|
|
||||||||
Departments of 1 Internal
Medicine, 2 Cellular and Molecular
Physiology, and
4 Pediatricsa, Kidney-specific
cadherin (Ksp-cadherin, cadherin 16) is a tissue-specific member of the
cadherin superfamily that is expressed exclusively in the basolateral
membrane of tubular epithelial cells in the kidney. To determine the
basis for tissue-specific expression of Ksp-cadherin in vivo, we
evaluated the activity of the promoter in transgenic mice. Transgenic
mice containing 3.3 kb of the mouse Ksp-cadherin promoter and an
Escherichia coli lacZ reporter gene
were generated by pronuclear microinjection. Assays of
gene regulation; KIDNEY-SPECIFIC CADHERIN (Ksp-cadherin, cadherin 16) is
a novel, kidney-specific member of the cadherin family of
Ca2+-dependent cell adhesion
molecules (30, 31). Cadherins are integral plasma membrane proteins
that mediate homotypic cell-cell interactions and are involved in
morphogenetic processes such as cell compaction, epithelial
differentiation, and cell migration (12, 28). Ksp-cadherin is a
structurally distinct member of the cadherin family that lacks an
amino-terminal prosequence and contains a highly truncated cytoplasmic
domain (30, 31). Ksp-cadherin is further distinguished by its unique
tissue distribution. Studies in the rabbit, mouse, and human have shown
that Ksp-cadherin is exclusively expressed in the kidney (30, 31).
Within the kidney, Ksp-cadherin has been immunolocalized to the
basolateral membrane of renal tubular epithelial cells but is not
expressed in glomeruli, blood vessels, or renal interstitial cells
(30). In addition to tissue specificity, the expression of Ksp-cadherin
is developmentally regulated. Northern blot analysis of embryonic mouse
kidneys has shown that Ksp-cadherin is first detected at 14.5 days
postcoitus (pc), which is after the formation of the first S-shaped
bodies (Vanden Heuvel and Igarashi, unpublished observations).
Expression increases during late gestation and remains high in the
adult kidney. Immunolocalization studies in the developing human and rabbit kidney have shown that Ksp-cadherin is expressed in tubular epithelial cells of maturing nephrons but not in metanephric
mesenchyme, renal vesicles, comma-shaped bodies, or S-shaped bodies (9, 29). Likewise, in the developing renal collecting system, Ksp-cadherin is expressed in the maturing collecting ducts but not in the ampullae of the ureteric buds. Thus the expression of Ksp-cadherin in renal tubular epithelial cells is differentiation specific as well as tissue
specific. The abundant expression of Ksp-cadherin in mature renal
tubular epithelial cells suggests that it may have a role in
maintaining the differentiated state.
Although the function of Ksp-cadherin remains unclear, it has proven to
be a useful model of kidney-specific gene expression. In the companion
study (33), we report the cloning and characterization of the mouse
Ksp-cadherin gene promoter. The promoter is TATA-less but contains
other consensus eukaryotic promoter elements including an initiator, GC
boxes, and CAAT box. Several consensus binding sites for transcription
factors that mediate tissue-specific gene expression were identified,
including activator protein-2 (AP-2), hepatocyte nuclear factor-3
(HNF-3), CCAAT/enhancer-binding protein (C/EBP), basic helix-loop-helix
(bHLH) proteins, and GATA factors. Using reporter gene assays in
transfected cells, we showed that 2.6 kb of the proximal 5'
flanking region of the Ksp-cadherin gene contained a functional
promoter that was orientation specific. Moreover, the promoter was
highly active in renal epithelial cells (MDCK and mIMCD-3) but not in
mesenchymal cells (NIH 3T3 or MMR1), suggesting that the Ksp-cadherin
promoter was kidney epithelial cell specific in vitro. Studies using
electrophoretic mobility-shift assay (EMSA) showed that renal
epithelial cells contain nuclear proteins that bind specifically to the
proximal Ksp-cadherin promoter. As a rigorous proof of tissue
specificity, the present study utilized reporter gene assays in
transgenic mice to verify whether the activity of the Ksp-cadherin
promoter was kidney specific in vivo. We also examined the temporal
pattern of expression of the transgene to evaluate whether the promoter
could direct differentiation-specific expression in renal epithelial
cells. A preliminary account of this work has been published in
abstract form (16).
Materials. FVB/N mice were obtained
from Taconic (Germantown, NY). CD-1 mice and B6/CBA hybrid mice were
from Charles River Laboratories (Wilmington, MA) or The Jackson
Laboratory (Bar Harbor, ME). Restriction endonucleases and
DNA-modifying enzymes were from New England Biolabs (Beverly, MA) or
Boehringer-Mannheim (Indianapolis, IN). Galacto-Star chemiluminescent
substrate was obtained from Tropix (Bedford, MA). Plasmid and genomic
DNA preparation kits were from Qiagen (Valencia, CA).
Fluorescein-conjugated Dolichos biflorus agglutinin (DBA) was from Vector Laboratories
(Burlingame, CA). Other reagents were of molecular biological grade
from Sigma (St. Louis, MO), Promega (Madison, WI), Boehringer-Mannheim,
or US Biochemicals (Cleveland, OH). Oligonucleotides were synthesized by the Yale Pathology Department Program in Critical Technologies and
were purified by PAGE or OPC columns (Perkin-Elmer, Norwalk, CT).
Construction of the reporter plasmid.
The Generation of transgenic mice.
Transgenic mice were generated by pronuclear microinjection as
described previously (13). All experiments involving mice were
performed in accordance with the National Institutes of Health (NIH)
"Guide for the Care and Use of Laboratory Animals" [DHHS
Publication No. (NIH) 85-23, Revised 1985, Office of
Science and Health Reports, Bethesda, MD 20892] and under the
auspices of the Yale Animal Care and Use Committee. Briefly, 15-20
female donor mice (strain FVB/N) were superovulated with pregnant
mare's serum (10 U/30 g ip) 3 days prior to the experiment and human
chorionic gonadotropin (hCG, 10 U ip) 1 day prior to the experiment.
