|
|
||||||||
-stimulated NO and cGMP via
V1 receptor in cultured rat
mesangial cells
Departments of 1 Nephrology and 2 Cardiology, Jichi Medical School, Tochigi, 329-0498 Japan
| |
ABSTRACT |
|---|
|
|
|---|
The present study examined how arginine
vasopressin (AVP) affects nitric oxide (NO) metabolism in cultured rat
glomerular mesangial cells (GMC). GMC were incubated with test agents
and nitrite, and intracellular cGMP content, inducible nitric oxide synthase (iNOS) mRNA, and iNOS protein were analyzed by the Griess method, enzyme immunoassay, and Northern and Western blotting, respectively. AVP inhibited lipopolysaccharide (LPS)- and
interleukin-1
(IL-1
)-induced nitrite production in a dose- and
time-dependent manner, with concomitant changes in cGMP content, iNOS
mRNA, and iNOS protein. This inhibition by AVP was reversed by
V1- but not by oxytocin-receptor
antagonist. Inhibition by AVP was also reproduced on LPS and
interferon-
(IFN-
). Protein kinase C (PKC) inhibitors reversed
AVP inhibition, whereas PKC activator inhibited nitrite production.
Although dexamethasone and pyrrolidinedithiocarbamate (PDTC),
inhibitors of nuclear factor-
B, inhibited nitrite production, further inhibition by AVP was not observed. AVP did not
show further inhibition of nitrite production with actinomycin D, an
inhibitor of transcription, or cycloheximide, an inhibitor of protein
synthesis. In conclusion, AVP inhibits LPS- and IL-1
-induced NO
production through a V1 receptor.
The inhibitory action of AVP involves both the activation of PKC and
the transcription of iNOS mRNA in cultured rat GMC.
nitrite production; oxytocin receptor; inducible nitric oxide synthase; V1-receptor antagonist; oxytocin receptor antagonist; lipopolysaccharide
| |
INTRODUCTION |
|---|
|
|
|---|
NITRIC OXIDE (NO) is a messenger molecule with diverse
actions, including vasodilatation, inhibition of platelet aggregation, antimicrobial defense, and inhibition of vascular smooth muscle cell
(VSMC) mitogenesis (3, 19, 22). Recent studies have shown that renal
glomerular mesangial cells (GMC) produce NO in response to cytokines
such as interleukin-1
(IL-1
), tumor necrosis factor,
interferon-
(IFN-
), and lipopolysaccharide (LPS) through an
induction of inducible NO synthase (iNOS) as well as VSMC (15, 31,
32).
Recently, endothelin (ET) or extracellular mononucleotides such as ATP and UTP have been found to inhibit cytokine-induced NO production via ET type A receptors (4) or purinergic P2Y2 receptors (9) in cultured rat GMC. Arginine vasopressin (AVP) is a well-known vasoconstrictor that causes a rapid phospholipase C-mediated hydrolysis of phosphoinositide through V1 receptors. Renal GMC are known to possess the V1 type of AVP receptor. AVP exhibits potent vasoconstriction, as well as other biological activity, on target cells such as the VSMC, hepatocytes, and GMC via the V1 type receptor (14).
In a recent study, we reported that AVP inhibits IL-1
-stimulated NO
production and iNOS messenger RNA expression via the V1 receptor in cultured rat VSMC
(17). Meanwhile, GMC in all likelihood represents a specialized
pericyte and possesses many of the functional properties of smooth
muscle cells (29). The contractile properties of GMC are well
established, and it has been demonstrated that cell contraction is
stimulated by a variety of vasoactive agents (6, 29). However, the
effect of AVP on the iNOS expression in GMC is still unknown.
Therefore, the present study was undertaken to evaluate how AVP affects NO and cGMP production, as well as iNOS mRNA and iNOS protein expression in rat GMC.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
Human recombinant IL-1
was purchased from Genzyme
(Cambridge, MA). The V1-receptor
antagonist, [1-(
-mercapto-
,
-cyclopentamethylene propionic
acid),2-(O-Me)Tyr2,Arg8]vasopressin,
and the oxytocin (Oxt)-receptor antagonist,
[d(CH2)5,Tyr(Me)2,Orn8]vasotocin,
were purchased from Peninsula Laboratories (Belmont, CA).
Other chemicals, such as LPS, AVP, human recombinant IFN-
, phorbol
12-myristate 13-acetate (PMA), calphostin C, staurosporine, dexamethasone, pyrrolidinedithiocarbamate (PDTC), actinomycin D,
cycloheximide, and IBMX were purchased from Sigma (St. Louis, MO), with
the exception of those specifically described. A mouse macrophage iNOS
cDNA probe, prepared by RT-PCR, was kindly donated by Dr. Y. Kawahara
(Kobe University, Kobe, Japan). The PCR was used to amplify a 1,033-bp
iNOS cDNA fragment. The sequences of the forward
(ACAGGGAAGTCTGAAGCACTAG) and reverse (CATGCAAGGAAGGGAACTCTTC) primers
were based on the iNOS cDNA sequence (nt 1621-2653) (16). A
monoclonal anti-mouse iNOS synthase antibody, which crossreacts with
rat iNOS, was obtained from Transduction Laboratories (Lexington, KY).
Glomerular mesangial cell preparation and cell culture. Primary GMC cultures were prepared from rat kidneys of male Sprague-Dawley rats (150-200 g) with standard sieving methods, as reported previously (1). Briefly, the kidney cortex was minced and glomeruli were separated from tubules and debris by filtering through 100- and 200-µm-pore sieves. Glomeruli were collected and suspended in PBS containing 100 U/ml penicillin and 100 mg/ml streptomycin (Life Technology). After centrifugation at 900 rpm for 5 min, the glomeruli were resuspended and cells were grown in RPMI 1640 medium supplemented with 20% fetal bovine serum (ICN Biomedicals, Osaka, Japan), 100 U/ml penicillin, 100 mg/ml streptomycin, 10 µg/ml insulin, 5.5 µg/ml transferrin, and 6.7 ng/ml sodium selenite (Life Technology) in a 95% air-5% CO2 incubator at 37°C. Cells grown to confluence were detached by a treatment with 0.125% trypsin and 0.02% EDTA and reseeded in secondary cultures. Cells were used between passages 3 and 6. Cells were plated at 1-2 × 104 cells/ml in 24-well dishes (Falcon) in RPMI 1640 medium supplemented as described above and allowed to grow subconfluently for 72-96 h. They were then made "quiescent" by a 24-h incubation in serum-free RPMI 1640 medium.
Determination of nitrite. Nitrite was measured by the method of Green et al. (8). Briefly, assay samples were mixed with an equal volume of the Griess reagent [0.1% N(1-naphthyl)ethylenediamine dihydrochloride and 1% sulfanilamide in 3% H3PO4] and incubated to yield a chromophore. Because phenol red interfered with nitrite measurement to some degree, we used phenol red-free RPMI 1640 for incubation. The absorbance at 540 nm was measured, and nitrite concentration was determined using a curve calibrated from sodium nitrite standards. Nitrite levels were corrected for the total protein content of GMC extracts measured by the method of Lowry (20).
Assay for iNOS mRNA.
Inducible NOS mRNA expression was analyzed by Northern
blotting as reported previously (12, 13). Briefly, GMC were grown to
confluence on 100-mm dishes and lysed using ISOGEN (Nippon Gene, Tokyo,
Japan), which contained phenol and guanidine isothiocyanate. The lysate
was extracted with chloroform-isopropanol, washed with 75% ethanol,
and dissolved in 20 ml of diethyl pyrocarbonate (DEPC)-treated water.
Isolation of the RNA was carried out at room temperature. The RNA was
quantitated by ultraviolet absorbance at 260 nm. Total RNA (20 µg)
was fractionated on 1% denaturing agarose-formaldehyde gels and
capillary blotted onto nylon membranes (Hybond N; Amersham, Buckinghamshire, UK) in 20× standard saline citrate (SSC;
containing 0.15 M NaCl and 0.0015 M sodium citrate, pH 7.0)
overnight. Filters were prehybridized for 30 min at
68°C before hybridization using Quick-Hyb (Stratagene, La Jolla,
CA). Filters were then hybridized for 1 h at 68°C in the same
solution with 106 counts per
minute (cpm)/ml of
[
-32P]dCTP random
primer-labeled iNOS probes from mice (16). Filters were washed twice
for 10 min at room temperature in 2× SSC and 0.1% SDS, followed
by a 10-min wash at 45°C in 0.1× SSC and 0.1% SDS. The
hybridized filters were then exposed to Kodak XAR film overnight at
70°C with one intensifying screen. Autoradiography was
performed at
70°C and quantified by densitometric scanning (Immunomedica Image Analyzer TIF-64).
Assay for iNOS protein. iNOS protein was analyzed by Western blotting. Briefly, the cells were rinsed with ice-cold PBS, resuspended into the lysis buffer (50 mM Tris · HCl, pH 7.4, 1 mM EDTA, pH 7.5, 1 µM leupeptin, 1 µM pepstatin A, 0.1 mM phenylmethylsulfonyl fluoride, and 1 mM dithiothreitol), and sonicated. After incubation on ice for 30 min, cell extracts were centrifuged at 100,000 g for 20 min to remove cell debris. The supernatants were then separated through 10% SDS-PAGE using the Laemmli buffer and blotted onto polyvinylidene difluoride membrane (Immunobin; Millipore). The membrane was incubated for 1 h at room temperature in Tris-buffered saline-Tween 20 (TBST; 20 mM Tris · HCl, pH 7.4, 150 mM NaCl, 0.05% Tween 20) with 4% nonfat milk. The membrane was then incubated with mouse anti-iNOS antibody (1:1,000) (Transduction Laboratories) overnight in TBST at 4°C. Specific binding of the antibody was visualized by the enhanced chemiluminescence detection system (Amersham, Little Chalfont, UK) according to manufacturer instructions and quantified by densitometric scanning (Immunomedica Image Analyzer TIF-64).
