|
|
||||||||
3
cotransporter isoform NBC-3
1 Division of Nephrology, Na+-HCO
kidney; acid-base; sodium-bicarbonate cotransporter; NBC-1; inner
medullary collecting duct cells
SODIUM-BICARBONATE COTRANSPORTERS (NBC) were first
described in the kidney proximal tubule (7, 8, 26, 31). Subsequent studies have shown their presence extends to numerous other tissues, including brain, liver, cornea, heart, and lung (12, 16-18, 21, 23), suggesting that NBC plays an important role in mediating HCO Functional data suggest the presence of more than one NBC isoform, as
judged by direction and stoichiometry of the transporter. In kidney,
NBC activity leads to cell acidification, whereas in other tissues
(liver and heart) its function leads to cell alkalinization (7, 8, 12,
16-18, 21, 23, 26, 31). Furthermore, NBC has a stoichiometry of 3 equivalents of HCO Recent cloning experiments have identified two NBC isoforms, NBC-1 and
NBC-2 (9, 20, 28). NBC-1, which was cloned from human and amphibian
kidney, mediates an electrogenic,
Na+-dependent
HCO The purpose of the current experiments was to identify other possible
members of NBC family and study their expression and regulation.
Accordingly, a human NT-2 cell cDNA library was screened with NBC-2
cDNA. Positive clones were identified, isolated, and sequenced. The
results indicated a novel NBC cDNA isoform, called here NBC-3. NBC-3 is
highly expressed in the central nervous system and shows differential
regulation vs. NBC-1 in cells subjected to severe acid stress. NBC-3 is
likely involved in cell pH regulation by transporting
HCO Isolation of human NBC-3 cDNA. A cDNA
library (prepared from uninduced, exponentially growing testicular
teratocarcinoma neuroepithelial cells; Ntera-2/c1.D1, NT-2 cells,
cloned into the ZAP Express vector) was purchased from
Stratagene (La Jolla, CA) and screened at high stringency using a
1.48-kb 32P-labeled cDNA probe
prepared by PCR amplification of an expressed sequence tag cDNA clone
(GenBank accession no. AA216661) encoding a part of human NBC-2,
purchased from the American Type Culture Collection. The primers
GACGAGTCCATACGAGAG and CCATGATGACCACAAGCTGAC were used to amplify the
NBC-2 probe from the NBC-2 expressed sequence tag clone. Nylon
membranes were used to lift plaques in duplicate from plates. DNA was
denatured by incubation of the membranes (5-7 min) in 0.5 N NaOH,
1.5 M NaCl. Then the membranes were neutralized by soaking 5 min in 1 M
Tris-Cl, pH 8, followed by 5 min in 1 M Tris-Cl, pH 8, 1.5 M NaCl. This
was followed by a rinse in 2× SSPE. After ultraviolet
cross-linking, the membranes were dried. They were then soaked
overnight with gentle agitation in a 65°C prehybridization solution
containing 5× Denhardt's BSA, 6× SSPE, 0.1% SDS, and 100 µg/ml carrier DNA. The following day, freshly labeled probe was
added, and the hybridization was continued until the next morning. The
membranes were then washed twice for 10 min each in 2× SSPE + 0.1% SDS at room temperature. A third wash for 30 min at 65°C in
1× SSPE + 0.1% SDS was followed by a brief rinse in 2×
SSPE at room temperature before exposure to film. Following
plaque-purification and conversion to plasmid form (pBK-CMV), DNA
sequence analysis was performed on six clones at the University of
Cincinnati DNA Core, using dye-termination technology. The largest
insert (5.5 kb) contained part of the coding region of a novel member
of the
Na+-HCO RNA isolation. RNA was extracted from
rat kidney cortex and medulla or cultured mIMCD-3 cells, using
TriReagent (Molecular Research, Cincinnati, OH) according to the
manufacturer's instructions. The extracted RNA was dissolved in
Formazol, quantitated spectrophotometrically, and stored at
Northern hybridization. Total RNA
samples (30 µg/lane) were fractionated on 1.2% agarose-formaldehyde
gels and transferred to nylon membranes. RNA was covalently bound to
the nylon membranes by ultraviolet cross-linking (14). The human
multiple tissue blots containing 2 µg of
poly(A)+ RNA (normalized for
identical RT-PCR of NBC-2 on the RNA of mIMCD-3
cells. RNA (2 µg) from control and acid-stressed
cells was subjected to RT-PCR using an oligo-dT reverse transcriptase
primer and mouse NBC-2-specific primers for the PCR. Amplification
across an intron-exon junction ensured selectivity for mRNA vs. genomic
DNA. The mouse-specific primers were 5'-GACCGTATCAAGTTTGG and
5'-CAAGCCAACTGAGTTCTCTC. Cycling parameters were as follows:
30 cycles of 94°C, 30 s; 57°C, 1 min; 72°C, 2 min.
Cell culture procedures. mIMCD-3 cells
(which were developed from the inner medullary collecting duct cells of
simian virus transgenic mice and retain many characteristics of this
nephron segment, Ref. 27) were cultured in a 1:1 mixture of Ham's F-12 and DMEM (DMEM-F12) containing 2.5 mM
L-glutamine and 2.438 g/l sodium
bicarbonate (GIBCO-BRL) supplemented with 50 U/ml penicillin G, 50 µg/ml streptomycin, and 10% fetal bovine serum. Cultured mIMCD-3
cells and cells subjected to sublethal acid stress were incubated at
37°C in a humidified atmosphere of 5%
CO2 in air. The medium was
replaced every other day.
Sublethal acid stress. Cells that were
subjected to modified acid-suicide selection (sublethal acid stress)
were grown as described (5, 30). We have referred to these cells in the past as NHE2d or mutant cells based on the downregulation of NHE-2 isoform in response to sublethal acid stress (5, 30). Briefly, actively
proliferative, subconfluent mIMCD-3 cells were treated for 16 h with
the mutagen ethylmethylsulfonic acid (EMS) at 500 µg/ml and then
subjected to a modified protocol of lethal acid stress (30). Following
treatment with EMS, mIMCD-3 cells were grown to confluence,
trypsinized, centrifuged at room temperature, and loaded with
NH+4 by incubation for 10 min at 37°C in
an ammonium-containing solution that consisted of 20 mM
NH4Cl, 120 mM tetramethylammonium
chloride (TMA-Cl), 5 mM KCl, 5 mM glucose, and 5 mM
HEPES-Tris, pH 7.40. The cells were then acid loaded by incubation for
30 min in an NH+4-free solution that
consisted of 125 mM TMA-Cl, 5 mM KCl, 5 mM glucose, and 20 mM
HEPES-Tris, pH 5.5. Thereafter, cells were pelleted, washed, and
incubated for 120 min at 37°C in a solution with a very low
concentration of Na+ (5 mM NaCl)
that, in addition, consisted of 120 mM choline chloride, 5 mM KCl, 5 mM
glucose, and 20 mM of MES at pH 6.0. The cells were then centrifuged,
recovered, and seeded to culture-grade plastic dishes in DMEM-F12
medium (pH 7.40) for 10 days. Cells were subjected while in suspension
to two more rounds of acid stress, with each selection event separated
from its predecessor by 10 days. The cells were subcultured and
passaged at very high dilutions (1:1,000) to isolate individual
colonies. A number of individual colonies were isolated with cloning
cylinder, then collected and subcultured. One strain (NHE2d) was
studied in details for NHE isoform expression (30),
H+-ATPase activity (5), and the
current studies. In addition to the parent cells, three individual
colonies from cells not subjected to acid stress were obtained (using
trypsinization and passage at very high dilution followed by isolation
with cloning cylinder). These strains showed a pattern of NBC
expression very similar to the uncloned parent cell line. These results
suggest that overexpression of NBC-3 and suppression of NBC-1 in
stressed cells could represent true adaptive regulation of these
transporters by acid stress. Equally plausible, however, is the
possibility that the differential regulation of NBC-1 and NBC-3 could
be due to a combination of EMS-induced mutagenesis and acid-suicide.
Intracellular pH measurement. Changes
in intracellular pH (pHi) were
monitored using the acetoxymethyl ester of the pH-sensitive fluorescent
dye 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF-AM) as described (6, 34, 35). mIMCD-3 cells and cells that were
recovered from sublethal acid stress were grown to confluence on
coverslips and incubated in the presence of 5 µM BCECF in a
Na+-free solution that consisted
of 115 mM TMA-Cl and 25 mM KHCO3, pH 7.4 (solution A, Table
1).
pHi was measured in a
thermostatically controlled holding chamber (37°C) in a Delta Scan
dual-excitation spectrofluorometer (PTI, South Brunswick, NJ). The
monolayer was then perfused with the appropriate solutions (Table 1).
The fluorescence ratio at excitation wavelengths of 500 and 450 nm was
utilized to determine pHi values
in the experimental groups by comparison to the calibration curve that
was generated by KCl/nigericin technique. The fluorescence emission was
recorded at 525 nm. The
Na+-HCO
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
3
cotransporters mediate the transport of
HCO
3 into or out of the cell. Two
Na+-HCO
3
cotransporters (NBC) have been identified previously, which are
referred to as NBC-1 and NBC-2. A cDNA library from uninduced human
NT-2 cells was screened with an NBC-2 cDNA probe. Several clones were
identified and isolated. Sequence analysis of these clones identified a
partial coding region (2 kb) of a novel NBC (called here NBC-3), which
showed 53% and 72% identity with NBC-1 and NBC-2, respectively.
Northern blot analysis revealed that NBC-3 encodes a 4.4-kb mRNA with a
tissue distribution pattern distinct from NBC-1 and NBC-2. NBC-3 is
highly expressed in brain and spinal column, with moderate levels in
trachea, thyroid, and kidney. In contrast with NBC-1, NBC-3 shows low
levels of expression in pancreas and kidney cortex. In the kidney,
NBC-3 expression is predominantly limited to the medulla. Cultured
mouse inner medullary collecting duct (mIMCD-3) cells showed high
levels of NBC-1 and low levels of NBC-3 mRNA expression. Subjecting the mutagenized mIMCD-3 cells to sublethal acid stress decreased the mRNA
expression of NBC-1 by ~90% but increased the
Na+-dependent
HCO
3 cotransport activity by ~7-fold (as assayed by DIDS-sensitive,
Na+-dependent,
HCO
3-mediated intracellular pH
recovery). This increase was associated with ~5.5-fold enhancement of
NBC-3 mRNA levels. NBC showed significant affinity for
Li+ in the mutant but not the
parent mIMCD-3 cells. On the basis of the widespread distribution of
NBC-3, we propose that this isoform is likely involved in cell pH
regulation by transporting HCO
3 from
blood to the cell. We further propose that enhanced expression of NBC-3
in severe acid stress could play an important role in cell survival by
mediating the influx of HCO
3 into the cells.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
3 transport in both epithelial as
well as nonepithelial cells. In addition to reabsorption of
HCO
3 in proximal tubule, NBC also
plays an important role in cell pH regulation in various tissues by
transporting HCO
3 from blood to the
cell (7, 8, 12, 16-18, 21, 23, 26, 31). The expression of NBC in
epithelial tissues is restricted to the basolateral membrane (7, 8,
16-18, 23, 26, 31).
3 per
Na+ ion in the proximal tubule,
but shows a stoichiometry of 2 HCO
3 per Na+ in other tissues (16, 31,
32, 33, 36). The stoichiometry of NBC plays an important role in
determining the direction of the flux. In the kidney proximal tubule, a
stoichiometry of 3 HCO
3 per 1 Na+ causes membrane potential
driven efflux against uphill chemical gradients for
Na+ and
HCO
3 (32, 33, 36); whereas in liver and heart, a stoichiometry of only 2 HCO
3 per Na+ leads to the inward movement
of Na+ and
HCO
3 (12, 17, 18).
3 cotransport that is inhibitable by DIDS (9, 28). Human NBC-1 encodes a 7.6-kb mRNA, whereas amphibian
NBC-1 encodes a 4.2-kb mRNA (9, 28). Human NBC-1 shows highest levels
of expression in kidney and pancreas with lower levels in brain (9). In
the kidney, NBC-1 is predominantly expressed in the proximal tubule (1,
10, 29) and shows adaptive mRNA regulation in rats subjected to
HCO
3 loading (10), potassium
deprivation (4), or glucocorticoids (3). Pancreatic NBC-1 is a splice
variant of kidney NBC-1 and is expressed in both acinar and ductal
cells (2). A recent report indicated cloning of a new NBC isoform,
NBC-2, from a human retina cDNA library (20). NBC-2 encodes an 8.5-kb
mRNA and shows highest expression in testis and spleen and moderate
levels of expression in intestine, colon, and muscle (20). Functional properties of NBC-2 have not been described.
3 from blood to the cell.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
3
cotransporter family, NBC-3. A second clone contained a 2-kb insert
that included the 5' end of the coding region of NBC-3. The other
four clones contained smaller inserts that were included in the two
larger clones (the 5.5-and the 2-kb clones). The cloned cDNA represents
a partial sequence of a new NBC isoform (we refer to this as
NBC-3).1
A recent study reported the cloning of a full-length cDNA that shows
complete homology to our NBC-3 (24). However, no functional studies
were performed to examine the identity of the cloned cDNA.
80°C.
-actin expression in each lane) were
purchased from Clontech. Hybridization was performed
according to the method of Church and Gilbert (15). Briefly, membranes were preprehybridized for 1 h in 0.1× SSPE + 1% SDS
solution at 65°C. The membranes were then prehybridized for
1-3 h at 65°C with 0.5 M sodium phosphate buffer, pH 7.2, 7%
SDS, 1% BSA, 1 mM EDTA, and 100 µg/ml sonicated carrier DNA.
Thereafter, the membranes were hybridized overnight in the above
solution with 32P-labeled DNA
probe for NBC-1, NBC-2, or NBC-3. The cDNA probes were labeled with
32P-labeled deoxynucleotides using
the RadPrime DNA labeling kit (GIBCO-BRL). The membranes were washed
twice in 40 mM sodium phosphate buffer, pH 7.2, 5% SDS, 0.5% BSA, and
1 mM EDTA for 10 min at 65°C, washed four times in 40 mM sodium
phosphate buffer, pH 7.2, 1% SDS, and 1 mM EDTA for 10 min at
65°C, exposed to a PhosphorImager screen at room temperature for
24-72 h, and read by a STORM PhosphorImager (Molecular Dynamics).
Densitometric scanning of the blots was performed on the
PhosphorImager. For purpose of quantitation, blots from mIMCD-3 cells
or rat kidney were first probed with NBC-1, NBC-2, or NBC-3 and then
with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA. For
NBC-1, the full-length cDNA was used as a specific probe. For NBC-2,
the probe was generated by PCR amplification of an EST cDNA fragment
(GenBank accession no. AA216661) that encodes nucleotides 8-2808
and is a part of human NBC-2. For NBC-3, a 3-kb
Sst I fragment from the 5.5-kb cDNA or
a 700-bp fragment from the 2-kb cDNA was used as a probe. The
respective NBC probes recognize appropriate size mRNAs on high-stringency Northern blots that were performed on RNA isolated from
normal or acid-stressed mIMCD-3 cells (~7.6-kb message for NBC-1 and
4.4-kb message for NBC-3). A more specific 700-bp NBC-3 cDNA probe
(corresponding to nucleotides 900-1600) also recognized the 4.4-kb
message as the only transcript in mIMCD-3 cells.
3
cotransporter activity was determined as the initial rate of the
DIDS-sensitive, Na+-dependent
pHi recovery
(dpHi/dt,
pH/min) in a HCO
3-containing solution
(Table 1, solution C) following an
acid load induced by
NH3/NH+4
loading (Table 1, solution B) and withdrawal (Table 1, solution A).
The experiments were performed in the presence of 1 mM amiloride to
block the
Na+/H+
exchanger activity. Glucose was deleted from the solutions to minimize
the contribution of H+-ATPase to
pHi recovery from acidosis (5).
The initial rate of pHi recovery
(dpHi/dt,
pH/min) following intracellular acidosis was calculated by fitting to a
linear equation the first 30 s of the time course of
pHi recovery. Correlation
coefficients for these linear fits averaged 0.98 ± 0.01. The
representative and bar graph experiments were compiled from data from a
single acid-stressed clonal line.
Table 1.
Composition of experimental solutions
Materials. DMEM-F12 medium was purchased from Life Technologies. BCECF was from Molecular Probes. Amiloride, DIDS, nigericin, and other chemicals were purchased from Sigma Chemical. 32P was purchased from New England Nuclear (Boston, MA). The GIBCO-BRL RadPrime DNA labeling kit was purchased from Life Technologies.
Statistics. Results are means ± SE. Statistical significance between experimental groups was assessed by Student's t-test or by one-way analysis of variance. P < 0.05 was considered significant.
| |
RESULTS |
|---|
|
|
|---|
Partial sequence of NBC-3 cDNA. Figure
1 shows the partial nucleotide sequence
(encompassing 2 kb) and conceptual translation of NBC-3. The sequence
shows an in-frame stop codon prior to the initial methionine codon
indicating that the clone contains the 5' end of an NBC-3 cDNA
coding region. The remainder of the 5.5-kb sequence (not shown) did not
correlate with any known gene and is likely to be the second half of a
cDNA double insert. A separate 2-kb NBC-3 cDNA clone was identified
that spans the entire coding region of the 5.5-kb cDNA and contains the
5' end of NBC-3 cDNA clone. The absence of a cDNA region encoding
the terminal transmembrane regions common to other members of this
gene family suggests that the 3' end of the message is missing
from both of the cDNA clones (see Footnote 1). An analysis of the amino
acid translation of the open-reading frame shows 72% and 53% identity
with NBC-2 and NBC-1, respectively, as shown in Fig.
2.
|
|
Northern blots. Two human multiple
tissue Northern blots (Clontech) were probed with a
32P-labeled NBC-3 cDNA. Figure
3A shows
that a 4.4-kb mRNA in human brain hybridized strongly with the probe,
indicating a high level of NBC-3 expression in the central nervous
system. A moderate band was detected in kidney and skeletal
muscle. The expression of NBC-3 was very faint in the pancreas. In
addition to the 4.4-kb band, two other transcripts at 9 and 3 kb
were also detected in the brain. Figure
3B shows strong expression of the
4.4-kb mRNA in human spinal column followed by adrenal gland and
lymphoid tissue. A moderate band was detected in thyroid and trachea.
Similar to the brain, two other transcripts at 9 and 3 kb were also
detected in the spinal column and adrenal gland. Figure
3C examines the expression of NBC-3 in
rat kidney cortex and medulla. As indicated, NBC-3 mRNA is
predominantly expressed in the medulla, with NBC-3-to-GAPDH mRNA ratio
being 2.8 ± 0.3-fold higher in the medulla vs. cortex (Fig.
3D)
(n = 4 for each group,
P < 0.04).
|
Effect of acid stress on the expression of NBC
isoforms in mIMCD-3 cells. The expression and
regulation of NBC isoforms in the kidney inner medulla was next
examined. Normal cultured mIMCD-3 cells were subjected to sublethal
acid stress and examined. The Northern blot in Fig.
4A
indicates high levels of NBC-1 mRNA expression in control (parent)
mIMCD-3. Figure 4A further indicates
that cells subjected to acid stress showed significant reduction in NBC-1 mRNA expression. Figure 4B
demonstrates that NBC-1 mRNA levels were decreased by ~90% in
acid-stressed cells (n = 4 for acid
stress; n = 5 for control cells;
P < 0.001).
|
To correlate the expression of NBC-1 with its function, control mIMCD-3
cells were grown to confluence on coverslips, loaded with BCECF, and
monitored for pHi recovery from
intracellular acidosis. In the presence of amiloride (to block
Na+/H+
exchange), switching to a Na+- and
HCO
3-containing solution resulted in
rapid pHi recovery in mIMCD-3
cells (Fig.
5A).
This recovery was absolutely HCO
3
dependent, as shown by the lack of a significant pHi recovery in the absence of
HCO
3 (Fig.
5B). Indeed,
pHi recovery from acidosis in the
absence of HCO
3 was 0.011 ± 0.002 pH/min (n = 4), a value not
significantly different from zero. The
Na+-dependent
HCO
3 cotransport was completely
abolished in the presence of 300 µM DIDS (Fig.
5A). The results, summarized in Fig.
5C, indicate that the rate of
Na+-dependent
HCO
3-mediated
pHi recovery was 0.076 ± 0.005 pH/min (n = 7) and decreased to 0.012 ± 0.002 pH/min in the presence of 300 µM DIDS
(n = 5).
|
In the next series of experiments, NBC activity in cells subjected to
acid stress was assayed in a manner similar to Fig. 5. Figure
6A shows
representative pHi tracings from
both parent and stressed cells and demonstrates that the
Na+-dependent
HCO
3-mediated
pHi recovery from intracellular acidosis was significantly increased in stressed cells compared with
the parent cells
(dpHi/dt
was 0.610 ± 0.038 pH/min in stressed cells,
n = 7; and 0.085 ± 0.005 pH/min in
control cells, n = 6, P < 0.0001). The
pHi recovery from acidosis was
nearly completely inhibited by 300 µM DIDS (Fig. 6,
B and
C), consistent with the presence of
NBC activity in stressed cells (The rate of
pHi recovery was 0.676 ± 0.051 pH/min, and decreased to 0.027 ± 0.005 pH/min in the presence of
300 µM DIDS, n = 5 for each group,
Fig. 6C). The minimal
pHi recovery from acidosis in the
presence of DIDS likely represents a contribution by
H+-ATPase, as it was also evident
in the absence of HCO
3 in the media.
Depleting the intracellular
Cl
by incubating the cells
in Cl
-free media (only
Cl
-free solutions were used
for the duration of experiments, solution G, Table 1) did not reduce the rate of
Na+-dependent
HCO
3 cotransport into acid-loaded cells (Fig. 6D), indicating that the
enhanced activity is not due to the
Na+-dependent
Cl
/HCO
3
exchanger [The rate of pHi
recovery from acidosis was 0.630 ± 0.023 pH/min in
Cl
-free solution
(n = 4), a value not different from
pHi recovery in
Cl
-containing media].
HCO
3 dependence of
pHi recovery from cell acidosis in
stressed cells was confirmed by the lack of a significant recovery from
acidosis in the absence of HCO
3 in the
media (Fig. 6E).
pHi recovery from acidosis in the
absence of HCO
3 was only 0.01 ± 0.002 pH/min (n = 4).
|
The above experiments indicate that sublethal acid stress decreases the
mRNA expression of NBC-1 but increases the
Na+-dependent
HCO
3 cotransport activity. This
clearly raises the possibility that enhanced NBC activity in
acid-stressed cells is due to another NBC isoform. Figure
7A is a
Northern blot analysis and indicates that NBC-3 mRNA expression was
enhanced significantly in cells subjected to acid stress, with mRNA
levels increasing by ~5.5 ± 0.8-fold (Fig.
7B;
P < 0.01 vs. control
cells, n = 4 for each
group).2
|
Northern hybridization did not detect NBC-2 mRNA expression in either control cells or cells subjected to acid stress (data not shown). An attempt was then made to examine the expression of NBC-2 in IMCD cells by RT-PCR according to EXPERIMENTAL PROCEDURES (Fig. 7C). Lanes 1 and 2 in Fig. 7C are control mIMCD-3 cells, with and without reverse transcriptase, respectively. Lanes 3 and 4 are acid-stressed cells, with and without reverse transcriptase, respectively. Lane M is a 1-kb DNA molecular mass ladder (Life Technologies). As demonstrated, the mouse-specific primers amplified a single 279-bp product in both cell lines but failed to amplify a 1,018-bp genomic sequence (Fig. 7C). These results are consistent with the mRNA expression of NBC-2 in mIMCD-3 cells. Coupled with the fact that NBC-2 mRNA expression was not detected by Northern hybridization, we conclude that NBC-2 mRNA levels are very low in control and acid-stressed cells.
Functional characterization of NBC-1 and
NBC-3. The above experiments demonstrate high levels of
expression of NBC-1 and NBC-3 along with a DIDS-sensitive
Na+-dependent
HCO
3 cotransport activity in control and acid-stressed cells, respectively. Given very low mRNA levels for
NBC-2 and NBC-3, these data suggest that NBC activity in control mIMCD-3 cells is likely mediated via NBC-1. The very low levels of
NBC-1 and NBC-2 mRNA in acid-stressed cells strongly suggest that most
of the NBC activity in these cells is mediated via NBC-3. To
characterize the NBC activity in control mIMCD-3 and stressed cells
further, the interaction of Li+
with NBC in both cell lines was studied. As shown in Fig.
8A, control mIMCD-3 cells showed little
pHi recovery from intracellular acidosis in the presence of Li+
(Table 1, solution E). Switching
from the Li+-containing solution
to the Na+-containing solution
(Table 1, solution C) caused a rapid
rise in pHi recovery (Fig.
8A). As indicated and summarized in
Fig. 8B, the rate of
HCO
3-dependent
pHi recovery from acidosis was
very low in the presence of Li+
(0.008 ± 0.002 pH/min, n = 5) but
was significantly high in the presence of
Na+ (0.09 ± 0.009 pH/min,
n = 5). These results indicate that
NBC activity in control mIMCD-3 cells (likely mediated via NBC-1) has
low affinity for
Li+.3
|
The interaction of NBC with Li+ in
acid-stressed cells was next tested. As shown in Fig.
9A,
exposing the cells to a
Li+-containing solution (Table 1,
solution E) caused significant recovery from intracellular acidosis. As indicated and summarized in
Fig. 9B, the rate of
HCO
3-dependent
pHi recovery from acidosis was
0.327 ± 0.025 pH/min in the presence of
Li+
(n = 7) and 0.618 ± 0.033 in the
presence of Na+
(n = 7;
P < 0.0001). The
Li+-dependent
HCO
3 cotransport was completely
inhibited in the presence of 300 µM DIDS (Figs.
9C, representative
pHi tracings). Figure
9D is the summary of the results and
indicates that the rate of
Li+-dependent
HCO
3-mediated
pHi recovery from cell acidosis
was 0.327 ± 0.0025 pH/min (n = 7)
and decreased to 0.011 ± 0.003 pH/min in the presence of 300 µM
DIDS (n = 5). These results indicate
that Li+ can substitute for
Na+ on NBC in acid-stressed cells,
with Li+ showing less ability to
mediate HCO
3 cotransport. The NBC in
control or acid-stimulated cells showed no affinity for
K+ (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
The NBC-3 cDNA clone was identified by screening a NT-2 cell cDNA
library with NBC-2 cDNA. Figure 1 shows the partial nucleotide sequence
of NBC-3. Figure 2 shows significant homology with both NBC-1 and
NBC-2. Tissue distribution studies of NBC-3 (Fig. 3) show a pattern of
expression distinct from either NBC-1 and NBC-2. Unlike NBC-1 and
NBC-2, NBC-3 is highly expressed in brain and spinal column. Contrary
to NBC-1, NBC-3 shows low level of expression in pancreas and kidney
cortex. NBC-3 and NBC-1 are expressed in cells from renal inner medulla
and show differential expression in EMS-mutagenized mIMCD-3 cells
subjected to sublethal acid stress; NBC-1 is suppressed, whereas NBC-3
is enhanced. NBC-3 and NBC-1 show different affinities for
Li+; NBC-3 likely mediates
Li+-dependent
HCO
3 cotransport, whereas NBC-1 does not.
NBC-3 shows highest expression in brain and spinal cord, suggesting
that this isoform may be the dominant
Na+-dependent
HCO
3 cotransporter in human astrocytes (16). This is in contrast to NBC-1 and NBC-2, which show either low
expression or no expression, respectively, in brain (9, 20). In rat and
in contrast to human, NBC-1 shows high level of expression in brain
(10), indicating species differences with regard to the tissue
distribution of NBC isoforms.
NBC-1 expression in the rat kidney is limited to the cortex (1, 10,
29), whereas in the mouse kidney, it is expressed in both cortex and
medulla (11), consistent with functional studies. NBC-1 mRNA
expression, although absent in rat medullary thick ascending limb and
IMCD cells under baseline condition (10), shows heavy induction in
potassium depletion (4), indicating that this cotransporter may mediate
enhanced HCO
3 reabsorption in these
two nephron segments in certain pathophysiological states. NBC-3
expression in the rat kidney is predominantly observed in the
medulla (Fig. 3, C and
D), a finding distinct from NBC-1 (1, 10, 29).
Functional studies in cultured IMCD cells have localized the
Na+-dependent
HCO
3 cotransporter to the basolateral membrane (19), confirming earlier studies in proximal tubule and other epithelial cells (7, 8, 16-18, 26, 30). It is therefore
logical to conclude that both NBC-1 and NBC-3 are expressed on the
basolateral membrane of mIMCD-3 cells. Based on the clonal
origin of mIMCD-3 cells, we suggest that both these isoforms are
present on the basolateral membrane of the same cells rather than
different cells. A definitive answer, however, should come
from immunocytochemistry studies utilizing specific antibodies.
NBC-1, which is predominantly expressed in the kidney proximal tubule
cells, functions in an outwardly directed mode under physiological
conditions, resulting in transvectorial transport of
HCO
3 from lumen to the blood. Given
the important role of IMCD in HCO
3
reabsorption, it is likely that in mIMCD-3 cells, NBC-1 is functioning
in an efflux mode, resulting in the exit of
HCO
3 across the basolateral membrane
under physiological conditions. Induction of NBC-3 in cells that
survive the sublethal acid stress (more than 99% of the
EMS-mutagenized mIMCD-3 cells subjected to acid stress died; Refs. 5
and 30) suggests that this isoform likely functions in the influx mode
under this condition, leading to increased cell pH in severe acidosis.
The expression and activity of NHE-1 and
H+-ATPase, two known acid
extruders, are also increased in acid-stressed cells (5, 30). This
likely defends the cells against severe acidosis by transporting acid
out of the cells.
Enhancement of Na+-dependent
HCO
3 influx has also been observed in
fibroblasts subjected to proton suicide (13, 22). In PS120 cells, which
are NHE-deficient fibroblast cells (25),
Na+-dependent
Cl
/HCO
3
exchange is enhanced compared with PS127 cells, which overexpress NHE-1
(13, 22). As a result of overexpression of this
Na+-dependent
HCO
3 influx pathway, PS120 cells survive acidic pH in the presence but not the absence of
HCO
3 in the media (13, 22). Taken
together, these results, along with the results in Figs. 6 and 7,
strongly suggest that induction of NBC-3 likely prevents severe
intracellular acidosis by transporting HCO
3 into mIMCD-3 cells subjected to
modified acid-suicide selection.
In basolateral membrane vesicles isolated from rabbit kidney cortex, NBC shows considerable affinity for Li+; however, its affinity was fivefold lower than for Na+ (33). It is worth mentioning that, although mouse NBC-1 shows no affinity for Li+ (Fig. 8), human NBC-1 interacts with Li+ (6)3. Given the high degree of cDNA homology between mammalian NBC-1 isoforms (human and rat; see Refs. 9, 10, 28, 29), comparison of mouse and human NBC-1 cDNAs could yield possible clues regarding the Li+-binding site(s) of NBC-1.
In conclusion, a novel
Na+-HCO
3
cotransporter (NBC-3) has been cloned. Its partial cDNA sequence shows
both the homology and the divergence from NBC-1, NBC-2, and AEs,
indicating that NBC-3 is a new member of the superfamily of bicarbonate
transporters to which both anion exchangers and
Na+-HCO
3
cotransporters belong. NBC-3 shows distinct patterns of tissue
expression and shows differential expression compared with NBC-1 in
response to sublethal acid stress. On the basis of relatively
widespread distribution of NBC-3 and its induction in acid stress, we
propose that NBC-3 is likely involved in cell pH regulation by
mediating the influx of HCO
3 into the cells.
| |
ACKNOWLEDGEMENTS |
|---|
These studies were supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants RO1-DK-46789, RO1-DK-52821, and RO1-DK-54430 and by a grant from Dialysis Clinic Incorporated (to M. Soleimani).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
1 While this manuscript was under review, two independent entries into the GenBank (accession nos. AF069512 and AB018282) reported sequences identical to our NBC-3 cDNA. An alignment of our cDNA clone with these two other cDNAs showed perfect match. The 5' end of our cDNA sequence shows perfect match to the AF069512 sequence. However, the AB018282 sequence contains an extended 5' coding region of ~300 nucleotides that replaces the first 63 nucleotides of the two other cDNAs (the current NBC-3 sequence and the AF069512 sequence) and likely represents an alternative splice variant of NBC-3.
2 To determine the presence of a mouse homolog of human NBC-3 in the mIMCD-3 cells, an RT-PCR experiment was designed to detect, amplify, and sequence such a homolog. Accordingly, cDNA was prepared from mIMCD-cell total RNA (1 µg) using SuperScript reverse transcriptase (Life Technologies) and an oligo-dT primer according to standard procedures. The following PCR primers were designed (based on the known human sequence) to amplify a 601-bp product (upper, 5'-GCTATTTGGGGGCTTGGTG-3'; lower, 5'-CTGGAGGGTGTGATTGTTTGG-3'). Under moderate stringency conditions, several amplification products were detected by gel electrophoresis, and one band of ~600-bp was excised from the gel, reamplified, and sequenced, using the amplification primers as sequencing primers. Clear sequence electropherograms were obtained, indicating the amplification of a pure product. The nucleotide sequence of the PCR product was 87% identical to the human NBC-3 sequence. The mouse amino acid sequence was 94% identical to the human sequence. Taken together with the Northern blot analysis described in this article, this demonstrates that mIMCD-3 cells express NBC-3.
3
In several experiments,
Li+ caused a weak
HCO
3-dependent
pHi recovery in control mIMCD-3
cells when the nadir pHi was
reduced to ~5.8 (by longer incubation in the
NH+4 containing solution). The
Li+-dependent
pHi recovery reached a plateau at
pHi ~6.2. This suggests that the
interaction of NBC-1 with Li+ in
mIMCD-3 cells is likely dependent on the
pHi; At
pHi 6.2 or higher, NBC-1 does not
mediate Li+-dependent
HCO
3 cotransport.
Address for reprint requests and other correspondence: M. Soleimani, Univ. of Cincinnati Medical Center, 231 Bethesda Ave, MSB 5502, Cincinnati, OH 45267-0585 (E-mail: Manoocher.Soleimani{at}uc.edu).
Received 10 September 1998; accepted in final form 12 March 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abdulazade, N.,
I. Lee,
D. Newman,
J. Hwang,
A. Pushkin,
and
I. Kurtz.
Axial heterogeneity of sodium-bicarbonate cotransporter expression in the rabbit proximal tubule.
Am. J. Physiol.
274 (Renal Physiol. 43):
F628-F633,
1998
2.
Abdulazade, N.,
I. Lee,
D. Newman,
J. Hwang,
K. Boorer,
A. Pushkin,
and
I. Kurtz.
Molecular cloning, chromosomal localisation, tissue distribution, and functional expression of the human pancreatic sodium bicarbonate cotransporter.
J. Biol. Chem.
273:
17689-17695,
1998
3.
Ali, R., H. Amlal, C. Burnham, and M. Soleimani. The effect
of glucocorticoids on the expression and activity of the basolateral
Na+-HCO
3
cotransporter (NBC-1) in renal proximal tubule (PT).
J. Am. Soc. Nephrol. In press.
4.
Amlal, H., C. E. Burnham, and M. Soleimani.
Potassium deprivation (KD) upregulates the expression of the
basolateral
Na+:HCO
3
cotransporter (NBC-1) in rat renal nephron segments.
J. Am. Soc. Nephrol. In press.
5.
Amlal, H.,
Z. Wang,
and
M. Soleimani.
Functional upregulation of H+-ATPase by lethal acid stress in cultured inner medullary collecting duct cells.
Am. J. Physiol.
273 (Cell Physiol. 42):
C1194-C1205,
1997
6.
Amlal, H.,
Z. Wang,
C. E. Burnham,
and
M. Soleimani.
Functional characterization of a cloned human kidney Na+:HCO
3 cotransporter.
J. Biol. Chem.
273:
16810-16815,
1998
7.
Aronson, P. S.,
M. Soleimani,
and
S. M. Grassl.
Properties of the renal Na+-HCO
3 cotransporter.
Semin. Nephrol.
11:
28-36,
1991[Medline].
8.
Boron, W. F.,
and
E. L. Boulpaep.
The electrogenic Na/HCO3 cotransporter.
Kidney Int.
36:
392-402,
1989[Medline].
9.
Burnham, C. E.,
H. Amlal,
Z. Wang,
G. E. Shull,
and
M. Soleimani.
Cloning and functional expression of a human kidney Na:HCO
3 cotransporter.
J. Biol. Chem.
272:
19111-19114,
1997
10.
Burnham, C. E.,
M. Flagella,
Z. Wang,
H. Amlal,
G. H. Shull,
and
M. Soleimani.
Cloning, renal distribution, and regulation of the rat Na+-HCO
3 cotransporter.
Am. J. Physiol.
274 (Renal Physiol. 43):
F1119-F1126,
1998
11.
Burnham, C. E.,
Z. Wang,
H. Amlal,
and
M. Soleimani.
Tissue distribution and regulation of Na+-HCO
3 cotransporter mRNA in rat and mouse kidney (Abstract).
J. Am. Soc. Nephrol.
8:
3,
1997.
12.
Camilion, H. M. C.,
B. V. Alvarez,
N. G. Perez,
and
N. E. Cingolini.
Role of an electrogenic Na+/HCO
3 cotransport in determining myocardial pHi after an increase in heart rate.
Circ. Res.
79:
698-704,
1996
13.
Cassel, D.,
O. Scharf,
M. Rotman,
F. J. Cragoe,
and
M. Katz.
Characterization of Na+-linked and Na+-independent Cl
/HCO
3 exchange systems in Chinese hamster lung fibroblast.
J. Biol. Chem.
263:
6122-6127,
1988
14.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
15.
Church, G. M.,
and
W. Gilbert.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:
1991-1995,
1984
16.
Deitmer, J. W.
Electrogenic sodium-dependent bicarbonate secretion by glial cells of the leech central nervous system.
J. Gen. Physiol.
98:
637-655,
1991
17.
Fitz, J. C.,
M. Persico,
and
B. F. Scharschmidt.
Electrophysiological evidence for Na-coupled bicarbonate transport in cultured rat hepatocyte.
Am. J. Physiol.
256 (Gastrointest. Liver Physiol. 19):
G491-G500,
1989
18.
Gleeson, D.,
N. D. Smith,
and
J. L. Boyer.
Bicarbonate dependent and independent intracellular pH regulatory mechanisms in rat hepatocyte.
J. Clin. Invest.
84:
312-321,
1989.
19.
Hart, D.,
and
E. P. Nord.
Polarized distribution of Na+/H+ and Na+/HCO
3 cotransport in primary cultures of renal inner medullary collecting duct cells.
J. Biol. Chem.
266:
2374-2382,
1991
20.
Ishibashi, K.,
S. Sasaki,
and
F. Marumo.
Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina.
Biochem. Biophys. Res. Commun.
246:
5350538,
1998.
21.
Lagadic-Gossmann, D.,
K. J. Buckler,
and
R. D. Vaughn-Jones.
Role of HCO
3 in pH recovery from intracellular acidosis in the guinea-pig ventricular myocyte.
J. Physiol. (Lond.)
458:
361-384,
1992
22.
L'Allemain, G.,
S. Paris,
and
J. Pouyssegur.
Role of a Na-dependent Cl
/HCO
3 exchange in regulation of intracellular pH in fibroblasts.
J. Biol. Chem.
260:
4877-4883,
1985
23.
Lubman, R. L.,
D. C. Chao,
and
E. D. Granadall.
Basolateral localization of Na-HCO
3 cotransporter in alveolar epithelial cells.
Respir. Physiol.
100:
15-24,
1995[Medline].
24.
Nagase, T.,
K. Ishikawa,
M. Suyama,
R. Kikuno,
N. Miyajima,
A. Tanaka,
H. Kotani,
N. Nomura,
and
O. Ohara.
Prediction of the coding sequences of unidentified human genes. The complete sequence of 100 new cDNA clones from brain.
DNA Res.
5:
277-286,
1998[Abstract].
25.
Pouyssegur, J.,
C. Sardet,
A. Franchi,
G. L'Allemain,
and
S. Paris.
A specific mutation abolishing Na+/H+ exchange activity in hamster fibroblasts precludes growth at neutral and acidic pH.
Proc. Natl. Acad. Sci. USA
81:
4833-4837,
1984
26.
Preisig, P. A.,
and
R. J. Alpern.
Basolateral membrane H-OH-HCO3 transport in the proximal tubule.
Am. J. Physiol.
256 (Renal Fluid Electrolyte Physiol. 25):
F751-F756,
1989
27.
Rauchman, M. I.,
N. K. Sanjay,
E. Delpire,
and
S. R. Gullans.
An osmotically tolerant inner medullary collecting duct cell line from SV40 transgenic mouse.
Am. J. Physiol.
265 (Renal Fluid Electrolyte Physiol. 34):
F416-F424,
1993
28.
Romero, M. F.,
M. A. Hediger,
E. L. Boulpaep,
and
W. F. Boron.
Expression cloning and characterization of a renal electrogenic Na+:HCO
3 cotransporter.
Nature
387:
409-413,
1997[Medline].
29.
Romero, M. F.,
P. Fong,
U. V. Berger,
M. A. Hediger,
and
W. F. Boron.
Cloning and functional expression of rNBC, an electrogenic Na+-HCO
3 cotransporter.
Am. J. Physiol.
274 (Renal Physiol. 43):
F425-F432,
1998
30.
Singh, G.,
J. A. McAteer,
and
M. Soleimani.
The Effect of lethal acid stress on Na+/H+ exchanger isoforms in cultured inner medullary collecting duct cells: deletion of NHE-2 and over expression of NHE-1.
Biochim. Biophys. Acta
1239:
74-80,
1995[Medline].
31.
Soleimani, M.,
G. Bizal,
Y. Hattabaugh,
P. S. Aronson,
and
J. Bergman.
Molecular and Cellular Mechanisms of H+ Transport, edited by B. H. Hirst. Berlin: Springer-Verlag, 1994, p. 309-318.
32.
Soleimani, M.,
S. M. Grassl,
and
P. S. Aronson.
Stoichiometry of the Na+-HCO
3 co-transporter in basolateral membrane vesicles isolated from rabbit renal cortex.
J. Clin. Invest.
79:
1276-1280,
1987.
33.
Soleimani, M.,
and
P. S. Aronson.
Ionic mechanism of Na-HCO3 cotransport in rabbit renal basolateral membrane vesicles.
J. Biol. Chem.
264:
18302-18308,
1989
34.
Soleimani, M.,
G. Singh,
G. L. Bizal,
R. S. Gullans,
and
J. A. McAteer.
Na+/H+ exchanger isoforms NHE-2 and NHE-1 in inner medullary collecting duct cells: expression, functional localization, and differential regulation.
J. Biol. Chem.
269:
27973-27978,
1994
35.
Soleimani, M.,
G. Singh,
G. H. Dominguez,
and
R. L. Howard.
Long-term high osmolality activates Na+/H+ exchange and protein kinase C in aortic smooth muscle cells.
Circ. Res.
76:
530-535,
1995
36.
Yoshitomi, K.,
B. C. Burckhardt,
and
E. Fromter.
Rheogenic sodium-bicarbonate co-transport in the peritubular cell membrane of rat renal proximal tubule.
Pflügers Arch.
405:
360-366,
1985[Medline].
This article has been cited by other articles:
![]() |
C. Perry, D. O. Quissell, M. E. Reyland, and I. I. Grichtchenko Electrogenic NBCe1 (SLC4A4), but not electroneutral NBCn1 (SLC4A7), cotransporter undergoes cholinergic-stimulated endocytosis in salivary ParC5 cells Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1385 - C1398. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Parker, P. Bouyer, C. M. Daly, and W. F. Boron Cloning and characterization of novel human SLC4A8 gene products encoding Na+-driven Cl-/HCO3- exchanger variants NDCBE-A, -C, and -D Physiol Genomics, August 1, 2008; 34(3): 265 - 276. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Damkier, S. Nielsen, and J. Praetorius Molecular expression of SLC4-derived Na+-dependent anion transporters in selected human tissues Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2136 - R2146. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kanaan, R. M. Douglas, S. L. Alper, W. F. Boron, and G. G. Haddad Effect of chronic elevated carbon dioxide on the expression of acid-base transporters in the neonatal and adult mouse Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1294 - R1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Schwab, H Rossmann, M Klein, P Dieterich, B Gassner, C Neff, C Stock, and U Seidler Functional role of Na+-HCO3- cotransport in migration of transformed renal epithelial cells J. Physiol., October 15, 2005; 568(2): 445 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, X. C. Sun, and J. A. Bonanno Role of NBC1 in apical and basolateral HCO3- permeabilities and transendothelial HCO3- fluxes in bovine corneal endothelium Am J Physiol Cell Physiol, March 1, 2005; 288(3): C739 - C746. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bachmann, H. Rossmann, U. V. Berger, W. H. Colledge, R. Ratcliff, M. J. Evans, M. Gregor, and U. Seidler cAMP-mediated regulation of murine intestinal/pancreatic Na+/HCO3- cotransporter subtype pNBC1 Am J Physiol Gastrointest Liver Physiol, January 1, 2003; 284(1): G37 - G45. [Abstract] [Full Text] [PDF] |