placed into serum-free DMEM at 37°C. Between 0 and 120 min later, glutarate was added to a final concentration of 5 mM. When all the dishes had been in serum-free DMEM for 120 min (variable time of glutarate exposure), a 10-min uptake using 0.4 µM [3H]PAH was performed in Waymouth. Longer exposures to glutarate progressively increased the subsequent PAH uptake, whereas the sham-transfected cells exhibited a very low PAH uptake. C: comparison of the effect of preincubation with alpha -ketoglutarate (alpha -KG) vs. glutarate (each for 2 h at 5 mM) on subsequent [3H]PAH uptake over 10 min in hPAHT-expressing HeLa cells. D: effect of preincubation with unlabeled PAH (2 h, 5 mM) on the subsequent uptake of 14C-labeled alpha -ketoglutarate in hPAHT-expressing HeLa cells vs. sham-transfected HeLa cells.

Three additional sets of experiments also suggest such an exchange model. First, preincubation for various times with glutarate, a substrate of the PAH/alpha -ketoglutarate exchanger that crosses the plasma membrane well by nonionic diffusion (26, 27, 34), produced a time-dependent stimulation of subsequent PAH uptake (Fig. 2, B and C). HeLa cells that underwent sham transfection had very low PAH uptake that could not be stimulated by preincubation in glutarate (Fig. 2B). Similar results were seen when a control plasmid was transfected (data not shown).

Second, preincubation with alpha -ketoglutarate stimulated subsequent tracer PAH uptake, albeit to a lesser extent than preincubation with glutarate (Fig. 2C). Although control HeLa cell monolayers exhibited substantial accumulation of 14C-labeled alpha -ketoglutarate (~1 pmol · mg protein-1 · 10 min-1) compared with the uptake of [3H]PAH (~1 fmol · mg protein-1 · 10 min-1), it is likely that alpha -ketoglutarate permeates the cells less well by diffusion than glutarate (34).

Third, preincubation of hPAHT-expressing HeLa cells with unlabeled PAH produced significant stimulation of subsequent 14C-labeled alpha -ketoglutarate uptake (Fig. 2D). Sham-transfected HeLa cells also exhibited a very small degree of stimulation of alpha -ketoglutarate uptake by PAH preincubation (Fig. 2D), suggesting that these cells express a low-level background exchanger for these substrates.

We performed kinetic studies using 5-min uptake (0.4 µM [3H]PAH) in the presence or absence of unlabeled PAH (1 µM, 10 µM, or 100 µM). The data could be fit with a single exponential to yield an apparent Km of 5 µM (data not shown).

Various unlabeled organic anions cis-inhibited hPAHT (Fig. 3A). Furosemide, probenecid, hippurate, alpha -ketoglutarate, glutarate, indomethacin, and fluorescein moderately or strongly inhibited [3H]PAH uptake. This pattern is similar to that of rat OAT1, which is inhibited by furosemide, indomethacin, probenecid, and alpha -ketoglutarate (31). In contrast, aspirin, penicillin G, anandamide, MTX, mercury-cysteine complex, 8-bromo-cAMP, and PGF2alpha produced minimal or no inhibition. Although reported to stimulate PAH transport in isolated rabbit proximal tubules (3), we found that bovine serum albumin produced modest inhibition of hPAHT (Fig. 3A).


View larger version (27K):
[in this window]
[in a new window]
 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Candidate hPAHT substrates. Each point represents the mean of replicate measurements from 2-3 separate transfections. A: cis-inhibition of [3H]PAH uptake by unlabeled organic anions. A 10-min tracer uptake was performed, using the method described in Fig. 2A, in presence or absence of unlabeled organic anions (100 µM final). Data are expressed as PAH uptake relative to control (absence of unlabeled compounds). BSA, bovine serum albumin. B: lack of PGE2 or methotrexate (MTX) transport by hPAHT. HeLa cells either sham-transfected or transfected with hPAHT cDNA were placed in serum-free DMEM for 2 h without or with 5 mM glutarate, and then a 10-min tracer uptake in Waymouth was performed with [3H]PGE2 (0.5 nM), [3H]MTX (0.2 µM), or [3H]PAH (0.4 µM). Uptake units are in pmol/mg protein for PAH and MTX and in fmol/mg protein for PGE2.

The weak cis-inhibitory interaction of both PGF2alpha and MTX with hPAHT stands in contrast to the results of similar experiments reported for rat OAT1, in which PGE2 and MTX strongly cis-inhibited PAH uptake (31). In that report, PGE2 and MTX exhibited "uptake" as defined by an OAT1-induced increase in cell-associated tracer counts (31). To test directly the substrate specificity of hPAHT, we measured hPAHT-mediated cell association of [3H]PGE2 and [3H]MTX and compared these to [3H]PAH (Fig. 3B; note that the units of uptake for PAH and MTX are different from those for PGE2). As shown at left, expression of hPAHT resulted in a substantial increment of cell-associated tracer PAH counts compared with sham-transfected cells. Furthermore, pretreatment with 5 mM glutarate increased cell-associated tracer PAH counts by ~40%, indicating that PAH is well transported by hPAHT. In contrast, expression of hPAHT caused no increment in cell-associated MTX counts (middle) or PGE2 counts (right), indicating that neither MTX nor PGE2 is transported. (For comparison, the 10-min PGE2 uptake by the prostaglandin transporter PGT at this PGE2 substrate concentration would be ~250 fmol/mg protein; see Ref. 15).

We tested the hypothesis that hPAHT is regulated by phosphorylation. Although a variety of activators and/or inhibitors of PKA and tyrosine kinase pathways had no effect on [3H]PAH uptake, the calcium ionophore A23187 produced a small inhibition (Fig. 4), whereas PMA significantly inhibited transport (Fig. 4, A and C). As shown by a single experiment (Fig. 4B), phorbol ester inhibited transport in a time-dependent fashion that was maximal at 30 min. Half-maximal inhibition was obtained at 80 nM (data not shown). The phorbol-induced inhibition was reversed by the inhibitor staurosporine and was not seen with the inactive form of PMA, 4alpha -PDD (Fig. 4C), confirming that the inhibition is due to PKC activation and not blockade of the transporter by PMA.


View larger version (14K):
[in this window]
[in a new window]
 


View larger version (13K):
[in this window]
[in a new window]
 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibition of hPAHT by protein kinase C (PKC) activation. Each point represents the mean of replicate measurements from 2-3 separate transfections. A: effect of various kinase modulators on hPAHT. HeLa cells expressing hPAHT were washed and placed in serum-free DMEM ± the agents shown for 120 min. Concentrations were as follows: phorbol 12-myristate 13-acetate (PMA, 100 nM), A23187 (1 µM), N-(2{[3-(4-bromophenyl)-2-propenyl]-amino}-ethyl)-5-isoquinolinesulfonamide (H-89, 10 µM), 8-Br-cAMP (10 µM), and genistein (50 µM). Thereafter, the dishes were washed and a 10-min tracer PAH uptake in Waymouth was performed. Only A23187 and PMA caused a significant change in PAH uptake. B: time dependence of phorbol ester inhibition. HeLa cells expressing hPAHT were incubated in 100 nM PMA for the times indicated, then washed, after which [3H]PAH uptake was determined as in Fig. 1B. Full inhibition of transport was achieved by 30 min. C: specificity of phorbol inhibition. HeLa cells expressing hPAHT were incubated in Waymouth (2 h control), PMA (100 nM, 2 h), staurosporine (2 µM, 2.5 h), staurosporine (2 µM, 30 min) followed by combined staurosporine (2 µM) and PMA (100 nM, 2 h), or the inactive phorbol, 4alpha -phorbol-12,13 didecanoate (4alpha -PDD, 100 nM, 2 h). The PMA effect is reversed by preincubation with staurosporine and is not mimicked by 4alpha -PDD.


    DISCUSSION
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

The present study describes the cloning, expression, and characterization of a human kidney PAH transporter, hPAHT. hPAHT shares properties with the rat (31, 34) and flounder (38) transporters in that the mRNA expression is limited, PAH uptake is trans-stimulated by preincubation with glutarate and is inhibited strongly by probenecid, and a fair number of organic anions can cis-inhibit uptake. In addition, we now show that tracer alpha -ketoglutarate uptake is stimulated by preincubation with PAH. However, unlike the rat OAT1 (31), hPAHT is not capable of transporting PGE2 or MTX. Thus hPAHT has a seemingly narrow substrate specificity. Another important finding is that hPAHT-mediated PAH uptake is inhibited by PKC activation, suggesting that the PKC-mediated inhibition of transepithelial organic anion secretion described in several preparations is likely due, at least in part, to direct effects on the basolateral exchanger.

It is unclear whether the "organic anion secretory system" consists of a single transporter with very broad specificity, analogous to P-glycoprotein, or of multiple proteins with more narrow, but perhaps overlapping, specificities. Ullrich and Rumrich (37) carried out extensive micropuncture studies in which they assessed the ability of organic compounds to compete for peritubular PAH uptake. From these studies, they concluded that a typical substrate for this system has the following properties: 1) a hydrophobic domain 4-10 Å long; 2) the strength of the interaction varies with the ionic charge (i.e., pKa varies with Ki); 3) the transporter accepts hydrophobic substrates that cannot be ionized, in which case the carrier does not sense the degree of ionization; and 4) electron-attracting side groups (Cl, Br, NO2) augment the interaction with the PAH transporter (9, 36, 37). This definition is extremely inclusive. Their model has been interpreted to mean that a single protein mediates this broad transport. Indeed, a recent report on the rat renal PAH exchanger cDNA by Sekine et al. (31) is consistent with this interpretation, in that cell-associated counts of tracer MTX, cAMP, cGMP, PGE2, urate, and alpha -ketoglutarate were all increased in oocytes expressing OAT1 relative to controls.

In contrast, neither tracer PGE2 nor MTX exhibited significant cell-associated counts in hPAHT-expressing HeLa cells relative to controls. Our negative data are almost certainly not due to technical problems. We have, for example, demonstrated high tracer PGE2 and PGF2alpha transport rates by the prostaglandin transporter PGT using the same expression and assay systems (5, 15, 20). Possible explanations for the discrepancy include species differences in the transporter cDNAs or differences in the expression systems (Xenopus oocytes vs. mammalian cells, although we have seen no differences between these two expression systems with regard to PGT; Ref. 5). It is also possible that the hPAHT clone does not correspond exactly to rat OAT1, although there is a very high degree of amino acid identity between the two. In this regard, the apparent affinity of hPAHT for PAH (~5 µM) is substantially lower than that reported for the rat transporter as reported by Sweet et al. (Ref. 34; 70 µM), but is similar to that of the rat as reported by Sekine et al. (Ref. 31; 14 µM) and to that of the flounder homolog (20 µM) (38).

It is of interest that, in rat micropuncture studies, several seemingly generic organic anions fail to block PAH uptake, yet are secreted by the proximal tubule (e.g., 4-aminobenzoate; see Refs. 23 and 37). This indicates that other transporters must exist outside of the "PAH framework." Moreover, Miller and Pritchard (22) have shown that uphill transport of fluorescein-MTX across the killifish proximal tubule basolateral membrane is poorly inhibited by PAH, indicating an alternative entry pathway. Clearly, both the number of systems and their relative contributions to the handling of a given organic anion remain areas of uncertainty (29).

The nephrotoxic effect of several organic anions, including mercury-cysteine conjugates, can be blocked in rats and in isolated renal cells by probenecid, suggesting that these conjugates are transported by the PAH transporter, and there is a correlation between the intracellular concentration and the degree of toxic response (2, 40). We found that a cysteine-mercury complex failed to interact with hPAHT. This makes it unlikely that hPAHT accounts for basolateral inorganic mercury uptake by the proximal tubule. Similarly, although carrier-mediated transport of the cannabinoid receptor agonist anandamide has been proposed (1), the lack of significant inhibition makes it unlikely that hPAHT is this carrier (Fig. 3A).

Transport by hPAHT was acutely inhibited to a small extent by the calcium ionophore A23187 and strongly by low concentrations of the PKC activator PMA, but not by maneuvers expected to alter cAMP or tyrosine phosphorylation. The phorbol ester effect is specific for PKC activation, and does not appears to be due to direct blockade of the transporter by PMA itself, since the inhibition was reversed by the PKC blocker staurosporine and was not replicated by the inactive phorbol 4alpha -PDD (Fig. 4C). There is clear evidence (6) that phorbol ester added to HeLa cells under comparable conditions causes translocation from the cytosol to the membrane of PKC isoforms alpha , gamma , and epsilon .

Our findings on PKC are in accord with a number of studies showing that renal tubular organic anion secretion can be acutely downregulated by PKC (see NOTE ADDED IN PROOF). Dopamine was shown to inhibit the vectorial secretion of dichlorophenoxyacetic acid by primary culture monolayers of flounder proximal tubule, an effect that was mimicked by phorbol ester and blocked by staurosporine (12). Vectorial secretion of PAH by monolayers of the opossum kidney (OK) proximal tubule cell line was inhibited by parathyroid hormone (PTH), and the second messenger for PTH was probably PKC (24, 35). Finally, fluorescein secretion by killifish proximal tubules was inhibited by PKC activation (21).

Takano et al. (35) reported that basolateral uptake of PAH in OK cells is almost completely inhibited by PMA (100 nM) treatment for ~3 h, whereas we never achieved full inhibition of PAH uptake by PMA in the present system. Although the exact reason(s) for this quantitative discrepancy is not clear, it is possible that activation of PKC in OK cells causes inhibition of the basolateral PAH uptake exchanger at several levels (e.g., direct phosphorylation of the exchanger plus PKC-mediated exchanger internalization), whereas only one of these pathways may be operative in the heterologous HeLa cell expression system. Further insights into the differences between the degree of inhibition by PKC of OK cells versus the hPAHT transporter must await cloning and expression of the OK PAH transporter cDNA.

In the case of OK cells and killifish tubules, PKC inhibited primarily the basolateral entry step (21, 35). Although we have not yet localized hPAHT in the human kidney, we expect that it will be expressed at the basolateral membrane of the proximal tubule. Our data would therefore suggest that PKC inhibits organic anion secretion by directly modulating the basolateral anion exchanger. Further studies are underway to test directly whether hPAHT can be phosphorylated by PKC.

In summary, we have cloned and functionally expressed a novel human renal PAH transporter, hPAHT, the gene for hPAHT isolated on human chromosome 11. The substrate specificity is narrower than that reported for the rat transporter OAT1. hPAHT is inhibited by PKC activation, suggesting that the basolateral entry step in transepithelial organic anion transport may be regulated by serine-threonine phosphorylation of the exchanger.


    NOTE ADDED IN PROOF

While this paper was in press, another report of regulation of the rat organic anion transporter OAT1 by phorbal ester appeared (Y. Uwai, M. Tokuda, K. Takami, Y. Hashimoto, and K. Inui. Functional characterization of the rat multispecific organic anion transporter OAT1 mediating basolateral uptake of anionic drugs in the kidney. FEBS Lett. 438: 321-324, 1998).


    ACKNOWLEDGEMENTS

We thank Dr. I. David Goldman for the [3H]methotrexate.


    FOOTNOTES

A portion of the work was supported by grants to V. L. Schuster from the National Institute of Diabetes and Digestive and Kidney Diseases (Grant DK-49688), from Alcon Laboratories, and from the American Heart Association (New York City Affiliate).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: V. L. Schuster, Renal Division, Ullmann 617, 1300 Morris Park Ave., Bronx, NY 10461.

Received 2 June 1998; accepted in final form 22 October 1998.


    REFERENCES
Top
Abstract
Introduction
Experimental procedures
Results
Discussion
References

1.   Beltramo, M., N. Stella, A. Calignano, S. Y. Lin, A. Makriyannis, and D. Piomelli. Functional role of high-affinity anandamide transport, as revealed by selective inhibition. Science 277: 1094-1097, 1997[Abstract/Free Full Text].

2.   Berndt, W. O. Potential involvement of renal transport mechanisms in nephrotoxicity. Toxicology 46: 77-82, 1989.

3.   Bessseghir, K., D. Mosig, and F. Roch-Ramel. Facilitation by serum albumin of renal tubular secretion of organic anions. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F475-F484, 1989[Abstract/Free Full Text].

4.   Blomstedt, J. W., and P. S. Aronson. pH gradient-stimulated transport of urate and p-aminohippurate in dog renal microvillus membrane vesicles. J. Clin. Invest. 65: 931-934, 1980.

5.   Chan, B., J. A. Satriano, M. Pucci, and V. L. Schuster. Mechanism of PGE2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter "PGT". J. Biol. Chem. 273: 6689-6697, 1998[Abstract/Free Full Text].

6.   Chun, J.-S., M.-J. Ha, and B. S. Jacobson. Differential translocation of protein kinase C epsilon  during HeLa cell adhesion to a gelatin substratum. J. Biol. Chem. 271: 13008-13012, 1996[Abstract/Free Full Text].

7.   Dantzler, W. H. Comparative aspects of renal function. In: The Kidney: Physiology and Pathophysiology (2nd ed.), edited by D. W. Seldin, and G. Giebisch. New York: Raven, 1992, p. 885-942.

8.   Drwinga, H. L., L. H. Toji, C. H. Kim, A. E. Greene, and R. A. Mulivor. NIGMS human/rodent somatic cell hybrid mapping panels 1 and 2. Genomics 16: 311-314, 1993[Medline].

9.   Fritzsch, G., G. Rumrich, and K. J. Ullrich. Anion transport through the contralateral cell membrane of renal proximal tubule. The influence of hydrophobicity and molecular charge distribution on the inhibitory activity of organic anions. Biochim. Biophys. Acta 978: 249-256, 1989[Medline].

10.   Fry, D. W., J. C. Yalowich, and I. D. Goldman. Rapid formation of poly-gamma -glutamyl derivatives of methotrexate and their association with dihydrofolate reductase as assessed by high pressure liquid chromatography in the Ehrlich ascites tumor cell in vitro. J. Biol. Chem. 257: 1890-1896, 1982[Free Full Text].

11.   Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83: 8122-8126, 1986[Abstract/Free Full Text].

12.   Halpin, P. A., and J. L. Renfro. Renal organic anion secretion: evidence for dopaminergic and adrenergic regulation. Am. J. Physiol. 271 (Regulatory Integrative Comp. Physiol. 40): R1372-R1379, 1996[Abstract/Free Full Text].

13.   Heidenhain, R. Versuche über den Vorgang der Harnabsonderung. Pflügers Arch. 9: 1-27, 1874.

14.   Hook, J. B., and W. R. Hewitt. Development of mechanisms for drug excretion. Am. J. Med. 62: 497-506, 1993.

15.   Kanai, N., R. Lu, J. A. Satriano, Y. Bao, A. W. Wolkoff, and V. L. Schuster. Identification and characterization of a prostaglandin transporter. Science 268: 866-869, 1995[Abstract/Free Full Text].

16.   Kennelly, P. J., and E. G. Krebs. Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J. Biol. Chem. 266: 15555-15558, 1991[Free Full Text].

17.   Kluwe, W. M., and J. B. Hook. Effects of environmental chemicals on kidney metabolism and function. Kidney Int. 18: 648-655, 1980[Medline].

18.   Kyte, J., and R. F. Doolittle. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105-132, 1982[Medline].

19.   Lopez-Nieto, C. E., G. You, K. T. Bush, E. J. Barros, D. R. Beier, and S. K. Nigam. Molecular cloning and characterization of NKT, a gene product related to the organic cation transporter family that is almost exclusively expressed in the kidney. J. Biol. Chem. 272: 6471-6478, 1997[Abstract/Free Full Text].

20.   Lu, R., N. Kanai, Y. Bao, and V. L. Schuster. Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA (hPGT). J. Clin. Invest. 98: 1142-1149, 1996[Medline].

21.   Miller, D. S. Protein kinase C regulation of organic anion transport in renal proximal tubule. Am. J. Physiol. 274 (Renal Physiol. 43): F156-F164, 1998[Abstract/Free Full Text].

22.   Miller, D. S., and J. B. Pritchard. Dual pathways for organic anion secretion in renal proximal tubule. J. Exp. Zool. 279: 462-470, 1997[Medline].

23.   Moller, J. V., and M. I. Sheikh. Renal organic anion transport system: pharmacological, physiological, and biochemical aspects. Pharmacol. Rev. 34: 315-358, 1983[Medline].

24.   Nagai, J., I. Yano, Y. Hashimoto, M. Takano, and K. Inui. Inhibition of PAH transport by parathyroid hormone in OK cells: involvement of protein kinase C pathway. Am. J. Physiol. 273 (Renal Physiol. 42): F674-F679, 1997[Abstract/Free Full Text].

25.   Pearson, R. B., and B. E. Kemp. Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Methods Enzymol. 200: 62-81, 1991[Medline].

26.   Pritchard, J. B. Coupled transport of p-aminohippurate by rat kidney basolateral membrane vesicles. Am. J. Physiol. 255 (Renal Fluid Electrolyte Physiol. 24): F597-F604, 1988[Abstract/Free Full Text].

27.   Pritchard, J. B. Rat renal cortical slices demonstrate p-aminohippurate/glutarate exchange and sodium/glutarate coupled p-aminohippurate transport. J. Pharmacol. Exp. Ther. 255: 969-975, 1990[Abstract/Free Full Text].

28.   Pritchard, J. B., and D. S. Miller. Comparative insights into the mechanisms of renal organic anion and cation secretion. Am. J. Physiol. 261 (Regulatory Integrative Comp. Physiol. 30): R1329-R1340, 1991[Abstract/Free Full Text].

29.   Pritchard, J. B., and D. S. Miller. Proximal tubular transport of organic anions and cations. In: The Kidney: Physiology and Pathophysiology (2nd ed.), edited by D. W. Seldin, and G. Giebisch. New York: Raven, 1992, p. 2921-2945.

30.   Rochelle, J. M., M. L. Watson, R. J. Oakey, and M. F. Seldin. A linkage map of mouse chromosome 19: definition of comparative mapping relationships with human chromosomes 10 and 11 including the MEN1 locus. Genomics 14: 26-31, 1992[Medline].

31.   Sekine, T., N. Watanabe, M. Hosoyamada, Y. Kanai, and H. Endou. Expression cloning and characterization of a novel multispecific organic anion transporter. J. Biol. Chem. 272: 18526-18529, 1997[Abstract/Free Full Text].

32.   Steffens, T. G., P. D. Holohan, and C. R. Ross. Operational modes of the organic anion exchanger in canine renal brush-border membrane vesicles. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F596-F609, 1989[Abstract/Free Full Text].

33.   Sullivan, L. P., and J. J. Grantham. Specificity of basolateral organic anion exchanger in proximal tubule for cellular and extracellular solutes. J. Am. Soc. Nephrol. 2: 1192-1200, 1992[Abstract].

34.   Sweet, D. H., N. A. Wolff, and J. B. Pritchard. Expression cloning and characterization of ROAT1. The basolateral organic anion transporter in rat kidney. J. Biol. Chem. 272: 30088-30095, 1997[Abstract/Free Full Text].

35.   Takano, M., J. Nagai, M. Yasuhara, and K. Inui. Regulation of p-aminohippurate transport by protein kinase C in OK kidney epithelial cells. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F469-F475, 1996[Abstract/Free Full Text].

36.   Ullrich, K. J. Renal transporters for organic anions and organic cations. Structural requirements for substrates. J. Membr. Biol. 158: 95-107, 1997[Medline].

37.   Ullrich, K. J., and G. Rumrich. Contraluminal transport systems in the proximal renal tubule involved in secretion of organic anions. Am. J. Physiol. 254 (Renal Fluid Electrolyte Physiol. 23): F453-F462, 1988[Abstract/Free Full Text].

38.   Wolff, N. A., A. Werner, S. Burkhardt, and G. Burckhardt. Expression cloning and characterization of a renal organic anion transporter from winter flounder. FEBS Lett. 417: 287-291, 1997[Medline].

39.   Wu, X., P. D. Prasad, F. H. Leibach, and V. Ganapathy. cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family. Biochem. Biophys. Res. Commun. 246: 589-595, 1998[Medline].

40.   Zalups, R. K., and D. W. Barfuss. Participation of mercuric conjugates of cysteine, homocysteine, and N-acetylcysteine in mechanisms involved in the renal tubular uptake of inorganic mercury. J. Am. Soc. Nephrol. 9: 551-561, 1998[Abstract].

41.   Zhang, L., M. J. Dresser, A. T. Gray, S. C. Yost, S. Terashita, and K. M. Giacomini. Cloning and functional expression of a human liver organic cation transporter. Mol. Pharmacol. 51: 913-921, 1997[Abstract/Free Full Text].


Am J Physiol Renal Physiol 276(2):F295-F303
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Li, P. Duan, and G. You
Regulation of human organic anion transporter 1 by ANG II: involvement of protein kinase C{alpha}
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E378 - E383.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Kwon, W.-W. Wang, and S. Miller
Renal organic anion transporter 1 is maldistributed and diminishes in proximal tubule cells but increases in vasculature after ischemia and reperfusion
Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1807 - F1816.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
O. Kwon, S.-M. Hong, and K. Blouch
Alteration in Renal Organic Anion Transporter 1 After Ischemia/Reperfusion in Cadaveric Renal Allografts
J. Histochem. Cytochem., June 1, 2007; 55(6): 575 - 584.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Schneider, C. Sauvant, B. Betz, M. Otremba, D. Fischer, H. Holzinger, C. Wanner, J. Galle, and M. Gekle
Downregulation of organic anion transporters OAT1 and OAT3 correlates with impaired secretion of para-aminohippurate after ischemic acute renal failure in rats
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1599 - F1605.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. G. Aslamkhan, D. M. Thompson, J. L. Perry, K. Bleasby, N. A. Wolff, S. Barros, D. S. Miller, and J. B. Pritchard
The flounder organic anion transporter fOat has sequence, function, and substrate specificity similarity to both mammalian Oat1 and Oat3
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1773 - R1780.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T. Sekine, H. Miyazaki, and H. Endou
Molecular physiology of renal organic anion transporters
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F251 - F261.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. H.E. Smeets, R. A.M.H. van Aubel, A. C. Wouterse, J. J.M.W. van den Heuvel, and F. G.M. Russel
Contribution of Multidrug Resistance Protein 2 (MRP2/ABCC2) to the Renal Excretion of p-aminohippurate (PAH) and Identification of MRP4 (ABCC4) as a Novel PAH Transporter
J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2828 - 2835.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Zhang, C. E. Groves, A. Bahn, W. M. Barendt, M. D. Prado, M. Rodiger, V. Chatsudthipong, G. Burckhardt, and S. H. Wright
Relative contribution of OAT and OCT transporters to organic electrolyte transport in rabbit proximal tubule
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F999 - F1010.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Soodvilai, V. Chatsudthipong, K. K. Evans, S. H. Wright, and W. H. Dantzler
Acute regulation of OAT3-mediated estrone sulfate transport in isolated rabbit renal proximal tubules
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F1021 - F1029.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. H. Wright and W. H. Dantzler
Molecular and Cellular Physiology of Renal Organic Cation and Anion Transport
Physiol Rev, July 1, 2004; 84(3): 987 - 1049.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Ljubojevic, C. M. Herak-Kramberger, Y. Hagos, A. Bahn, H. Endou, G. Burckhardt, and I. Sabolic
Rat renal cortical OAT1 and OAT3 exhibit gender differences determined by both androgen stimulation and estrogen inhibition
Am J Physiol Renal Physiol, July 1, 2004; 287(1): F124 - F138.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. W. Beyenbach
Kidneys sans glomeruli
Am J Physiol Renal Physiol, May 1, 2004; 286(5): F811 - F827.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Sauvant, D. Hesse, H. Holzinger, K. K. Evans, W. H. Dantzler, and M. Gekle
Action of EGF and PGE2 on basolateral organic anion uptake in rabbit proximal renal tubules and hOAT1 expressed in human kidney epithelial cells
Am J Physiol Renal Physiol, April 1, 2004; 286(4): F774 - F783.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Aslamkhan, Y.-H. Han, R. Walden, D. H. Sweet, and J. B. Pritchard
Stoichiometry of organic anion/dicarboxylate exchange in membrane vesicles from rat renal cortex and hOAT1-expressing cells
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F775 - F783.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. H. Sweet, L. M. S. Chan, R. Walden, X.-P. Yang, D. S. Miller, and J. B. Pritchard
Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient
Am J Physiol Renal Physiol, April 1, 2003; 284(4): F763 - F769.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. G. Aslamkhan, Y.-H. Han, X.-P. Yang, R. K. Zalups, and J. B. Pritchard
Human Renal Organic Anion Transporter 1-Dependent Uptake and Toxicity of Mercuric-Thiol Conjugates in Madin-Darby Canine Kidney Cells
Mol. Pharmacol., March 1, 2003; 63(3): 590 - 596.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Bahn, M. Knabe, Y. Hagos, M. Rodiger, S. Godehardt, D. S. Graber-Neufeld, K. K. Evans, G. Burckhardt, and S. H. Wright
Interaction of the Metal Chelator 2,3-Dimercapto-1-propanesulfonate with the Rabbit Multispecific Organic Anion Transporter 1 (rbOAT1)
Mol. Pharmacol., November 1, 2002; 62(5): 1128 - 1136.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Takeda, S. Khamdang, S. Narikawa, H. Kimura, M. Hosoyamada, S. H. Cha, T. Sekine, and H. Endou
Characterization of Methotrexate Transport and Its Drug Interactions with Human Organic Anion Transporters
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 666 - 671.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y. Kobayashi, N. Ohshiro, A. Shibusawa, T. Sasaki, S. Tokuyama, T. Sekine, H. Endou, and T. Yamamoto
Isolation, Characterization and Differential Gene Expression of Multispecific Organic Anion Transporter 2 in Mice
Mol. Pharmacol., July 1, 2002; 62(1): 7 - 14.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. C. N. Buist, N. J. Cherrington, S. Choudhuri, D. P. Hartley, and C. D. Klaassen
Gender-Specific and Developmental Influences on the Expression of Rat Organic Anion Transporters
J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 145 - 151.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Kimura, M. Takeda, S. Narikawa, A. Enomoto, K. Ichida, and H. Endou
Human Organic Anion Transporters and Human Organic Cation Transporters Mediate Renal Transport of Prostaglandins
J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 293 - 298.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Kojima, T. Sekine, M. Kawachi, S. H. Cha, Y. Suzuki, and H. Endou
Immunolocalization of Multispecific Organic Anion Transporters, OAT1, OAT2, and OAT3, in Rat Kidney
J. Am. Soc. Nephrol., April 1, 2002; 13(4): 848 - 857.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. Motohashi, Y. Sakurai, H. Saito, S. Masuda, Y. Urakami, M. Goto, A. Fukatsu, O. Ogawa, and K.-i. Inui
Gene Expression Levels and Immunolocalization of Organic Ion Transporters in the Human Kidney
J. Am. Soc. Nephrol., April 1, 2002; 13(4): 866 - 874.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
G. Lee, S. Dallas, M. Hong, and R. Bendayan
Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations
Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
F. Islinger, M. Gekle, and S. H. Wright
Interaction of 2,3-Dimercapto-1-propane Sulfonate with the Human Organic Anion Transporter hOAT1
J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 741 - 747.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
N. A. WOLFF, B. GRUNWALD, B. FRIEDRICH, F. LANG, S. GODEHARDT, and G. BURCKHARDT
Cationic Amino Acids Involved in Dicarboxylate Binding of the Flounder Renal Organic Anion Transporter
J. Am. Soc. Nephrol., October 1, 2001; 12(10): 2012 - 2018.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. H. Sweet, K. T. Bush, and S. K. Nigam
The organic anion transporter family: from physiology to ontogeny and the clinic
Am J Physiol Renal Physiol, August 1, 2001; 281(2): F197 - F205.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. H. Cha, T. Sekine, J.-i. Fukushima, Y. Kanai, Y. Kobayashi, T. Goya, and H. Endou
Identification and Characterization of Human Organic Anion Transporter 3 Expressing Predominantly in the Kidney
Mol. Pharmacol., April 16, 2001; 59(5): 1277 - 1286.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. A. M. H. Van Aubel, R. Masereeuw, and F. G. M. Russel
Molecular pharmacology of renal organic anion transporters
Am J Physiol Renal Physiol, August 1, 2000; 279(2): F216 - F232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Burckhardt and N. A. Wolff
Structure of renal organic anion and cation transporters
Am J Physiol Renal Physiol, June 1, 2000; 278(6): F853 - F866.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. You, K. Kuze, R. A. Kohanski, K. Amsler, and S. Henderson
Regulation of mOAT-mediated Organic Anion Transport by Okadaic Acid and Protein Kinase C in LLC-PK1 Cells
J. Biol. Chem., March 31, 2000; 275(14): 10278 - 10284.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
E. S. HO, D. C. LIN, D. B. MENDEL, and T. CIHLAR
Cytotoxicity of Antiviral Nucleotides Adefovir and Cidofovir Is Induced by the Expression of Human Renal Organic Anion Transporter 1
J. Am. Soc. Nephrol., March 1, 2000; 11(3): 383 - 393.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. H. Cha, T. Sekine, H. Kusuhara, E. Yu, J. Y. Kim, D. K. Kim, Y. Sugiyama, Y. Kanai, and H. Endou
Molecular Cloning and Characterization of Multispecific Organic Anion Transporter 4 Expressed in the Placenta
J. Biol. Chem., February 11, 2000; 275(6): 4507 - 4512.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
B. C. BURCKHARDT, N. A. WOLFF, and G. BURCKHARDT
Electrophysiologic Characterization of an Organic Anion Transporter Cloned from Winter Flounder Kidney (fROAT)
J. Am. Soc. Nephrol., January 1, 2000; 11(1): 9 - 17.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Shuprisha, R. M. Lynch, S. H. Wright, and W. H. Dantzler
PKC regulation of organic anion secretion in perfused S2 segments of rabbit proximal tubules
Am J Physiol Renal Physiol, January 1, 2000; 278(1): F104 - F109.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. B. Pritchard, D. H. Sweet, D. S. Miller, and R. Walden
Mechanism of Organic Anion Transport across the Apical Membrane of Choroid Plexus
J. Biol. Chem., November 19, 1999; 274(47): 33382 - 33387.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. Cihlar, D. C. Lin, J. B. Pritchard, M. D. Fuller, D. B. Mendel, and D. H. Sweet
The Antiviral Nucleotide Analogs Cidofovir and Adefovir Are Novel Substrates for Human and Rat Renal Organic Anion Transporter 1
Mol. Pharmacol., September 1, 1999; 56(3): 570 - 580.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Gekle, S. Mildenberger, C. Sauvant, D. Bednarczyk, S. H. Wright, and W. H. Dantzler
Inhibition of initial transport rate of basolateral organic anion carrier in renal PT by BK and phenylephrine
Am J Physiol Renal Physiol, August 1, 1999; 277(2): F251 - F256.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Sauvant, H. Holzinger, and M. Gekle
Modulation of the Basolateral and Apical Step of Transepithelial Organic Anion Secretion in Proximal Tubular Opossum Kidney Cells. ACUTE EFFECTS OF EPIDERMAL GROWTH FACTOR AND MITOGEN-ACTIVATED PROTEIN KINASE
J. Biol. Chem., April 27, 2001; 276(18): 14695 - 14703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, R.
Right arrow Articles by Schuster, V. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, R.
Right arrow Articles by Schuster, V. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online