Measurement of intracellular cGMP contents.
cGMP contents were determined as reported previously
(25). Briefly, the phosphodiesterase inhibitor IBMX was added to each well at a final concentration of 0.5 mM, immediately after measurement of nitrite. After incubation for 15 min in a humidified incubator in
95% O2-5%
CO2 at 37°C, the medium was
aspirated off and cells were immediately immersed in 0.2 ml of 0.1 N
HCl to stop the reaction. Cells were collected into glass
tubes with a rubber policeman, boiled for 3 min, and then centrifuged
at 2,500 g for 15 min at room
temperature. The supernatants were decanted and 0.05 ml of 50 mM sodium
acetate was added to each tube. These were kept at
30°C
until assay for cGMP contents. The pellets were dissolved in 0.2 ml of
1% SDS and kept at
30°C until assay for protein. Intracellular cGMP contents were determined using a cGMP enzyme immunoassay kit (Amersham) and normalized to protein content of each
well. The lower limit of detection was 2 fmol/well.
Cytotoxicity assays. Cytotoxicity was determined by the release of lactate dehydrogenase (LDH) (35) from GMC to rule out any toxic effect of the combination of test agents that we examined. We measured LDH in the culture medium from GMC, after 24-h incubation with or without test agents, using colorimetric method.
The release of LDH from GMC into the RPMI 1640 medium alone was trivial (20.0 ± 2.1 IU/l). There was no significant increase of LDH release with all the combinations of test agents. Therefore, we reasoned that the test agents in the present study did not have any cytotoxic effect on GMC.Statistical analysis. The results are expressed as means ± SE. Data were analyzed by analysis of variance combined with Scheffe multiple comparisons or unpaired t-test, as appropriate. P < 0.05 was considered to be significant. Figures 1-8 each represent one of at least three separate experiments.
| |
RESULTS |
|---|
|
|
|---|
Time course and dose response of AVP effect on LPS- and
IL-1
-induced nitrite production.
In preliminary studies, we examined the effects of
IL-1
and LPS on nitrite production in GMC. GMC produced nitrite in
response to LPS (10 µg/ml) alone, IL-1
(1 ng/ml) alone, or a
combination of IL-1
and LPS (Fig.
1A).
In the presence of 10 µg/ml LPS with IL-1
, nitrite production
showed a time-dependent increase up to 24 h compared with LPS or
IL-1
alone. Hence, after being rinsed with PBS at pH 7.35, confluent
cells were incubated for 24 h with serum- and phenol red-free RPMI 1640 medium containing 10 µg/ml LPS and 1 ng/ml human recombinant IL-1
,
with the exception of the time-course studies. Agents such as AVP, the
V1-receptor antagonist, or the
Oxt-receptor antagonist and the other chemicals were added to the
incubation medium concomitantly with LPS and IL-1
, except for those
specifically described.
|
-induced (1 ng/ml) nitrite production. GMC were
stimulated for 24 h with LPS and IL-1
, in either the presence or
absence of 1 µM AVP. We added 1 µM AVP or medium alone 0, 3, 6, 12, or 24 h before determination of nitrite. As shown in Fig.
1B, AVP significantly inhibited
nitrite production over a 12-h coincubation (14.8 ± 7.2 and 28.5 ± 6.0% inhibition at 12 and 24 h, respectively). On the other
hand, medium alone did not affect nitrite production at all. Therefore,
we conducted a 24-h incubation in the subsequent experiments for
measurements of nitrite and cGMP production.
As shown in Fig. 1C, nitrite
production is fairly low (7.1 ± 0.3 nmol/mg protein) in the absence
of NO stimulators, whereas addition of 10 µg/ml of LPS and 1 ng/ml
IL-1
markedly enhanced nitrite production (695.4 ± 19.0 nmol/mg
protein). AVP inhibited LPS- and IL-1
-induced nitrite production in
a dose-dependent manner, with significance at concentrations above 1 nM. On the other hand, 1 µM AVP did not affect cytokine-independent
nitrite production at all.
Effect of AVP on LPS- and IL-1
-induced iNOS mRNA and
iNOS protein expression.
Next, we examined the effect of AVP on iNOS mRNA
expression. As shown in Fig.
2A, 10 µg/ml LPS and 1 ng/ml IL-1
markedly stimulated iNOS mRNA
expression in a time-dependent fashion up to 24 h. Simultaneous
addition of 1 µM AVP showed 66% inhibition by relative densitometric
units of iNOS mRNA expression compared with that of LPS and IL-1
.
|
markedly induced iNOS protein expression in a time-dependent
fashion up to 24 h. Simultaneous addition of 1 µM AVP showed 66%
inhibition of iNOS protein expression by relative densitometric units
compared with that of LPS and IL-1
.
Effects of V1- and
Oxt-receptor antagonists on AVP inhibition of LPS- and
IL-1
-induced nitrite, cGMP production, and iNOS mRNA
expression.
Next, we investigated whether the inhibition by AVP may
be mediated through V1 receptors
or Oxt receptors. Because the V2 receptor does not reside in GMC,
V1- and Oxt-receptor antagonists were exclusively investigated. As shown in Fig.
3A,
inhibition of nitrite production by 1 µM AVP was reversed by the
V1 antagonist in a dose-dependent
manner, with significance at concentrations above 1 µM. On the
contrary, the Oxt-receptor antagonist did not reverse the inhibition by
AVP (Fig. 3B). Neither the
V1-receptor antagonist (1 µM)
nor the Oxt-receptor antagonist (1 µM) alone affected nitrite
production at all (Fig. 3, A and
B). Identical results were obtained
for cGMP production (Fig. 3C).
|
markedly induced iNOS mRNA expression; 1 µM AVP showed 58% inhibition of iNOS mRNA expression by relative
densitometric units. Whereas the
V1-receptor antagonist reversed
this inhibition by AVP, the Oxt-receptor antagonist did not. Both
V1-receptor and Oxt-receptor
antagonists alone did not affect iNOS mRNA expression at
all.
|
Effects of AVP, V1-, and
Oxt-receptor antagonists on LPS- and IFN-
-induced
nitrite production.
We also examined the effect of AVP on LPS- and
IFN-
-induced nitrite production (as another combination of potent
iNOS stimulators). As shown in Fig. 5,
nitrite production is fairly low (18.5 ± 1.6 nmol/mg protein) in
the absence of NO stimulators, whereas the addition of 10 µg/ml of
LPS and 100 U/ml IFN-
markedly enhanced nitrite production (724.1 ± 57.3 nmol/mg protein). LPS- and IFN-
-induced nitrite
production was significantly inhibited by 1 µM AVP (445.7 ± 31.8 nmol/mg protein; P < 0.05).
Inhibition of nitrite production by AVP was reversed by 1 µM
V1-antagonist (765.0 ± 23.7 nmol/mg protein), whereas 1 µM Oxt-receptor antagonist did not
reverse the inhibition by AVP (377.7 ± 28.9 nmol/mg
protein).
|
Effects of protein kinase C inhibitors or activators on LPS- and
IL-1
-induced nitrite production and iNOS mRNA
expression.
Because AVP evokes a rapid phospholipase C-mediated
hydrolysis of phosphoinositide through the
V1 receptor and activates protein kinase C (PKC), we examined the effects of the PKC inhibitors calphostin C (1 µM) and staurosporine (10 nM) on LPS- and
IL-1
-stimulated nitrite production. As shown in
Fig.6A,
inhibition of LPS- and IL-1
-induced nitrite production by AVP was
abolished when calphostin C or staurosporine was added concomitantly.
Calphostin C or staurosporine alone did not affect LPS- and
IL-1
-induced nitrite production.
|
-induced nitrite production were examined. As shown in Fig.
6B, PMA mimics the inhibitory effect
of AVP on nitrite production. PMA inhibited nitrite production in a
dose-dependent manner, with significance at concentrations above 100 nM. On the other hand, 1 µM PMA did not affect cytokine-independent
nitrite production at all.
Furthermore, we examined the effects of these compounds on iNOS mRNA
expression. As shown in Fig. 6C, 10 µg/ml of LPS and 1 ng/ml of IL-1
markedly induced iNOS mRNA
expression. PMA (1 µM) and AVP (1 µM) showed 69% and 63%
inhibition of iNOS mRNA expression by relative densitometric units,
respectively. This AVP-mediated inhibition was abolished when
calphostin C (1 µM) or staurosporine (10 nM) was added.
Effect of dexamethasone or PDTC on LPS- and
IL-1
-induced nitrite production.
It has been reported that dexamethasone and PDTC,
inhibitors of nuclear transcription factor (NF)-
B, inhibit
cytokine-stimulated NO synthesis in rat GMC (28).
Therefore, we investigated whether AVP exerts further inhibitory
effects in the presence of these agents. Figure
7 shows that both 1 µM dexamethasone and
100 µM PDTC strongly inhibited LPS- and IL-1
-induced nitrite
production, whereas dexamethasone or PDTC alone did not affect basal
nitrite production. Further additive inhibition by AVP (1 µM) with
dexamethasone or PDTC was not observed.
|
Effect of actinomycin D and cycloheximide on LPS- and
IL-1
-induced nitrite production.
We also investigated whether AVP still exerts its
inhibitory effect on nitrite production after iNOS mRNA or iNOS protein was induced. To check this point, we added actinomycin D, an inhibitor of transcription, or cycloheximide, an inhibitor of protein synthesis, to GMC after a 12-h incubation with LPS and IL-1
, in either the presence or absence of 1 µM AVP, and looked at nitrite production after a 24-h incubation. As shown in Fig.
8, both actinomycin D (10 µg/ml) and
cycloheximide (10 µg/ml) strongly inhibited LPS- and IL-1
-induced
nitrite production. However, we could not see further inhibition of
nitrite production by AVP with either actinomycin D or cycloheximide.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study clearly demonstrates that AVP inhibits LPS- and
IL-1
-induced NO and cGMP production, as well as iNOS mRNA and
protein expressions, via the V1
receptor in cultured rat GMC. In addition, it was shown that AVP may
inhibit NO production through activation of PKC and may act before
transcription of iNOS mRNA.
LPS is one of the bacterial endotoxins and strong NO stimulators in
VSMC and GMC. Incubation of mesangial cells with LPS and/or several cytokines such as tumor necrosis factor, IFN-
, and IL-1
results in an increase of iNOS mRNA expression and NO synthesis (31).
Synergistic upregulation of iNOS protein by cytokines with endotoxin
has been observed in various kinds of culture cells because more than
one pathway has been thought to be necessary to yield maximal iNOS
protein induction (7). As for the NO production, we found that IL-1
alone had a weak effect but worked synergistically with LPS in rat GMC.
Therefore, we used a combination of LPS and IL-1
for NO production
in the present study. We also examined the effect of AVP on LPS- and
IFN-
-induced nitrite production as another potent combination of NO
stimulators. As shown in the present study, the inhibitory action of
AVP may not be limited to the combination of LPS and IL-1
for NO
production in GMC.
AVP activates two different receptors. One, found in the renal
collecting tubule cells, enhances tubular water reabsorption (V2 receptor), and another
produces GMC or VSMC contraction
(V1 receptor) (6). It is possible
that the glomerular effect of AVP may be mediated by Oxt receptors
because both hormones were closely related structurally and differ by
only two amino acids (6). Therefore, it is possible that AVP and Oxt
bind to the same receptor to elicit intracellular signaling and induce
contraction. Thus the possibility that Oxt receptors mediate the
inhibition of LPS- and IL-1
-induced NO and cGMP production by AVP
cannot be denied. However, the present results clearly showed that this inhibitory effect was not mediated by the Oxt receptor because the
selective V1-antagonist reversed
the inhibitory effect of AVP, whereas the Oxt-receptor antagonist did not.
In contrast to the present study, Hirata et al. (10) reported that AVP stimulated NO release through the endothelial V1 receptor in isolated perfused rat kidney. The release of NO from vascular endothelial cells is primarily regulated by constitutive NOS. This regulation also requires increases in intracellular calcium concentration. Therefore, it is thought that AVP, via the V1 receptor, may stimulate NO production through activation of endothelial NOS. On the other hand, AVP may inhibit cytokine-induced NO production through suppression of iNOS protein. These actions of AVP seem to be important for the regulation of glomerular hemodynamics and ultrafiltration.
NO is known to activate soluble guanylate cyclase in GMC to generate intracellular cGMP, which causes subsequent mesangial dilatation (30, 34). In the kidney, physiological amounts of NO have an important role in the regulation of renal hemodynamics, as well as sodium and water excretion (27). On the other hand, iNOS protein induction by cytokines or bacterial endotoxin could be detrimental for glomerular function and structure. Large amounts of NO release after iNOS protein induction could lead to a marked relaxation of GMC as well as VSMC of the renal microvasculature and may cause reduction of glomerular hydrostatic pressure and ultrafiltration. Indeed, alterations in NO synthesis have been implicated in several pathophysiological conditions, including arterial hypertension and progression of renal failure (2). In these conditions, when iNOS protein synthesizes NO in large quantities and its effect in the vasculature is long lasting, NO inhibitions seem to be protective (18). Recent studies have shown that GMC induces iNOS protein, as well as VSMC (15, 31, 32). Therefore, a large amount of NO produced in GMC during glomerular inflammation may alter the mesangial function by counteracting mesangial cell contraction. However, a recent study by Greenberg et al. (9) demonstrated that not only cytokines or bacterial endotoxin but also autacoid mimetics such as dibutyryl-cAMP or 2-methylthioadenosine 5'-triphosphate, a P2Y receptor agonist, induced iNOS protein in rat alveolar macrophages in vivo. Taking these into account, we should pay attention to the interpretation of the NO system in patients with renal diseases such as glomerulonephritis, especially when patients have taken medications that could modulate cAMP and the purinergic receptor pathway.
As for the signal transduction of AVP-mediated suppression of NO production, V1 receptor-mediated phosphoinositide hydrolysis and PKC activation might be responsible. Because iNOS activity is commonly calcium independent (19, 22), involvement of PKC activation in AVP action was exclusively investigated in the present study. We demonstrated that different PKC inhibitors such as calphostin C or staurosporine reversed AVP action and that the PKC activator PMA mimicked the AVP action, suggesting the involvement of PKC. Recently, Nakayama et al. (24) reported that angiotensin II inhibited cytokine-stimulated NO production and iNOS mRNA expression via activation of PKC in VSMC. In addition, Mohaupt et al. (21) also demonstrated that activation of purinergic P2Y2 receptors by ATP or UTP inhibited iNOS protein expression via a PKC-dependent mechanism in cultured rat GMC. However, in other cell types, opposite effects of PKC on iNOS protein expression have been reported. Acute administration of PMA led to an increase in NO production, iNOS mRNA, and iNOS protein induced by inflammatory stimuli in avian osteoclasts (33). Therefore, even activation of identical PKC isoforms did not show comparable effects on iNOS protein expression in different cell types (23, 26). Although PKC activation may be involved in the suppressive effect of AVP on NO production, we cannot determine which isoform of PKC is responsible for AVP-mediated suppression of NO production in GMC until selective inhibitors of PKC isoforms are available (11).
Concerning the molecular mechanism of inhibitory action of AVP in iNOS
mRNA and protein expression, we examined at first the effects of known
inhibitors of NF-
B, such as dexamethasone and PDTC. It is already
reported that these compounds directly inhibit cytokine-induced iNOS
activity and expression in rat GMC (28). Because there was no additive
effect of AVP, either with dexamethasone or PDTC, in the present study,
AVP was thought to act at least at the step before transcription of
iNOS mRNA. In addition, the fact that AVP did not show any additive
effect with actinomycin D, an inhibitor of transcription, indicates
that the action site of AVP may involve the transcriptional level.
Furthermore, because AVP did not show any additive effect with
cycloheximide, an inhibitor of protein synthesis, it is thought that
AVP may act at the step before iNOS protein synthesis. However, the
precise associations among PKC activation, iNOS mRNA, and iNOS protein
expression in terms of inhibitory action of AVP remain to be elucidated.
In the present study, the fact that the changes of NO and cGMP production were parallel indicates that AVP inhibition of NO and cGMP may have physiological meaning in the regulation of glomerular hemodynamics and ultrafiltration, especially in conditions such as acute or chronic glomerular inflammation, in which blood cytokines and AVP levels are sometimes high. It is well known that cytokines in inflammatory states stimulate the release of hypophysial hormones, including AVP (5). AVP is one of the vasoconstrictive hormones and opposes the vasodilatation mediated by NO. AVP may also prevent inappropriate vasodilatation due to massive NO production within the glomerulus by downregulating iNOS protein expression in GMC. However, the precise role of AVP in the glomerular hemodynamics, under acute or chronic glomerulonephritis, remains to be elucidated.
In summary, AVP may influence glomerular hemodynamics not only through direct action, but also through indirect action by inhibiting NO production. This AVP action may be important to maintain the glomerular microcirculation and ultrafiltration under conditions such as acute or chronic glomerulonephritis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Yuko Watanabe and Toshiko Kanbe for technical assistance.
| |
FOOTNOTES |
|---|
This study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan (06671146), a Grants-in-Aid for Scientific Research from the Ministry of Health and Welfare, Japan, and a grant from Jin-Kenkyukai.
Part of this study has been reported in abstract form (J. Am. Soc. Nephrol. 8: 354A, 1997).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: E. Kusano, Dept. of Nephrology, Jichi Medical School, Yakushiji 3311-1, Minamikawachi, Tochigi 329-0498 Japan.
Received 27 July 1998; accepted in final form 3 November 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akai, Y.,
E. Kusano,
M. Amemiya,
S. Ono,
S. Takeda,
S. Homma,
and
Y. Asano.
PMA and ionomycin differently affect atrial natriuretic peptide stimulated cyclic GMP production in rat mesangial cells.
Tohoku J. Exp. Med.
178:
137-149,
1996[Medline].
2.
Baylis, C.,
B. Mitruka,
and
A. Deng.
Chronic blockade of nitric oxide synthesis in rat produces systemic hypertension and glomerular damage.
J. Clin. Invest.
90:
278-281,
1992.
3.
Beasley, D.,
R. A. Cohen,
and
N. G. Levinsky.
Interleukin-1 inhibits contraction of vascular smooth muscle.
J. Clin. Invest.
83:
331-335,
1989.
4.
Beck, K.-F.,
M. G. Mohaupt,
and
B. Sterzel.
Endothelin-1 inhibits cytokine-stimulated transcription of inducible nitric oxide synthase in glomerular mesangial cells.
Kidney Int.
48:
1893-1899,
1995[Medline].
5.
Bernton, E. W.,
J. E. Beach,
J. W. Holaday,
R. C. Smallridge,
and
H. G. Fein.
Release of multiple hormones by a direct action of interleukin-1 on pituitary cells.
Science
238:
520-521,
1987.
6.
Briner, V. A.,
P. Tsai,
H. L. Choong,
and
R. W. Schrier.
Comparative effects of arginine vasopressin and oxytocin in cell culture systems.
Am. J. Physiol.
263 (Renal Fluid Electrolyte Physiol. 32):
F222-F227,
1992
7.
Charlotte, F.,
L. Aurore,
N. Martin,
Y. Gereyn,
M. Nollet,
P. Gaulard,
and
E. S. Zafrani.
Immunohistochemical detection of bcl-2 protein in normal and pathological human liver.
Am. J. Pathol.
144:
460-465,
1994[Abstract].
8.
Green, L. C.,
D. A. Wagner,
J. Glogowski,
P. L. Skipper,
J. S. Wishnok,
and
S. R. Tannenbaum.
Analysis of nitrate, nitrite, and 15N nitrate in biological fluids.
Anal. Biochem.
126:
131-138,
1982[Medline].
9.
Greenberg, S. S.,
X. Zhao,
J. Wang,
L. Hau,
and
J. Ouyang.
cAMP and purinergic P2y receptors upregulate and enhance inducible NO synthase mRNA and protein in vivo.
Am. J. Physiol.
273 (Lung Cell. Mol. Physiol. 17):
L967-L979,
1997
10.
Hirata, Y.,
H. Hayakawa,
M. Kakoki,
A. Tojo,
E. Suzuki,
D. Nagata,
K. Kimura,
A. Goto,
K. Kikuchi,
T. Nagano,
M. Hirobe,
and
M. Omata.
Receptor subtype for vasopressin-induced release of nitric oxide from rat kidney.
Hypertension
29:
58-64,
1997
11.
Hofmann, J.
The potential for isoenzyme-selective modulation of protein kinase C.
FASEB J.
11:
649-669,
1997[Abstract].
12.
Iimura, O.,
E. Kusano,
M. Amemiya,
S. Muto,
U. Ikeda,
K. Shimada,
and
Y. Asano.
Dipyridamole enhances interleukin-1
-stimulated nitric oxide production by cultured rat vascular smooth muscle cells.
Eur. J. Pharmacol.
296:
319-326,
1996[Medline].
13.
Iimura, O.,
E. Kusano,
S. Homma,
S. Takeda,
U. Ikeda,
K. Shimada,
and
Y. Asano.
Atrial natriuretic peptide enhances interleukin-1
-stimulated nitric oxide production in cultured rat vascular smooth muscle cells.
Kidney Blood Press. Res.
21:
36-41,
1998[Medline].
14.
Jamil, K. M. A.,
T. Watanabe,
A. Nakao,
T. Okuda,
and
K. Kurokawa.
Distinct mechanisms of action of V1 antagonists OPC-21268 and [d(CH2)5Tyr(Me)AVP] in mesangial cells.
Biochem. Biophys. Res. Commun.
193:
738-743,
1993[Medline].
15.
Jansen, A.,
T. Cook,
G. M. Taylor,
P. Largen,
V. Riveros-Moreno,
S. Moncada,
and
V. Cattell.
Induction of nitric oxide synthase in rat immune complex glomerulonephritis.
Kidney Int.
45:
1215-1219,
1994[Medline].
16.
Koide, M.,
Y. Kawahara,
I. Nakayama,
T. Tsuda,
and
M. Yokoyama.
Cyclic AMP-elevating agents induce an inducible type of nitric oxide synthase in cultured vascular smooth muscle cells.
J. Biol. Chem.
268:
24959-24966,
1993
17.
Kusano, E.,
S. Tian,
T. Umino,
T. Tetsuka,
Y. Ando,
and
Y. Asano.
Arginine vasopressin inhibits interleukin-1
-stimulated nitric oxide and cyclic guanosine monophosphate production via the V1 receptor in cultured rat vascular smooth muscle cells.
J. Hypertens.
15:
627-632,
1997[Medline].
18.
Lazlo, F.,
B. J. R. Whittle,
and
S. Moncada.
Time-dependent enhancement or inhibition of endotoxin-induced vascular injury in rat intestine by nitric oxide synthase inhibitors.
Br. J. Pharmacol.
111:
1309-1315,
1994[Medline].
19.
Lowenstein, C. J.,
and
S. H. Snyder.
Nitric oxide, a novel biologic messenger.
Cell
70:
705-707,
1992[Medline].
20.
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr,
and
R. J. Randall.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:
265-275,
1951
21.
Mohaupt, M. G.,
T. Fischer,
J. Schwobel,
R. B. Sterzel,
and
E. Schulze-Lohoff.
Activation of purinergic P2Y2 receptors inhibits inducible NO synthase in cultured rat mesangial cells.
Am. J. Physiol.
275 (Renal Physiol. 44):
F103-F110,
1998
22.
Moncada, S.,
R. M. J. Palmer,
and
E. A. Higgs.
Nitric oxide: physiology, pathophysiology and pharmacology.
Pharmacol. Rev.
43:
109-142,
1991[Medline].
23.
Muhl, H.,
and
J. Pfeilschifter.
Possible role of protein kinase C-
isoenzyme in inhibition of interleukin 1
induction of nitric oxide synthase in rat renal mesangial cells.
Biochem. J.
303:
607-612,
1994.
24.
Nakayama, I.,
Y. Kawahara,
T. Tsuda,
M. Okuda,
and
M. Yokoyama.
Angiotensin II inhibits cytokine-stimulated inducible nitric oxide synthase expression in vascular smooth muscle cells.
J. Biol. Chem.
269:
11628-11633,
1994
25.
Ohkawa, F.,
U. Ikeda,
K. Kawasaki,
E. Kusano,
M. Igarashi,
and
K. Shimada.
Inhibitory effect of interleukin-6 on vascular smooth muscle contraction.
Am. J. Physiol.
266 (Heart Circ. Physiol. 35):
H898-H902,
1994
26.
Paul, A.,
K. Doherty,
and
R. Plevin.
Differential regulation by protein kinase C isoforms of nitric oxide synthase induction in RAW 264.7 macrophages and rat aortic smooth muscle cells.
Br. J. Pharmacol.
120:
940-946,
1997[Medline].
27.
Romero, J. C.,
V. Lahera,
M. G. Salom,
and
M. L. Biondi.
Role of the endothelium-dependent relaxing factor nitric oxide on renal function.
J. Am. Soc. Nephrol.
2:
1371-1387,
1992[Abstract].
28.
Saura, M.,
S. López,
P. M. Rodríguez,
P. D. Rodríguez,
and
S. Lamas.
Regulation of inducible nitric oxide synthase expression in rat mesangial cells and isolated glomeruli.
Kidney Int.
47:
500-509,
1995[Medline].
29.
Schlondorff, D.
The glomerular mesangial cell: an expanding role for a specialized pericyte.
FASEB J.
1:
272-281,
1987[Abstract].
30.
Shultz, P. J.,
A. E. Schorer,
and
L. Raij.
Effects of endothelium-derived relaxing factor and nitric oxide on rat mesangial cells.
Am. J. Physiol.
258 (Renal Fluid Electrolyte Physiol. 27):
F162-F167,
1990
31.
Shultz, P. J.,
M. A. Tayeh,
M. A. Marletta,
and
L. Raij.
Synthesis and action of nitric oxide in rat glomerular mesangial cells.
Am. J. Physiol.
261 (Renal Fluid Electrolyte Physiol. 30):
F600-F606,
1991
32.
Shultz, P. J.,
S. L. Archer,
and
M. E. Rosenberg.
Inducible nitric oxide synthase mRNA and activity in glomerular mesangial cells.
Kidney Int.
46:
683-689,
1994[Medline].
33.
Sunyer, T.,
L. Rothe,
D. Kirsch,
X. Jiang,
F. Anderson,
P. Osdoby,
and
P. Collin-Osdoby.
Ca2+ or phorbol ester but not inflammatory stimuli elevate inducible nitric oxide synthase messenger ribonucleic acid and nitric oxide (NO) release in avian osteoclasts: autocrine NO mediates Ca2+-inhibited bone resorption.
Endocrinology
138:
2148-2162,
1997
34.
Tolins, J. P.,
and
L. Raij.
Effects of amino acid infusion on renal hemodynamics.
Hypertension
17:
1045-1051,
1991
35.
Weidmann, E.,
J. Brieger,
B. Jahn,
D. Hoelzer,
L. Bergmann,
and
P. S. Mitrou.
Lactate dehydrogenase-release assay: a reliable, nonradioactive technique for analysis of cytotoxic lymphocyte-mediated lytic activity against blasts from acute myelocytic leukemia.
Ann. Hematol.
70:
153-158,
1995[Medline].
This article has been cited by other articles:
![]() |
K. Kirima, K. Tsuchiya, H. Sei, T. Hasegawa, M. Shikishima, Y. Motobayashi, K. Morita, M. Yoshizumi, and T. Tamaki Evaluation of systemic blood NO dynamics by EPR spectroscopy: HbNO as an endogenous index of NO Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H589 - H596. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Landry and J. A. Oliver The Pathogenesis of Vasodilatory Shock N. Engl. J. Med., August 23, 2001; 345(8): 588 - 595. [Full Text] [PDF] |
||||
![]() |
M. W. Dunser, A. J. Mayr, H. Ulmer, N. Ritsch, H. Knotzer, W. Pajk, G. Luckner, N. J. Mutz, and W. R. Hasibeder The Effects of Vasopressin on Systemic Hemodynamics in Catecholamine-Resistant Septic and Postcardiotomy Shock: A Retrospective Analysis Anesth. Analg., July 1, 2001; 93(1): 7 - 13. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |