AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 277: F587-F598, 1999;
0363-6127/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whyte, D. A.
Right arrow Articles by Igarashi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whyte, D. A.
Right arrow Articles by Igarashi, P.
Vol. 277, Issue 4, F587-F598, October 1999

Ksp-cadherin gene promoter. I. Characterization and renal epithelial cell-specific activity

Dilys A. Whyte1, Congyi Li2, R. Brent Thomson2, Stacey L. Nix2, Reza Zanjani2, Sharon L. Karp4, Peter S. Aronson2,3, and Peter Igarashi2,3

Departments of 1 Pediatrics, 2 Internal Medicine, and 3 Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06520; and 4 Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana 46202


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Kidney-specific cadherin (Ksp-cadherin, cadherin 16) is a novel, kidney-specific member of the cadherin superfamily that is expressed exclusively in the basolateral membrane of renal tubular epithelial cells. To characterize the Ksp-cadherin gene promoter, a lambda  bacteriophage clone containing 3.7 kb of the proximal 5' flanking region of the mouse Ksp-cadherin gene was isolated. The transcription initiation site was mapped by RNase protection assays and 5' rapid amplification of cDNA ends, and a 709-bp intron was identified within the 5' untranslated region. The proximal 5' flanking region was "TATA-less" but contained other consensus promoter elements including an initiator (Inr), GC boxes, and a CAAT box. Potential binding sites were identified for transcription factors that are involved in tissue-specific gene expression including activator protein-2 (AP-2), hepatocyte nuclear factor-3 (HNF-3), basic helix-loop-helix (bHLH) proteins, CCAAT/enhancer-binding protein (C/EBP), and GATA factors. Transfection of luciferase reporter plasmids containing 2.6 kb of the 5' flanking region markedly increased luciferase activity in renal epithelial cells (MDCK and mIMCD-3) but not in mesenchymal cells (NIH 3T3 and MMR1). Deletion analysis identified an 82-bp region from -31 to -113 that was essential for promoter activity in transfected renal epithelial cells. Electrophoretic mobility-shift assays showed that mIMCD-3 cells contain nuclear proteins that bind to this region of the promoter. Mutational analysis showed that sequences within the HNF-3 consensus site and CAAT box were involved in protein binding and promoter activity. We conclude that the proximal 5' flanking region of the mouse Ksp-cadherin gene contains an orientation-dependent promoter that is kidney epithelial cell specific. The region of the promoter from -113 to -31 is required for transcriptional activity and contains binding sites for nuclear proteins that are specifically expressed in renal epithelial cells.

kidney specific; gene regulation; transcription factor; cell adhesion


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

STUDIES OF KIDNEY-SPECIFIC gene expression may provide insights into transcriptional regulation of renal cell differentiation and kidney organogenesis. However, relatively little information is available regarding molecular mechanisms of tissue-specific gene expression in the kidney, particularly when compared with other organs such as the liver. Recently, a number of cDNAs that are expressed exclusively or nearly exclusively in the kidney have been cloned. Many of these kidney-specific cDNAs encode membrane transporters such as the Na-phosphate cotransporter (NPT2), Na-glucose cotransporter (SGLT2), aquaporin-2 (AQP2), chloride channels (ClC-K1, ClC-K2, ClC-5), Na-Cl cotransporter (NCCT), Na-K-Cl cotransporter (NKCC2), H+-peptide cotransporter (PEPT2), vacuolar H+-ATPase (V-ATPase) B1 subunit, and organic solute transporters (OAT1, RST, OCT2). Other kidney-specific cDNAs include erythropoietin, Tamm-Horsfall protein, gamma -glutamyl transpeptidase (GGT, type 2), vitamin D3 1-alpha hydroxylase, and V2 vasopressin receptor. The promoters of the GGT, AQP2, ClC-K1 chloride channel, NPT2, and NKCC2 genes have been cloned and shown to direct kidney cell-specific expression in vitro and/or in transgenic mice (10, 12, 20, 25, 30). However, to date, no enhancer elements or kidney-specific transcription factors that are responsible for tissue-specific expression of these genes have been identified.

Kidney-specific cadherin (Ksp-cadherin, cadherin 16) is a novel, kidney-specific member of the cadherin family of cell adhesion molecules (27). Cadherins are integral plasma membrane proteins that have a characteristic structure consisting of a prosequence that is cleaved upon processing, a large extracellular domain, a single transmembrane segment, and a cytoplasmic domain (8, 26). The extracellular domain consists of four homologous repeats, each containing the conserved amino acid sequence LDRE and the putative calcium-binding sequences DXND and DXD. Near the transmembrane segment, there are four cysteine residues whose positions are highly conserved among the family members. The cytoplasmic domains of some cadherins bind to the catenin family of proteins involved in signal transduction and cytoskeletal anchoring. Cadherins mediate calcium-dependent cell-cell adhesion through homotypic interactions involving their extracellular domain repeats. The prototype of this family, E-cadherin (uvomorulin), is expressed in the adherens-type junctions of epithelial cells, where it has important roles in tissue morphogenesis and maintenance of the terminally differentiated phenotype. Alterations in E-cadherin expression are associated with tissue invasiveness, cellular dedifferentiation, and hyperplastic cell growth (8).

Ksp-cadherin, which was first identified as a stilbene-binding protein in the rabbit kidney, represents a structurally distinct member of the cadherin family (27). Ksp-cadherin contains the cadherin-specific extracellular domain repeats and conserved cysteine residues but lacks the prosequence and contains a highly truncated cytoplasmic domain. The structure of Ksp-cadherin suggests that it belongs to the recently described LI-cadherin/HPT-1 subfamily of cadherins (3). Ksp-cadherin is further distinguished by its unique tissue distribution. Northern blot analysis in the rabbit, mouse, and human has shown that the 3-kb Ksp-cadherin transcript is expressed exclusively in the kidney (27, 28). Within the kidney, Ksp-cadherin has been immunolocalized to the basolateral membrane of renal tubular epithelial cells but is not expressed in glomeruli, blood vessels, or renal interstitial cells (27). The function of Ksp-cadherin remains unknown, but it exhibits the calcium-dependent sensitivity to proteolysis that is typical of other cadherin family members (27). Chromosomal localization studies have mapped Ksp-cadherin (Cdh16) within a cluster of cadherin genes on mouse chromosome 8 and human chromosome 16, suggesting that the members of the cadherin family arose via duplication of a common ancestral gene (28).

The present study was undertaken to begin examining the molecular basis for kidney-specific expression of Ksp-cadherin. The specific aims were to clone and sequence the Ksp-cadherin promoter and to evaluate whether the activity of the promoter was kidney cell specific. A preliminary account of this work has been published in abstract form (32).


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Mice (strain 129/Sv, age greater than 35 days) were obtained from The Jackson Laboratory (Bar Harbor, ME). Restriction endonucleases and DNA-modifying enzymes were from New England Biolabs (Beverly, MA) or Boehringer-Mannheim (Indianapolis, IN). pGL3 plasmids, pSV2beta gal, luciferin, and reporter lysis buffer were from Promega (Madison, WI). Lipofectamine, Trizol, and RNase H-free Moloney murine leukemia virus (MMLV) reverse transcriptase (Superscript II) were from Life Technologies (Gaithersburg, MD). Galacto-Star chemiluminescent substrate was obtained from Tropix (Bedford, MA). Nylon filters (Hybond-N) and radionucleotides were from Amersham (Arlington Heights, IL). Protease inhibitor cocktail (Complete) was from Boehringer-Mannheim. Plasmid maxi-prep kits and Oligotex affinity columns were from Qiagen (Valencia, CA). Oligonucleotides were synthesized by the Yale Pathology Department Program in Critical Technologies and were purified by PAGE or OPC cartridges (Applied Biosystems). Other reagents were of molecular biological grade from Ambion (Austin, TX), Sigma (St. Louis, MO), Promega, Boehringer-Mannheim, or US Biochemicals (Cleveland, OH).

Library screening. A mouse genomic library in lambda FIXII (strain 129/Sv, catalog no. 946305) was purchased from Stratagene (La Jolla, CA) and screened by filter-hybridization with a 32P-labeled murine Ksp-cadherin cDNA, as described previously (11). Clones that were positive on duplicate filters were plaque purified, and the genomic inserts were restriction mapped using single or double digests with Sac I, Xba I, or Sal I. Restriction fragments were transferred to nylon membranes, and the end fragments and exon-containing fragments were identified by Southern blot analysis. A 3,913-bp Spe I restriction fragment containing the 5' end of the cDNA and a 921-bp Sac I fragment containing the 5' end of the genomic insert were subcloned into pBluescript II KS(+) (Stratagene) and sequenced completely. Overlapping sequence of both strands was obtained using automated cycle sequencing (11), which was performed by the W. H. Keck Foundation Biotechnology Resource Center at Yale University. Sequence analysis was performed using MacVector v4.1 (Eastman Kodak, Rochester, NY) or Wisconsin GCG software. Consensus sequences of transcription factor binding sites were identified using MacVector and by searching the TRANSFAC v3.2 database using Transcription Element Search Software (TESS, http://www.cbil.upenn.edu/tess). Pairwise sequence alignments were performed using the FASTA programs ALIGN and LALIGN.

RNase protection assays. RNase protection assays were performed as described previously (4). A restriction fragment containing nucleotides -113 to +74 of the genomic clone mKspgen7 was subcloned into pBluescript SK. After linearization with Hind III, an antisense riboprobe was transcribed using T3 RNA polymerase and [alpha -32P]UTP. The riboprobe was gel-purified and annealed to 100 µg mouse kidney RNA, which was isolated using acid guanidinium hydrochloride-phenol-chloroform extraction (Trizol). RNA from the liver and yeast tRNA were used as negative controls. Hybridization was performed overnight at 60°C in medium containing 80% formamide, 40 mM PIPES (pH 6.4), 0.4 M NaCl, 1 mM EDTA, and 5 × 105 cpm labeled probe. Samples were digested with RNase A (40 µg/ml) and RNase T1 (2.2 µg/ml), extracted with phenol and chloroform, then precipitated with ethanol. Products were resolved on 6% polyacrylamide-8 M urea sequencing gels. Autoradiography was performed using Kodak BioMax MS film, and the sizes of the protected bands were determined by comparison with sequencing ladders and molecular weight standards run in adjacent lanes.

Rapid amplification of cDNA ends (RACE). 5'-RACE was performed using SMART RACE cDNA amplification kits from Clontech (Palo Alto, CA). Total RNA was isolated from tissues by homogenization in Trizol, and poly(A)+ RNA was purified using Oligotex affinity columns. First strand cDNA was synthesized from 1.2 µg poly(A)+ using MMLV reverse transcriptase primed by the 5'-CDS primer (Clontech). The SMART II oligonucleotide sequence was appended to the 5' end by template switching. An aliquot of the cDNA was then amplified by PCR using the Advantage 2 polymerase mix, universal primer (UPM), and an antisense primer specific for Ksp-cadherin (CCACCATAGTTTTCAGGGACTTCTGTGTG). To amplify glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts, a gene-specific primer (GCTCCTGGAAGATGGTGATGGGCTT) was used. Thirty cycles of denaturation at 94°C for 50 s, annealing at 72-68° for 2 min, and elongation at 72°C for 3 min were performed using a Stratagene RoboCycler. PCR products were analyzed by agarose gel electrophoresis and stained with ethidium bromide. Bands were excised from low-melting agarose gels (NuSieve, FMC Bioproducts), cloned into the plasmid pCR2.1 (Invitrogen), and sequenced.

Construction of reporter plasmids. Luciferase reporter plasmids used in this study were derived from pGL3-Basic (Promega). A PCR product containing nucleotide sequence from -2608 to +74 (numbered with respect to the transcription initiation site) was amplified from the 3,913-bp Spe I fragment of genomic clone mKspgen7 using primers containing Sal I restriction sites [ACGCGTCGACCCTCCTGGGTAGCTGAGATTATAGG and ACGCGTCGACAATTTGGCTTAGGTGGGGCG (primer A)]. The 2.6-kb PCR product was digested with Sal I and cloned in both the sense and antisense orientations into the unique Xho I site of pGL3-Basic. The resulting plasmids, designated pKsp(2608F)-luc and pKsp(2608R)-luc, respectively, contained 2,608 bp of the proximal 5' flanking region and a portion of the first noncoding exon cloned upstream to a luciferase reporter gene from Photinus pyralis. Empty pGL3-Basic containing no insert was used as a negative control, and pGL3-Control containing the SV40 enhancer/promoter was used as a positive control.

Reporter plasmids containing nested deletions of the proximal 5' flanking region of the Ksp-cadherin gene were generated as follows. For pKsp(2069F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with EcoR I and Sma I, removal of the 539-bp fragment, end-filling with Klenow, and recircularization with T4 DNA ligase. For pKsp(1673F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Msc I and Sma I, removal of the 935-bp fragment, and recircularization. For pKsp(1268F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Hind III, isolation of the 1.3-kb fragment, and cloning in the sense orientation into the unique Hind III site of pGL3-Basic. For pKsp(958F)-luc, we proceeded with PCR amplification using primer A and ACGCGTCGACTATACCATGAGCAGTCC- TCGGG, digestion with Sal I, and cloning in the sense orientation into the unique Xho I site of pGL3-Basic. For pKsp(610F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Sac I, removal of 1,998-bp fragment, and recircularization. For pKsp(397F)-luc, we proceeded with PCR amplification using primer A and ACGCGTCGACAGGGCTTTCCTGAAGAAGGGGT, digestion with Sal I, and cloning in the sense orientation into the unique Xho I site of pGL3-Basic. For pKsp(250F)-luc, we proceeded with PCR amplification using primer CCTTGCTAGCGTCCAGTTTCCAGGAGAAAGGAAT and CCTTGCTAGCAAGTGGGAGCCAAGTCTGAACAC, digestion with Nhe I, and cloning in the sense orientation into the unique Nhe I site of pGL3-Basic. For pKsp(113F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Avr II and Nhe I, removal of the 924-bp and 1,571-bp fragments, and recircularization. For pKsp(31F)-luc, we proceeded with restriction digestion of pKsp(2608F)-luc with Stu I and Sma I, removal of the 25-bp, 1,761-bp, and 791-bp fragments, and recircularization. All plasmids were sequenced to verify the orientation and integrity of the inserts. DNA for transfections was purified by alkaline lysis maxi-preps and anion-exchange chromatography (Qiagen).

Cell culture and transfection. Madin-Darby canine kidney (MDCK) cells were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (Intergen, Purchase, NY). Mouse inner medullary collecting duct cells (mIMCD-3) were a generous gift from Dr. Steven Gullans (Harvard Medical School) and were grown in DMEM-Ham's F-12 (50:50) supplemented with 10% fetal bovine serum (24). MMR1 cells, an established mesenchymal cell line derived from the murine metanephric ridge, were grown as described previously (14). NIH 3T3 fibroblasts were obtained from the American Type Culture Collection and were maintained in DMEM supplemented with 10% fetal bovine serum.

Luciferase reporter plasmids were transfected into cultured cells using cationic liposomes (Lipofectamine, Life Technologies) as described previously (12). Cells were plated in 100-mm plastic dishes at a density of 0.5-1 × 106 cells/dish. After 24-48 h, when they were 60% confluent, the cells were washed once with Opti-MEM I reduced serum medium (Life Technologies) then transfected with 10 µg of reporter plasmid. Cotransfection with 2 µg pSV2beta gal encoding Escherichia coli beta -galactosidase was performed as a control for transfection efficiency. Plasmid DNA (12 µg total) and cationic liposomes (48 µl) were combined in 1 ml of Opti-MEM I and incubated at room temperature for 20 min. An additional 7 ml of Opti-MEM I was added, and the mixture was applied to a single dish of cells. After incubation for 6 h at 37°C, 8 ml of culture medium containing twice the usual concentration of fetal bovine serum was added. Dishes were refed with standard culture medium 24 h after transfection; 48 h after transfection, the cells were lysed and assayed for luciferase and beta -galactosidase activity.

Reporter gene assays. Luciferase activity was measured in cell lysates using methods similar to those described previously (12). Cells were washed twice with Ca2+-, Mg2+-free PBS (150 mM NaCl, 15 mM sodium phosphate, pH 7.3) then lysed by incubation for 20 min at room temperature in 900 µl of Reporter Lysis Buffer (Promega). Lysed cells were scraped into 1.5-ml microcentrifuge tubes, then freeze-thawed once at -20°C. Tubes were vortexed briefly, then centrifuged at 14,000 g to remove cell debris. Twenty microliters of the supernatant was aliquoted into 75 × 12-mm plastic tubes (Sarstedt). One hundred microliters of Luciferase Assay Reagent (Promega) containing 20 mM Tricine (pH 7.8), 1.07 mM (MgCO3)4 · Mg(OH)2 · 5H2O, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM dithiothreitol (DTT), 270 µM coenzyme A, 530 µM ATP, and 470 µM luciferin was rapidly injected into the tubes. After a 1-s delay, light output was integrated over 10 s at room temperature using an Optocomp I photon-counting luminometer (MGM Instruments, Hamden, CT).

Luciferase activity was normalized to beta -galactosidase activity, which was measured in the identical cell lysates. beta -Galactosidase assays were performed using a chemiluminescent reporter assay system (Tropix). Cell lysates were preincubated at 48°C for 50 min to inactivate mammalian beta -galactosidase-like activity. Twenty microliters of heat-inactivated cell lysate was incubated for 60 min with 300 µl of reaction buffer containing Galacto-Star, 100 mM sodium phosphate (pH 7.5), 1 mM MgCl2, and 5% Sapphire-II (Tropix). Light output was integrated over 5 s at room temperature using a luminometer. Measurements of luciferase and beta -galactosidase were performed in triplicate. Samples were diluted with reporter lysis buffer as necessary to ensure that measurements were within the linear range of the assays.

Electrophoretic mobility-shift assays (EMSA). Nuclear extracts were prepared from cultured cells using the method of Andrews and Faller (1). Briefly, confluent cells were grown in 150-mm dishes (~5 × 106 cells/dish), then scraped into 1.5 ml PBS and pelleted. Cells were lysed for 10 min in ice-cold medium containing 10 mM HEPES-KOH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and protease inhibitors (Complete, Boehringer-Mannheim). Nuclei were pelleted by centrifugation, then extracted for 20 min with 20 mM HEPES-KOH (pH 7.9), 25% glycerol, 420 mM NaCl, 5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and protease inhibitors. After centrifugation, the supernatant was dialyzed overnight against 20 mM HEPES-KOH (pH 7.9), 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, and protease inhibitors. Protein concentration was measured using the Pierce Coomassie Plus Protein Assay (Rockford, IL) with BSA as the standard.

EMSAs were performed as described previously (22). Double-stranded oligonucleotides containing the sequences of the promoter from -109 to -80 (GGCTGGCAGTCACGGATGCTGAGCAGATCT) and from -79 to -50 (GGCTCTCCAAAGTCAATAAGTAACTTGGGG) were end-labeled with 32P using T4 polynucleotide kinase. Binding reactions (20 µl) contained 25 mM NaCl, 10 mM Tris-Cl (pH 7.5), 1 mM MgCl2, 5 mM EDTA, 5% glycerol, 1 mM DTT, labeled probe (5 × 104 cpm), and 1 µg nuclear extracts. In some reactions, a 50-fold molar excess of unlabeled oligonucleotide was included as a specific competitor. All binding reactions contained 1.5 µg poly(dI-dC) as a nonspecific competitor. After incubation at room temperature for 30 min, samples were loaded on nondenaturing 5% polyacrylamide gels and electrophoresed at 8 V/cm for 2 h in 0.5× TBE [1× TBE is 89 mM Tris-borate, 2 mM EDTA (pH 8.0)]. Gels were dried, and the radiolabeled bands were detected by autoradiography.

Site-directed mutagenesis. Specific mutations were introduced into the luciferase reporter plasmids using QuikChange site-directed mutagenesis kits from Stratagene. Complementary sense and antisense 30-mers containing the desired mutations were synthesized and purified by PAGE. The mutagenic primers were annealed to the plasmid pKsp(113F)-luc and extended using a nonstrand-displacing DNA polymerase (PfuTurbo). Eighteen cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and elongation at 68°C for 10 min were performed. The parental DNA template was then digested with Dpn I, and the mutated plasmids were transformed into E. coli strain XL1-Blue. The presence of the mutation was verified by DNA sequencing.

Statistical analysis. The mean data from four to nine independent transfections using different cell preparations are reported. Values are means ± SE. Statistical analysis was performed using one-way analysis of variance and Student's t-test with the Bonferroni correction for multiple comparisons. Statistical significance was defined as P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cloning of the 5' flanking region of the mouse Ksp-cadherin gene. A mouse genomic library in bacteriophage lambda  was screened by filter-hybridization with a Ksp-cadherin cDNA, and a clone containing a 15.8-kb insert (mKspgen7) was obtained (Fig. 1A). Southern blot analysis (not shown) indicated that mKspgen7 contained the 5' end of the Ksp-cadherin cDNA and was therefore likely to include the 5' flanking region of the gene. A 3.9-kb Spe I restriction fragment (clone SPE5) was subcloned into pBluescript and sequenced completely. Additional sequence of mKspgen7 was obtained by subcloning and partially sequencing a 921-bp 5'-end Sac I fragment and an internal 8-kb Xba I fragment. Figure 1B shows a portion of the sequence of the mouse Ksp-cadherin gene and the proximal 5' flanking region. The nucleotide sequences of mKspgen7 and the mouse Ksp-cadherin cDNA (28) were identical in the region of overlap (indicated by broken underscore in Fig. 1B), verifying the identity of the genomic clone. However, beginning at nucleotide +148, the sequence of mKspgen7 contained an additional 709 bp of sequence that was not present in the cDNA and that was flanked by consensus splice donor (MAG/GTRAGT) and acceptor (YnNYAG/G) sites. These results indicated that the first exon of Ksp-cadherin was 147 bp in length and was noncoding. The first intron was 709 bp, and the second exon contained the translation start codon. The complete 4884-bp sequence containing 3,696 bp of 5' flanking region, the first two exons, the first two introns, and a portion of the third exon has been deposited in the GenBank database (accession no. AF118228).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence of the 5' end of the mouse kidney-specific cadherin (Ksp-cadherin) gene. A: partial restriction map of genomic clone mKspgen7. Positions of restriction sites are indicated by the vertical bars. Bent arrow, transcription initiation site; and ATG, start codon. Thick line indicates the extent of the cloned 5' flanking region. B: sequence of the proximal 5' flanking region and noncoding region of the mouse Ksp-cadherin gene obtained from genomic clone mKspgen7. Nucleotide positions are numbered to the right with respect to the transcription initiation site at +1. Bent arrow, transcription initiation site mapped by RNase protection assays. * Transcriptional start site mapped by 5'-RACE. Single lines indicate consensus transcription factor recognition sequences. Double lines indicate the CA microsatellite. Broken underscored sequence is identical to the cDNA sequence. Bold nucleotides are invariant in splice donor and acceptor sites, and slash marks indicate the splice sites. Only a portion of the sequence of the first intron (lower case) is shown.

Mapping of the transcription initiation site. The transcription initiation site was mapped using RNase protection assays and 5'-RACE. A 32P-labeled antisense riboprobe extending upstream from a known site in the 5' untranslated region was annealed to RNA from mouse kidney, then digested with RNases. Figure 2 shows that the major protected fragment in the kidney was 75 bp, which indicated that the 5' end of the Ksp-cadherin mRNA was located 33 bp upstream to the origin of the cloned cDNA and 869 bp from the start codon. Minor bands of higher molecular weight were also observed, suggesting the existence of multiple transcription initiation sites, as are frequently observed in TATA-less promoters (see below). The specificity of the assay was verified by the absence of protected fragments in yeast tRNA and in RNA from liver, which does not express Ksp-cadherin.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 2.   Mapping of the transcription initiation site by RNase protection assays (A) and 5'-RACE (B). A: an antisense riboprobe containing nucleotides -113 to +74 (Fig. 1B) was labeled with [32P]UTP and annealed to 100 µg RNA from mouse kidney (right lane), mouse liver (middle lane), or yeast tRNA (left lane). Following digestion with RNase A and T1, the products were analyzed on 6% polyacrylamide sequencing gels. Arrow, major protected band. Positions of molecular weight standards (in bp) are indicated on left. B: RACE was performed using a universal 5' primer and 3' primers specific for Ksp-cadherin (top) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (bottom). Ethidium bromide-stained agarose gel shows products amplified from kidney (lanes 1-3) or liver (lanes 4-6). Positions of molecular weight standards (in bp) are indicated on left.

Since RNase-protected bands can terminate at splice acceptor sites as well as the 5' terminus, 5'-RACE was performed to independently verify the transcriptional start site. Poly(A)+ RNA from mouse kidney was reverse transcribed into cDNA, and a unique oligonucleotide was appended to the 5' end by template switching. PCR was then used to amplify the sequence between the 5' oligonucleotide and a 3' primer specific for Ksp-cadherin. Figure 2B (top) shows an ethidium-bromide-stained agarose gel in which bands of 325 bp and 260 bp were observed in the sample from mouse kidney (lane 1). The PCR products were specific, since they were only observed in reactions containing both the 5' oligonucleotide and the 3' gene-specific primer and were absent in the samples from mouse liver, which does not express Ksp-cadherin (lane 4). In contrast, a 355-bp PCR product was obtained from both liver and kidney using a primer specific for the housekeeping gene, GAPDH (Fig. 2B, bottom). Although the transcription initiation site of the mouse GAPDH gene has not yet been identified, the size of the GAPDH product corresponded to the known transcriptional start sites in the rat and human genes. The 325-bp Ksp-cadherin product was similar in size to the expected product (322 bp) based on the transcriptional start site identified by RNase protection assays. To precisely identify the 5' end of the Ksp-cadherin transcript, the 325-bp PCR product was cloned into the plasmid pCR2.1 and sequenced. The transcriptional start site identified by 5'-RACE was located within 6 bp of the site identified by RNase protection assays (Fig. 1B). The minor variation in transcriptional start sites identified by the two methods may be due to the absence of a TATA box in the Ksp-cadherin promoter (see below). In addition to the 325-bp band, a 260-bp 5'-RACE product was also observed in the kidney. DNA sequencing revealed that the 260-bp product resulted from premature termination in a G+C-rich region located within the 5' untranslated region (not shown). Attempts to map the transcriptional start site by primer extension analysis were unsuccessful, apparently because of premature termination in this G+C-rich region.

Sequence of the proximal 5' flanking region of the mouse Ksp-cadherin gene. Figure 1B shows the sequence of the proximal 1 kb of 5' flanking region of the mouse Ksp-cadherin gene. The arrow in Fig. 1B depicts the transcription initiation site mapped by RNase protection assays, and the asterisk indicates the transcriptional start site mapped by 5'-RACE. The transcription initiation site mapped by RNase protection assays was located within the sequence CC<UNL>A</UNL>CTCC (underscore indicates nucleotide at +1), which exactly matched a consensus initiator (Inr) element (YY<UNL>A</UNL>NWYY) (13). The proximal 5' flanking region was examined for the presence of typical eukaryotic promoter elements. No TATA box was identified near the transcription initiation site. However, a variant CCAAT box was located at position -63, and two GC boxes were located at positions -38 and -14. The GC box at -38 conformed to a consensus Sp1 binding site (GGCGGG). Thus, although the Ksp-cadherin promoter is "TATA-less," regulatory elements that are competent to initiate gene transcription are present, including the initiator and GC boxes. A noteworthy feature of the 5' flanking sequence is the presence of several simple sequence repeats including (C-A)16-(G-T)16 at position -199, (G-A)21-(C-T)21 at position -1334, (GGAGAG)7-(CCTCTC)7 at position -1292, and (C-A)26-(G-T)26 at position -2132. A poly(T) tract is located from position -2819 to -2898.

The proximal 5' flanking region contained consensus recognition sequences for several transcription factors that are known to be involved in tissue-specific expression of other genes (Fig. 1B; Table 1). Some of these tissue-specific proteins, such as NF-E2 and Pu.1, are not expressed in the kidney and would not be expected to be involved in Ksp-cadherin gene regulation. However, the Ksp-cadherin promoter also contained potential binding sites for CCAAT/enhancer-binding protein (C/EBP), hepatocyte nuclear factor 3 (HNF-3), basic helix-loop-helix (bHLH) proteins, and GATA factors, which are tissue-restricted transcription factors that are expressed in the kidney. The Ksp-cadherin promoter also contained consensus binding sites for transcription factors that are involved in signal transduction pathways including activator protein-1 (AP-1), AP-2, glucocorticoid receptor, peroxisome proliferation-activated receptor (PPAR), NF-kappa B, and serum response factor (SRF) (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Consensus transcription factor recognition sequences in the proximal 5' flanking region of the Ksp-cadherin gene

Comparison between the Ksp-cadherin promoter and other cadherins. The Ksp-cadherin promoter was aligned with the promoters of other cadherins that have been cloned in the mouse (Fig. 3). Comparison with the mouse P-cadherin promoter revealed only 34% overall sequence identity. However, the 50-bp region immediately upstream to the transcription start site was 60% identical. This region of the Ksp-cadherin promoter contained putative Sp1 and AP-2 binding sites. In the P-cadherin promoter, these elements were absent from this region but were located instead at positions -88 and -101, respectively. Figure 3 shows the comparison between the promoters of the mouse Ksp-cadherin and E-cadherin genes. Overall, the Ksp-cadherin promoter was 47% identical to the E-cadherin promoter. However, there was a 136-bp region of extended homology (52% identity) immediately surrounding the transcription start site. The locations of the transcription start sites and two upstream GC boxes including the putative Sp1 binding site were conserved in the two promoters.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison between sequences of Ksp-cadherin, P-cadherin, and E-cadherin promoters. Pairwise sequence alignments were constructed using the LALIGN program with gap penalties of -16/-4. Sequence of the Ksp-cadherin promoter is shown in top lines of each panel, and the sequence of the mouse P-cadherin promoter (6) and mouse E-cadherin promoter (2) is shown in the bottom lines of each panel. Only the highest scoring region of local homology is shown; ":" indicates sequence identity; "-" indicates gaps introduced to optimize the alignments. Lines indicate consensus transcription factor binding sites or enhancers. Nucleotide positions are shown relative to the transcription initiation site at +1 (underscored).

Kidney cell-specific activity of the Ksp-cadherin promoter. To verify that the proximal 5' flanking region contained a functional gene promoter and to evaluate cell specificity, reporter gene assays were performed in cultured cells. A 2.7-kb fragment of the genomic clone mKspgen7 containing the transcription initiation site, 2,608 bp of proximal 5' flanking region, and a portion of the first (noncoding) exon was cloned upstream to a promoterless luciferase reporter gene in the plasmid pGL3-Basic. The resulting plasmid, designated pKsp(2608F)-luc, was transfected into cultured cells using cationic liposomes; 48 h after transfection, the cells were lysed and assayed for luciferase activity. As a control for transfection efficiency, cells were cotransfected with pSV2beta gal, and beta -galactosidase activity was assayed in the cell lysates using a chemiluminescent assay. Promoter activity was inferred from luciferase activity normalized for differences in transfection efficiency (which were minimal). Since promoter activity should be orientation dependent, cells were also transfected with pGL3-Basic containing the Ksp-cadherin sequence cloned in the antisense orientation [pKsp (2608R)-luc] as a negative control.

Preliminary studies using Northern blot analysis and immunoblot analysis (not shown) indicated that Ksp-cadherin was endogenously expressed in two renal epithelial cell lines, MDCK cells and mIMCD-3. In contrast, Ksp-cadherin was not expressed in NIH 3T3 fibroblasts or MMR1 cells, a mesenchymal cell line derived from the mouse metanephric ridge (14). To evaluate whether the activity of the Ksp-cadherin promoter was cell specific, transfections were performed in MDCK cells and mIMCD-3 cells, and the results were compared with transfections in NIH 3T3 cells and MMR1 cells. Figure 4 shows the luciferase activity produced following transfection with the reporter plasmids pKsp(2608F)-luc (gray-shaded bars) and pKsp(2608R)-luc (hatched bars) compared with empty pGL3-Basic (solid bars). Transfection of pKsp(2608F)-luc into MDCK cells resulted in a 60-fold stimulation of luciferase activity, and transfection into mIMCD-3 cells resulted in a 48-fold stimulation. These increases in luciferase activity were statistically significant (P < 0.001). In contrast, transfection of MMR1 cells resulted in less than twofold stimulation, although this difference was also statistically significant (P < 0.01). There was no significant stimulation of luciferase activity following transfection into NIH 3T3 cells (P > 0.05). The stimulation of luciferase activity in MDCK cells and mIMCD-3 cells was orientation dependent, since transfection with pKsp(2608R)-luc containing the Ksp-cadherin promoter in the antisense orientation produced no stimulation (Fig. 4, hatched bars). Transfection of the positive control plasmid pGL3-Control into MDCK, mIMCD-3, MMR1, and NIH 3T3 cells resulted in significant luciferase activity in all cell types (596 ± 141, 305 ± 20, 126 ± 66, and 146 ± 28, respectively). Taken together, these results demonstrated that the cloned 2.7-kb fragment contained an orientation-specific promoter that was highly active in MDCK cells and mIMCD-3 cells. The minimal stimulation in MMR1 cells and the lack of stimulation in NIH 3T3 cells suggested that the activity of the Ksp-cadherin promoter was kidney epithelial cell specific. These results also indicated that kidney-specific expression of Ksp-cadherin was due, at least in part, to tissue-specific gene transcription.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of the Ksp-cadherin promoter in cultured cells. Cells were transfected with 10 µg empty pGL3-Basic (solid bars), 10 µg pKsp(2608F)-luc (gray-shaded bars), or 10 µg pKsp(2608R)-luc (hatched bars), and luciferase activity was measured after 48 h. To control for transfection efficiency, cells were cotransfected with 2 µg pSV2beta gal, and luciferase activity was normalized to beta -galactosidase activity. Normalized luciferase activity is shown relative to pGL3-Basic. Data are means ± SE of 9 separate transfections. * Significantly greater than pGL3-Basic (P < 0.05).

Deletion analysis of the Ksp-cadherin promoter. To identify regions of the Ksp-cadherin promoter that were required for activity in transfected renal epithelial cells, deletion analysis was performed. Reporter plasmids containing a nested set of truncations of the proximal 5' flanking region of the Ksp-cadherin gene were created by restriction digestion or PCR. Constructs produced by PCR were sequenced completely to verify the fidelity of the Taq polymerase. All of the sequences were identical to genomic DNA except for pKsp(953F)-luc, which contained a single nucleotide substitution (G to A) at -894, a position that does not appear to be critical for activity (see below). The truncated reporter plasmids were transfected into MDCK cells and mIMCD-3 cells, and luciferase activity was measured after 48 h. As shown in Fig. 5, truncation of the promoter from -2608 to -250 did not significantly decrease luciferase activity in either MDCK cells (hatched bars) or mIMCD-3 cells (gray-shaded bars). However, further truncation of the promoter to nucleotide -113 resulted in a 40% reduction in luciferase activity, and truncation to nucleotide -31 completely abolished activity in both cell types. The full-length Ksp-cadherin promoter as well as the deletion constructs produced only basal luciferase activity in NIH 3T3 cells and MMR1 cells (not shown), indicating that truncation of the promoter did not significantly increase promoter activity in mesenchymal cells. Taken together, these results indicated that positive regulatory elements that control Ksp-cadherin promoter activity in transfected renal epithelial cells were likely to be located from -250 to -113, and essential elements were located between -113 and -31.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Deletion analysis of proximal 5' flanking region of the Ksp-cadherin gene. Reporter plasmids (10 µg) containing the indicated lengths of the 5' flanking region of Ksp-cadherin were transfected into mIMCD-3 cells (gray-shaded bars) or MDCK cells (hatched bars), and luciferase activity was measured after 48 h. To control for transfection efficiency, cells were cotransfected with 2 µg pSV2beta gal, and luciferase activity was normalized to beta -galactosidase activity. Normalized luciferase activity is shown relative to the plasmid containing 2,608 bp of 5' flanking region. Data are means ± SE of 9 separate transfections. * Significantly greater than pGL3-Basic (P < 0.05).

Binding of nuclear proteins to the Ksp-cadherin promoter. To determine whether renal epithelial cells contain nuclear proteins that bind to the Ksp-cadherin promoter, EMSAs were performed. Double-stranded oligonucleotides derived from the critical region between -31 and -113 were end-labeled with 32P, incubated with nuclear extracts, and the DNA-protein complexes were resolved from unbound oligonucleotide by nondenaturing gel electrophoresis. All binding reactions were performed in the presence of 1.5 µg poly(dI-dC) to inhibit nonspecific binding. To determine whether binding proteins were specific to renal epithelial cells, extracts from mIMCD-3 cells were compared with extracts from MMR1 cells. Figure 6 (lanes 1-5) shows binding to a 30-mer containing nucleotides -109 to -80 of the promoter. In lane 4, the arrowhead indicates a retarded band that was present in nuclear extracts from mIMCD-3 cells but was absent in reactions containing no nuclear extracts (lane 1). Binding was specific, since a 50-fold molar excess of unlabeled oligonucleotide inhibited the formation of the DNA-protein complex (lane 5). Lane 2 shows that a retarded band of similar mobility was also detected in extracts from MMR1 cells, and formation of this complex was also specific (lane 3). Figure 6, lanes 6-10, shows binding to a 30-mer containing nucleotides -79 to -50 of the promoter. In lane 9, the arrowheads indicate retarded bands that were present in mIMCD-3 cells, absent in reactions containing no nuclear extracts (lane 6), and competed by a 50-fold excess of unlabeled oligonucleotide (lane 10). In contrast to the -109/-80 oligonucleotide, these bands were not detected in extracts from MMR1 cells (lanes 7-8). Taken together, these results demonstrated that mIMCD-3 cells and MMR1 cells contained nuclear proteins that bind specifically to the region of the promoter from -109 to -80, but only mIMCD-3 cells contained proteins that bind specifically to the region from -79 to -50.


View larger version (96K):
[in this window]
[in a new window]
 
Fig. 6.   Binding of nuclear proteins to the Ksp-cadherin promoter. Electrophoretic mobility shift assays (EMSA) were performed using radiolabeled oligonucleotides containing nucleotides -109 to -80 (lanes 1-5) or -79 to -50 (lanes 6-10). Nuclear extracts were obtained from MMR1 cells (lanes 2, 3, 7, and 8) or mIMCD-3 cells (lanes 4, 5, 9, and 10). Lanes 1 and 6 contain no extract; "-" indicates lanes containing labeled oligonucleotide and 1 µg protein; "+" indicates lanes containing labeled oligonucleotide, 1 µg protein, and a 50-fold molar excess of unlabeled oligonucleotide. Arrow (F), position of the free oligonucleotide; arrowheads, specific retarded bands.

Mutational analysis of the Ksp-cadherin promoter. To further define the region of the promoter that was involved in protein binding and transcriptional activity, mutational analysis was performed. Since EMSA indicated that the region from -50 to -79 binds to nuclear proteins that are present in mIMCD-3 cells but not in MMR1 cells, we focused the analysis on this region of the promoter. Figure 7 shows the results of EMSA comparing the abilities of mutated oligonucleotides to compete with the wild-type sequence for binding to nuclear extracts from mIMCD-3 renal epithelial cells. In lane 2 of Fig. 7, the arrowheads show that nuclear extracts from mIMCD-3 cells contained proteins that bind to the region from -79 to -50, similar to the results shown in Fig. 6. Binding was specific, since the formation of the retarded bands was completely inhibited by a 5-fold excess (lane 3) or 50-fold excess (lane 8) of unlabeled wild-type oligonucleotide. In contrast, a 5-fold or 50-fold molar excess of an oligonucleotide containing mutation 3 had no effect on formation of the retarded bands (Fig. 7, lanes 6 and 11), which indicated that the mutated sequence was unable to compete for binding. A fivefold excess of oligonucleotides containing mutations 1, 2, and 4 only partially inhibited complex formation (lanes 4, 5, and 7), although a higher concentration (50-fold excess) produced more complete inhibition (lanes 9, 10, and 12).


View larger version (94K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of mutations of the Ksp-cadherin promoter on protein binding. EMSAs were performed using radiolabeled wild-type oligonucleotide (nucleotides -79 to -50) and nuclear extracts from mIMCD-3 cells. Binding was conducted in absence (lane 2) or presence of a 5-fold excess (lanes 3-7) or a 50-fold excess (lanes 8-12) of unlabeled wild-type (wt) or mutated (m) oligonucleotides. Lane 1 contains no nuclear extract. Arrow (F), position of the free oligonucleotide; arrowheads, specific retarded bands; *, nonspecific bands. Sequences of the wild-type and mutant oligonucleotides were: wt, GGCTCTCCAAAGTCAATAAGTAACTTGGGG; m1, GGCTCTCC- <UNL>CCC</UNL>GTCAATAAGTAACTTGGGG; m2, GGCTCTCCAAA<UNL>TGA</UNL>AATA- AGTAACTTGGGG; m3, GGCTCTCCAAAGTC<UNL>CCG</UNL>AAGTAACTTG- GGG; and m4, GGCTCTCCAAAGTCAAT<UNL>CCT</UNL>TAACTTGGGG.

The mutations of the region -50 to -79 were introduced into the Ksp-cadherin promoter by site-directed mutagenesis and tested for their effects on transcriptional activity using reporter gene assays. Figure 8 shows that transfection of mIMCD-3 cells with a reporter plasmid containing 113 bp of the wild-type promoter produced a 28-fold stimulation of luciferase activity, similar to the results shown in Fig. 5. Transfection with a reporter plasmid containing mutation 1 resulted in a 33% decrease in activity compared with wild type, although this difference was not statistically significant. Transfection with plasmids containing mutations 2, 3, or 4 resulted in a significant 70-80% decrease in activity compared with wild type (P < 0.05, t-test with Bonferroni correction). Taken together, these results indicated that mutations within the region from -79 to -50 interfered with both protein binding and transcriptional activity.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   Effects of mutations on promoter activity in transfected mIMCD-3 cells. Ten micrograms of a reporter plasmid pKsp(113F)-luc containing either wild-type (WT) promoter sequence or mutated (Mut) sequence was transfected into mIMCD-3 cells, and luciferase activity was measured after 48 h. Sequences of the mutations are shown in the legend to Fig. 7. Luciferase activity was normalized to transfection efficiency and is shown relative to empty pGL3-Basic. Data are means ± SE of 4 separate transfections. * Significantly less than wild type (P < 0.05).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The cis-acting regulatory elements that govern gene transcription (e.g., enhancers, locus control regions, and negative regulatory elements) may be located throughout the gene locus. However, in many cases, the proximal promoter region contains elements that are sufficient to mediate high-level, tissue-specific gene transcription. These proximal regulatory elements may represent binding sites for tissue-restricted proteins that mediate transcriptional activation in expressing cells. Accordingly, we first focused on the proximal 5' flanking region to identify elements that are responsible for kidney-specific expression of Ksp-cadherin. We isolated a genomic clone that contained 3.7 kb of the proximal 5' flanking region and showed using reporter gene assays in transfected cells that this region contained a functional promoter that was orientation specific. Moreover, the promoter was highly active in MDCK cells and mIMCD-3 cells but not in MMR1 cells or NIH 3T3 cells, which suggested that the Ksp-cadherin promoter was kidney epithelial cell specific in vitro. Studies performed in transgenic mice (described in the companion study, Ref. 10a) verified that the promoter was also kidney-specific in vivo. The sequence of the Ksp-cadherin promoter was "TATA-less" but contained other typical eukaryotic promoter elements including an initiator (Inr), a CAAT box, and two GC boxes. The upstream GC box conformed to a consensus binding site for the transcription factor Sp1, which is a ubiquitous zinc finger protein that can initiate transcription by recruiting the RNA polymerase holoenzyme to the promoter. In addition, GC boxes may represent binding sites for tissue-specific Krüppel-like factors (such as EKLF, LKLF, and GKLF). A Krüppel-like zinc finger protein named EEK3 has recently been identified in developing renal tubular epithelial cells and could be a candidate for interacting with the Sp1 site in the Ksp-cadherin promoter (15).

Sequence comparisons between the promoters of different kidney-specific genes may identify conserved elements that are involved in the regulation of tissue specificity. Studies in the companion report (10a) demonstrated that the cloned region of the Ksp-cadherin promoter was most active in renal collecting ducts. Accordingly, we compared the Ksp-cadherin promoter with the promoters of the V2 vasopressin receptor gene (17) and the AQP2 gene (31), which are also expressed in this nephron segment. Overall, the mouse Ksp-cadherin promoter was 42% identical to the rat V2 receptor promoter (data not shown). The highest homology (61% identity) was found in a 54-bp region located from -451 to -398 in the Ksp-cadherin promoter and from -1022 to -968 in the V2 receptor promoter. Comparison between the Ksp-cadherin promoter and the human AQP2 promoter revealed 44% identity overall, with highest homology between nucleotides -125 to -159 of Ksp-cadherin and nucleotides -99 to -133 of AQP2 (69% identity). This region contained a conserved NF-E2 site, but the AP-1 site present at -148 in the Ksp-cadherin promoter was absent from the AQP2 sequence. Recent studies suggest that the AQP2 promoter can be transactivated by GATA-3, a tissue-specific zinc finger protein that is expressed in collecting ducts (29). The Ksp-cadherin promoter contains a GATA motif at -698, but this region of the promoter appears to be dispensable for transcriptional activity. Two regions of the human AQP2 promoter (-84 to -153, and -364 to -434) contain negative regulatory elements that may prevent transcription in nonexpressing cells (7). The region of greatest similarity between Ksp-cadherin and AQP2 is encompassed by one of these regions (-84 to -153). Another negative regulatory element (AATCCTTATCTGGGAGTTCATTAACGAG) has been identified in the rat AQP2 promoter by DNase I footprint analysis (23). The Ksp-cadherin promoter contains a sequence (from -437 to -456) that matches this element at 14/19 positions. However, deletion of these regions did not increase promoter activity in transfected mesenchymal cells, suggesting that the expression of Ksp-cadherin was not primarily due to negative regulation.

The promoter of the Ksp-cadherin gene was compared with two other cadherins, E-cadherin and P-cadherin, that are also expressed in the kidney. E-cadherin is expressed in tubular epithelial cells, whereas P-cadherin is expressed primarily in glomerular epithelial cells. The E-cadherin and P-cadherin promoters have an overall structure that is similar to Ksp-cadherin, including absence of a TATA box, presence of a CAAT box, two putative AP-2 binding sites, and a GC-rich region containing a potential Sp1 binding site (2, 6). Interestingly, the transcription initiation sites of the E-cadherin and Ksp-cadherin genes are located at identical positions when the sequences are optimally aligned. This similarity in structure is consistent with the hypothesis that the genes arose by duplication of a common ancestral gene as was previously suggested by chromosomal localization studies (28). However, the mechanisms of gene regulation may be distinct. Epithelial-specific expression of E-cadherin requires an upstream E-Pal element (CACCTGCAGGTG) and an intronic enhancer (2, 9). Ksp-cadherin contains a sequence (CATCTGAAGGTG) that is identical to the E-Pal element at 10/12 positions (Fig. 3). However, unlike E-cadherin, in which the E-Pal element is located 75 bp upstream to the transcription initiation site, the related sequence in Ksp-cadherin is located at the 3' end of the first exon in a region that is not essential for promoter activity in transfected renal epithelial cells. No sequences that are similar to the intronic enhancers in the E-cadherin gene were identified in the promoter or first intron of the Ksp-cadherin gene.

Deletion analysis was performed to identify the regions of the Ksp-cadherin promoter that were required for activity in transfected renal epithelial cells. The results of these studies indicated that promoter activity was dependent on positive regulatory elements (enhancers) that were located within 250 bp upstream from the transcriptional start site. Additional studies in transgenic mice will be required to verify whether this region is sufficient to direct expression in vivo. The proximal promoter contained the CAAT box (at -63), the putative Sp1 site (at -38), and a (C-A)n microsatellite repeat (at -199). Several consensus recognition sequences for transcription factors that are involved in tissue-specific gene regulation were identified including HNF-3 (at -62), bHLH proteins (at -165), and AP-2 (-30 and -103). HNF-3 is a transcriptional activator that was first shown to be important for liver-specific expression of genes such as alpha 1-antitrypsin and transthyretin (5). The sequence of the putative HNF-3 site in the Ksp-cadherin promoter is identical to a known HNF-3 site in the alpha 1-antitrypsin promoter. Of the three isoforms of HNF-3 (alpha , beta , and gamma ), HNF-3alpha is expressed in the kidney (33). In addition, HNF-3 belongs to the large family of fork head proteins that contain a conserved DNA-binding motif known as a winged helix (16). A kidney-specific fork head protein named HFH-3 (Freac-6) has recently been identified in renal tubular epithelial cells (21). However, the consensus sequence recognized by HFH-3 (DBDTRTTTRYDTD) differs somewhat from the -62 site. An E box (CANNTG) was located in the important region of the Ksp-cadherin promoter between -113 and -250, which could represent a binding site for bHLH proteins. bHLH proteins, such as MyoD and NeuroD, are important for tissue-specific gene expression in muscle, neurons, lymphocytes, and pancreas (19), although bHLH proteins that are involved in kidney-specific gene expression have not yet been identified. The presence of two potential AP-2 binding sites in the proximal Ksp-cadherin promoter may be significant, since this transcription factor has been implicated in epithelial-specific expression of E-cadherin (9). AP-2 is expressed primarily in epithelial and neural tissue and is induced in response to retinoic acid. Of the three isoforms of AP-2 (alpha , beta , and gamma ), AP-2beta is expressed in renal tubular epithelial cells and has been shown to be essential for normal tubular development (18).

Studies using EMSA demonstrated that nuclear extracts from mIMCD-3 cells contained proteins that bind specifically to the functionally important region of the Ksp-cadherin promoter. These proteins are candidates for transcription factors that regulate Ksp-cadherin gene expression in renal epithelial cells. Nuclear extracts from MMR1 cells, which do not endogenously express Ksp-cadherin, also contained proteins that bind specifically to the region of the promoter from -109 to -80. Moreover, the mobility of the retarded band was similar to mIMCD-3 cells, suggesting that it may have the same protein composition. However, only extracts from mIMCD-3 cells contained proteins that specifically bind to the region of the promoter from -79 to -50. Binding proteins that are present in mIMCD-3 cells but not in MMR1 cells may represent tissue-enriched transcriptional activators that are involved in kidney-specific expression of Ksp-cadherin. Mutational analysis further demonstrated that sequences within the -79 to -50 region were involved in protein binding and transcriptional activity. In particular, mutation 3 inhibited promoter activity by 80% and completely prevented protein binding. Other mutations in this region only partially inhibited protein binding, suggesting that they had affinities that were intermediate between mutation 3 and the wild-type sequence. Mutation 3 was located within the consensus HNF-3 site and CAAT box, further underscoring the potential importance of proteins that recognize these sequences for transcription of the Ksp-cadherin gene. Additional studies will be required to determine whether HNF-3 or other proteins bind to the proximal Ksp-cadherin promoter and mediate tissue-specific transcription.

In conclusion, the proximal 5' flanking sequence of the mouse Ksp-cadherin gene contains an orientation-dependent promoter that directs kidney epithelial cell-specific expression in vitro. The region of the promoter from -113 to -31 is required for transcriptional activity in transfected renal epithelial cells. The region from -79 to -50 contains binding sites for nuclear proteins that are specifically expressed in renal epithelial cells and that may be involved in kidney-specific gene expression.


    ACKNOWLEDGEMENTS

We thank Dr. Steven Gullans for providing mIMCD-3 cells. We thank Shuxian Liu-Chen for expert technical assistance, Ilyssa Okrent for performing preliminary experiments on this project, and Michele Pucci for secretarial assistance.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Research Grants R01-DK-42921 (to P. Igarashi), R29-DK-51045 (to R. B. Thomson), K08-DK-02287 (to S. L. Karp), and R01-DK-17433 (to P. S. Aronson). D. A. Whyte was supported by NIDDK Postdoctoral Training Grant T32-DK-07276 and a Postdoctoral Fellowship from the National Kidney Foundation and American Society of Nephrology. P. Igarashi is an Established Investigator of the American Heart Association.

Present address of D. A. Whyte: Dept. of Pediatrics, SUNY at Stony Brook School of Medicine, Stony Brook, NY 11794.

D. A. Whyte and C. Li contributed equally to this work.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence and present address of P. Igarashi: Division of Nephrology, UT Southwestern, 5323 Harry Hines Blvd., Dallas TX 75235-8856 (E-mail: peter.igarashi{at}emailswmed.edu).

Received 22 December 1998; accepted in final form 10 June 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Andrews, N. C., and D. V. Faller. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19: 2499, 1991[Free Full Text].

2.   Behrens, J., O. Löwrick, L. Klein-Hitpass, and W. Birchmeier. The E-cadherin promoter: functional analysis of a GC-rich region and an epithelial cell-specific palindromic regulatory element. Proc. Natl. Acad. Sci. USA 88: 11495-11499, 1991[Abstract/Free Full Text].

3.   Berndorff, D., R. Gessner, B. Kreft, N. Schnoy, A. M. Lajous-Petter, N. Loch, W. Reutter, M. Hortsch, and R. Tauber. Liver-intestine cadherin: molecular cloning and characterization of a novel Ca2+-dependent cell adhesion molecule expressed in liver and intestine. J. Cell Biol. 125: 1353-1369, 1994[Abstract/Free Full Text].

4.   Blaurock, M. C., N. A. Rebouças, J. L. Kusnezov, and P. Igarashi. Phylogenetically conserved sequences in the promoter of the rabbit sodium-hydrogen exchanger isoform 1 gene (NHE1/SLC9A1). Biochim. Biophys. Acta 1262: 159-163, 1995[Medline].

5.   de Simone, V., and R. Cortese. Transcription factors and liver-specific genes. Biochim. Biophys. Acta 1132: 119-126, 1992[Medline].

6.   Faraldo, M. L. M., and A. Cano. The 5' flanking sequence of the mouse P-cadherin gene: homologies to 5' sequences of the E-cadherin gene and identification of a first 215 base-pair intron. J. Mol. Biol. 231: 935-941, 1993[Medline].

7.   Furuno, M., S. Uchida, F. Marumo, and S. Sasaki. Repressive regulation of the aquaporin-2 gene. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F854-F860, 1996[Abstract/Free Full Text].

8.   Geiger, B., and O. Ayalon. Cadherins. Annu. Rev. Cell Biol. 8: 307-332, 1992.

9.   Hennig, G., O. Löwrick, W. Birchmeier, and J. Behrens. Mechanisms identified in the transcriptional control of epithelial gene expression. J. Biol. Chem. 271: 595-602, 1996[Abstract/Free Full Text].

10.   Hilfiker, H., C. M. Hartmann, G. Stange, and H. Murer. Characterization of the 5'-flanking region of OK cell type II Na-Pi cotransporter gene. Am. J. Physiol. 274 (Renal Physiol. 43): F197-F204, 1998[Abstract/Free Full Text].

10a.   Igarashi, P., C. S. Shashikant, R. B. Thomson, D. A. Whyte, S. Liu-Chen, F. H. Ruddle, and P. S. Aronson. Ksp-cadherin gene promoter. II. Kidney-specific activity in transgenic mice. Am. J. Physiol. 277 (Renal Physiol. 46): F599-F610, 1999[Abstract/Free Full Text].

11.   Igarashi, P., G. B. Vanden Heuvel, J. A. Payne, and B. Forbush, III. Cloning, embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl cotransporter. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): F405-F418, 1995[Abstract/Free Full Text].

12.   Igarashi, P., D. A. Whyte, K. Li, and G. T. Nagami. Cloning and kidney cell-specific activity of the promoter of the murine renal Na-K-Cl cotransporter gene. J. Biol. Chem. 271: 9666-9674, 1996[Abstract/Free Full Text].

13.   Javahery, R., A. Khachi, K. Lo, B. Zenzie-Gregory, and S. T. Smale. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol. Cell. Biol. 14: 116-127, 1994[Abstract/Free Full Text].

14.   Karp, S. L., A. Ortiz-Arduan, S. Li, and E. G. Neilson. Epithelial differentiation of metanephric mesenchymal cells after stimulation with hepatocyte growth factor or embryonic spinal cord. Proc. Natl. Acad. Sci. USA 91: 5286-5290, 1994[Abstract/Free Full Text].

15.   Karp, S. L., and K. Phipps. The novel zinc finger protein EEK3 is expressed in epithelial cells of the developing kidney (Abstract). J. Am. Soc. Nephrol. 9: 363, 1998[Abstract].

16.   Lai, E., K. L. Clark, S. K. Burley, and J. E. Darnell, Jr. Hepatocyte nuclear factor 3/fork head or "winged helix" proteins: a family of transcription factors of diverse biologic function. Proc. Natl. Acad. Sci. USA 90: 10421-10423, 1993[Abstract/Free Full Text].

17.   Mandon, B., A. C. Bellanger, and J. M. Elalouf. Inverse PCR-mediated cloning of the promoter for the rat vasopressin V2 receptor gene. Pflügers Arch. 430: 12-18, 1995[Medline].

18.   Moser, M., A. Pscherer, C. Roth, J. Becker, G. Mucher, K. Zerres, C. Dixkens, J. Weis, L. Guay-Woodford, R. Buettner, and R. Fassler. Enhanced apoptotic cell death of renal epithelial cells in mice lacking transcription factor AP-2beta . Genes Dev. 11: 1938-1948, 1997[Abstract/Free Full Text].

19.   Murre, C., and D. Baltimore. The helix-loop-helix motif: structure and function. In: Transcriptional Regulation, edited by S. L. McKnight, and K. R. Yamamoto. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1992, p. 861-879.

20.   Nelson, R. D., P. Stricklett, C. Gustafson, A. Stevens, D. Ausiello, D. Brown, and D. E. Kohan. Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice. Am. J. Physiol. 275 (Cell Physiol. 44): C216-C226, 1998[Abstract/Free Full Text].

21.   Overdier, D. G., H. Ye, R. S. Peterson, D. E. Clevidence, and R. H. Costa. The winged helix transcriptional activator HFH-3 is expressed in the distal tubules of embryonic and adult mouse kidney. J. Biol. Chem. 272: 13725-13730, 1997[Abstract/Free Full Text].

22.   Quaggin, S. E., G. B. Vanden Heuvel, K. Golden, R. Bodmer, and P. Igarashi. Primary structure, neural-specific expression, and chromosomal localization of Cux-2, a second murine homeobox gene related to Drosophila cut. J. Biol. Chem. 271: 22624-22634, 1996[Abstract/Free Full Text].

23.   Rai, T., S. Uchida, F. Marumo, and S. Sasaki. Cloning of rat and mouse aquaporin-2 gene promoters and identification of a negative cis-regulatory element. Am. J. Physiol. 273 (Renal Physiol. 42): F264-F273, 1997[Abstract/Free Full Text].

24.   Rauchman, M. I., S. K. Nigam, E. Delpire, and S. R. Gullans. An osmotically tolerant inner medullary collecting duct cell line derived from an SV40 transgenic mouse. Am. J. Physiol. 265 (Renal Fluid Electrolyte Physiol. 34): F416-F424, 1993[Abstract/Free Full Text].

25.   Sepulveda, S. R., S. L. Huang, R. M. Lebovitz, and M. W. Lieberman. A 346-base pair region of the mouse gamma -glutamyl transpeptidase type II promoter contains sufficient cis-acting elements for the kidney-restricted expression in transgenic mice. J. Biol. Chem. 272: 11959-11967, 1997[Abstract/Free Full Text].

26.   Takeichi, M. Cadherins: a molecular family important in selective cell-cell adhesion. Annu. Rev. Biochem. 59: 237-252, 1990[Medline].

27.   Thomson, R. B., P. Igarashi, D. Biemesderfer, R. Kim, A. Abu-Alfa, M. Soleimani, and P. S. Aronson. Isolation and cDNA cloning of Ksp-cadherin, a novel kidney-specific member of the cadherin multigene family. J. Biol. Chem. 270: 17594-17601, 1995[Abstract/Free Full Text].

28.   Thomson, R. B., D. C. Ward, S. E. Quaggin, P. Igarashi, Z. E. Muckler, and P. S. Aronson. cDNA cloning and chromosomal localization of the human and mouse isoforms of Ksp-cadherin. Genomics 51: 445-451, 1998[Medline].

29.   Uchida, S., Y. Matsumura, T. Rai, S. Sasaki, and F. Marumo. Regulation of aquaporin-2 gene transcription by GATA-3. Biochem. Biophys. Res. Commun. 232: 65-68, 1997[Medline].

30.   Uchida, S., T. Rai, H. Yatsushige, Y. Matsumura, M. Kawasaki, S. Sasaki, and F. Maruno. Isolation and characterization of kidney-specific ClC-K1 chloride channel gene promoter. Am. J. Physiol. 274 (Renal Physiol. 43): F602-F610, 1998[Abstract/Free Full Text].

31.   Uchida, S., S. Sasaki, K. Fushimi, and F. Marumo. Isolation of human aquaporin-CD gene. J. Biol. Chem. 269: 23451-23455, 1994[Abstract/Free Full Text].

32.   Whyte, D. A., R. B. Thomson, S. L. Nix, S. L. Karp, P. S. Aronson, and P. Igarashi. Cloning and characterization of the mouse Ksp-cadherin gene promoter (Abstract). J. Am. Soc. Nephrol. 9: 369, 1998.

33.   Xanthopoulos, K. G., V. R. Prezioso, W. S. Chen, F. M. Sladek, R. Cortese, and J. R. Darnell, Jr. The different tissue transcription patterns of genes for HNF-1, C/EBP, HNF-3, and HNF-4, protein factors that govern liver-specific transcription. Proc. Natl. Acad. Sci. USA 88: 3807-3811, 1991[Abstract/Free Full Text].


Am J Physiol Renal Physiol 277(4):F587-F598
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Sakai, K. Tamura, Y. Tsurumi, Y. Tanaka, Y. Koide, M. Matsuda, T. Ishigami, M. Yabana, Y. Tokita, Y. Hiroi, et al.
Expression of MAK-V/Hunk in renal distal tubules and its possible involvement in proliferative suppression
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1526 - F1536.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic
The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Bai, M. Pontoglio, T. Hiesberger, A. M. Sinclair, and P. Igarashi
Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta
Am J Physiol Renal Physiol, October 1, 2002; 283(4): F839 - F851.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
X. Shao, J. E. Johnson, J. A. Richardson, T. Hiesberger, and P. Igarashi
A Minimal Ksp-Cadherin Promoter Linked to a Green Fluorescent Protein Reporter Gene Exhibits Tissue-Specific Expression in the Developing Kidney and Genitourinary Tract
J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1824 - 1836.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
X. Shao, S. Somlo, and P. Igarashi
Epithelial-Specific Cre/lox Recombination in the Developing Kidney and Genitourinary Tract
J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1837 - 1846.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. Yoshida, J. Yoshino, M. Hayashi, and T. Saruta
Identification of a Renal Proximal Tubular Cell-Specific Enhancer in the Mouse 25-Hydroxyvitamin D 1{alpha}-Hydroxylase Gene
J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1455 - 1463.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Robert-Nicoud, M. Flahaut, J.-M. Elalouf, M. Nicod, M. Salinas, M. Bens, A. Doucet, P. Wincker, F. Artiguenave, J.-D. Horisberger, et al.
Transcriptome of a mouse kidney cortical collecting duct cell line: Effects of aldosterone and vasopressin
PNAS, February 15, 2001; (2001) 51603198.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Igarashi, C. S. Shashikant, R. B. Thomson, D. A. Whyte, S. Liu-Chen, F. H. Ruddle, and P. S. Aronson
Ksp-cadherin gene promoter. II. Kidney-specific activity in transgenic mice
Am J Physiol Renal Physiol, October 1, 1999; 277(4): F599 - F610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Taniyama, K. Sato, A. Sugawara, A. Uruno, Y. Ikeda, M. Kudo, S. Ito, and K. Takeuchi
Renal Tubule-specific Transcription and Chromosomal Localization of Rat Thiazide-sensitive Na-Cl Cotransporter Gene
J. Biol. Chem., July 6, 2001; 276(28): 26260 - 26268.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Robert-Nicoud, M. Flahaut, J.-M. Elalouf, M. Nicod, M. Salinas, M. Bens, A. Doucet, P. Wincker, F. Artiguenave, J.-D. Horisberger, et al.
Transcriptome of a mouse kidney cortical collecting duct cell line: Effects of aldosterone and vasopressin
PNAS, February 27, 2001; 98(5): 2712 - 2716.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whyte, D. A.
Right arrow Articles by Igarashi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whyte, D. A.
Right arrow Articles by Igarashi, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online