|
|
||||||||
1 Department of Nephrology, Cyclosporin A (CsA)-induced renal vasoconstriction (RV) is
attributed to an imbalance in vasoactive factors release. Dexamethasone (Dex) exerts a renal vasodilatory effect by a mechanism not yet characterized. This study evaluates whether the effect of
Dex is mediated by NO and whether it prevents CsA-induced RV.
Micropuncture studies were performed in six groups of uninephrectomized
rats treated for 7 days with the following: vehicle (Veh);
Veh + 4 mg/kg dexamethasone (Veh+Dex); 30 mg/kg CsA; CsA+Dex;
vehicle + 10 mg/kg nitro-L-arginine methyl ester
(Veh+L-NAME); and
Veh+Dex+L-NAME. NO
synthase (NOS) isoform mRNA levels were evaluated in renal cortex and medulla by semiquantitative RT-PCR analysis in the first
four groups. Dex produced renal vasodilation, which was blocked by
concomitant L-NAME
administration, and the effect of Dex was associated with
higher cortical and medullary endothelial NOS (eNOS) and cortical
inducible NOS (iNOS) mRNA levels. In the CsA group, Dex prevented RV,
restoring glomerular hemodynamics to control values. These changes were
associated with further enhancement of eNOS and restoration of
medullary iNOS and neuronal NOS (nNOS) expression. We conclude that Dex
prevents CsA-induced RV, and its vasodilator effect could be mediated
by increased intrarenal generation of NO, secondary to enhanced
expression of eNOS and iNOS.
glomerular hemodynamics; reverse transcription-polymerase chain
reaction; renal vasodilation; nitric oxide synthase expression; nitric
oxide synthesis inhibition
CYCLOSPORIN A (CsA) is a potent immunosuppressive agent
that has greatly improved short-term survival rate of transplanted patients as well as of patients with autoimmune disease (7). Its toxic
effects on the kidney, however, have limited its widespread utilization. Experimental studies, evaluating glomerular hemodynamics, have shown that CsA produces vasoconstriction, affecting predominantly afferent arterioles. The vasoconstriction decreases the glomerular plasma flow, which is associated with a reduction in the
ultrafiltration coefficient,
Kf (1, 28, 29,
34). These changes, in turn, produce a marked decrease in the
glomerular filtration rate (GFR).
CsA-induced renal vasoconstriction is attributed to an imbalance of
locally released vasoactive agents, on one hand, by increased release
of vasoconstricting factors, such as thromboxane, endothelin, and
angiotensin II (17, 23, 24), and, on the other, by a decrease in
vasodilating factors, such as prostacyclin (23) and nitric oxide (NO)
(11, 32). In fact, strategies directed to suppress vasoconstriction,
such as angiotensin converting enzyme inhibitors (22, 23), endothelin
receptors blockers (12), and thromboxane inhibitors (24), have been
used as an approach to prevent CsA nephrotoxicity; however, no
satisfactory results have been obtained.
Participation of NO in CsA nephrotoxicity has not been well defined.
Initial studies suggested that CsA impairs NO production, but recent
studies from our laboratory and others have demonstrated that NO
synthesis is well preserved during CsA nephrotoxicity. López-Ongil et al. (20) detected in bovine endothelial cells that
CsA induces an increase in endothelial NO synthase (eNOS) mRNA and
protein levels. In addition, we have shown in rats that CsA increases
eNOS mRNA levels in renal cortex and that acute (6) or chronic (4)
inhibition of NO synthesis accentuates renal vasoconstriction and
structural changes in CsA-treated animals, suggesting that NO synthesis
counterbalances renal vasoconstriction induced by CsA.
It is well known that glucocorticoids, which are commonly used in
clinical transplantation associated with CsA, exhibit a renal
vasodilator effect, but the mechanism responsible has not been
established. Some vasoactive agents, such as prostaglandins (3) and
atrial natriuretic factor (10, 13, 15), have been proposed as the
mediators of glucocorticoid-induced renal vasodilation. However, De
Matteo and May (9) reported in sheep that the increase in renal flow
induced by cortisol is suppressed when NO synthesis is inhibited,
suggesting that NO is the principal mediator of the vasodilator effect
exerted by glucocorticoids. Thus the major goals of the present study
was to evaluate whether renal vasodilator effect of Dex is mediated by
NO and whether Dex can prevent renal vasoconstriction induced by CsA.
For this purpose, we evaluated the effect of Dex on glomerular
hemodynamics in control and CsA- and nitro-L-arginine
methyl ester (L-NAME)-treated rats, as well as changes in neuronal NOS (nNOS), inducible NOS (iNOS),
and eNOS gene expression in renal cortex and medulla during Dex or CsA
administration. Our data suggest that renal vasodilation induced by Dex
prevents CsA renal vasoconstriction. This effect was partially mediated
by a NO-dependent mechanism, which is associated with an increment of
eNOS gene expression.
Male Wistar rats, weighing 300-350 g, with right nephrectomy were
used for the study. Fifteen days after nephrectomy, animals were
randomly divided into four groups, which were subjected to the
following daily treatments during 7 days: group
I included 12 rats that received 0.1 ml olive oil as
vehicle (Veh); group II consisted of
12 rats treated with vehicle plus 4 mg/kg sc dexamethasone (Veh+Dex);
group III consisted of 12 rats that
received 30 mg/kg sc CsA (CsA); group
IV consisted of 12 rats treated with CsA and Dex
(CsA+Dex); group V consisted of 6 rats
treated with 10 mg/kg L-NAME in
drinking water for 2 days before micropuncture studies were performed
(Veh+L-NAME); and
group VI consisted of 6 rats that
received Veh+Dex+L-NAME. The
Veh, Veh+Dex, and Veh+L-NAME groups were pair fed.
Micropuncture studies. Hemodynamic
studies were performed in seven rats of groups
I, II,
III, and
IV, as well as in six rats of
groups V and
VI. Rats were anesthetized with
pentobarbital sodium (30 mg/kg ip), and supplemental doses were
instilled as required. The rats were placed on a thermoregulated table,
and temperature was maintained at 37°C. Trachea, both jugular
veins, femoral arteries, and the left ureter were catheterized with
polyethylene tubing (PE-240, PE-50, and PE-10). The left kidney was
exposed, placed in a Lucite holder, sealed with elastomer (Xantropen,
Bayer), and covered with Ringer solution. Mean arterial pressure (MAP) was monitored with a pressure transducer (model p23 db; Gould, San
Juan, PR) and recorded on a polygraph (Grass Instruments, Quincy, MA). Blood samples were taken periodically and replaced with
blood from a donor rat.
Rats were maintained under euvolemic conditions by infusion of 10 ml/kg
of body weight of isotonic rat plasma during surgery, followed by an infusion of 25% polyfructosan, at 2.2 ml/h (Inutest, Laevosan-Gesellschaft). After 60 min, five to six 3-min collection samples of proximal tubular fluid were obtained to determine flow rate
and polyfructosan concentration. Intratubular pressure under free-flow
and stop-flow conditions and peritubular capillary
pressure were measured in other proximal tubules with a servo-null
device (Servo Nulling Pressure System; Instrumentation for Physiology and Medicine, San Diego, CA). Polyfructosan was measured in plasma samples. Glomerular colloid osmotic pressure was estimated in protein
from blood of the femoral artery
(Ca) and surface efferent arterioles (Ce). Polyfructosan
concentrations were determined by the technique of Davidson and Sackner
(8). Tubular fluid volume was estimated as previously described (16).
Concentration of tubular polyfructosan was measured by the method of
Vurek and Pegram (38). Protein concentration in afferent and efferent samples was determined according to the method of Viets et al. (37).
MAP, GFR, single-nephron GFR (SNGFR), glomerular capillary hydrostatic
pressure (Pgc), single-nephron
filtration fraction, single-nephron plasma flow
(Qa), afferent
(Ra) and
efferent (Re) resistances, Kf,
and oncotic pressure ( RNA isolation. Kidneys were obtained
from five rats of groups I,
II,
III, and
IV. Rats were anesthetized by
intraperitoneal injection of pentobarbital sodium, and their left
kidneys were excised, macroscopically divided into renal cortex and
medulla, frozen in liquid nitrogen, and kept at Relative quantitation of NOS mRNA. The
relative level of NOS mRNA expression was assessed in the renal cortex
and medulla by semiquantitative RT-PCR, as previously described (4, 5). Briefly, NOS primer sequences were custom obtained from GIBCO-BRL (Life
Technologies, Gaithersburg, MD). nNOS primers were as follows: sense
5' GAACCCCCAAGACCATCC 3' and antisense 3'
GGCTTTGCTCCCACAGTT 5', which amplified a fragment
of 308 bp on the amino-terminal domain of nNOS (from base 692 to
999 of rat cerebellum nNOS sequence). iNOS primers were as
follows: sense 5' GTGTTCCACCAGGAGATGTTG 3' and antisense
3' CTCCTGCCCACTGAGTTCGTC 5', which amplified a fragment of
570 bp on the amino-terminal domain of iNOS (from base 1407 to 1977 of
the murine macrophages iNOS sequence), and eNOS primers were as
follows: sense 5' TACGGAGCAGCAAATCCAC 3' and antisense 3' CAGGCTGCAGTCCTTTGATC 5', which amplified a fragment of
819 bp on the amino-terminal domain of eNOS (from base 2331 to 3144 of
rat eNOS). To monitor nonspecific effects of the experimental treatment
and to semiquantitate NOS isoforms expression, we amplified a fragment
of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), using primers
previously described (27). Genomic DNA contamination was checked by
treating all RNA samples with DNase and by carrying samples through PCR
procedure without adding reverse transcriptase.
Reverse transcription (RT) was carried out using 10 µg of total RNA
from the renal cortex or medulla of each rat. Prior to RT reaction, the
RNA was heated at 65°C for 10 min. RT was performed at 37°C for
60 min in a total volume of 20 µl using 200 U of the Moloney murine
leukemia virus reverse transcriptase (GIBCO-BRL), 100 pmol of random
hexamers (GIBCO-BRL), 0.5 mM of each dNTP (Sigma Chemical, St. Louis
MO), and 1× RT buffer (75 mM KCl, 50 mM
Tris · HCl, 3 mM
MgCl2, and 10 mM DTT, pH 8.3).
Samples were heated at 95°C for 5 min to inactivate the reverse
transcriptase and diluted to 40 µl with PCR grade water. One-tenth of
the RT individual samples of each group was used for each NOS isoform
or GAPDH amplification in 20-µl final volume reactions containing
1× PCR buffer (10 mM Tris · HCl, 1.5 mM
MgCl2, and 50 mM KCl, pH 8.3), 0.1 mM of each dNTP, 0.2 µCi of
[ Amplification kinetics of the three NOS isoforms and housekeeping gene
in renal cortex and medulla total RNA and the optimal number of cycles
for quantitation for each NOS isoform were previously reported (4). To
analyze the PCR products, one-half of each reaction was electrophoresed
in a 5% acrylamide gel. Bands were ethidium bromide stained and
visualized under UV light, cut out, suspended in 1 ml of scintillation
cocktail (Ecolume; ICN, Aurora, OH), and counted by liquid
scintillation (model LS6500; Beckman, Fullerton, CA). To semiquantitate
each NOS isoform, we performed all reactions individually from each
cortex or medulla total RNA in duplicate.
Statistical analysis. Statistical
significance is defined as two-tailed
P < 0.05, and the results are
presented as means ± SE. NOS isoforms expression is shown as the
ratio between NOS/GAPDH PCR product. We tested the differences between
groups by one-way ANOVA and Student-Newman-Kuels for multiple comparisons.
Hemodynamic studies. Table
1 summarizes the results obtained in
glomerular hemodynamic studies on groups
I to IV. Dex
administration produced a clear vasodilator effect. In Veh+Dex group,
compared with Veh group, glomerular plasma flow increased 39.8%, due
to a 34.2% fall in afferent resistance, while efferent resistance was
not modified; preglomerular vasodilation allowed the transmission of
MAP to glomerular capillaries, and
Pgc increased significantly. The
fall in Ra
resulted in a 39.8% increase in glomerular plasma flow, whereas
Kf values
remained unchanged. Thus significant elevations in SNGFR and total GFR
(26.4 and 48%, respectively) were observed. These results confirm the
ability of Dex to produce renal vasodilation under normal conditions.
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
) were calculated according to equations given
elsewhere (2).
80°C until
used. Total RNA was isolated from each cortex or medulla following the
guanidine isothiocyanate-cesium chloride method (30). Integrity of
isolated total RNA was examined by 1% agarose gel electrophoresis, and RNA concentration was determined by the ultraviolet (UV) light absorbance at 260 nm (model DU640; Beckman, Brea, CA). All RNA samples
were incubated with RNase-free DNase I (Boehringer,
Mannheim, Germany) for 15 min at 37°C and extracted with the
phenol-chloroform technique.
-32P]dCTP
(~3,000 Ci/mmol, 9.25 MBq, 250 µCi), 10 µM of each primer, and 1 U of Taq DNA polymerase (GIBCO-BRL).
The samples were overlaid with 30 µl mineral oil, and PCR cycles were
performed in a DNA thermal cycler (M.J. Research, Watertown, MA), with
the following profile: denaturation 1 min at 94°C, annealing 1 min
at 55°C for nNOS primers and 60°C for iNOS and eNOS primers,
and 1 min extension step at 72°C. The last cycle was
followed by a final extension step of 5 min at 72°C. The control
gene was coamplified simultaneously in each reaction.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
Table 1.
Dexamethasone effect on glomerular hemodynamics during CsA
nephrotoxicity
Chronic CsA administration produced marked renal vasoconstriction, as evidenced by 51% reduction in glomerular plasma flow produced by sharp increases in both Ra and Re. Glomerular plasma flow was reduced, Pgc remained unchanged, and Kf was significantly reduced. The fall in two of the four determinants of GFR, that is Qa and Kf, was responsible for the decrease in SNGFR to almost one-half of the values obtained in Veh animals. Thus the CsA group exhibited the characteristic renal vasoconstriction observed during chronic treatment.
In the CsA+Dex group, Dex administration produced a marked vasodilator effect and restored renal hemodynamics to control values. Pre- and postglomerular vasodilation were observed; thus Ra and Re decreased significantly (61.5 and 48.7%, respectively). The fall in Ra allowed the transmission of a greater fraction of MAP to glomerular capillaries in this group, causing a rise in Pgc. Arteriolar vasodilation induced an important rise in Qa (171.3%) compared with CsA-treated rats. The percent increase of Qa in CsA+Dex vs. CsA group was fourfold higher than that observed in Veh+Dex vs. Veh alone (171.3 vs. 39.8%). An increase in Kf was also observed. Elevations in Qa, Pgc, and Kf caused a significant increase in SNGFR and total GFR of 104.8 and 116.0%, respectively, reestablishing completely glomerular dynamics to control values. These results clearly demonstrate that Dex administration prevented renal vasoconstriction induced by CsA.
To evaluate whether the vasodilatory effect induced by Dex was due to
increased NO generation, the glomerular hemodynamics in rats treated
with Dex were assessed with and without administration of the NO
synthesis inhibitor L-NAME, as
well as in a group treated with
L-NAME alone. Figure
1 shows the results of these series of
experiments. As we also shown in Table 1, Dex administration produced
renal vasodilation characterized by increases in
Pgc, Qa, and SNGFR.
L-NAME produced renal
vasoconstriction characterized by a reduction of
Qa, due to a profound elevation of
Ra and
Re resistances
(6.3 ± 0.5 and 4.1 ± 0.4 dyn · s · cm
5,
respectively), together with an increase in
Pgc and a decrease in
Kf. Theses
changes resulted in significant fall in SNGFR. However, in the presence
of NO synthesis inhibition by
L-NAME, the vasodilatory effect
of Dex was completely suppressed, as indicated by the similar values of
Qa,
Kf, and SNGFR in
Veh+Dex+L-NAME group, as in rats treated with L-NAME alone. Thus
Dex renal vasodilation seems to be dependent on NO synthesis.
|
Expression of NOS mRNA. Figure
2 shows the results of each NOS isoform
gene expression in renal cortex and medulla determined by
semiquantitative RT-PCR analysis in groups
I, II,
III, and IV. Dex administration was associated
with a fivefold increase of eNOS expression in renal cortex (Fig.
2A) and a slightly lower, but
nevertheless significant, increment (twofold) in renal medulla (Fig.
2B). In addition, Dex also induced a
threefold increase of iNOS expression in renal cortex (Fig.
2C), but not in renal medulla (Fig.
2D). No changes were observed in
nNOS levels in either cortex or medulla (Fig. 2,
E and
F).
|
In CsA-treated rats, we found that eNOS mRNA levels increased in renal
cortex (Fig. 2A), whereas nNOS and
iNOS mRNA levels were not modified. In contrast, in medullary total
RNA, eNOS did not change (Fig. 2B),
whereas nNOS and iNOS decreased significantly (Fig. 2,
D and
F). Interestingly, Dex
administration in rats receiving CsA was associated with a further
increase in cortical eNOS mRNA (Fig.
2A). Also, in the group treated with
CsA+Dex, we observed an increase in eNOS levels in medullary RNA (Fig.
2B) and in iNOS in cortical total
RNA (Fig. 2C). In addition, compared
with CsA, Dex administration restored nNOS and iNOS mRNA levels in
renal medulla (Figs. 2, D and
F). Figure
3 shows a representative autoradiography containing eNOS and GAPDH amplification products in renal cortex of
each rat from the four studied groups. The increase in eNOS expression
in Veh+Dex and CsA+Dex groups is evident.
|
| |
DISCUSSION |
|---|
|
|
|---|
The major findings of this study are that renal vasodilation induced by Dex is associated with an upregulation of cortical and medullary eNOS mRNA levels. This vasodilator effect was blocked by NO synthesis inhibition. In addition, Dex administration prevented CsA-induced renal vasoconstriction and enhanced eNOS mRNA levels and restored medullary nNOS and iNOS expression.
In the present study, we found that chronic Dex administration produced marked renal vasodilation, which appeared to be limited to preglomerular vessels. In fact, afferent resistance decreased, whereas efferent resistance remained unchanged. These changes were associated with a significant increment in both glomerular capillary pressure and flow that resulted in a striking elevation of SNGFR.
It has been known for years that glucocorticoid administration results in renal vasodilation, which is associated with an increase in GFR (3), this vasodilator effect is observed solely in the kidney. However, the mechanism responsible for this effect is not known. The participation of vasoconstrictors is not clear, since the renin-angiotensin system and endothelin seem to be not altered by glucocorticoids. A novel potential mechanism to explain the renal vasodilator effect of glucocorticoids is the liberation of NO in renal arteries. De Matteo and May (9) demonstrated in sheep that the inhibition of NO synthesis markedly attenuates the renal vasodilator response to cortisol, suggesting that glucocorticoid action depends on NO release. In this study, we observed that the vasodilatory effect of Dex was completely suppressed by concomitant L-NAME administration. In fact, glomerular hemodynamics in Dex+L-NAME group were similar to that observed in rats treated with L-NAME alone, also suggesting that NO could be implicated in this vasodilatory effect. More recently, it was reported that renal vasodilation induced by cortisol is partially prevented by indomethacin, suggesting that prostaglandins are, in addition to NO, another locally released factor involved in mediating the renal vasodilation induced by glucocorticoids (10). Therefore, renal vasodilation induced by Dex could be the result of an imbalance between vasoconstricting and vasodilating factors, secondary in part to increase in the liberation of vasodilatory substances such as NO and prostaglandins. More studies are necessary to establish other mechanisms implicated in this effect.
In CsA-treated rats, Dex administration produced a marked renal vasodilation, raising Pgc, Qa, and SNGFR to normal values. Thus Dex completely reversed renal vasoconstriction induced by CsA.
In the clinical transplantation, CsA nephrotoxicity is a relatively common complication despite the fact that CsA is routinely administrated in combination with glucocorticoids. However, the most commonly used drugs are prednisone and prednisolone, which are unlikely to have a significant renal vasodilatory effect at the low doses that are given in the late stage of transplant, when CsA toxicity occurs.
Locally released NO plays a key role in maintaining renal function, its effect however, is determined by the pattern of expression of each NOS isoform. In the kidney, NO is produced by at least three NOS isoforms that are constitutively expressed and located in specific nephron structures (for review, see Ref. 18). nNOS is expressed in macula densa cells and inner medullary collecting duct; NO produced by this isoform regulates the tubuloglomerular feedback system activation and renin release. iNOS is present in the proximal tubular epithelium, afferent arteriole wall, and in immunostimulated mesangial cells. The role of iNOS under normal conditions is still unknown. eNOS is located in glomerular capillaries, afferent and efferent arterioles, medullary capillaries, and tubular epithelium; NO generated by this isoform regulates afferent arteriole tone, glomerular capillary pressure, and glomerular plasma flow.
In the present study, as we have shown before (4), CsA treatment was associated with increased eNOS gene expression in renal cortex, and decreased nNOS and iNOS mRNA levels in renal medulla, suggesting that increased cortical NO counterbalances the renal vasoconstriction induced by CsA. Interestingly, in control and CsA-treated rats, chronic Dex administration induced striking changes in the pattern of NOS isoforms gene expression in renal cortex and medulla.
In Veh+Dex animals, Dex administration resulted in a significant increase in eNOS gene expression in both cortex and medulla, suggesting that renal vasodilation could be mediated by a greater NO release. In CsA-treated rats, in which the pattern of NOS isoforms expression was altered by increased cortical eNOS and decreased medullary nNOS and iNOS, Dex enhanced even more the expression of eNOS in the cortex and medulla and reestablished nNOS and iNOS gene expression to control levels. Thus the renal vasodilator effect of Dex was associated with an increase in eNOS mRNA levels, in both renal cortex and medulla. Since, eNOS isoform is located in the endothelium of glomerular vessels and NO released by this isoform diffuses into vascular smooth muscle cells, it is quite likely that the increase in eNOS expression could be in part responsible for the vasodilator effect. However, further studies are required to determine the type of cells in the renal cortex and medulla in which the increase of eNOS expression occurs.
The mechanism by which Dex induces an increase in eNOS mRNA level can be direct or indirect. There is no evidence for the existence of a glucocorticoid responsive element in the promoter region of eNOS gene. Alternatively, increased eNOS expression could result from the induction of other transcription factors acting on the promoter region of this isoform gene or by increasing eNOS mRNA stability. A possible explanation could be related to the Dex effect on the heat shock proteins, specially the Hsp90, which recently has been shown to interact with eNOS, resulting in a marked increase in eNOS activity and stability (14). It is evident that more studies are necessary to establish the molecular mechanism responsible for the induction of eNOS expression by Dex.
In our study, Dex increased iNOS mRNA levels in renal cortex. This
finding differs with previous studies in which Dex inhibited iNOS
transcription (19, 31). We believe that our observations cannot be
attributed to DNA contamination, since it was carefully assessed.
Several possibilities to explain this discrepancy can be considered.
First, most of the studies in which iNOS expression was reduced by Dex
were made under immunostimulated conditions, whereas we are showing the
effect of Dex on the fraction of iNOS that is constitutively expressed.
Thus it is possible that Dex blocks the immunostimulation of iNOS
expression, rather than the constitutive expression of iNOS. Second,
our observation was made using total RNA from renal cortex. Since we
studied the constitutive expression of iNOS, it is highly likely that
this represent iNOS from proximal tubules and renal blood vessels. It
is possible that regulation of iNOS expression is very different among
different types of cells. Third, preliminary evidence suggests that
there could be two iNOS isoforms in the rat kidney: one that is
predominantly expressed in renal tubule segments, with the highest
expression in the medullary thick ascending limb, and the other one in
vascular smooth muscle cells from the afferent arteriole, glomeruli,
and interlobular and arcuate arteries (21, 35). If indeed two isoforms
of iNOS exist, then it is possible that they could be regulated by
different mechanisms. Since we only observed upregulation of iNOS in
renal cortex where the vascular smooth muscle cell iNOS isoform has
been located (21), our results agree with the finding of Perrella et
al. (25), that Dex does not inhibit nitrate production in
interleukin-1
-induced smooth muscle cells and increases transcriptional rate and iNOS mRNA half-life. The contribution of NO
generated by this isoform is difficult to evaluate, since under
nonimmunostimulated conditions the expression of iNOS in the kidney is
relatively small. More studies are necessary to establish the
regulation of NOS isoforms in the kidney by glucocorticoids.
We have shown in the present and in a previous study (4) that CsA reduces iNOS and nNOS expression in renal medulla. Furthermore, in the present study Dex administration prevented this reduction in CsA-treated rats. Chronic renal ischemia induced by CsA administration is associated with increased apoptosis (33), expression of osteopontin (26), and reduction of iNOS (4, 36). In addition, it has been reported recently that renal injury produced by CsA involves a hypoxia-reoxygenation mechanism (39), suggesting that tubulointerstitial fibrosis resulted from renal hypoxia. Thus, in the present study, preservation of nNOS and iNOS levels in renal medulla by Dex in CsA-treated rats was probably mediated by restoration of the renal blood flow that preventing medullary hypoxia.
In summary, the present study suggests that the renal vasodilator effect of Dex is partially mediated by increased NO generation that could be secondary to an increase of cortical and medullary eNOS expression. Our results confirm that CsA-induced renal vasoconstriction is associated with an increased cortical eNOS and decreased medullary nNOS and iNOS expression. Finally, our findings indicate that prevention of CsA renal vasoconstriction by Dex was associated with further enhancement of eNOS. Restoration of renal perfusion by Dex probably prevented the suppression of medullary nNOS and iNOS expression induced by CsA.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by Mexican Council of Science and Technology (CONACYT) Research Grant 28668 (to N. A. Bobadilla) and Grants 0054 and 97692m (to G. Gamba). G. Gamba is an International Research Scholar from Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
Part of this work was presented at the 31st Annual Meeting of the American Society of Nephrology, Philadelphia, PA, in 1998.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: N. A. Bobadilla, Dept. of Nephrology, Instituto Nacional de Cardiología I. Ch., Juan Badiano No 1, Col Sección XVI, Mexico City CP 14080, Mexico (E-mail: nbobadillas{at}mailer.main.conacyt.mx).
Received 15 December 1998; accepted in final form 4 June 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Barros, E.,
M. A. Boim,
H. Ajzen,
O. L. Ramos,
and
N. Schor.
Glomerular hemodynamics and hormonal participation on cyclosporine nephrotoxicity.
Kidney Int.
32:
19-25,
1987[Medline].
2.
Baylis, C.,
W. M. Deen,
B. D. Myers,
and
B. M. Brenner.
Effects of some vasodilator drugs on transcapillary fluid exchange in renal cortex.
Am. J. Physiol.
230:
1148-1158,
1976.
3.
Baylis, C.,
R. K. Handa,
and
M. Sorkin.
Glucocorticoids and control of glomerular filtration rate.
Semin. Nephrol.
10:
320-329,
1990[Medline].
4.
Bobadilla, N. A.,
G. Gamba,
E. Tapia,
R. García-Torres,
A. Bolio,
P. López-Zetina,
and
J. Herrera-Acosta.
Role of NO in cyclosporin nephrotoxicity: effects of chronic NO inhibition and NO synthases gene expression.
Am. J. Physiol.
274 (Renal Physiol. 43):
F791-F798,
1998
5.
Bobadilla, N. A.,
J. P. Herrera,
A. Merino,
and
G. Gamba.
Semi-quantitative PCR: a tool to study low abundance messages in the kidney.
Arch. Med. Res.
1:
55-60,
1997.
6.
Bobadilla, N. A.,
E. Tapia,
M. Franco,
P. López,
S. Mendoza,
R. García-Torres,
J. A. Alvarado,
and
J. Herrera-Acosta.
Role of nitric oxide in renal hemodynamic abnormalities of cyclosporin nephrotoxicity.
Kidney Int.
46:
773-779,
1994[Medline].
7.
Cecka, J. M.,
and
P. I. Terasaki.
The UNS Scientific Renal Transplant Registry. Clinical Transplants. Los Angeles, CA: UCLA Tissue Typing Laboratory, 1994, vol. 1, p. 18.
8.
Davidson, W. D.,
and
M. A. Sackner.
Simplification of the anthrone method for the determination of inulin in clearance studies.
J. Lab. Clin. Med.
62:
351-356,
1963[Medline].
9.
De Matteo, R.,
and
C. N. May.
Glucocorticoid induced renal vasodilatation is mediated by a direct renal action involving nitric oxide.
Am. J. Physiol.
273 (Regulatory Integrative Comp. Physiol. 42):
R1972-R1979,
1997
10.
De Matteo, R.,
and
C. N. May.
Inhibition of prostaglandin and nitric oxide synthesis prevents cortisol-induced renal vasodilatation in sheep.
Am. J. Physiol.
276 (Regulatory Integrative Comp. Physiol. 45):
R1125-R1131,
1999
11.
Diederich, D.,
Z. Yang,
and
T. F. Lüscher.
Chronic cyclosporine therapy impairs endothelium-dependent relaxation in the renal artery of the rat.
J. Am. Soc. Nephrol.
2:
1291-1297,
1992[Abstract].
12.
Fogo, A.,
S. E. Hellings,
T. Inagami,
and
V. Kon.
Endothelin receptor antagonism is protective in acute cyclosporine toxicity.
Kidney Int.
42:
770-774,
1992[Medline].
13.
García, R.,
W. Debinski,
J. Gutkowska,
O. Kuchel,
G. Thibault,
J. Genest,
and
M. Cantin.
Gluco and mineralocorticoids may regulate the natriuretic effect and the synthesis and release of atrial natriuretic factor by the rat atria in vivo.
Biochem. Biophys. Res. Commun.
131:
806-814,
1985[Medline].
14.
García-Cardeña, G.,
R. Fan,
V. Shah,
R. Sorrentino,
G. Cirino,
A. Papapetropoulos,
and
W. C. Sessa.
Dynamic activation of endothelial nitric oxide synthase by Hsp 90.
Nature
392:
821-824,
1998[Medline].
15.
Gardner, D. G.,
S. Hane,
D. Stracheuzki,
D. Shenk,
and
J. D. Baxter.
Atrial natriuretic peptide mRNA is regulated by glucocorticoids in vivo.
Biochem. Biophys. Res. Commun.
139:
1047-1054,
1986[Medline].
16.
Herrera-Acosta, J.,
M. Franco,
E. Tapia,
F. Gabbai,
J. L. Cermeño,
C. Calleja,
J. M. Pérez,
R. Barrios,
and
G. Torres.
Mechanism of glomerular permeability reduction in non-clipped kidney of rats with Goldblatt hypertension.
Hypertension
8, Suppl. I:
I-105-I-109,
1986.
17.
Kon, V.,
M. Sugiura,
T. Inagami,
B. R. Harvie,
I. Ichikawa,
and
R. L. Hoover.
Role of endothelin in cyclosporine-induced glomerular dysfunction.
Kidney Int.
37:
1487-1491,
1990[Medline].
18.
Kone, B. C.,
and
C. Baylis.
Biosynthesis and homeostatic roles of nitric oxide in the normal kidney.
Am. J. Physiol.
272 (Renal Physiol. 41):
F561-F578,
1997
19.
Kunz, D.,
G. Walker,
W. Eberhardt,
and
J. Pfeilschifter.
Molecular mechanisms of dexamethasone inhibition of nitric oxide synthase expression in interleukin 1
-stimulated mesangial cells: evidence for the involvement of transcriptional and posttranscriptional regulation.
Proc. Natl. Acad. Sci. USA
93:
255-259,
1996
20.
López-Ongil, S.,
M. Saura,
D. Rodríguez-Puyol,
M. Rodríguez-Puyol,
and
S. Lamas.
Regulation of endothelial NO synthase expression by cyclosporin A in bovine aortic endothelial cells.
Am. J. Physiol.
271 (Heart Circ. Physiol. 40):
H1072-H1078,
1996
21.
Mohaupt, M. G.,
J. L. Elzie,
K. Y. Ahn,
W. L. Clapp,
C. S. Wilcox,
and
B. C. Kone.
Differential expression and induction of mRNAs encoding two: inducible nitric oxide synthases in the rat.
Kidney Int.
46:
653-665,
1994[Medline].
22.
Murray, B. M.,
M. S. Paller,
and
T. F. Ferris.
Effect of cyclosporine administration on renal hemodynamics in conscious rats.
Kidney Int.
28:
767-764,
1985[Medline].
23.
Perico, N.,
A. Benigni,
E. Bosco,
M. Rossini,
S. Orisio,
F. Ghilardi,
A. Piccinelli,
and
G. Remuzzi.
Acute cyclosporin A nephrotoxicity in rats: which role for renin-angiotensin system and glomerular prostaglandins?
Clin. Nephrol.
25, Suppl. 1:
S83-S88,
1986.
24.
Perico, N.,
A. Benigni,
C. Zoja,
F. Delaini,
and
G. Remuzzi.
Functional significance of exaggerated renal thromboxane A2 synthesis induced by cyclosporine A.
Am. J. Physiol.
251 (Renal Fluid Electrolyte Physiol. 20):
F581-F587,
1986.
25.
Perrella, M. A.,
M. Yoshizumi,
Z. Fen,
J. C. Tsai,
C. M. Hsieh,
S. Kourembanas,
and
M. E. Lee.
Transforming growth factor-
1, but not dexamethasone, down-regulates nitric-oxide synthase mRNA after its induction by interleukin-1
in rat smooth muscle cells.
J. Biol. Chem.
269:
14595-14600,
1994
26.
Pichler, R. H.,
N. Franceschini,
B. A. Young,
C. Hugo,
T. F. Andoh,
E. A. Burdmann,
S. J. Shankland,
C. E. Alperts,
W. M. Bennett,
W. G. Courser,
and
R. J. Johnson.
Pathogenesis of cyclosporine nephropathy: roles of angiotensin II and osteopontin.
J. Am. Soc. Nephrol.
6:
1186-1196,
1995[Abstract].
27.
Rocco, M. V.,
E. G. Neilson,
J. R. Hoyer,
and
F. N. Ziyadeh.
Attenuated expression of epithelial cell adhesion molecules in murine polycystic kidney disease.
Am. J. Physiol.
262 (Renal Fluid Electrolyte Physiol. 31):
F679-F686,
1992
28.
Sabbatini, M.,
C. Esposito,
F. Uccello,
L. De Nicola,
M. Alba,
G. Conte,
A. Dal Canton,
and
V. E. Andreucci.
Acute effects of cyclosporine on glomerular dynamics. Micropuncture study in the rat.
Transplant. Proc.
20:
544-548,
1988[Medline].
29.
Sabbatini, M.,
L. De Nicola,
F. Uccello,
G. Romano,
G. Papaccio,
V. Esposito,
V. Sepe,
G. Conte,
and
G. Fuiano.
Medium-term cyclosporin renal dysfunction and its reversibility in rats.
Am. J. Physiol.
260 (Renal Fluid Electrolyte Physiol. 29):
F898-F905,
1991
30.
Sambrook, J.,
E. F Fritsch,
and
T. Maniatis.
Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989, p. 7-7.15.
31.
Saura, M.,
C. Zaragoza,
M. Díaz-Cazorla,
O. Hernández-Perera,
E. Eng,
C. J. Lowenstein,
D. Pérez-Sala,
and
S. Lamas.
Involvement of transcriptional mechanisms in the inhibition of NOS2 expression by dexamethasone in rat mesangial cells.
Kidney Int.
53:
38-49,
1998[Medline].
32.
Takenaka, T.,
Y. Hashimoto,
and
M. Epstein.
Diminished acetylcholine-induced vasodilation in renal microvessels of cyclosporine-treated rats.
J. Am. Soc. Nephrol.
3:
42-50,
1992[Abstract].
33.
Thomas, S. E.,
T. F. Andoh,
R. H. Pichler,
S. J. Shankland,
W. G. Couser,
W. M. Bennett,
and
R. J. Johnson.
Accelerated apoptosis characterizes cyclosporine-associated interstitial fibrosis.
Kidney Int.
53:
897-908,
1998[Medline].
34.
Thomson, S. C.,
B. J. Tucker,
F. Gabbai,
and
R. C. Blantz.
Functional effects on glomerular hemodynamics of short-term chronic cyclosporine in male rats.
J. Clin. Invest.
83:
960-969,
1989.
35.
Tojo, A.,
S. S. Gross,
L. Zhang,
C. C. Tisher,
H. H. Schmidt,
C. S. Wilcox,
and
K. M. Madsen.
Immunocytochemical localization of distinct isoforms of nitric oxide synthase in the juxtaglomerular apparatus of normal rat kidney.
J. Am. Soc. Nephrol.
4:
1438-1447,
1994[Abstract].
36.
Vaziri, N. D.,
Z. NI,
Y. P. Zhang,
E. P. Ruzics,
P. Maleki,
and
Y. Ding.
Depressed renal and vascular nitric oxide synthase expression in cyclosporine-induced hypertension.
Kidney Int.
54:
482-491,
1998[Medline].
37.
Viets, J. W.,
W. M. Deen,
J. L. Troy,
and
B. M. Brenner.
Determination of serum protein concentration in nanoliter blood samples using fluorescamine or o-phthalaldehyde.
Anal. Biochem.
88:
513-521,
1978[Medline].
38.
Vurek, G. G.,
and
S. E. Pegram.
Fluorometric method for the determination of nanogram quantities of inulin.
Anal. Biochem.
16:
409-419,
1966.
39.
Zhong, Z.,
G. E. Arteel,
H. D. Connor,
M. Yin,
M. V. Frankenberg,
R. F. Stachlewitz,
J. A. Raleigh,
R. P. Mason,
and
R. G. Thurman.
Cyclosporin A increases hypoxia and free radical production in rat kidneys: prevention by dietary glycine.
Am. J. Physiol.
275 (Renal Physiol. 44):
F595-F604,
1998
This article has been cited by other articles:
![]() |
J. Trujillo, V. Ramirez, J. Perez, I. Torre-Villalvazo, N. Torres, A. R. Tovar, R. M. Munoz, N. Uribe, G. Gamba, and N. A. Bobadilla Renal protection by a soy diet in obese Zucker rats is associated with restoration of nitric oxide generation Am J Physiol Renal Physiol, January 1, 2005; 288(1): F108 - F116. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |