|
|
||||||||
3 Department of Physiology, Pediatrics, and 2 Division of Gastroentrology, Department of Medicine, and 1 Eudowood Division of Respiratory Sciences, The Johns Hopkins School of Medicine, The Johns Hopkins University, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
Mutations in the chloride channel, ClC-5, have been described in
several inherited diseases that result in the formation of kidney
stones. To determine whether ClC-5 is also involved in calcium
homeostasis, we investigated whether ClC-5 mRNA and protein expression
are modulated in rats deficient in 1
,25(OH)2 vitamin
D3 with and without thyroparathyroidectomy. Parathyroid hormone (PTH) was replaced in some animals. Vitamin D-deficient, thyroparathyrodectomized rats had lower serum and higher urinary calcium concentrations compared with control animals as well as lower
serum PTH and calcitonin concentrations. ClC-5 mRNA and protein levels
in the cortex decrease in vitamin D-deficient, thyroparathyroidectomized rats compared with both control and vitamin
D-deficient animals. ClC-5 mRNA and protein expression increase near to
control levels in vitamin D-deficient, thyroparathyroidectomized rats
injected with PTH. No significant changes in ClC-5 mRNA and protein
expression in the medulla were detected in any experimental group. Our
results suggest that PTH modulates the expression of ClC-5 in the
kidney cortex and that neither 1
,25(OH)2 vitamin D3 nor PTH regulates ClC-5 expression in the medulla. The
pattern of expression of ClC-5 varies with urinary calcium. Animals
with higher urinary calcium concentrations have lower levels of ClC-5 mRNA and protein expression, suggesting that the ClC-5 chloride channel
plays a role in calcium reabsorption.
chloride channels; kidney stones; nephrolithiasis
| |
INTRODUCTION |
|---|
|
|
|---|
NEPHROLITHIASIS IS CHARACTERIZED by the precipitation of salts within the collecting ducts and/or in the renal papillae, leading to stones (2, 16, 18). It is well known that the major defect in kidney stone formation is an imbalance of calcium homeostasis, but there is also some evidence of pH misregulation (16, 18, 38). Recently, several forms of inherited renal stone disease have been described, including Dent's disease, X-linked recessive nephrolithiasis, and X-linked hypophosphatemic rickets. Hypercalciuria, nephrocalcinosis, and nephrolithiasis are common features of these diseases (29, 33, 34, 40).
The gene responsible for Dent's disease was identified on the X chromosome within locus Xp 11.22 (19, 22). The gene encodes a new member of the ClC family of voltage-gated-chloride channels, CLC-5 (22, 23). Nine members of the ClC family have been cloned (12). They are likely to play a role in transepithelial transport, cell volume regulation, and membrane excitability (12, 13, 32, 37). The ClC-5 (5) chloride channel has an outwardly rectifying current vs. voltage relationship, is activated by strong depolarizing voltages, and is inhibited by DIDS (35).
Lloyd and co-workers (22, 23) have identified mutations in the ClC-5 gene responsible for Dent's disease, X-linked recessive nephrolithiasis, and hypophosphatemic rickets. Several authors have also identified mutations in the ClC-5 gene found in patients with other types of nephrolithiasis (14, 22, 23, 29, 33). Several theories regarding the role of ClC-5 in kidney stone formation have been formulated (9, 22, 23). ClC-5 colocalizes with the H+-ATPase in intercalated cells of distal tubules (8, 26). These cells are involved in H+ secretion and acidification of urine, suggesting that ClC-5 may provide the chloride currents that would be necessary to maintain H+ secretion. It follows that a loss of ClC-5 function would be expected to impair acid secretion and lead to alkalinization of urine and precipitation of calcium salts as stones (40).
Parathyroid hormone (PTH) is a peptide hormone produced in the
parathyroid glands and released in response to a fall in plasma calcium
concentration. It acts to raise plasma calcium concentration by
enhancing bone absorption and increasing calcium reabsorption by the
kidney (11). PTH also enhances the synthesis of the active metabolite
of vitamin D, 1
,25(OH)2 vitamin D3, by
kidney cells. PTH regulates several transporters in the kidney,
including the Na+-Pi cotransporter (28), the
Na+/H+ exchanger (1), and the
Na+-K+-ATPase (27). PTH also inhibits
reabsorption of phosphate by the kidney, augmenting its excretion. The
active metabolite of vitamin D, 1
,25(OH)2 vitamin
D3 regulates calcium homeostasis by controlling bone
resorption, calcium uptake by the intestine, and PTH gene expression
(4, 36).
Because the regulation of ClC-5 in kidney is unknown and ClC-5 loss of
function mutations leads to the hypercalciuric phenotype, the goal of
this study was to determine whether hormones such as PTH and 1
,
25(OH)2 vitamin D3, which are involved in
calcium homeostasis, also regulate ClC-5 expression.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and treatment. Ten female Wistar rats, 2 wk pregnant, were housed in a dark room with free access to a vitamin D-deficient diet (0.3% calcium and 0.47% phosphate, Harlan Teklad, Madison, WI) and tap water. Pups from these animals were also raised in the dark room and fed the vitamin D-deficient diet. Animals raised in vitamin D-deficient conditions were used in subsequent experiments. For the control group, pups were raised on a normal diet with a daily 12:12-h light-dark cycle.
Male rats between 6 and 8 wk old and weighing 200-250 g were anesthetized by using ketamine plus acetopromazine (0.1 mg plus 0.25 mg/100 g body wt, respectively) by intraperitonial injection. The rats were thyroparathyroidectomized (TPTX) by using standard surgical techniques. Groups of eight animals each were randomly chosen and submitted to the following treatments (n = 8 each group): 1) control group: sham operated and treated by an osmotic pump with Ringer's solution; 2) vitamin D-deficient: sham operated and treated by an osmotic pump with Ringer solution; 3) vitamin D-deficient, TPTX: sham treated with Ringer solution by an osmotic pump; and 4) vitamin D-deficient, TPTX: PTH replete with rat 1-34 PTH at 10
7 M diluted in Ringer
solution per day by an osmotic pump.
The animals were kept in a dark room for 3 days after surgery with
daily care and free access to tap water and a vitamin D-deficient diet.
On the second day the rats were placed in individual metabolic cages to
collect 24-h urine samples. On the third day the animals were given an
overdose of pentobarbital sodium. Urine and blood were collected and
properly stored until use. The kidneys were perfused with cooled Ringer
solution and then dissected into cortex and medulla. All the procedures
are in agreement with The Johns Hopkins Animal Use Committee.
RNA and protein isolation.
Total RNA was isolated by using TRIzol (GIBCO-BRL, Grand Island, NY)
according to the manufacture's protocol without any modification. Total RNA was treated with RNase-free DNase at 10 U/µl
(Boehringer-Mannheim, Indianapolis, IN) for 1 h at 37°C. Then the
samples were digested with proteinase K (Boehringer-Mannheim) at 10 µg/ ml for 30 min at 50°C. RNA was extracted from the mix by
using phenol-chloroform-isoamylalcohol (GIBCO-BRL) extraction and
precipitated in 100% ethanol plus 0.5 M ammonium acetate (RNase free)
overnight at
80°C. RNA concentration was measured by
spectrophotometer (Beckman Instruments) at optical densities of 260 and
280 nm.
Urine and serum analysis for calcium. Twenty-four-hour urine was collected and analyzed for calcium and creatinine by using kits (Sigma Diagnostics, St. Louis, MO) according the manufacture's protocol.
Serum analysis for 1
,25(OH)2 vitamin
D3, PTH, and calcitonin (CT).
The concentration of 1
,25(OH)2 vitamin D3
was measured by HPLC/competitive binding assay. A RIA was used to
determine the PTH and calcitonin concentrations (Peninsula
Laboratories, Belmont, CA) following the manufacture's protocols. A
gamma counter (Beckman Instruments) was used to measure radioactive counts.
Quantification of the ClC-5 transcripts by RNase protection assay (RPA). To quantify ClC-5 mRNA, we performed a RPA. A ClC-5 PCR product was generated from rat cortex cDNA. cDNA was generated by using the Retroscript kit (Ambion, Austin, TX) following the manufacturer's protocol. The primers used for the generation were forward primer 5' CACTGTGGCGTTCCTTCTTCG3' (nucleotides 992-1012) and reverse primer 5' GCTGTCACAATGAGGACC3' (nucleotides 1238-1256) encompassing 264 bp. The thermal cycles were 94°C, 5 min ("hot start"; 1 cycle), followed by 94°C, 1 min; 53°C, 1 min; and 72°C, 1 min (40 cycles). The reaction mix consisted of (in mM) 200 Tris · HCl, pH: 8.00, 0.1 EDTA, 1 1,4-dithiothreitol, 50% (vol/vol) glycerol, 0.2 dNTPs, 50 MgCl2 and 2.5 U of Taq polymerase. This PCR product was subcloned into pCR Script SK+ vector and used to transform in Epicurian XL-Blue Escherichia coli (Stratagene, La Jolla, CA). Cloned ClC-5 cDNA were sequenced by using Sequenase 2.0 (Amersham Life Science, Cleveland, OH) following the manufacture's protocol and confirmed by The Johns Hopkins Core Sequence Facility.
Plasmids were digested with a Hind III restriction enzyme, and the linearized template was used to generate antisense RNA. The antisense RNA was made following the protocol provided by the Maxi Script kit (Ambion, Austin, TX) using
-[32P]UTP (800 µCi/mmol, NEN-DuPont,
Boston, MA). The antisense RNA probe was hybridized for 24 h at
45°C with 50 µg of total RNA from the rat groups. For control, 5 µg of yeast tRNA were used to check RNase digestion and specificity
of the probes. The ClC-5 probe was 75 bases longer, and the
-actin
was 56 bases longer than the expected RNase-protected fragments. The
samples were loaded onto 4.5% acrylamide/8 M urea denaturing gels, and
the protected fragments were visualized by exposing the dried gel to an
autoradiogram at
80°C. The bands obtained after 1-day
exposure were analyzed by laser densitometry for
-actin. The same
films were exposed for 3-5 days, and the bands of ClC-5 were also
analyzed by laser densitometry. The data were then normalized and
expressed as a ratio of ClC-5 over
-actin.
Generation of anti-serum against ClC-5 and Western blotting.
A fragment encompassing 225 bp was amplified by RT-PCR from cDNA of rat
kidney cortex. The region chosen was the extracellular loop between the
transmembrane domains D8 and D9. This region was chosen because it has
lower homology among ClC-3, ClC-4, and ClC-5. This same region was
chosen by another group to generate antibodies against human ClC-5 (5).
Primers used for PCR were forward primer 5'
GAGGTCCTCATTGTGACAG3' (nucleotides 1237-1256) and reverse
primer 5' CAAAGCCAGCTGCCACATG3' (nucleotides
1445-1462). The PCR fragment was amplified by using the following
thermal cycle: 94°C for 5 min for 1 cycle followed by 94°C, 1 min 53°C, 1 min, and 72°C, 1 min (40 cycles). Reagents used for
this reaction are the same as described above. The PCR fragment was
subcloned into PCR-Script SK+ vector and used to transform Epicurian
XL-Blue-competent E. coli (Stratagene). The PCR product ClC-5
was sequenced by using Sequenase 2.0 (Amershan Life Science) following
the manufacture's protocol. The vector was digested with BamH
I and Sst I, generating two fragments. The longer fragment of
225 bp, encompassing an open-reading frame of ClC-5, was subcloned into
the same restriction sites of pTrC His-2 C myc-tagged vector
(Invitrogen, Carlsbad, CA), used to transform DH5
-competent cells
(Stratagene), and sequenced by using Sequenase 2.0 (Amershan, Life
Science). The fusion protein was induced by 1mM IPTG for 9 h and
affinity-purified by using Nickel columns (Invitrogen, Carlsbad, CA).
Purity of the fusion protein was examined by SDS-PAGE and Western
blotting with anti-myc antibody (Invitrogen), and both have shown a
protein with a mobility of 13 kDa. This fusion protein was used to
immunize chickens.
Chemicals and materials. Rat parathyroid hormone (1-34), calcium, and creatinine kits were purchased from Sigma Chemical. Osmotic pumps were purchased from Alzet MiniPumps model 1003D (Alza, Palo Alto, CA). The metabolic cages were purchased from Nalgene (Nalgene, Rochester, NY).
Statistics. All results are expressed as means ± SE. The samples were analyzed by ANOVA and non-paired Bonferroni post hoc tests. Results were significant at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Serum levels of PTH, CT, and 1
, 25(OH)2
vitamin D3.
Effects of vitamin D deficiency and replacement with PTH were verified
by measuring the serum concentrations of these hormones. These data are
shown in Fig. 1. Control rats have serum
PTH concentrations of 100 ± 15 pg/ml, serum CT of 34 ± 4 pg/ml, and
1
,25(OH)2 vitamin D3 of 71 ± 18 pg/ml
(n = 5 P < 0.05). In vitamin D-deficient rats in all
experimental conditions (sham operated, TPTX rats and those repleted
with PTH) there is a fourfold decrease in serum
1
,25(OH)2 vitamin D3 concentration to 18 ± 4 pg/ml (n = 24, P < 0.05, combined data
for all vitamin D-deficient animals) compared with control rats. PTH
and CT increase in vitamin D-deficient rats compared with the control
animals (145 ± 15 pg/ml, n = 5, P < 0.05) and CT
(59 ± 15 pg/ml, n = 5, P < 0.05). As expected TPTX,
vitamin-D-deficient animals caused a decrease in both PTH (51 ± 20 pg/ml, n = 5, P < 0.05) and CT (24 ± 6 pg/ml, n = 5, P < 0.05) 3 days
after the surgery. Replacement with PTH in vitamin D-deficient, TPTX
animals increases PTH to 150 ± 5 pg/ml (n = 5) but did not
change the levels of CT (20 ± 4 pg/ml, n = 5, P < 0.05).
|
Calcium homeostasis.
Serum calcium concentrations and Ca2+ excretion rates were
analyzed to quantify the impact of our experimental maneuvers on calcium metabolism (Fig. 2A).
|
,25(OH)2 vitamin D3, which
impaired intestinal calcium absorption. This impaired intestinal
absorption, and continued excretion of calcium did not allow
restoration of serum calcium back to control levels.
Quantification of ClC-5 by RPA.
RPA was performed to quantify the changes in ClC-5 mRNA levels in each
experimental group. In the kidney cortex ClC-5 mRNA was equal in both
control and vitamin D-deficient-sham operated rats (n = 8, P < 0.05) (Fig. 3, A and
B). However, ClC-5 mRNA decreased 45% in vitamin D-deficient,
TPTX animals (n = 8, P < 0.05). These data
demonstrate that ClC5 mRNA levels are not sensitive to changes in
circulating levels of 1
,25(OH)2 vitamin D3
but do respond dramatically to a reduction in PTH levels. This is shown
more clearly when PTH was infused into vitamin D-deficient, TPTX
animals. Replacement of PTH resulted in a restoration in ClC-5 mRNA
levels to values equivalent to that seen in control animals (n = 8, P < 0.05). These results suggest that PTH regulates ClC-5 mRNA in the kidney cortex. In contrast, despite the changes in
1
,25(OH)2 vitamin D3 or PTH levels induced
in our experimental protocols, there were no changes in ClC-5 mRNA
expression in the kidney medulla (n = 8) (Fig.
4, A and B), suggesting
that 1
,25(OH)2 vitamin D3 and PTH do not
regulate ClC-5 expression in the medulla.
|
|
Detection of ClC-5 protein by Western blots.
Because mRNA and protein expression do not always correlate, we
generated an antibody against ClC-5 to assess ClC-5 protein expression.
The antibody detected a major protein of 80 kDa, a mobility predicted
for ClC-5. The antibody also detects two minor proteins of 50 and 35 kDa. The major 80-kDa band was easily detected in kidney and colon but
faintly in brain, lung, and bone (Fig. 5).
The smaller 50- and 35-kDa bands were detected only in kidney. The
identity of the minor 50- and 35-kDa bands on the gel is not known. It
is possible that they represent either different isoforms or
degradation products of ClC-5.
|
|
,25(OH)2 vitamin D3 or PTH.
| |
DISCUSSION |
|---|
|
|
|---|
Two major hormones regulate mineral metabolism, PTH and
1
,25(OH)2 vitamin D3. PTH acts mainly in
cortical segments of the nephron (11) whereas, 1
,25(OH)2
vitamin D3 receptors are predominantly expressed in the
kidney medulla (11). In this work, we investigated whether PTH and/or
1
,25(OH)2 vitamin D3 could modulate the
expression pattern of ClC-5 mRNA and protein in rat kidney cortex and medulla.
1
,25(OH)2 vitamin D3 depletion alone does
not affect ClC-5 expression in renal cortex. Our data suggest that
PTH does play a role in modulating expression of ClC-5 mRNA and protein
levels in kidney cortex. The modulation of ClC-5 expression may be
modulated through second-messenger systems directly related to PTH.
Alternatively, it is also possible that ClC-5 message is regulated by
changes in Ca2+ excretion subsequent to changes in PTH.
Although, ClC-5 is expressed in the medulla, it is not regulated by hormones involved in calcium homeostasis. This differential modulation of ClC-5 in cortex but not in medulla is probably indicative of regional differences in the role ClC-5 in calcium reabsorption in cortical vs. medullary nephron segments.
Other investigators have also identified chloride channels activated by PTH in the proximal tubule. For example, Suzuki and co-workers (39) studied a chloride channel in the apical cell membrane of the proximal convoluted tubule by using patch-clamp analysis. They found a rectifying chloride-selective channel with conductances of 33 pS at positive potentials and 22.5 pS at negative potentials, which were blocked by DIDS. PTH activates this channel via the action of protein kinase A or by protein kinase C, but not by calcium.
How do chloride channels play a role in calcium absorption? Gesek and Friedman (7) have described a chloride conductance that promotes the driving force for calcium reabsorption in mouse distal convoluted tubule (DCT) cells. Blocking the chloride channel also blocks calcium entry across the apical membrane. They suggest that activating a chloride channel would hyperpolarize the plasma membrane, allowing calcium to flow through the plasma membrane via calcium channels (24), thereby enhancing calcium reabsorption.
They found that PTH increases the chloride conductance of the DCT, but the effect is not immediate. It occurs only after a long latency (~8 min). This may reflect differences in the signaling mechanisms between CT and PTH, with PTH acting via a modulation of protein expression (7). In our work we showed that PTH modulates ClC-5 in the renal cortex via an increase in mRNA and protein expression. Clearly, one possibility is that the channel identified by Gesek and Freedman (7) is ClC-5. The channel described by Gesek and Friedman has outwardly rectifying current vs. voltage relationship. This feature resembles the characteristics of ClC-5 chloride channel. Although the properties of their channel in the DCT are similar to ClC-5, ClC-5 mRNA and protein have been detected primarily in the glomerulus, proximal tubules, and connecting and collecting ducts (26, 35). This raises the possibility that another kind of chloride channel similar to ClC-5 and also regulated by PTH is responsible for calcium reabsorption in the DCT.
To determine whether changes in ClC-5 expression correlates with calcium excretion, we analyzed urinary calcium. The urinary excretion of calcium in vitamin D-deficient rats did not change compared with controls. These animals were also able to maintain ClC-5 mRNA and protein in kidney cortex similar to control values. When vitamin D-deficient animals are TPTX, there is an increase in calcium excretion that is inversely proportional to the amount of ClC-5 mRNA and protein in kidney cortex, suggesting that this chlorides channel may play a role in calcium reabsorption.
Several diseases involved with imbalances in calcium and phosphate
homeostasis are referred to as idiopathic hypercalciuria. Some patients
with this disorder have lower levels of PTH in the absence of changes
in 1
,25(OH)2 vitamin D3 (4), whereas, other forms of normocalcemic hypercalciuria in humans may involve disordered regulation of 1
,25(OH)2 vitamin D3 (3). In
some cases, hypercalciuria may lead to kidney stone formation (16, 18,
38). Our results predict that patients with idiopathic hypercalciuria
associated with lower levels of PTH may have reduced expression of
ClC-5, which in turn would contribute to enhanced renal calcium excretion.
Mutations that disrupt the function of the ClC-5 chloride channel have been detected in several types of inherited forms of nephrolithiasis. These patients show low-molecular-weight proteinuria, hypercalciuria, and nephrolithiasis (10, 23, 25, 32). We have shown that lower levels of ClC-5 expression correlate with higher urinary calcium excretion. Therefore, the loss of function of ClC-5 could lead to the hypercalciuric phenotype.
Interestingly, cases of hyperparathyroidism have been reported in some patients with both idiopathic nephrolithiasis and X-linked hypophosphatemia (15). Some mutations in the CLC-5 gene found in X-linked hypophosphatemic patients generate a lower conductance channel compared with wild type (14, 22, 23). We showed that replacement of PTH in vitamin D-deficient parathyroidectomized rats restores ClC-5 protein levels. Although not tested here, higher doses of PTH may induce even higher expression of ClC-5. It is also possible that hyperparathyroidism in these patients would increase the ClC-5 protein, partially offsetting the reduction in conductance.
A feature that is often associated with mutations in ClC-5 is
low-molecular-weight proteinuria (5, 23, 25).
2-Microglobulin is the major protein found in the urine
from people who lose ClC-5 function. This protein is normally
reabsorbed by endocytosis in proximal tubules of nephron. In the
proximal tubule, ClC-5 protein is located in early endosomes
colocalizing with the vacuolar H+-ATPase (8) that pumps
H+ into the endosomes acidifying them. We speculate that
ClC-5 provides the chloride conductance necessary to neutralize the
positive charge generated by H+ within the endosome. Thus a
mutation in the CLC5 gene that interrupts channel function would be
expected to disrupt normal endosome function, leading to increases in
2-microglobulin excretion.
Protein endocytosis and subsequent degradation is an important mechanism for the regulation of membrane proteins. For example, PTH enhances the catabolism of type II Na+-Pi cotransporter in opossum kidney cells by targeting it for lysosomal degradation (28). Likewise, Devuyst et al. (5) have demonstrated a colocalization of endocytosed albumin and transfected ClC5 suggestive of a role of ClC5 in albumin endocytosis. These data taken together, we speculate that PTH could regulate ClC-5 expression to maintain the number of vesicles able to recycle both membrane and endocytosed proteins in proximal tubules. Furthermore, a disruption of ClC-5 function could impair not only protein endocytosis but also the internalization of calcium crystals in renal epithelia (20).
In conclusion, we have shown that alterations in mineral homeostasis can affect the expression of ClC-5 in the kidney. PTH plays a role in regulating both mRNA and protein expression in kidney cortex. ClC-5 protein regulation in kidney cortex correlates with the level of urinary calcium excretion. It is well known that PTH is a major mediator of calcium reabsorption in kidney and its site of action is mainly in the kidney cortex. This paper suggests that PTH may exert part of its action on calcium reabsorption by regulating ClC-5 mRNA and protein expression.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institutes of Health Grants DK-43423 (to S. Guggino), K08 HL-03469 (to C J. Blaisdell), and DK-32753 (to W. B. Guggino).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: W. B. Guggino, Johns Hopkins Univ. School of Medicine, 725 N.Wolfe St., Baltimore, MD 21205 (E-mail: wguggino{at}jhmi.edu).
Received 3 February 1999; accepted in final form 15 September 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Azarani, A.,
D. Goltzman,
and
J. Orlowski.
Parathyroid hormone and parathyroid hormone-related peptide inhibit the apical Na+/H+ exchanger NHE-3 isoform in renal cells (OK) via dual signaling cassette involving protein kinase A and C.
J. Biol. Chem.
270:
20004-20010,
1995
2.
Bushinsky, D. A.,
M. D. Grynpas,
E. L. Nilsson,
Y. Nakagawa,
and
F. L. Coe.
Stone formation in genetic hypercalciuric rats.
Kidney Int.
48:
1705-1713,
1995[Web of Science][Medline].
3.
Coe, F. L.,
and
D. A. Bushinsky.
Pathophysiology of hypercalciuria.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
247:
F1-F14,
1984.
4.
Coe, F. L.,
M., J. Favus,
T. Crocket,
A. L. Strauss,
J. H. Parks,
A. Porat,
C. L. Gantt,
and
L. M. Sherwood.
Effects of low-calcium diet on urine calcium excretion, parathyroid function and serum 1
, 25(OH)2 vitamin D3 levels in patients with idiopathic hypercalciuria and normal subjects.
Am. J. Med.
72:
25-31,
1982[Web of Science][Medline].
5.
Devuyst, O.,
P. T. Christie,
P. J. Courtoy,
R. Beauwens,
and
R. V Thakker.
Intra-renal and subcellular distribution of human chloride channel, ClC-5, reveals a pathophysiological basis for Dent's disease.
Hum. Mol. Genet.
8:
247-257,
1999
6.
Fisher, S. E.,
G. C. M. Black,
S. E. Lloyd,
E. Hatchwell,
O. Wrong,
R. V. Thakker,
and
I. W. Craig.
Isolation and partial characterization of a chloride channel gene which is expressed in kidney and is a candidate for Dent's disease (an X-linked hereditary nephrolithiasis) Hum.
Mol. Genet.
3:
2053-2059,
1994.
7.
Gesek, F. A.,
and
P. A. Friedman.
Calcitonin stimulates calcium transport in distal convoluted tubule cells.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
264:
F744-F751,
1993
8.
Gunther, W.,
A. Luchow,
F. Cluzeaud,
A. Vandewalle,
and
T. J. Jentsch.
ClC-5, the chloride channel mutated in Dent's disease, co-localizes with the proton pump in endocytotically active kidney cells.
Proc. Natl. Acad. Sci. USA
95:
8075-8080,
1998
9.
Hebert, S. C.
Crystal-clear chloride channels.
Nature Lond.
379:
398-399,
1996[Medline].
10.
Hoopes, R. R., Jr.,
P. A. Hueber,
R. J. Reid, Jr.,
G. L. Braden,
P. R. Goodyer,
A. R. Melnyk,
M. P. Midgley,
D. I. Moel,
A. M. Neu,
S. K. VanWhy,
and
S. J. Scheinman.
CLC-5 chloride-channel mutations in six new North American families with X-linked nephrolithiasis.
Kidney Int.
54:
698-7051,
1998[Web of Science][Medline].
11.
Hugi, K.,
J.-P. Bonjour,
and
H. Fleisch.
Renal handling of calcium: influence of parathyroid hormone, and 1
,25(OH)2 vitamin D3.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
236:
F349-F356,
1979.
12.
Jentsch, T. J.
Structure and function of ClC chloride channels.
Jpn. J. Physiol.
44:
S1-S2,
1994.
13.
Jentsch, T. J.,
W. Gunther,
M. Pusch,
and
B. Schwappach.
Properties of voltage-gated chloride channels of the ClC gene family.
J. Physiol. (Lond.)
482:
19S-25S,
1995.
14.
Kelleher, C. L.,
V. M. Buckalew,
E. D. Frederickson,
D. J. Rhodes,
D. A. Conner,
and
J. G. Seidman.
CLC-5 mutation Ser244Leu is associated with X-linked renal failure without X-linked recessive hypophosphatemic rickets.
Kidney Int.
53:
31-37,
1998[Web of Science][Medline].
15.
Kiebzak, G. M.,
B. A. Roos,
and
R. A. Meyer, Jr.
Secondary hyperparathyroidism in X-linked hypophosphatemic mice.
Endocrinology.
111:
650-652,
1982
16.
Khan, S. R.,
and
P. A. Glenton.
Deposition of calcium phosphate and calcium oxalate crystals in the kidney.
J. Urol.
153:
811-817,
1995[Web of Science][Medline].
17.
Knudtzon, J.,
J. Halse,
E. Monn,
A. Nesland,
K. P. Nordal,
P. Paus,
M. Seip,
S. Sund,
and
G. Sodal.
Autonomous hyperparathyroidism in X-linked hypophosphataemia.
Clin. Endocrinol. (Oxf.)
42:
199-203,
1995[Medline].
18.
Kok, D. J.,
and
S. R. Khan.
Calcium oxalate nephrolithiasis, a free or fixed particle disease.
Kidney Int.
46:
847-854,
1994[Web of Science][Medline].
19.
Kumar, R.
ClC-5 chloride channels and renal disease.
Kidney Int.
53:
228-229,
1998[Web of Science][Medline].
20.
Lieske, J. C.,
H. Swift,
T. Martin,
B. Patterson,
and
F. G. Toback.
Renal epithelial cells rapidly bind and internalize calcium oxalate monohydrate crystals.
Proc. Natl. Acad. Sci. USA
91:
6987-6991,
1994
21.
Lindenthal, S.,
S. Schmieder,
J. Ehrenfeld,
and
N. K. Wills.
Cloning and functional expression of a ClC Cl
channel from the renal cell line A6.
Am. J. Physiol. Cell Physiol.
273:
C1176-C1185,
1997
22.
Lloyd, S. E.,
W. Gunther,
S. H. Pearce,
A. Thomson,
M. L. Bianchi,
M. Bosio,
I. W. Craig,
S. E. Fisher,
S. J. Scheinman,
O. Wrong,
T. J. Jentsch,
and
R. V. Thakker.
Characterization of renal chloride channel, CLC-5, mutations in hypercalciuric nephrolithiasis (kidney stones) disorders.
Hum. Mol. Genet.
6:
1233-1239,
1997
23.
Lloyd, S. E.,
S. H. Pearce,
S. E. Fisher,
K. Steinmeyer,
B. Schwappach,
S. J. Scheinman,
B. Harding,
A. Bolino,
M. Devoto,
P. Goodyer,
S. P. Rigden,
O. Wrong,
T. J. Jentsch,
I. W. Craig,
and
R. V. Thakker.
A common molecular basis for three inherited kidney stone diseases.
Nature
379:
445-449,
1996[Medline].
24.
Matsunaga, H.,
B. A. Stanton,
F. A. Gesek,
and
P. A. Friedman.
Epithelial Ca2+ channels sensitive to dihydropyridines, and activated by hyperpolarizing voltages.
Am. J. Physiol. Cell Physiol.
267:
C157-C165,
1994
25.
Morimoto, T.,
S. Uchida,
H. Sakamoto,
Y. Kondo,
H. Hanamizu,
M. Fukui,
Y. Tomino,
N. Nagano,
S. Sasaki,
and
F. Marumo.
Mutations in CLC-5 chloride channel in Japanese patients with low molecular weight proteinuria.
J. Am. Soc. Nephrol.
9:
811-818,
1998[Abstract].
26.
Obermuller, N.,
N. Gretz,
W. Kris,
R. F. Reilly,
and
R. Witxgall.
The swelling-activated chloride channel ClC-2, the chloride channel ClC-3, and ClC-5 a chloride channel mutated in kidney stone disease, are expressed in distinct subpopulations of renal epithelial cells.
J. Clin. Invest.
101:
635-642,
1998[Web of Science][Medline].
27.
Ominato, M.,
T. Satoh,
and
A. I. Katz.
Regulation of Na-K-ATPase activity in the proximal tubule: role of the protein kinase C pathway and of eicosanoids.
J. Membr. Biol.
152:
235-243,
1996[Web of Science][Medline].
28.
Pfister, M. F.,
I. Ruf,
G. Stange,
U. Zieger,
E. Lederer,
J. Bilber,
and
H. Murer.
Parathyroid hormone leads to the lysosomal degradation of the renal type II Na/Pi cotransporter.
Proc. Natl. Acad. Sci. USA
95:
1909-1914,
1998
29.
Reinhart, S. C.,
A. G. W. Nordem,
M. Lapsley,
R. V. Thakker,
J. Pang,
A. M. Moses,
P. A. Frymoyer,
M. J. Favus,
J. A. Hoepner,
and
S. J. Scheinman.
Characterization of carrier females and affected males with X-linked recessive nephrolithiasis.
J. Am S. Nephr.
5:
1451-1461,
1993.
30.
Rivkees, S. A.,
G. El-Hajj-Fuleihan,
E. M. Brown,
and
J. D. Crawford.
Tertiary hyperparathyroidism during high phosphate therapy of familial hypophosphatemic rickets.
J. Clin. Endocrinol. Metab.
75:
1514-1518,
1992[Abstract].
31.
Sakamoto, H.,
M. Kawasaki,
S. Uchida,
S. Sasaki,
and
F. Marumo.
Identification of a new outwardly rectifying Cl- channel that belongs to a subfamily of the ClC Cl
channels.
J. Biol. Chem.
271:
10210-10216,
1996
32.
Sasaki, S.,
S. Uchida,
M. Kawasaki,
S. Sasaki,
S. Adachi,
and
F. Marumo.
ClC family in the Kidney.
Jpn. J. Physiol.
44:
S3-S8,
1994.
33.
Scheinman, S. J.
X-linked hypercalciuric nephrolithiasis: clinical syndromes and chloride channel mutations.
Kidney Int.
53:
3-17,
1998[Web of Science][Medline].
34.
Shapiro, L. J.
The genetic basis of X-linked nephrolithiasis: leaving no stone unturned (Abstract).
J. Clin. Invest.
91:
2339,
1993.
35.
Steinmeyer, K.,
B. Schwappach,
M. Bens,
A. Vandewalle,
and
T. J. Jentsch.
Cloning and functional expression of rat ClC-5, a chloride channel related to kidney disease.
J. Biol. Chem.
270:
31172-31177,
1995
36.
Stim, J. A.,
A. A. Bernardo,
and
J. A. Arruda.
The role of parathyroid hormone and vitamin D in acid excretion and extrarenal buffer mobilization.
Miner. Electrolyte. Metab.
20:
60-71,
1994[Web of Science][Medline].
37.
Strange, K.,
F. Emma,
and
P. S. Jackson.
Cellular and molecular physiology of volume-sensitive anion channels.
Am. J. Physiol. Cell Physiol.
270:
C711-C730,
1996
38.
Strohmaier, W. L.,
R. D. Seeger,
H. Osswald,
and
K. H. Bichler.
Reduction of vitamin D induced stone formation by calcium.
Urol. Res.
22:
301-303,
1994[Web of Science][Medline].
39.
Suzuki, M.,
T. Morita,
K. Hanaoka,
Y. Kawagushi,
and
O. Sakai.
A Cl- channel activated by parathyroid hormone in rabbit renal proximal tubule cells.
J. Clin. Invest.
88:
735-742,
1991.
40.
Thakker, R. V.
The role of renal chloride channels mutations in kidney stone disease and nephrocalcinosis.
Curr. Opin. Nephrol. Hypertens.
7:
385-388,
1998[Web of Science][Medline].
This article has been cited by other articles:
![]() |
P.-C. Pham, O. Devuyst, P.-T. Pham, N. Matsumoto, R. N. G. Shih, O. D. Jo, N. Yanagawa, and A. M. Sun Hypertonicity increases CLC-5 expression in mouse medullary thick ascending limb cells Am J Physiol Renal Physiol, October 1, 2004; 287(4): F747 - F752. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Devuyst and W. B. Guggino Chloride channels in the kidney: lessons learned from knockout animals Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1176 - F1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kunzelmann and M. Mall Electrolyte Transport in the Mammalian Colon: Mechanisms and Implications for Disease Physiol Rev, January 1, 2002; 82(1): 245 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Wills and P. Fong ClC Chloride Channels in Epithelia: Recent Progress and Remaining Puzzles Physiology, August 1, 2001; 16(4): 161 - 166. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Wang, O. Devuyst, P. J. Courtoy, X.-T. Wang, H. Wang, Y. Wang, R. V. Thakker, S. Guggino, and W. B. Guggino Mice lacking renal chloride channel, CLC-5, are a model for Dent's disease, a nephrolithiasis disorder associated with defective receptor-mediated endocytosis Hum. Mol. Genet., December 1, 2000; 9(20): 2937 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uchida In vivo role of CLC chloride channels in the kidney Am J Physiol Renal Physiol, November 1, 2000; 279(5): F802 - F808. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Edmonds, I. V. Silva, W. B. Guggino, R. B. Butler, P. L. Zeitlin, and C. J. Blaisdell Pre- and Postnatal Lung Development, Maturation, and Plasticity: ClC-5: ontogeny of an alternative chloride channel in respiratory epithelia Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L501 - L507. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |