|
|
||||||||
Departments of 1 Pediatrics, 2 Internal Medicine, and 3 Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06520; and 4 Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana 46202
| |
ABSTRACT |
|---|
|
|
|---|
Kidney-specific
cadherin (Ksp-cadherin, cadherin 16) is a novel,
kidney-specific member of the cadherin superfamily that is expressed
exclusively in the basolateral membrane of renal tubular epithelial
cells. To characterize the Ksp-cadherin gene promoter, a
bacteriophage clone containing 3.7 kb of the proximal 5' flanking region of the mouse Ksp-cadherin gene was isolated. The transcription initiation site was mapped by RNase protection assays and 5'
rapid amplification of cDNA ends, and a 709-bp intron was identified within the 5' untranslated region. The proximal 5' flanking
region was "TATA-less" but contained other consensus promoter
elements including an initiator (Inr), GC boxes, and a CAAT box.
Potential binding sites were identified for transcription factors that
are involved in tissue-specific gene expression including activator protein-2 (AP-2), hepatocyte nuclear factor-3 (HNF-3), basic
helix-loop-helix (bHLH) proteins, CCAAT/enhancer-binding protein
(C/EBP), and GATA factors. Transfection of luciferase reporter plasmids
containing 2.6 kb of the 5' flanking region markedly increased
luciferase activity in renal epithelial cells (MDCK and mIMCD-3) but
not in mesenchymal cells (NIH 3T3 and MMR1). Deletion analysis
identified an 82-bp region from
31 to
113 that was
essential for promoter activity in transfected renal epithelial cells.
Electrophoretic mobility-shift assays showed that mIMCD-3 cells contain
nuclear proteins that bind to this region of the promoter. Mutational analysis showed that sequences within the HNF-3 consensus site and CAAT
box were involved in protein binding and promoter activity. We conclude
that the proximal 5' flanking region of the mouse Ksp-cadherin
gene contains an orientation-dependent promoter that is kidney
epithelial cell specific. The region of the promoter from
113 to
31 is required for transcriptional activity and contains binding
sites for nuclear proteins that are specifically expressed in renal
epithelial cells.
kidney specific; gene regulation; transcription factor; cell adhesion
| |
INTRODUCTION |
|---|
|
|
|---|
STUDIES OF KIDNEY-SPECIFIC gene expression may provide
insights into transcriptional regulation of renal cell differentiation and kidney organogenesis. However, relatively little information is
available regarding molecular mechanisms of tissue-specific gene
expression in the kidney, particularly when compared with other organs
such as the liver. Recently, a number of cDNAs that are expressed
exclusively or nearly exclusively in the kidney have been cloned. Many
of these kidney-specific cDNAs encode membrane transporters such as the
Na-phosphate cotransporter (NPT2), Na-glucose cotransporter (SGLT2),
aquaporin-2 (AQP2), chloride channels (ClC-K1, ClC-K2, ClC-5), Na-Cl
cotransporter (NCCT), Na-K-Cl cotransporter (NKCC2),
H+-peptide cotransporter (PEPT2),
vacuolar H+-ATPase (V-ATPase) B1
subunit, and organic solute transporters (OAT1, RST, OCT2). Other
kidney-specific cDNAs include erythropoietin, Tamm-Horsfall protein,
-glutamyl transpeptidase (GGT, type 2), vitamin
D3 1-
hydroxylase, and V2
vasopressin receptor. The promoters of the GGT, AQP2, ClC-K1 chloride
channel, NPT2, and NKCC2 genes have been cloned and shown to direct
kidney cell-specific expression in vitro and/or in transgenic mice (10,
12, 20, 25, 30). However, to date, no enhancer elements or
kidney-specific transcription factors that are responsible for
tissue-specific expression of these genes have been identified.
Kidney-specific cadherin (Ksp-cadherin, cadherin 16) is a novel, kidney-specific member of the cadherin family of cell adhesion molecules (27). Cadherins are integral plasma membrane proteins that have a characteristic structure consisting of a prosequence that is cleaved upon processing, a large extracellular domain, a single transmembrane segment, and a cytoplasmic domain (8, 26). The extracellular domain consists of four homologous repeats, each containing the conserved amino acid sequence LDRE and the putative calcium-binding sequences DXND and DXD. Near the transmembrane segment, there are four cysteine residues whose positions are highly conserved among the family members. The cytoplasmic domains of some cadherins bind to the catenin family of proteins involved in signal transduction and cytoskeletal anchoring. Cadherins mediate calcium-dependent cell-cell adhesion through homotypic interactions involving their extracellular domain repeats. The prototype of this family, E-cadherin (uvomorulin), is expressed in the adherens-type junctions of epithelial cells, where it has important roles in tissue morphogenesis and maintenance of the terminally differentiated phenotype. Alterations in E-cadherin expression are associated with tissue invasiveness, cellular dedifferentiation, and hyperplastic cell growth (8).
Ksp-cadherin, which was first identified as a stilbene-binding protein in the rabbit kidney, represents a structurally distinct member of the cadherin family (27). Ksp-cadherin contains the cadherin-specific extracellular domain repeats and conserved cysteine residues but lacks the prosequence and contains a highly truncated cytoplasmic domain. The structure of Ksp-cadherin suggests that it belongs to the recently described LI-cadherin/HPT-1 subfamily of cadherins (3). Ksp-cadherin is further distinguished by its unique tissue distribution. Northern blot analysis in the rabbit, mouse, and human has shown that the 3-kb Ksp-cadherin transcript is expressed exclusively in the kidney (27, 28). Within the kidney, Ksp-cadherin has been immunolocalized to the basolateral membrane of renal tubular epithelial cells but is not expressed in glomeruli, blood vessels, or renal interstitial cells (27). The function of Ksp-cadherin remains unknown, but it exhibits the calcium-dependent sensitivity to proteolysis that is typical of other cadherin family members (27). Chromosomal localization studies have mapped Ksp-cadherin (Cdh16) within a cluster of cadherin genes on mouse chromosome 8 and human chromosome 16, suggesting that the members of the cadherin family arose via duplication of a common ancestral gene (28).
The present study was undertaken to begin examining the molecular basis for kidney-specific expression of Ksp-cadherin. The specific aims were to clone and sequence the Ksp-cadherin promoter and to evaluate whether the activity of the promoter was kidney cell specific. A preliminary account of this work has been published in abstract form (32).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials. Mice (strain 129/Sv, age
greater than 35 days) were obtained from The Jackson Laboratory (Bar
Harbor, ME). Restriction endonucleases and DNA-modifying enzymes were
from New England Biolabs (Beverly, MA) or Boehringer-Mannheim
(Indianapolis, IN). pGL3 plasmids, pSV2
gal, luciferin, and reporter
lysis buffer were from Promega (Madison, WI). Lipofectamine, Trizol,
and RNase H-free Moloney murine leukemia virus (MMLV) reverse
transcriptase (Superscript II) were from Life Technologies
(Gaithersburg, MD). Galacto-Star chemiluminescent substrate was
obtained from Tropix (Bedford, MA). Nylon filters (Hybond-N) and
radionucleotides were from Amersham (Arlington Heights, IL). Protease
inhibitor cocktail (Complete) was from Boehringer-Mannheim. Plasmid
maxi-prep kits and Oligotex affinity columns were from Qiagen
(Valencia, CA). Oligonucleotides were synthesized by the Yale Pathology
Department Program in Critical Technologies and were purified by PAGE
or OPC cartridges (Applied Biosystems). Other reagents were of
molecular biological grade from Ambion (Austin, TX), Sigma (St. Louis,
MO), Promega, Boehringer-Mannheim, or US Biochemicals (Cleveland, OH).
Library screening. A mouse genomic
library in
FIXII (strain 129/Sv, catalog no. 946305) was purchased
from Stratagene (La Jolla, CA) and screened by filter-hybridization
with a 32P-labeled murine
Ksp-cadherin cDNA, as described previously (11). Clones that were
positive on duplicate filters were plaque purified, and the genomic
inserts were restriction mapped using single or double digests with
Sac I,
Xba I, or
Sal I. Restriction fragments were
transferred to nylon membranes, and the end fragments and exon-containing fragments were identified by Southern blot analysis. A
3,913-bp Spe I restriction fragment
containing the 5' end of the cDNA and a 921-bp
Sac I fragment containing the 5'
end of the genomic insert were subcloned into pBluescript II KS(+)
(Stratagene) and sequenced completely. Overlapping sequence of both
strands was obtained using automated cycle sequencing (11), which was performed by the W. H. Keck Foundation Biotechnology Resource Center at
Yale University. Sequence analysis was performed using MacVector v4.1
(Eastman Kodak, Rochester, NY) or Wisconsin GCG software. Consensus
sequences of transcription factor binding sites were identified using
MacVector and by searching the TRANSFAC v3.2 database using
Transcription Element Search Software (TESS, http://www.cbil.upenn.edu/tess). Pairwise sequence
alignments were performed using the FASTA programs ALIGN and LALIGN.
RNase protection assays. RNase
protection assays were performed as described previously (4). A
restriction fragment containing nucleotides
113 to +74 of the
genomic clone mKspgen7 was subcloned into pBluescript SK. After
linearization with Hind III, an
antisense riboprobe was transcribed using T3 RNA polymerase and
[
-32P]UTP. The
riboprobe was gel-purified and annealed to 100 µg mouse kidney RNA,
which was isolated using acid guanidinium
hydrochloride-phenol-chloroform extraction (Trizol). RNA from the liver
and yeast tRNA were used as negative controls. Hybridization was
performed overnight at 60°C in medium containing 80% formamide, 40 mM PIPES (pH 6.4), 0.4 M NaCl, 1 mM EDTA, and 5 × 105 cpm labeled probe. Samples
were digested with RNase A (40 µg/ml) and RNase T1 (2.2 µg/ml),
extracted with phenol and chloroform, then precipitated with ethanol.
Products were resolved on 6% polyacrylamide-8 M urea sequencing gels.
Autoradiography was performed using Kodak BioMax MS film, and the sizes
of the protected bands were determined by comparison with sequencing
ladders and molecular weight standards run in adjacent lanes.
Rapid amplification of cDNA ends (RACE). 5'-RACE was performed using SMART RACE cDNA amplification kits from Clontech (Palo Alto, CA). Total RNA was isolated from tissues by homogenization in Trizol, and poly(A)+ RNA was purified using Oligotex affinity columns. First strand cDNA was synthesized from 1.2 µg poly(A)+ using MMLV reverse transcriptase primed by the 5'-CDS primer (Clontech). The SMART II oligonucleotide sequence was appended to the 5' end by template switching. An aliquot of the cDNA was then amplified by PCR using the Advantage 2 polymerase mix, universal primer (UPM), and an antisense primer specific for Ksp-cadherin (CCACCATAGTTTTCAGGGACTTCTGTGTG). To amplify glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts, a gene-specific primer (GCTCCTGGAAGATGGTGATGGGCTT) was used. Thirty cycles of denaturation at 94°C for 50 s, annealing at 72-68° for 2 min, and elongation at 72°C for 3 min were performed using a Stratagene RoboCycler. PCR products were analyzed by agarose gel electrophoresis and stained with ethidium bromide. Bands were excised from low-melting agarose gels (NuSieve, FMC Bioproducts), cloned into the plasmid pCR2.1 (Invitrogen), and sequenced.
Construction of reporter plasmids.
Luciferase reporter plasmids used in this study were derived from
pGL3-Basic (Promega). A PCR product containing nucleotide sequence from
2608 to +74 (numbered with respect to the transcription
initiation site) was amplified from the 3,913-bp
Spe I fragment of genomic clone
mKspgen7 using primers containing Sal
I restriction sites [ACGCGTCGACCCTCCTGGGTAGCTGAGATTATAGG and
ACGCGTCGACAATTTGGCTTAGGTGGGGCG (primer
A)]. The 2.6-kb PCR product was
digested with Sal I and cloned in both
the sense and antisense orientations into the unique
Xho I site of pGL3-Basic. The
resulting plasmids, designated pKsp(2608F)-luc and pKsp(2608R)-luc, respectively, contained 2,608 bp of the proximal 5' flanking
region and a portion of the first noncoding exon cloned upstream to a luciferase reporter gene from Photinus
pyralis. Empty pGL3-Basic containing no insert was used
as a negative control, and pGL3-Control containing the SV40
enhancer/promoter was used as a positive control.
Reporter plasmids containing nested deletions of the proximal 5' flanking region of the Ksp-cadherin gene were generated as follows. For pKsp(2069F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with EcoR I and Sma I, removal of the 539-bp fragment, end-filling with Klenow, and recircularization with T4 DNA ligase. For pKsp(1673F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Msc I and Sma I, removal of the 935-bp fragment, and recircularization. For pKsp(1268F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Hind III, isolation of the 1.3-kb fragment, and cloning in the sense orientation into the unique Hind III site of pGL3-Basic. For pKsp(958F)-luc, we proceeded with PCR amplification using primer A and ACGCGTCGACTATACCATGAGCAGTCC- TCGGG, digestion with Sal I, and cloning in the sense orientation into the unique Xho I site of pGL3-Basic. For pKsp(610F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Sac I, removal of 1,998-bp fragment, and recircularization. For pKsp(397F)-luc, we proceeded with PCR amplification using primer A and ACGCGTCGACAGGGCTTTCCTGAAGAAGGGGT, digestion with Sal I, and cloning in the sense orientation into the unique Xho I site of pGL3-Basic. For pKsp(250F)-luc, we proceeded with PCR amplification using primer CCTTGCTAGCGTCCAGTTTCCAGGAGAAAGGAAT and CCTTGCTAGCAAGTGGGAGCCAAGTCTGAACAC, digestion with Nhe I, and cloning in the sense orientation into the unique Nhe I site of pGL3-Basic. For pKsp(113F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Avr II and Nhe I, removal of the 924-bp and 1,571-bp fragments, and recircularization. For pKsp(31F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Stu I and Sma I, removal of the 25-bp, 1,761-bp, and 791-bp fragments, and recircularization. All plasmids were sequenced to verify the orientation and integrity of the inserts. DNA for transfections was purified by alkaline lysis maxi-preps and anion-exchange chromatography (Qiagen).
Cell culture and transfection. Madin-Darby canine kidney (MDCK) cells were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (Intergen, Purchase, NY). Mouse inner medullary collecting duct cells (mIMCD-3) were a generous gift from Dr. Steven Gullans (Harvard Medical School) and were grown in DMEM-Ham's F-12 (50:50) supplemented with 10% fetal bovine serum (24). MMR1 cells, an established mesenchymal cell line derived from the murine metanephric ridge, were grown as described previously (14). NIH 3T3 fibroblasts were obtained from the American Type Culture Collection and were maintained in DMEM supplemented with 10% fetal bovine serum.
Luciferase reporter plasmids were transfected into cultured cells using
cationic liposomes (Lipofectamine, Life Technologies) as described
previously (12). Cells were plated in 100-mm plastic dishes at a
density of 0.5-1 × 106
cells/dish. After 24-48 h, when they were 60% confluent, the cells were washed once with Opti-MEM I reduced serum medium (Life Technologies) then transfected with 10 µg of reporter plasmid. Cotransfection with 2 µg pSV2
gal encoding
Escherichia coli
-galactosidase was
performed as a control for transfection efficiency. Plasmid DNA (12 µg total) and cationic liposomes (48 µl) were combined in 1 ml of
Opti-MEM I and incubated at room temperature for 20 min. An additional
7 ml of Opti-MEM I was added, and the mixture was applied to a single
dish of cells. After incubation for 6 h at 37°C, 8 ml of culture
medium containing twice the usual concentration of fetal bovine serum
was added. Dishes were refed with standard culture medium 24 h after
transfection; 48 h after transfection, the cells were lysed and assayed
for luciferase and
-galactosidase activity.
Reporter gene assays. Luciferase
activity was measured in cell lysates using methods similar to those
described previously (12). Cells were washed twice with
Ca2+-,
Mg2+-free PBS (150 mM NaCl, 15 mM
sodium phosphate, pH 7.3) then lysed by incubation for 20 min at room
temperature in 900 µl of Reporter Lysis Buffer (Promega). Lysed cells
were scraped into 1.5-ml microcentrifuge tubes, then freeze-thawed once
at
20°C. Tubes were vortexed briefly, then centrifuged at
14,000 g to remove cell debris. Twenty
microliters of the supernatant was aliquoted into 75 × 12-mm
plastic tubes (Sarstedt). One hundred microliters of Luciferase Assay
Reagent (Promega) containing 20 mM Tricine (pH 7.8), 1.07 mM
(MgCO3)4 · Mg(OH)2 · 5H2O,
2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM dithiothreitol (DTT), 270 µM coenzyme A, 530 µM ATP, and 470 µM luciferin was rapidly injected into the tubes. After a 1-s delay,
light output was integrated over 10 s at room temperature using an
Optocomp I photon-counting luminometer (MGM Instruments, Hamden, CT).
Luciferase activity was normalized to
-galactosidase activity, which
was measured in the identical cell lysates.
-Galactosidase assays
were performed using a chemiluminescent reporter assay system (Tropix).
Cell lysates were preincubated at 48°C for 50 min to inactivate
mammalian
-galactosidase-like activity. Twenty microliters of
heat-inactivated cell lysate was incubated for 60 min with 300 µl of
reaction buffer containing Galacto-Star, 100 mM sodium phosphate (pH
7.5), 1 mM MgCl2, and 5%
Sapphire-II (Tropix). Light output was integrated over 5 s at room
temperature using a luminometer. Measurements of luciferase and
-galactosidase were performed in triplicate. Samples were diluted
with reporter lysis buffer as necessary to ensure that measurements
were within the linear range of the assays.
Electrophoretic mobility-shift assays (EMSA). Nuclear extracts were prepared from cultured cells using the method of Andrews and Faller (1). Briefly, confluent cells were grown in 150-mm dishes (~5 × 106 cells/dish), then scraped into 1.5 ml PBS and pelleted. Cells were lysed for 10 min in ice-cold medium containing 10 mM HEPES-KOH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and protease inhibitors (Complete, Boehringer-Mannheim). Nuclei were pelleted by centrifugation, then extracted for 20 min with 20 mM HEPES-KOH (pH 7.9), 25% glycerol, 420 mM NaCl, 5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and protease inhibitors. After centrifugation, the supernatant was dialyzed overnight against 20 mM HEPES-KOH (pH 7.9), 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, and protease inhibitors. Protein concentration was measured using the Pierce Coomassie Plus Protein Assay (Rockford, IL) with BSA as the standard.
EMSAs were performed as described previously (22). Double-stranded
oligonucleotides containing the sequences of the promoter from
109 to
80 (GGCTGGCAGTCACGGATGCTGAGCAGATCT) and from
79 to
50 (GGCTCTCCAAAGTCAATAAGTAACTTGGGG) were
end-labeled with 32P using T4
polynucleotide kinase. Binding reactions (20 µl)
contained 25 mM NaCl, 10 mM Tris-Cl (pH 7.5), 1 mM
MgCl2, 5 mM EDTA, 5% glycerol, 1 mM DTT, labeled probe (5 × 104 cpm), and 1 µg nuclear
extracts. In some reactions, a 50-fold molar excess of unlabeled
oligonucleotide was included as a specific competitor. All binding
reactions contained 1.5 µg poly(dI-dC) as a nonspecific
competitor. After incubation at room temperature for 30 min, samples
were loaded on nondenaturing 5% polyacrylamide gels and
electrophoresed at 8 V/cm for 2 h in 0.5× TBE [1× TBE is 89 mM Tris-borate, 2 mM EDTA (pH 8.0)]. Gels
were dried, and the radiolabeled bands were detected by autoradiography.
Site-directed mutagenesis. Specific mutations were introduced into the luciferase reporter plasmids using QuikChange site-directed mutagenesis kits from Stratagene. Complementary sense and antisense 30-mers containing the desired mutations were synthesized and purified by PAGE. The mutagenic primers were annealed to the plasmid pKsp(113F)-luc and extended using a nonstrand-displacing DNA polymerase (PfuTurbo). Eighteen cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and elongation at 68°C for 10 min were performed. The parental DNA template was then digested with Dpn I, and the mutated plasmids were transformed into E. coli strain XL1-Blue. The presence of the mutation was verified by DNA sequencing.
Statistical analysis. The mean data from four to nine independent transfections using different cell preparations are reported. Values are means ± SE. Statistical analysis was performed using one-way analysis of variance and Student's t-test with the Bonferroni correction for multiple comparisons. Statistical significance was defined as P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the 5' flanking region of the mouse
Ksp-cadherin gene. A mouse genomic library in
bacteriophage
was screened by filter-hybridization with a
Ksp-cadherin cDNA, and a clone containing a 15.8-kb insert (mKspgen7)
was obtained (Fig.
1A). Southern blot analysis (not shown) indicated that mKspgen7 contained the 5' end of the Ksp-cadherin cDNA and was therefore likely to include the 5' flanking region of the gene. A 3.9-kb
Spe I restriction fragment (clone
SPE5) was subcloned into pBluescript and sequenced completely.
Additional sequence of mKspgen7 was obtained by subcloning and
partially sequencing a 921-bp 5'-end
Sac I fragment and an internal 8-kb
Xba I fragment. Figure
1B shows a portion of the sequence of
the mouse Ksp-cadherin gene and the proximal 5' flanking region.
The nucleotide sequences of mKspgen7 and the mouse Ksp-cadherin cDNA
(28) were identical in the region of overlap (indicated by broken
underscore in Fig. 1B), verifying
the identity of the genomic clone. However, beginning at nucleotide
+148, the sequence of mKspgen7 contained an additional 709 bp of
sequence that was not present in the cDNA and that was flanked by
consensus splice donor (MAG/GTRAGT) and acceptor (YnNYAG/G) sites.
These results indicated that the first exon of Ksp-cadherin was 147 bp
in length and was noncoding. The first intron was 709 bp, and the
second exon contained the translation start codon. The complete 4884-bp sequence containing 3,696 bp of 5' flanking region, the first two
exons, the first two introns, and a portion of the third exon has been
deposited in the GenBank database (accession no. AF118228).
|
Mapping of the transcription initiation
site. The transcription initiation site was mapped
using RNase protection assays and 5'-RACE. A
32P-labeled antisense riboprobe
extending upstream from a known site in the 5' untranslated
region was annealed to RNA from mouse kidney, then digested with
RNases. Figure 2 shows that the major protected fragment in the kidney was 75 bp, which indicated that the
5' end of the Ksp-cadherin mRNA was located 33 bp upstream to the
origin of the cloned cDNA and 869 bp from the start codon. Minor bands
of higher molecular weight were also observed, suggesting the existence
of multiple transcription initiation sites, as are frequently observed
in TATA-less promoters (see below). The specificity of the assay was
verified by the absence of protected fragments in yeast tRNA and in RNA
from liver, which does not express Ksp-cadherin.
|
Since RNase-protected bands can terminate at splice acceptor sites as well as the 5' terminus, 5'-RACE was performed to independently verify the transcriptional start site. Poly(A)+ RNA from mouse kidney was reverse transcribed into cDNA, and a unique oligonucleotide was appended to the 5' end by template switching. PCR was then used to amplify the sequence between the 5' oligonucleotide and a 3' primer specific for Ksp-cadherin. Figure 2B (top) shows an ethidium-bromide-stained agarose gel in which bands of 325 bp and 260 bp were observed in the sample from mouse kidney (lane 1). The PCR products were specific, since they were only observed in reactions containing both the 5' oligonucleotide and the 3' gene-specific primer and were absent in the samples from mouse liver, which does not express Ksp-cadherin (lane 4). In contrast, a 355-bp PCR product was obtained from both liver and kidney using a primer specific for the housekeeping gene, GAPDH (Fig. 2B, bottom). Although the transcription initiation site of the mouse GAPDH gene has not yet been identified, the size of the GAPDH product corresponded to the known transcriptional start sites in the rat and human genes. The 325-bp Ksp-cadherin product was similar in size to the expected product (322 bp) based on the transcriptional start site identified by RNase protection assays. To precisely identify the 5' end of the Ksp-cadherin transcript, the 325-bp PCR product was cloned into the plasmid pCR2.1 and sequenced. The transcriptional start site identified by 5'-RACE was located within 6 bp of the site identified by RNase protection assays (Fig. 1B). The minor variation in transcriptional start sites identified by the two methods may be due to the absence of a TATA box in the Ksp-cadherin promoter (see below). In addition to the 325-bp band, a 260-bp 5'-RACE product was also observed in the kidney. DNA sequencing revealed that the 260-bp product resulted from premature termination in a G+C-rich region located within the 5' untranslated region (not shown). Attempts to map the transcriptional start site by primer extension analysis were unsuccessful, apparently because of premature termination in this G+C-rich region.
Sequence of the proximal 5' flanking region of
the mouse Ksp-cadherin gene. Figure
1B shows the sequence of the proximal
1 kb of 5' flanking region of the mouse Ksp-cadherin gene. The
arrow in Fig. 1B depicts the
transcription initiation site mapped by RNase protection assays, and
the asterisk indicates the transcriptional start site mapped by
5'-RACE. The transcription initiation site mapped by RNase
protection assays was located within the sequence
CTCC (underscore indicates nucleotide at
+1), which exactly matched a consensus initiator (Inr)
element (
NWYY) (13). The proximal
5' flanking region was examined for the presence of typical
eukaryotic promoter elements. No TATA box was identified near the
transcription initiation site. However, a variant CCAAT box was located
at position
63, and two GC boxes were located at positions
38 and
14. The GC box at
38 conformed to a
consensus Sp1 binding site (GGCGGG). Thus, although the Ksp-cadherin
promoter is "TATA-less," regulatory elements that are competent
to initiate gene transcription are present, including the initiator and
GC boxes. A noteworthy feature of the 5' flanking sequence is the presence of several simple sequence repeats including
(C-A)16-(G-T)16 at position
199,
(G-A)21-(C-T)21
at position
1334,
(GGAGAG)7-(CCTCTC)7 at position
1292, and
(C-A)26-(G-T)26
at position
2132. A poly(T) tract is located from position
2819 to
2898.
The proximal 5' flanking region contained consensus recognition
sequences for several transcription factors that are known to be
involved in tissue-specific expression of other genes (Fig. 1B; Table
1). Some of these tissue-specific proteins,
such as NF-E2 and Pu.1, are not expressed in the kidney and would not be expected to be involved in Ksp-cadherin gene regulation. However, the Ksp-cadherin promoter also contained potential binding sites for
CCAAT/enhancer-binding protein (C/EBP), hepatocyte nuclear factor 3 (HNF-3), basic helix-loop-helix (bHLH) proteins, and GATA factors,
which are tissue-restricted transcription factors that are expressed in
the kidney. The Ksp-cadherin promoter also contained consensus binding
sites for transcription factors that are involved in signal
transduction pathways including activator protein-1 (AP-1), AP-2,
glucocorticoid receptor, peroxisome proliferation-activated receptor
(PPAR), NF-
B, and serum response factor (SRF) (Table 1).
|
Comparison between the Ksp-cadherin promoter and other
cadherins. The Ksp-cadherin promoter was aligned with
the promoters of other cadherins that have been cloned in the mouse
(Fig. 3). Comparison with the mouse
P-cadherin promoter revealed only 34% overall sequence identity.
However, the 50-bp region immediately upstream to the transcription
start site was 60% identical. This region of the Ksp-cadherin promoter
contained putative Sp1 and AP-2 binding sites. In the P-cadherin
promoter, these elements were absent from this region but were located
instead at positions
88 and
101, respectively. Figure 3
shows the comparison between the promoters of the mouse Ksp-cadherin
and E-cadherin genes. Overall, the Ksp-cadherin promoter was 47%
identical to the E-cadherin promoter. However, there was a 136-bp
region of extended homology (52% identity) immediately surrounding the
transcription start site. The locations of the transcription start
sites and two upstream GC boxes including the putative Sp1 binding site
were conserved in the two promoters.
|
Kidney cell-specific activity of the Ksp-cadherin
promoter. To verify that the proximal 5' flanking
region contained a functional gene promoter and to evaluate cell
specificity, reporter gene assays were performed in cultured cells. A
2.7-kb fragment of the genomic clone mKspgen7 containing the
transcription initiation site, 2,608 bp of proximal 5' flanking
region, and a portion of the first (noncoding) exon was cloned upstream
to a promoterless luciferase reporter gene in the plasmid pGL3-Basic.
The resulting plasmid, designated pKsp(2608F)-luc, was transfected into
cultured cells using cationic liposomes; 48 h after transfection, the
cells were lysed and assayed for luciferase activity. As a control for transfection efficiency, cells were cotransfected with pSV2
gal, and
-galactosidase activity was assayed in the cell lysates using a
chemiluminescent assay. Promoter activity was inferred from luciferase
activity normalized for differences in transfection efficiency (which
were minimal). Since promoter activity should be orientation dependent,
cells were also transfected with pGL3-Basic containing the Ksp-cadherin
sequence cloned in the antisense orientation [pKsp (2608R)-luc] as a negative control.
Preliminary studies using Northern blot analysis and immunoblot
analysis (not shown) indicated that Ksp-cadherin was endogenously expressed in two renal epithelial cell lines, MDCK cells and mIMCD-3. In contrast, Ksp-cadherin was not expressed in NIH 3T3 fibroblasts or
MMR1 cells, a mesenchymal cell line derived from the mouse metanephric
ridge (14). To evaluate whether the activity of the Ksp-cadherin
promoter was cell specific, transfections were performed in MDCK cells
and mIMCD-3 cells, and the results were compared with transfections in
NIH 3T3 cells and MMR1 cells. Figure 4
shows the luciferase activity produced following transfection with the
reporter plasmids pKsp(2608F)-luc (gray-shaded bars) and
pKsp(2608R)-luc (hatched bars) compared with empty pGL3-Basic (solid
bars). Transfection of pKsp(2608F)-luc into MDCK cells resulted in a
60-fold stimulation of luciferase activity, and transfection into
mIMCD-3 cells resulted in a 48-fold stimulation. These increases in
luciferase activity were statistically significant (P < 0.001). In contrast,
transfection of MMR1 cells resulted in less than twofold stimulation,
although this difference was also statistically significant
(P < 0.01). There was no significant stimulation of luciferase activity following transfection into NIH 3T3
cells (P > 0.05). The stimulation of
luciferase activity in MDCK cells and mIMCD-3 cells was orientation
dependent, since transfection with pKsp(2608R)-luc containing the
Ksp-cadherin promoter in the antisense orientation produced no
stimulation (Fig. 4, hatched bars). Transfection of the positive
control plasmid pGL3-Control into MDCK, mIMCD-3, MMR1, and NIH 3T3
cells resulted in significant luciferase activity in all cell types
(596 ± 141, 305 ± 20, 126 ± 66, and 146 ± 28, respectively). Taken together, these results demonstrated
that the cloned 2.7-kb fragment contained an orientation-specific
promoter that was highly active in MDCK cells and mIMCD-3 cells. The
minimal stimulation in MMR1 cells and the lack of stimulation in NIH
3T3 cells suggested that the activity of the Ksp-cadherin promoter was
kidney epithelial cell specific. These results also indicated that
kidney-specific expression of Ksp-cadherin was due, at least in part,
to tissue-specific gene transcription.
|
Deletion analysis of the Ksp-cadherin
promoter. To identify regions of the Ksp-cadherin
promoter that were required for activity in transfected renal
epithelial cells, deletion analysis was performed. Reporter plasmids
containing a nested set of truncations of the proximal 5'
flanking region of the Ksp-cadherin gene were created by restriction
digestion or PCR. Constructs produced by PCR were sequenced completely
to verify the fidelity of the Taq
polymerase. All of the sequences were identical to genomic DNA except
for pKsp(953F)-luc, which contained a single nucleotide substitution (G
to A) at
894, a position that does not appear to be critical for
activity (see below). The truncated reporter plasmids were transfected
into MDCK cells and mIMCD-3 cells, and luciferase activity was measured
after 48 h. As shown in Fig. 5, truncation of the promoter from
2608 to
250 did not significantly
decrease luciferase activity in either MDCK cells (hatched bars) or
mIMCD-3 cells (gray-shaded bars). However, further truncation of the
promoter to nucleotide
113 resulted in a 40% reduction in
luciferase activity, and truncation to nucleotide
31 completely
abolished activity in both cell types. The full-length Ksp-cadherin
promoter as well as the deletion constructs produced only basal
luciferase activity in NIH 3T3 cells and MMR1 cells (not shown),
indicating that truncation of the promoter did not significantly
increase promoter activity in mesenchymal cells. Taken together, these
results indicated that positive regulatory elements that control
Ksp-cadherin promoter activity in transfected renal epithelial cells
were likely to be located from
250 to
113, and essential
elements were located between
113 and
31.
|
Binding of nuclear proteins to the Ksp-cadherin
promoter. To determine whether renal epithelial cells
contain nuclear proteins that bind to the Ksp-cadherin promoter, EMSAs
were performed. Double-stranded oligonucleotides derived from the
critical region between
31 and
113 were end-labeled with
32P, incubated with nuclear
extracts, and the DNA-protein complexes were resolved from unbound
oligonucleotide by nondenaturing gel electrophoresis. All binding
reactions were performed in the presence of 1.5 µg poly(dI-dC) to
inhibit nonspecific binding. To determine whether binding proteins were
specific to renal epithelial cells, extracts from mIMCD-3 cells were
compared with extracts from MMR1 cells. Figure
6 (lanes
1-5) shows binding to a 30-mer containing nucleotides
109 to
80 of the promoter. In
lane 4, the arrowhead indicates a
retarded band that was present in nuclear extracts from mIMCD-3 cells
but was absent in reactions containing no nuclear extracts
(lane 1). Binding was specific,
since a 50-fold molar excess of unlabeled oligonucleotide inhibited the
formation of the DNA-protein complex (lane
5). Lane 2 shows
that a retarded band of similar mobility was also detected in extracts
from MMR1 cells, and formation of this complex was also specific
(lane 3). Figure 6,
lanes 6-10, shows binding to a
30-mer containing nucleotides
79 to
50 of the promoter.
In lane 9, the arrowheads indicate retarded bands that were present in mIMCD-3 cells, absent in reactions containing no nuclear extracts (lane
6), and competed by a 50-fold excess of unlabeled
oligonucleotide (lane 10). In
contrast to the
109/
80 oligonucleotide, these bands were
not detected in extracts from MMR1 cells (lanes
7-8). Taken together, these results demonstrated
that mIMCD-3 cells and MMR1 cells contained nuclear proteins that bind
specifically to the region of the promoter from
109 to
80, but only mIMCD-3 cells contained proteins that bind
specifically to the region from
79 to
50.
|
Mutational analysis of the Ksp-cadherin
promoter. To further define the region of the promoter
that was involved in protein binding and transcriptional activity,
mutational analysis was performed. Since EMSA indicated that the region
from
50 to
79 binds to nuclear proteins that are present
in mIMCD-3 cells but not in MMR1 cells, we focused the analysis on this
region of the promoter. Figure 7 shows the
results of EMSA comparing the abilities of mutated oligonucleotides to
compete with the wild-type sequence for binding to nuclear extracts
from mIMCD-3 renal epithelial cells. In lane
2 of Fig. 7, the arrowheads show that nuclear extracts from mIMCD-3 cells contained proteins that bind to the region from
79 to
50, similar to the results shown in Fig. 6. Binding was specific, since the formation of the retarded bands was completely inhibited by a 5-fold excess (lane
3) or 50-fold excess (lane 8) of unlabeled wild-type oligonucleotide. In
contrast, a 5-fold or 50-fold molar excess of an oligonucleotide
containing mutation 3 had no effect on
formation of the retarded bands (Fig. 7, lanes 6 and 11), which
indicated that the mutated sequence was unable to compete for binding.
A fivefold excess of oligonucleotides containing
mutations 1,
2, and
4 only partially inhibited complex formation (lanes 4,
5, and
7), although a higher concentration (50-fold excess) produced more complete inhibition
(lanes 9,
10, and
12).
|
The mutations of the region
50 to
79 were introduced into
the Ksp-cadherin promoter by site-directed mutagenesis and tested for
their effects on transcriptional activity using reporter gene assays.
Figure 8 shows that transfection of mIMCD-3
cells with a reporter plasmid containing 113 bp of the wild-type
promoter produced a 28-fold stimulation of luciferase activity, similar to the results shown in Fig. 5. Transfection with a reporter plasmid containing mutation 1 resulted in a
33% decrease in activity compared with wild type, although this
difference was not statistically significant. Transfection with
plasmids containing mutations 2, 3, or
4 resulted in a significant
70-80% decrease in activity compared with wild type
(P < 0.05, t-test with Bonferroni correction). Taken together, these results indicated that mutations within the
region from
79 to
50 interfered with both protein binding and transcriptional activity.
|
| |
DISCUSSION |
|---|
|
|
|---|
The cis-acting regulatory elements that govern gene transcription (e.g., enhancers, locus control regions, and negative regulatory elements) may be located throughout the gene locus. However, in many cases, the proximal promoter region contains elements that are sufficient to mediate high-level, tissue-specific gene transcription. These proximal regulatory elements may represent binding sites for tissue-restricted proteins that mediate transcriptional activation in expressing cells. Accordingly, we first focused on the proximal 5' flanking region to identify elements that are responsible for kidney-specific expression of Ksp-cadherin. We isolated a genomic clone that contained 3.7 kb of the proximal 5' flanking region and showed using reporter gene assays in transfected cells that this region contained a functional promoter that was orientation specific. Moreover, the promoter was highly active in MDCK cells and mIMCD-3 cells but not in MMR1 cells or NIH 3T3 cells, which suggested that the Ksp-cadherin promoter was kidney epithelial cell specific in vitro. Studies performed in transgenic mice (described in the companion study, Ref. 10a) verified that the promoter was also kidney-specific in vivo. The sequence of the Ksp-cadherin promoter was "TATA-less" but contained other typical eukaryotic promoter elements including an initiator (Inr), a CAAT box, and two GC boxes. The upstream GC box conformed to a consensus binding site for the transcription factor Sp1, which is a ubiquitous zinc finger protein that can initiate transcription by recruiting the RNA polymerase holoenzyme to the promoter. In addition, GC boxes may represent binding sites for tissue-specific Krüppel-like factors (such as EKLF, LKLF, and GKLF). A Krüppel-like zinc finger protein named EEK3 has recently been identified in developing renal tubular epithelial cells and could be a candidate for interacting with the Sp1 site in the Ksp-cadherin promoter (15).
Sequence comparisons between the promoters of different kidney-specific
genes may identify conserved elements that are involved in the
regulation of tissue specificity. Studies in the companion report (10a)
demonstrated that the cloned region of the Ksp-cadherin promoter was
most active in renal collecting ducts. Accordingly, we compared the
Ksp-cadherin promoter with the promoters of the V2 vasopressin receptor
gene (17) and the AQP2 gene (31), which are also expressed in this
nephron segment. Overall, the mouse Ksp-cadherin promoter was 42%
identical to the rat V2 receptor promoter (data not shown). The highest
homology (61% identity) was found in a 54-bp region located from
451 to
398 in the Ksp-cadherin promoter and from
1022 to
968 in the V2 receptor promoter. Comparison between the Ksp-cadherin promoter and the human AQP2 promoter revealed
44% identity overall, with highest homology between nucleotides
125 to
159 of Ksp-cadherin and nucleotides
99 to
133 of AQP2 (69% identity). This region contained a conserved
NF-E2 site, but the AP-1 site present at
148 in the Ksp-cadherin
promoter was absent from the AQP2 sequence. Recent studies suggest that the AQP2 promoter can be transactivated by GATA-3, a tissue-specific zinc finger protein that is expressed in collecting ducts (29). The
Ksp-cadherin promoter contains a GATA motif at
698, but this region of the promoter appears to be dispensable for transcriptional activity. Two regions of the human AQP2 promoter (
84 to
153, and
364 to
434) contain negative regulatory
elements that may prevent transcription in nonexpressing cells (7). The
region of greatest similarity between Ksp-cadherin and AQP2 is
encompassed by one of these regions (
84 to
153). Another
negative regulatory element (AATCCTTATCTGGGAGTTCATTAACGAG) has been
identified in the rat AQP2 promoter by DNase I footprint analysis (23).
The Ksp-cadherin promoter contains a sequence (from
437 to
456) that matches this element at 14/19 positions. However,
deletion of these regions did not increase promoter activity in
transfected mesenchymal cells, suggesting that the expression of
Ksp-cadherin was not primarily due to negative regulation.
The promoter of the Ksp-cadherin gene was compared with two other cadherins, E-cadherin and P-cadherin, that are also expressed in the kidney. E-cadherin is expressed in tubular epithelial cells, whereas P-cadherin is expressed primarily in glomerular epithelial cells. The E-cadherin and P-cadherin promoters have an overall structure that is similar to Ksp-cadherin, including absence of a TATA box, presence of a CAAT box, two putative AP-2 binding sites, and a GC-rich region containing a potential Sp1 binding site (2, 6). Interestingly, the transcription initiation sites of the E-cadherin and Ksp-cadherin genes are located at identical positions when the sequences are optimally aligned. This similarity in structure is consistent with the hypothesis that the genes arose by duplication of a common ancestral gene as was previously suggested by chromosomal localization studies (28). However, the mechanisms of gene regulation may be distinct. Epithelial-specific expression of E-cadherin requires an upstream E-Pal element (CACCTGCAGGTG) and an intronic enhancer (2, 9). Ksp-cadherin contains a sequence (CATCTGAAGGTG) that is identical to the E-Pal element at 10/12 positions (Fig. 3). However, unlike E-cadherin, in which the E-Pal element is located 75 bp upstream to the transcription initiation site, the related sequence in Ksp-cadherin is located at the 3' end of the first exon in a region that is not essential for promoter activity in transfected renal epithelial cells. No sequences that are similar to the intronic enhancers in the E-cadherin gene were identified in the promoter or first intron of the Ksp-cadherin gene.
Deletion analysis was performed to identify the regions of the
Ksp-cadherin promoter that were required for activity in transfected renal epithelial cells. The results of these studies indicated that
promoter activity was dependent on positive regulatory elements (enhancers) that were located within 250 bp upstream from the transcriptional start site. Additional studies in transgenic mice will
be required to verify whether this region is sufficient to direct
expression in vivo. The proximal promoter contained the CAAT box (at
63), the putative Sp1 site (at
38), and a
(C-A)n microsatellite repeat (at
199). Several consensus recognition sequences for transcription factors that are involved in
tissue-specific gene regulation were identified including HNF-3 (at
62), bHLH proteins (at
165), and AP-2 (
30 and
103). HNF-3 is a transcriptional activator that was first shown
to be important for liver-specific expression of genes such as
1-antitrypsin and transthyretin (5). The sequence of the putative
HNF-3 site in the Ksp-cadherin promoter is identical to a known HNF-3
site in the
1-antitrypsin promoter. Of the three isoforms of HNF-3
(
,
, and
), HNF-3
is expressed in the kidney (33). In
addition, HNF-3 belongs to the large family of fork head proteins that
contain a conserved DNA-binding motif known as a winged helix (16). A
kidney-specific fork head protein named HFH-3 (Freac-6) has recently
been identified in renal tubular epithelial cells (21). However, the
consensus sequence recognized by HFH-3 (DBDTRTTTRYDTD) differs somewhat from the
62 site. An E box (CANNTG) was located in the important region of the Ksp-cadherin promoter between
113 and
250,
which could represent a binding site for bHLH proteins. bHLH proteins, such as MyoD and NeuroD, are important for tissue-specific gene expression in muscle, neurons, lymphocytes, and pancreas (19), although
bHLH proteins that are involved in kidney-specific gene expression have
not yet been identified. The presence of two potential AP-2 binding
sites in the proximal Ksp-cadherin promoter may be significant, since
this transcription factor has been implicated in epithelial-specific
expression of E-cadherin (9). AP-2 is expressed primarily in epithelial
and neural tissue and is induced in response to retinoic acid. Of the
three isoforms of AP-2 (
,
, and
), AP-2
is
expressed in renal tubular epithelial cells and has been shown to be
essential for normal tubular development (18).
Studies using EMSA demonstrated that nuclear extracts from mIMCD-3
cells contained proteins that bind specifically to the functionally
important region of the Ksp-cadherin promoter. These proteins are
candidates for transcription factors that regulate Ksp-cadherin gene
expression in renal epithelial cells. Nuclear extracts from MMR1 cells,
which do not endogenously express Ksp-cadherin, also contained proteins
that bind specifically to the region of the promoter from
109 to
80. Moreover, the mobility of the retarded band was similar to
mIMCD-3 cells, suggesting that it may have the same protein
composition. However, only extracts from mIMCD-3 cells contained
proteins that specifically bind to the region of the promoter from
79 to
50. Binding proteins that are present in mIMCD-3
cells but not in MMR1 cells may represent tissue-enriched transcriptional activators that are involved in kidney-specific expression of Ksp-cadherin. Mutational analysis further demonstrated that sequences within the
79 to
50 region were involved
in protein binding and transcriptional activity. In particular,
mutation 3 inhibited promoter activity
by 80% and completely prevented protein binding. Other mutations in
this region only partially inhibited protein binding, suggesting that
they had affinities that were intermediate between
mutation 3 and the wild-type sequence. Mutation 3 was located within the
consensus HNF-3 site and CAAT box, further underscoring the potential
importance of proteins that recognize these sequences for transcription
of the Ksp-cadherin gene. Additional studies will be required to
determine whether HNF-3 or other proteins bind to the proximal
Ksp-cadherin promoter and mediate tissue-specific transcription.
In conclusion, the proximal 5' flanking sequence of the mouse
Ksp-cadherin gene contains an orientation-dependent promoter that
directs kidney epithelial cell-specific expression in vitro. The region
of the promoter from
113 to
31 is required for
transcriptional activity in transfected renal epithelial cells. The
region from
79 to
50 contains binding sites for nuclear
proteins that are specifically expressed in renal epithelial cells and
that may be involved in kidney-specific gene expression.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Steven Gullans for providing mIMCD-3 cells. We thank Shuxian Liu-Chen for expert technical assistance, Ilyssa Okrent for performing preliminary experiments on this project, and Michele Pucci for secretarial assistance.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Research Grants R01-DK-42921 (to P. Igarashi), R29-DK-51045 (to R. B. Thomson), K08-DK-02287 (to S. L. Karp), and R01-DK-17433 (to P. S. Aronson). D. A. Whyte was supported by NIDDK Postdoctoral Training Grant T32-DK-07276 and a Postdoctoral Fellowship from the National Kidney Foundation and American Society of Nephrology. P. Igarashi is an Established Investigator of the American Heart Association.
Present address of D. A. Whyte: Dept. of Pediatrics, SUNY at Stony Brook School of Medicine, Stony Brook, NY 11794.
D. A. Whyte and C. Li contributed equally to this work.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence and present address of P. Igarashi: Division of Nephrology, UT Southwestern, 5323 Harry Hines Blvd., Dallas TX 75235-8856 (E-mail: peter.igarashi{at}emailswmed.edu).
Received 22 December 1998; accepted in final form 10 June 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Andrews, N. C.,
and
D. V. Faller.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res.
19:
2499,
1991
2.
Behrens, J.,
O. Löwrick,
L. Klein-Hitpass,
and
W. Birchmeier.
The E-cadherin promoter: functional analysis of a GC-rich region and an epithelial cell-specific palindromic regulatory element.
Proc. Natl. Acad. Sci. USA
88:
11495-11499,
1991
3.
Berndorff, D.,
R. Gessner,
B. Kreft,
N. Schnoy,
A. M. Lajous-Petter,
N. Loch,
W. Reutter,
M. Hortsch,
and
R. Tauber.
Liver-intestine cadherin: molecular cloning and characterization of a novel Ca2+-dependent cell adhesion molecule expressed in liver and intestine.
J. Cell Biol.
125:
1353-1369,
1994
4.
Blaurock, M. C.,
N. A. Rebouças,
J. L. Kusnezov,
and
P. Igarashi.
Phylogenetically conserved sequences in the promoter of the rabbit sodium-hydrogen exchanger isoform 1 gene (NHE1/SLC9A1).
Biochim. Biophys. Acta
1262:
159-163,
1995[Medline].
5.
de Simone, V.,
and
R. Cortese.
Transcription factors and liver-specific genes.
Biochim. Biophys. Acta
1132:
119-126,
1992[Medline].
6.
Faraldo, M. L. M.,
and
A. Cano.
The 5' flanking sequence of the mouse P-cadherin gene: homologies to 5' sequences of the E-cadherin gene and identification of a first 215 base-pair intron.
J. Mol. Biol.
231:
935-941,
1993[Medline].
7.
Furuno, M.,
S. Uchida,
F. Marumo,
and
S. Sasaki.
Repressive regulation of the aquaporin-2 gene.
Am. J. Physiol.
271 (Renal Fluid Electrolyte Physiol. 40):
F854-F860,
1996
8.
Geiger, B.,
and
O. Ayalon.
Cadherins.
Annu. Rev. Cell Biol.
8:
307-332,
1992.
9.
Hennig, G.,
O. Löwrick,
W. Birchmeier,
and
J. Behrens.
Mechanisms identified in the transcriptional control of epithelial gene expression.
J. Biol. Chem.
271:
595-602,
1996
10.
Hilfiker, H.,
C. M. Hartmann,
G. Stange,
and
H. Murer.
Characterization of the 5'-flanking region of OK cell type II Na-Pi cotransporter gene.
Am. J. Physiol.
274 (Renal Physiol. 43):
F197-F204,
1998
10a.
Igarashi, P.,
C. S. Shashikant,
R. B. Thomson,
D. A. Whyte,
S. Liu-Chen,
F. H. Ruddle,
and
P. S. Aronson.
Ksp-cadherin gene promoter. II. Kidney-specific activity in transgenic mice.
Am. J. Physiol.
277 (Renal Physiol. 46):
F599-F610,
1999
11.
Igarashi, P.,
G. B. Vanden Heuvel,
J. A. Payne,
and
B. Forbush, III.
Cloning, embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl cotransporter.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F405-F418,
1995
12.
Igarashi, P.,
D. A. Whyte,
K. Li,
and
G. T. Nagami.
Cloning and kidney cell-specific activity of the promoter of the murine renal Na-K-Cl cotransporter gene.
J. Biol. Chem.
271:
9666-9674,
1996
13.
Javahery, R.,
A. Khachi,
K. Lo,
B. Zenzie-Gregory,
and
S. T. Smale.
DNA sequence requirements for transcriptional initiator activity in mammalian cells.
Mol. Cell. Biol.
14:
116-127,
1994
14.
Karp, S. L.,
A. Ortiz-Arduan,
S. Li,
and
E. G. Neilson.
Epithelial differentiation of metanephric mesenchymal cells after stimulation with hepatocyte growth factor or embryonic spinal cord.
Proc. Natl. Acad. Sci. USA
91:
5286-5290,
1994
15.
Karp, S. L.,
and
K. Phipps.
The novel zinc finger protein EEK3 is expressed in epithelial cells of the developing kidney (Abstract).
J. Am. Soc. Nephrol.
9:
363,
1998[Abstract].
16.
Lai, E.,
K. L. Clark,
S. K. Burley,
and
J. E. Darnell, Jr.
Hepatocyte nuclear factor 3/fork head or "winged helix" proteins: a family of transcription factors of diverse biologic function.
Proc. Natl. Acad. Sci. USA
90:
10421-10423,
1993
17.
Mandon, B.,
A. C. Bellanger,
and
J. M. Elalouf.
Inverse PCR-mediated cloning of the promoter for the rat vasopressin V2 receptor gene.
Pflügers Arch.
430:
12-18,
1995[Medline].
18.
Moser, M.,
A. Pscherer,
C. Roth,
J. Becker,
G. Mucher,
K. Zerres,
C. Dixkens,
J. Weis,
L. Guay-Woodford,
R. Buettner,
and
R. Fassler.
Enhanced apoptotic cell death of renal epithelial cells in mice lacking transcription factor AP-2
.
Genes Dev.
11:
1938-1948,
1997
19.
Murre, C.,
and
D. Baltimore.
The helix-loop-helix motif: structure and function.
In: Transcriptional Regulation, edited by S. L. McKnight,
and K. R. Yamamoto. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1992, p. 861-879.
20.
Nelson, R. D.,
P. Stricklett,
C. Gustafson,
A. Stevens,
D. Ausiello,
D. Brown,
and
D. E. Kohan.
Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice.
Am. J. Physiol.
275 (Cell Physiol. 44):
C216-C226,
1998
21.
Overdier, D. G.,
H. Ye,
R. S. Peterson,
D. E. Clevidence,
and
R. H. Costa.
The winged helix transcriptional activator HFH-3 is expressed in the distal tubules of embryonic and adult mouse kidney.
J. Biol. Chem.
272:
13725-13730,
1997
22.
Quaggin, S. E.,
G. B. Vanden Heuvel,
K. Golden,
R. Bodmer,
and
P. Igarashi.
Primary structure, neural-specific expression, and chromosomal localization of Cux-2, a second murine homeobox gene related to Drosophila cut.
J. Biol. Chem.
271:
22624-22634,
1996
23.
Rai, T.,
S. Uchida,
F. Marumo,
and
S. Sasaki.
Cloning of rat and mouse aquaporin-2 gene promoters and identification of a negative cis-regulatory element.
Am. J. Physiol.
273 (Renal Physiol. 42):
F264-F273,
1997
24.
Rauchman, M. I.,
S. K. Nigam,
E. Delpire,
and
S. R. Gullans.
An osmotically tolerant inner medullary collecting duct cell line derived from an SV40 transgenic mouse.
Am. J. Physiol.
265 (Renal Fluid Electrolyte Physiol. 34):
F416-F424,
1993