Donor females were mated with stud males (strain FVB/N) ~18 h prior
to the experiment. At the same time, 30-40 female mice (B6/CBA
hybrids or CD-1) were randomly mated with vasectomized CD-1 males to
obtain at least 3-6 pseudopregnant foster mothers. Donor females
with copulatory plugs were euthanized by cervical dislocation and
ovariectomized, and the fertilized single-cell embryos were harvested
from the ampullae. Embryos were incubated with hyaluronidase to remove the cumulus cells, washed, then transferred to M16 culture medium. Three to seven hours after harvesting, the embryos were transferred to
a drop of M2 culture medium overlaid with oil. A holding pipette was
used to position the embryo while a glass injection needle was inserted
into the male pronucleus. Injection of purified DNA (200-500
copies) was verified by visible swelling of the pronucleus. Embryos
that survived microinjection were transferred into the oviduct of a
pseudopregnant foster mother. Transgenic progeny were identified by
Southern blot hybridization of genomic DNA extracted from tail biopsies
or yolk sacs using a probe derived from the E. coli lacZ gene. To estimate copy number, Southern blots
were rehybridized with a probe derived from the Ksp-cadherin promoter
that recognizes both the transgene and the endogenous Ksp-cadherin gene.
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase enzyme activity showed that the transgene was
expressed exclusively in the kidney in both adult and developing mice.
Within the kidney, the transgene was expressed in a subset of renal
tubular epithelial cells that endogenously expressed Ksp-cadherin and
that were identified as collecting ducts by colabeling with
Dolichos biflorus agglutinin. In the
developing metanephros, expression of the transgene in the branching
ureteric bud correlated with the developmental expression of
Ksp-cadherin. Identical patterns of expression were observed in
multiple founder mice, indicating that kidney specificity was
independent of transgene integration site. However, heterocellular
expression was observed consistent with repeat-induced gene silencing.
We conclude that the Ksp-cadherin gene promoter directs kidney-specific
expression in vivo. Regulatory elements that are sufficient to
recapitulate the tissue- and differentiation-specific expression of
Ksp-cadherin in the renal collecting duct are located within 3.3 kb
upstream to the transcriptional start site.
-galactosidase; pronuclear microinjection; collecting duct; kidney development; epithelial cell
differentiation
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase reporter plasmid used in this study was derived
from pnLacF (19), which was a generous gift from Dr. Josephine Briggs
(National Institute of Diabetes and Digestive and Kidney Diseases).
pnLacF encodes Escherichia coli
-galactosidase containing a nuclear localization signal from simian
virus 40 (Pro-Lys-Lys-Lys-Arg-Lys-Val) fused to the amino terminus. A
PCR product containing the sequence of the mouse Ksp-cadherin promoter
from nucleotides
3458 to +129 (numbered with respect to the
transcription initiation site) was amplified from the mouse genomic
clone mKspgen7 (see companion study, Ref. 33) using primers containing
Sal I restriction sites (ACGCGTCGACCTGAAGATTCTATTGCCTCTCCACAC and
ACGCGTCGACTCTCCCTTGGTCCAGTTTCCAG). PCR was performed
using the Boehringer-Mannheim Expand High Fidelity PCR System. The
50-µl reaction mixture contained 68 ng of DNA template, 1×
Expand HF buffer, 200 µM of each dNTP, and 300 nM of each primer.
Samples were heated to 95°C for 2 min and maintained at 72°C
prior to addition of 0.75 µl of a mixture of
Taq and
Pwo DNA polymerases. Thirty cycles of
amplification were performed, each consisting of incubation at 95°C
for 50 s, 60°C for 2.5 min, and 72°C for 2.5 min. The 3.6-kb
PCR product was digested with Sal I
and cloned in the sense orientation into the unique
Sal I site of pnLacF to generate the
plasmid pKsp-nlacZ. Plasmids were transformed into XL-2 Blue competent
cells and purified using alkaline lysis maxipreps and anion-exchange
chromatography (Qiagen EndoFree plasmid kits). The sequence of the
insert was verified by automated DNA sequencing, which was performed by
the W. H. Keck Foundation Biotechnology Resource Laboratory at Yale
University. pKsp-nlacZ was digested with
Pst I and
Sca I, and a 6.9-kb restriction fragment (containing 3,350 bp of the Ksp-cadherin 5' flanking region, the E. coli lacZ reporter
gene, and a mouse protamine-1 intron and polyadenylation signal) was
purified from vector-derived fragments by centrifugation through
10-40% sucrose density gradients. Fractions containing the 6.9-kb
fragment were collected, dialyzed exhaustively against microinjection
buffer [10 mM Tris-Cl (pH 7.4), 0.25 mM EDTA], and
concentrated to 4 µg/ml using Microcon-30 filters (Millipore,
Bedford, MA). DNA solutions were filtered through 0.2 µm filters
(Vangard, Neptune, NJ) prior to microinjection.
-Galactosidase assays.
Assays of
-galactosidase activity in tissue homogenates were
performed using a chemiluminescent assay as described by Shaper et al.
(27). Fresh tissues (100 mg) were dissected from transgenic and
nontransgenic mice and were homogenized in 1 ml of lysis buffer containing 100 mM potassium phosphate (pH 7.8), 0.2% Nonidet
P-40, 1 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl
fluoride (PMSF), and 5 µg/ml leupeptin. Homogenization was performed
for 20 s on ice using a VirTis homogenizer (Gardiner, NY). After
centrifugation at 12,500 g for 10 min,
the supernatants were heated at 48°C for 50 min to inactivate
endogenous mammalian
-galactosidase-like activity (34). Twenty
microliters of heat-inactivated lysate was incubated for 60 min with
300 µl of reaction buffer containing Galacto-Star (Tropix), 100 mM
sodium phosphate (pH 7.5), 1 mM MgCl2, and 5% Sapphire-II
(Tropix). Light output was integrated over 5 s at room temperature
using an Optocomp I photon counting luminometer (MGM Instruments,
Hamden, CT).
-Galactosidase activity was normalized to protein
concentration, which was determined using the Coomassie Plus Protein
Assay Reagent (Pierce, Rockford, IL) with BSA as the standard.
-galactosidase activity in situ were performed by staining
with 5-bromo-4-chloro-3-indoyl
-D-galactoside (X-Gal). Whole
mount staining with X-Gal was performed as described previously (2).
Embryos (up to 16.5 days pc) or isolated metanephroi were dissected and
washed in ice-cold PBS (150 mM NaCl, 15 mM sodium phosphate, pH 7.3).
To ensure adequate exposure to the substrate, the metanephroi were
bisected, and the peritoneal cavities of late-gestation embryos were
opened and the overlying livers were removed. Samples were fixed by
immersion in PBS containing 0.25% glutaraldehyde for 30 min on ice,
then washed three times with PBS. Samples were then incubated overnight
in staining solution [PBS containing 20 mM Tris-Cl (pH 7.3), 1.8 mM spermidine, 2 mM MgCl2, 0.02%
Nonidet P-40, 0.01% sodium deoxycholate, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, and 1 mg/ml X-Gal]. Staining with X-Gal was performed at 37°C in the dark with
continuous agitation. Stained specimens were rinsed with PBS, then
photographed under incident light with a Wild M420
macroscope (Leica, Deerfield, IL) and Kodak 160T film.
-galactosidase activity were performed in triplicate, and activity
is expressed as light output (arbitrary units) per milligram protein.
Mean data of independent experiments using different tissue
preparations are reported. Error bars represent SE of the mean.
Statistical analysis was performed using paired
t-tests. Statistical significance was
defined as P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Generation of transgenic mice. To
measure the activity of the Ksp-cadherin promoter in vivo, a transgene
containing the promoter and a
-galactosidase reporter gene was
created and expressed in mice. The Ksp-cadherin/nlacZ transgene (Fig.
1) contained 3,350 bp of the proximal
5' flanking region of the mouse Ksp-cadherin gene and a portion
of the first (noncoding) exon cloned upstream to an E. coli lacZ reporter gene in the plasmid pnLacF (19). Since pnLacF does not contain its own promoter, the expression of the
reporter gene is dependent on the promoter and regulatory elements
contained in the Ksp-cadherin sequence. The
-galactosidase gene in
pnLacF contains a nuclear localization signal from simian virus 40 that
permits the enzyme produced by the reporter gene (nuclear) to be
unequivocally distinguished from endogenous
-galactosidase-like activity (cytoplasmic) (5). pnLacF also contains an intron and
polyadenylation signal from the mouse protamine-1 gene to enhance
transgene expression (6).
|
A 6.9-kb Pst I restriction fragment
containing the Ksp-cadherin/nlacZ construct was isolated from vector
sequences and microinjected into the pronuclei of fertilized one-cell
embryos to generate transgenic mice. Transgenic progeny were identified
by Southern blot analysis of genomic DNA isolated from tail biopsies or
yolk sacs. Transgenic mice were then examined for expression of
-galactosidase using a chemiluminescent assay or by whole mount
staining with X-Gal. The initial analysis was performed on
F0 founders in which each animal
represents a unique transgene integration site and copy number. Of 28 independent embryos examined, 6 exhibited
-galactosidase activity
exclusively in the kidney with a pattern that will be described below.
To permit examination of genetically identical mice at different
developmental stages, an additional set of founders was produced and
bred to generate permanent lines. Two of the permanent lines
(lines 8 and
26) were selected for detailed
study. Genomic DNA from the two lines was digested with
Xba I, which cuts once within the
transgene, and hybridized with a probe derived from the lacZ gene. A
7-kb band was observed in both lines consistent with tandem integration
in a head-to-tail orientation, which confirmed the absence of gross
rearrangements of the transgene (data not shown). The
number of integrated copies of the transgene was estimated as 3 copies
in line 8 and 10 copies in
line 26. With a few exceptions (noted
below), the patterns of expression of the transgene were identical in
the different founder animals and two permanent lines.
Expression of the transgene in the adult and
developing mouse. To determine whether the expression
of the Ksp-cadherin/nlacZ transgene was kidney specific,
-galactosidase activity was measured in tissue homogenates using a
sensitive chemiluminescent assay. Since mammalian tissues contain
endogenous
-galactosidase-like activity, lysates were pretreated by
heating at 48°C, which inactivates the mammalian enzyme but does
not affect bacterial
-galactosidase (34). Figure
2 shows the expression of
-galactosidase
in various tissues obtained from adult transgenic mice (hatched bars)
and their nontransgenic littermates (gray-shaded bars). Low activity was observed in most tissues, and there were no differences between transgenic and nontransgenic mice (P > 0.05). However, in the kidney there was a significant increase in
-galactosidase activity in transgenic mice compared with their
nontransgenic littermates (P < 0.025). The results shown are for line
8; results in line 26 were similar (not shown). These results suggested that the expression
of the transgene was kidney specific. However, since not all tissues
could be tested in this manner, we examined the expression of the
transgene in developing mouse embryos. Preliminary studies using whole
mount staining of embryos suggested that the transgene was only
expressed in the developing kidney (not shown). To examine this issue
more completely, we prepared sections of entire mouse embryos and
stained them with X-Gal. With this reagent, the appearance of insoluble
blue reaction product indicates sites of
-galactosidase activity.
Figure 3 shows sagittal sections of a mouse
embryo at 15.5 days pc, a stage at which Ksp-cadherin is endogenously
expressed in the metanephros. Figure 3,
A and C, shows dark-field illumination of
the head (A) and trunk
(C) regions to provide orientation.
Figure 3, B and
D, shows bright-field illumination
following staining with X-Gal. Note that the blue reaction product was
only present in the developing kidney (metanephros), indicated by the
arrows in Fig. 3,
C-F.
Higher magnification images (Fig. 3, E
and F), showed expression in the
developing kidney but no expression in surrounding tissues including
the liver, stomach, adrenal gland, pancreas, spinal cord, and
mesonephros. The
-galactosidase reaction product could be
distinguished from osseous calcification (arrowheads, Fig. 3,
B, D,
and F), which appeared
gray on bright-field illumination and white on dark-field illumination.
No expression of the transgene was observed at earlier stages of
development (10.5 days pc or 11.5 days pc, data not shown). Taken
together, these results demonstrated that the expression of the
transgene was kidney specific in both the developing and adult mouse.
These results also verified that kidney-specific expression of
Ksp-cadherin was due, at least in part, to tissue-specific gene
transcription.
|
|
Expression of the transgene in the developing
metanephros. Figure 4 shows
the expression of the Ksp-cadherin/nlacZ transgene in the developing
metanephros at 15.5 days pc. To verify that the transgene was
appropriately expressed in cells that endogenously produced
Ksp-cadherin, colocalization studies were performed. Serial sections of
the metanephros were prepared, and Fig. 4, A and
B, shows adjacent sections stained
with X-Gal (Fig. 4B) and an antibody
to Ksp-cadherin (Fig. 4A). Figure
4A shows that the expression of
Ksp-cadherin in the mouse metanephros was identical to the pattern
observed in the human and rabbit (9, 29). Antibody labeling was
restricted to tubular epithelial cells, and no expression of
Ksp-cadherin was observed in glomeruli or in nonepithelial cells. The
developing metanephros exhibits a centripetal gradient of nephron
maturation in which the subcapsular nephrogenic zone contains uninduced
mesenchyme, pretubular condensates, ampullae of the ureteric buds, and
immature nephrons (renal vesicles, comma-shaped bodies, S-shaped
bodies). Progressively more mature nephrons and segments of the
collecting duct are located toward the medullary region in the center
of the metanephros. Figure 4A shows
that Ksp-cadherin was only expressed in maturing tubular epithelial
cells located in the central region of the developing metanephros but
was not significantly expressed in the subcapsular nephrogenic zone.
Thus, in the developing mouse metanephros, as in the rabbit and human
(9, 29), the expression of Ksp-cadherin was differentiation specific.
|
The arrows in Fig. 4, A and
B, indicate that the
Ksp-cadherin/nlacZ transgene was highly expressed in a subset of
tubular epithelial cells that endogenously expressed Ksp-cadherin
protein. No
-galactosidase-positive tubules were Ksp-cadherin
negative, and there was no expression of the transgene in mesenchymal
cells, which do not express Ksp-cadherin. The nuclear localization of the blue reaction product demonstrated that the
-galactosidase activity originated from the transgene and was not due to endogenous lysosomal
-galactosidase-like activity. However, the arrowhead in
Fig. 4A indicates that
not all Ksp-cadherin-positive tubules expressed the transgene. On the
basis of their location and characteristic branching, the tubules
expressing the transgene were identified as branches of the ureteric
bud. Figure 4, C and
D, shows that the expression of the
transgene in the branching ureteric bud was developmentally regulated.
Abundant
-galactosidase activity was present in nuclei of the more
mature branches of the ureteric bud located in the center of the
metanephros (arrows). There was considerably less expression in the
ampullae of the ureteric buds (arrowheads), which comprise relatively
undifferentiated epithelial cells. The arrowhead in the
top left corners of Fig. 4,
C and D, indicates a ureteric bud that was
sectioned longitudinally in which the proximal region (toward the
right) exhibited positive staining
with X-Gal. However, staining was reduced toward the renal capsule, and
the ampulla adjacent to the renal vesicle was stained minimally. Taken
together, these results demonstrated that the expression of the
transgene was differentiation specific and recapitulated the expression
of endogenous Ksp-cadherin in the developing collecting system.
Expression of the transgene in the neonatal
kidney. Next, we examined the expression of the
Ksp-cadherin/nlacZ transgene at 3 days postpartum (pp), a stage at
which nephrogenesis is still ongoing in the mouse. Figure
5,
A and
B, shows results of whole mount
staining of the metanephroi from two founder animals at 3 days pp.
Figure 5A shows a kidney from a
transgenic animal in which the blue reaction product was present
primarily in the medullary region (arrow). Figure
5B shows a kidney from a nontransgenic littermate, which was negative. Figure 5,
C and
D, shows staining of adjacent sections
of the medullary region with X-Gal (Fig. 5D) and a Ksp-cadherin antibody
(Fig. 5C). As indicated by the arrowheads in Fig. 5, C and
D,
-galactosidase was
present in the nuclei of collecting ducts that communicated with the
renal pelvis. Note that Ksp-cadherin was uniformly expressed in the collecting duct but that the expression of the transgene varied widely
between adjacent cells within the collecting duct (heterocellular expression). At this developmental stage, Ksp-cadherin and the transgene were also expressed in papillary surface epithelium (arrows
in Fig. 5, C and
D) and the ureter (not
shown). To verify that the transgene was expressed in collecting ducts,
we performed colocalization with DBA, a lectin that specifically labels
collecting ducts and ureteric buds. A method was developed for staining
the same section with both X-Gal and either DBA or an antibody to Ksp-cadherin. This method involved tissue fixation with 2%
paraformaldehyde, staining first with X-Gal and then with antibody or
lectin, postfixation after staining with DBA, and use of aqueous
mounting medium to minimize diffusion of the X-Gal reaction product.
Preliminary studies verified that these procedures did not affect the
pattern or intensity of X-Gal staining (not shown). Figure 5,
E and
F, shows a transverse section of the
renal medulla stained with both fluorescein-conjugated DBA (Fig.
5E) and X-Gal (Fig.
5F). As indicated by the arrows, all
of the blue-stained nuclei were located within DBA-positive collecting
ducts. Again, expression was heterocellular, since some collecting duct
cells did not highly express the transgene. Figure 5,
G and
H, shows the cortical region of the
neonatal mouse kidney; the arrows indicate that the expression of
-galactosidase in a branching collecting duct coincided with
expression of Ksp-cadherin. Expression of both
-galactosidase and
Ksp-cadherin ceased as the tubule entered the subcapsular nephrogenic
zone. Figure 5, G and H, also illustrates
that the renal cortex contained many other tubular epithelial cells
that endogenously expressed Ksp-cadherin but did not express the
transgene.
|
Expression of the transgene in the adult
kidney. Next, we examined the expression of the
Ksp-cadherin/nlacZ transgene in the adult kidney. Figure
6,
A and
B, shows results of whole mount staining of adult kidneys with X-Gal. The transgenic kidney (Fig. 6A) exhibited blue staining in a
collecting duct pattern, whereas staining was absent in the kidney of a
nontransgenic littermate (Fig. 6B).
Figure 6, C and
D, shows a section of the inner
medulla stained with both X-Gal (Fig.
6D) and a Ksp-cadherin antibody (Fig. 6C); the arrows indicate that
the transgene was expressed in the nuclei of inner medullary collecting
duct cells that endogenously expressed Ksp-cadherin. Figure 6,
E and
F, shows the corticomedullary region
stained with X-Gal (Fig. 6F) and DBA
(Fig. 6E); as indicated by the
arrows, the transgene was expressed exclusively in DBA-positive collecting ducts. Figure 6, G and
H, shows the outer cortex stained with
a Ksp-cadherin antibody (Fig. 6G)
and X-Gal (Fig. 6H); the transgene
was expressed in collecting ducts (arrows) that endogenously expressed
Ksp-cadherin. However, there was no expression of the transgene in
other tubular epithelial cells that also expressed Ksp-cadherin. The
nonexpressing tubules were identified as proximal tubules, on the basis
of their characteristic brush border, or as thick ascending limbs of
loops of Henle, on the basis of their straight conformation, single
cell type, absence of a brush border, and abundant expression of
Ksp-cadherin. Neither Ksp-cadherin nor
-galactosidase was expressed
in glomeruli.
|
The patterns of transgene expression described above were observed in six different founder animals and two independent permanent lines. The patterns of expression were identical in each of these animals with the exception of one of the founders, which exhibited a partial phenotype consisting of expression restricted to the renal papilla, and one of the permanent lines (line 8), which exhibited occasional expression in proximal tubules and thick ascending limbs of loops of Henle (not shown). No expression of the transgene was ever observed in cells that did not endogenously express Ksp-cadherin protein.
| |
DISCUSSION |
|---|
|
|
|---|
Studies of kidney-specific and developmentally regulated gene
expression in the kidney may provide insights into transcriptional regulation of renal cell differentiation. In the liver, tissue-specific expression of genes such as albumin and
1-antitrypsin is mediated by
liver-restricted transcription factors that bind to cognate sites in
target genes and stimulate transcription. As an initial step toward
understanding the mechanisms of tissue-specific gene expression in the
kidney, we have attempted to identify the regions in kidney-specific
genes that confer kidney specificity and that may contain binding sites
for regulatory proteins. In the companion article (33), we report
studies of the promoter of a kidney-specific cadherin (Ksp-cadherin)
that is expressed exclusively in renal tubular epithelial cells. The
Ksp-cadherin promoter was capable of directing high-level expression of
a heterologous reporter gene in renal epithelial cells but not in
mesenchymal cells, suggesting that the activity of the promoter was
renal epithelial cell specific. As rigorous proof of tissue
specificity, we have now performed reporter gene assays in transgenic
mice. These studies demonstrate that the activity of the proximal
Ksp-cadherin promoter is also kidney specific in vivo, verifying the in
vitro results.
Within the kidney, the cloned 3.3-kb Ksp-cadherin promoter is active in
renal tubular epithelial cells but not in glomeruli, blood vessels, or
interstitial cells, which is identical to the expression of the
endogenous Ksp-cadherin protein. Colocalization of
-galactosidase
activity and Ksp-cadherin protein showed that the cloned promoter is
only active in cells that endogenously express Ksp-cadherin. These
cells were identified as collecting ducts by colocalization of DBA.
Taken together, these results demonstrate that regulatory elements that
are sufficient for expression of Ksp-cadherin in the renal collecting
duct are located within 3.3 kb upstream to the transcription initiation
site. Deletion analysis of the Ksp-cadherin promoter in cultured cells
has identified an 82-bp region that is critical for promoter activity
in mIMCD-3 cells, which are derived from the renal collecting duct.
Further studies will be required to determine whether this region is
also sufficient for kidney-specific expression in vivo and to define the specific sequences that are responsible for tissue specificity. These sequences would represent candidate enhancers for binding to
transcription factors that mediate kidney-specific gene expression. The
transgene containing 3.3 kb of 5' flanking region was not significantly expressed in proximal tubules and loops of Henle, which
also express abundant Ksp-cadherin protein. This result suggests that
regulatory elements required for high-level expression in these
segments of the nephron are located elsewhere in the gene locus,
although we cannot exclude the possibility that the transgene directs
low levels of expression that are below the limits of detection of the assay.
In addition to tissue specificity, the expression of Ksp-cadherin is developmentally regulated. Studies in the developing kidney suggest that Ksp-cadherin is a marker for terminal differentiation of renal tubular epithelial cells. Ksp-cadherin is not expressed in the subcapsular nephrogenic zone, which contains renal vesicles and S-shaped bodies, but is expressed in more mature nephrons that are located toward the medulla. In the collecting system, Ksp-cadherin is expressed in the mature portions of the collecting duct toward the renal papilla but is not expressed in the immature ampullae of the ureteric buds. The expression of the transgene in the renal collecting duct recapitulates the differentiation-specific expression of Ksp-cadherin in the developing kidney. Thus regulatory elements that are sufficient for differentiation-specific expression of Ksp-cadherin must also be located in the cloned 3.3 kb of 5' flanking region. Further study will be required to determine whether these elements are identical to, or distinct from, the regulatory elements that mediate tissue specificity.
In addition to studies of kidney-specific gene regulation, the cloned Ksp-cadherin promoter may be a useful reagent for directing the expression of heterologous genes in transgenic mice. An example of this type of experiment has recently been reported by Nelson et al. (22) in which the 5' flanking region of the aquaporin-2 (AQP2) gene was used to drive Cre recombinase in the kidney and male reproductive system. By mating Cre transgenic mice with mice containing loxP sites incorporated by homologous recombination, tissue-specific gene knockouts may be achieved. In addition to this type of experiment, the Ksp-cadherin promoter may be useful for creating kidney-specific and differentiation-specific gain-of-function mutations of particular genes of interest.
In addition to Ksp-cadherin, only a few kidney-specific gene promoters
have been shown to direct appropriate expression in transgenic mice.
Among the kidney-specific promoters that have been validated in vivo
are erythropoietin,
-glutamyl transpeptidase (GGT), kidney
androgen-regulated protein (KAP), vacuolar
H+-ATPase (V-ATPase) B1 subunit,
and AQP2. The erythropoietin gene is expressed in the liver during
fetal life, but the kidney is the primary site of expression in
response to hypoxia/anemia in the adult. Studies using transgenic mice
have revealed that distinct 5' and 3' flanking sequences
mediate hypoxia-inducible expression in the kidney and liver (17, 25).
GGT, an important enzyme in glutathione metabolism, is expressed in
many epithelial cells including the renal proximal tubule. Six distinct
GGT transcripts are produced from a single-copy gene through use of
alternative promoters, of which the type II promoter is kidney
specific. Recently, a reporter gene containing 346 bp of the type II
promoter has been shown to be expressed exclusively in renal proximal
tubules in transgenic mice (26). Another promoter that is expressed in
the renal proximal tubule is the KAP promoter. KAP is an abundant protein of unknown function that is normally expressed in proximal convoluted tubules in males but not in females. Ding et al. (7) recently produced transgenic mice in which the expression of the human
angiotensinogen gene was controlled by 1,542 bp of the KAP promoter.
Angiotensinogen expression was restricted to renal proximal tubules and
could be induced in females by treatment with testosterone, indicating
that the KAP promoter contained elements that were sufficient for both
tissue specificity and androgen responsiveness.
Two other kidney-specific promoters have been shown to direct expression in collecting ducts. The B1 isoform of the 56-kDa subunit of the V-ATPase is expressed exclusively in intercalated cells in the distal nephron and collecting duct (20). In a preliminary study, a reporter gene containing 3.5 kb of the 5' flanking region of the human V-ATPase B1 subunit gene was expressed in renal intercalated cells in transgenic mice (21). AQP2 is expressed in principal cells in the renal collecting duct, and there are some sequence similarities between the Ksp-cadherin promoter and the AQP2 promoter (see companion study, Ref. 33). Nelson et al. (22) have shown that 14 kb of the human AQP2 promoter confers expression in the renal collecting ducts of transgenic mice. Unexpectedly, the AQP2 promoter was also active in seminiferous tubules in the testis and epithelial cells of the vas deferens, which were not previously known to be sites of endogenous AQP2 expression. However, follow-up studies confirmed that AQP2 protein was present in the apical membrane of the vas deferens, indicating that the transgene expression pattern was authentic (22). In contrast to AQP2, no activity of the Ksp-cadherin promoter was detected in the male reproductive system. In addition to the above kidney-specific promoters, several other promoters of genes that are not necessarily kidney specific have been shown to direct expression in specific nephron segments in transgenic mice. These promoters include dopamine- and cAMP-regulated phosphoprotein (DARPP-32) and prepro-epidermal growth factor (preproEGF), which direct expression in the loop of Henle (4, 24), and phosphoenolpyruvate carboxykinase (PEPCK) and plasminogen activator inhibitor type 1 (PAI-1), which direct expression in the proximal tubule (1, 10, 23).
Kidney-specific activity of the Ksp-cadherin promoter was observed in multiple founder animals, indicating that tissue specificity was not dependent on the integration site of the transgene (position effects). However, a heterocellular pattern was observed in which the expression of the transgene varied widely between adjacent cells within the collecting duct. Heterocellular expression, also known as cellular mosaicism or variegation, is unlikely to be due to differences in cell type since the phenomenon was observed in the terminal inner medullary collecting duct, which comprises a single cell type (32). Although the magnitude varied between different lines, heterocellular expression was observed in all of the founder animals, which excluded inadvertent integration into the X chromosome (and lyonization) or integration of the transgene after the first cell division as causes of cellular mosaicism. Heterocellular expression has frequently been observed in the tissues of transgenic mice, including the kidney (4, 22), and may be particularly evident when the assay for expression of the transgene can discriminate between individual cells (14, 18). In the present study, the use of a reporter gene product targeted to the nucleus permitted expression in neighboring cells to be readily detected.
Heterocellular expression resembles the phenomenon of position-effect
variegation (PEV), in which an active gene is integrated near inactive
heterochromatin, and propagation of the heterochromatin state along the
chromosome then leads to gene inactivation. Cell-to-cell variation in
the extent of heterochromatin spread produces a heterocellular pattern
of gene inactivation. Recent studies in
Drosophila have shown that tandem
arrays of transgenes can themselves induce the local formation of
heterochromatin (8). Heterochromatization causes inactivation of genes
within the array, and the magnitude of inactivation increases with
higher copy number. A similar phenomenon called repeat-induced gene
silencing (RIGS) occurs in mammals, and Garrick et al. (11) have found
that reducing the copy number of a transgene without altering the
integration site results in decreased chromatin compaction, decreased
methylation, and increased expression. In our study, mice from
line 8 had a lower copy number than
line 26 but exhibited higher levels of
-galactosidase expression, consistent with RIGS as a cause of
heterocellular expression.
In conclusion, the proximal 5' flanking region of the mouse Ksp-cadherin gene contains a functional promoter and regulatory elements that are sufficient to direct kidney-specific expression in vivo. The 3.3-kb fragment contains regulatory elements that recapitulate the expression of Ksp-cadherin in the ureteric bud of the developing metanephros and the collecting ducts of the adult kidney. Elements that are required for high levels of expression in the proximal tubule, loop of Henle, and distal tubule appear to be located elsewhere in the gene locus. Kidney-specific expression of the transgene is not dependent on the site of integration. However, the transgene exhibits cellular mosaicism consistent with RIGS.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to the Yale Renal Morphology Core, which is codirected by Drs. Dan Biemesderfer and Michael Caplan, and especially to Sue Ann Mentone for preparing the tissue sections and performing the immunofluorescence studies. We thank Kui Li for expert technical assistance and Michele Pucci for expert secretarial assistance. We thank Dr. Josephine Briggs [(NIDDK) National Institute of Diabetes and Digestive and Kidney Diseases] for providing the pnlacF plasmid and Drs. Raoul Nelson and Cecilia Lo for helpful discussions.
| |
FOOTNOTES |
|---|
This work was supported by National Institutes of Health Research Grants R01-DK-42921 (to P. Igarashi), R29-DK-51045 (to R. B. Thomson), R01-GM-09966 (to F. H. Ruddle), and R01-DK-17433 (to P. S. Aronson). D. A. Whyte was supported by NIDDK Postdoctoral Training Grant T32-DK-07276 and by a Postdoctoral Fellowship from the National Kidney Foundation and American Society of Nephrology. P. Igarashi is an Established Investigator of the American Heart Association.
Present addresses: C. S. Shashikant, Dept. of Dairy and Animal Science, College of Agricultural Sciences, Pennsylvania State Univ., University Park, PA 16802; and D. A. Whyte, Dept. of Pediatrics, SUNY at Stony Brook School of Medicine, Stony Brook, NY 11794.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence and present address of P. Igarashi: Division of Nephrology, UT Southwestern, 5323 Harry Hines Blvd., Dallas TX 75235-2754. (E-mail: peter.igarashi{at}emailswmed.edu).
Received 22 December 1998; accepted in final form 10 June 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Beale, E. G.,
D. E. Clouthier,
and
R. E. Hammer.
Cell-specific expression of cytosolic phosphoenolpyruvate carboxykinase in transgenic mice.
FASEB J.
6:
3330-3337,
1992[Abstract].
2.
Bieberich, C. J.,
M. F. Utset,
A. Awgulewitsch,
and
F. H. Ruddle.
Evidence of positive and negative regulation of the Hox-3.1 gene.
Proc. Natl. Acad. Sci. USA
87:
8462-8466,
1990
3.
Biemesderfer, D.,
J. Pizzonia,
A. Abu-Alfa,
M. Exner,
R. Reilly,
P. Igarashi,
and
P. S. Aronson.
NHE3: a Na+/H+ exchanger of the renal brush border.
Am. J. Physiol.
265 (Renal Fluid Electrolyte Physiol. 34):
F736-F742,
1993
4.
Blau, S.,
L. Daly,
A. Fienberg,
G. Teitelman,
and
M. E. Ehrlich.
DARPP-32 promoter directs transgene expression to renal thick ascending limb of loop of Henle.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F564-F570,
1995
5.
Bonnerot, C.,
D. Rocancourt,
P. Briand,
G. Grimber,
and
J. F. Nicolas.
A
-galactosidase hybrid protein targeted to nuclei as a marker for developmental studies.
Proc. Natl. Acad. Sci. USA
84:
6795-6799,
1987
6.
Brinster, R. L.,
J. M. Allen,
R. R. Behringer,
R. E. Gelinas,
and
R. D. Palmiter.
Introns increase transcriptional efficiency in transgenic mice.
Proc. Natl. Acad. Sci. USA
85:
836-840,
1988
7.
Ding, Y.,
R. L. Davisson,
D. O. Hardy,
L. J. Zhu,
D. C. Merrill,
J. F. Catterall,
and
C. D. Sigmund.
The kidney androgen-regulated protein promoter confers renal proximal tubule cell-specific and highly androgen-responsive expression on the human angiotensinogen gene in transgenic mice.
J. Biol. Chem.
272:
28142-28148,
1997
8.
Dorer, D. R.,
and
S. Henikoff.
Expansions of transgene repeats cause heterochromatin formation and gene silencing in Drosophila.
Cell
77:
993-1002,
1994[Medline].
9.
Earle, K. E.,
R. C. Kim,
C. L. Yang,
R. B. Thomson,
and
P. S. Aronson.
Developmental regulation of ksp-cadherin expression in rabbit kidney (Abstract).
J. Investig. Med.
44:
242,
1996.
10.
Emert, M. P.,
C. M. Sorenson,
D. P. Basile,
J. G. Rogers,
M. R. Hammerman,
and
J. J. Billadello.
The human plasminogen activator inhibitor type I gene promoter targets to kidney.
Am. J. Physiol.
274 (Renal Physiol. 43):
F405-F412,
1998
11.
Garrick, D.,
S. Giering,
D. I. K. Martin,
and
E. Whitelaw.
Repeat-induced gene silencing in mammals.
Nat. Genet.
18:
56-59,
1998[Medline].
12.
Geiger, B.,
and
O. Ayalon.
Cadherins.
Annu. Rev. Cell Biol.
8:
307-332,
1992.
13.
Gordon, J. W.,
G. A. Scangos,
D. J. Plotkin,
J. A. Barbosa,
and
F. H. Ruddle.
Genetic transformation of mouse embryos by microinjection of purified DNA.
Proc. Natl. Acad. Sci. USA
77:
7380-7384,
1980
14.
Henikoff, S.
Conspiracy of silence among repeated transgenes.
Bioessays
20:
532-535,
1998[Medline].
15.
Hogan, B.,
R. Beddington,
F. Costantini,
and
E. Lacy.
Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1994.
16.
Igarashi, P.,
C. S. Shashikant,
R. B. Thomson,
D. A. Whyte,
F. H. Ruddle,
and
P. S. Aronson.
Ksp-cadherin gene promoter directs kidney-specific expression in transgenic mice (Abstract).
J. Am. Soc. Nephrol.
9:
363,
1998[Abstract].
17.
Madan, A.,
C. Lin,
S. L. Hatch,
and
P. T. Curtin.
Regulated basal, inducible, and tissue-specific human erythropoietin gene expression in transgenic mice requires multiple cis DNA sequences.
Blood
85:
2735-2341,
1995
18.
Martin, D. I. K.,
and
E. Whitelaw.
The vagaries of variegating transgenes.
Bioessays
18:
919-923,
1996[Medline].
19.
Mercer, E. H.,
G. W. Hoyle,
R. P. Kapur,
R. L. Brinster,
and
R. D. Palmiter.
The dopamine
-hydroxylase gene promoter directs expression of E. coli lacZ to sympathetic and other neurons in adult transgenic mice.
Neuron
7:
703-716,
1991[Medline].
20.
Nelson, R. D.,
X. L. Guo,
K. Masood,
D. Brown,
M. Kalkbrenner,
and
S. Gluck.
Selectively amplified expression of an isoform of the vacuolar H+-ATPase 56-kilodalton subunit in renal intercalated cells.
Proc. Natl. Acad. Sci. USA
89:
3541-3545,
1992
21.
Nelson, R. D.,
S. Johnson,
S. Bae,
and
S. L. Gluck.
Intercalated cell (IC)-specific expression in transgenic mice by 5' flank of human H+-ATPase B1 subunit gene (Abstract).
J. Am. Soc. Nephrol.
7:
1258,
1996.
22.
Nelson, R. D.,
P. Stricklett,
C. Gustafson,
A. Stevens,
D. Ausiello,
D. Brown,
and
D. E. Kohan.
Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice.
Am. J. Physiol.
275 (Cell Physiol. 44):
C216-C226,
1998
23.
Patel, Y. M.,
J. S. Yun,
J. Liu,
M. M. McGrane,
and
R. W. Hanson.
An analysis of regulatory elements in the phosphoenolpyruvate carboxykinase (GTP) gene which are responsible for its tissue-specific expression and metabolic control in transgenic mice.
J. Biol. Chem.
269:
5619-5628,
1994
24.
Price, P. M.,
J. Megyesi,
S. Saggi,
and
R. L. Safirstein.
Regulation of transcription by the rat EGF gene promoter in normal and ischemic murine kidney cells.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F664-F670,
1995
25.
Semenza, G. L.,
S. T. Koury,
M. K. Nejfelt,
J. D. Gearhart,
and
S. E. Antonarakis.
Cell-type-specific and hypoxia-inducible expression of the human erythropoietin gene in transgenic mice.
Proc. Natl. Acad. Sci. USA
88:
8725-8729,
1991
26.
Sepulveda, S. R.,
S. L. Huang,
R. M. Lebovitz,
and
M. W. Lieberman.
A 346-base pair region of the mouse
-glutamyl transpeptidase type II promoter contains sufficient cis-acting elements for the kidney-restricted expression in transgenic mice.
J. Biol. Chem.
272:
11959-11967,
1997
27.
Shaper, N. L.,
A. Harduin-Lepers,
and
J. H. Shaper.
Male germ cell expression of murine
4-galactosyltransferase.
J. Biol. Chem.
269:
25165-25171,
1994
28.
Takeichi, M.
Cadherins: a molecular family important in selective cell-cell adhesion.
Annu. Rev. Biochem.
59:
237-252,
1990[Medline].
29.
Thomson, R. B.,
and
P. S. Aronson.
Immunolocalization of Ksp-cadherin in the adult and developing rabbit kidney.
Am. J. Physiol.
277 (Renal Physiol. 46):
F146-F156,
1999
30.
Thomson, R. B.,
P. Igarashi,
D. Biemesderfer,
R. Kim,
A. Abu-Alfa,
M. Soleimani,
and
P. S. Aronson.
Isolation and cDNA cloning of Ksp-cadherin, a novel kidney-specific member of the cadherin multigene family.
J. Biol. Chem.
270:
17594-17601,
1995
31.
Thomson, R. B.,
D. C. Ward,
S. E. Quaggin,
P. Igarashi,
Z. E. Muckler,
and
P. S. Aronson.
cDNA cloning and chromosomal localization of the human and mouse isoforms of Ksp-cadherin.
Genomics
51:
445-451,
1998[Medline].
32.
Tisher, C. C.,
and
K. M. Madsen.
Anatomy of the kidney.
In: The Kidney (3rd ed.), edited by B. M. Brenner,
and F. C. Rector, Jr.. Philadelphia, PA: Saunders, 1991, p. 3-75.
33.
Whyte, D. A.,
C. Li,
R. B. Thomson,
S. L. Nix,
R. Zanjani,
S. L. Karp,
P. S. Aronson,
and
P. Igarashi.
Ksp-cadherin gene promoter. I. Characterization and renal epithelial cell-specific activity.
Am. J. Physiol.
277 (Renal Physiol. 46):
F587-F598,
1999
34.
Young, D. C.,
S. D. Kingsley,
K. A. Ryan,
and
F. J. Dutko.
Selective inactivation of eukaryotic
-galactosidase in assays for inhibitors of HIV-1 TAT using bacterial
-galactosidase as a reporter enzyme.
Anal. Biochem.
215:
24-30,
1993[Medline].
This article has been cited by other articles:
![]() |
H.-W. Lee, J. W. Verlander, J. M. Bishop, P. Igarashi, M. E. Handlogten, and I. D. Weiner Collecting duct-specific Rh C glycoprotein deletion alters basal and acidosis-stimulated renal ammonia excretion Am J Physiol Renal Physiol, June 1, 2009; 296(6): F1364 - F1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Adler, E. Efrati, and I. Zelikovic Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, E. Zolty, S. Falk, S. Summer, R. Stearman, M. Geraci, and R. Schrier Prostacyclin in endotoxemia-induced acute kidney injury: cyclooxygenase inhibition and renal prostacyclin synthase transgenic mice Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1131 - F1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sakai, K. Tamura, Y. Tsurumi, Y. Tanaka, Y. Koide, M. Matsuda, T. Ishigami, M. Yabana, Y. Tokita, Y. Hiroi, et al. Expression of MAK-V/Hunk in renal distal tubules and its possible involvement in proliferative suppression Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1526 - F1536. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Yang, W. Y. Tam, S. Tam, H. Guo, X. Wu, G. Li, J. F. L. Chau, J. D. Klein, S. K. Chung, J. M. Sands, et al. Genetic restoration of aldose reductase to the collecting tubules restores maturation of the urine concentrating mechanism Am J Physiol Renal Physiol, July 1, 2006; 291(1): F186 - F195. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yamamoto, L. Cui, K. Johkura, K. Asanuma, Y. Okouchi, N. Ogiwara, and K. Sasaki Branching ducts similar to mesonephric ducts or ureteric buds in teratomas originating from mouse embryonic stem cells Am J Physiol Renal Physiol, January 1, 2006; 290(1): F52 - F60. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gawlik and S. E. Quaggin Deciphering the Renal Code: Advances in Conditional Gene Targeting Physiology, October 1, 2004; 19(5): 245 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Bianco, H. L. Keen, J. L. Lavoie, and C. D. Sigmund Untraditional methods for targeting the kidney in transgenic mice Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1027 - F1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zharkikh, X. Zhu, P. K. Stricklett, D. E. Kohan, G. Chipman, S. Breton, D. Brown, and R. D. Nelson Renal principal cell-specific expression of green fluorescent protein in transgenic mice Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1351 - F1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Bai, M. Pontoglio, T. Hiesberger, A. M. Sinclair, and P. Igarashi Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta Am J Physiol Renal Physiol, October 1, 2002; 283(4): F839 - F851. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Shao, J. E. Johnson, J. A. Richardson, T. Hiesberger, and P. Igarashi A Minimal Ksp-Cadherin Promoter Linked to a Green Fluorescent Protein Reporter Gene Exhibits Tissue-Specific Expression in the Developing Kidney and Genitourinary Tract J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1824 - 1836. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Shao, S. Somlo, and P. Igarashi Epithelial-Specific Cre/lox Recombination in the Developing Kidney and Genitourinary Tract J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1837 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Quaggin A "Molecular Toolbox" for the Nephrologist J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1682 - 1685. [Full Text] [PDF] |
||||
![]() |
S. Puttini, A. T. Beggah, A. Ouvrard-Pascaud, C. Legris, M. Blot-Chabaud, N. Farman, and F. Jaisser Tetracycline-inducible gene expression in cultured rat renal CD cells and in intact CD from transgenic mice Am J Physiol Renal Physiol, December 1, 2001; 281(6): F1164 - F1172. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Whyte, C. Li, R. B. Thomson, S. L. Nix, R. Zanjani, S. L. Karp, P. S. Aronson, and P. Igarashi Ksp-cadherin gene promoter. I. Characterization and renal epithelial cell-specific activity Am J Physiol Renal Physiol, October 1, 1999; 277(4): F587 - F598. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |