|
|
||||||||
1 Departments of Medicine and Surgery, Tulane University Medical Center, Tulane Environmental Astrobiology Center, Center for Bioenvironmental Research, and Veterans Affairs Medical Center, New Orleans, Louisiana 70112; 2 Enteric Neuromuscular Diseases Laboratory, Division of Gastroenterology, University of Texas Medical Branch, Galveston, Texas 77555; 3 Nephrology Section, The Children's Hospital, Boston, Massachusetts 02115; 4 Smooth Muscle Laboratory, Department of Surgical Sciences, University of Wisconsin School of Veterinary Medicine, Madison, Wisconsin 53792; and 5 Renal and Electrolyte Section, University of Pittsburgh, Pittsburgh, Pennsylvania 15261
| |
ABSTRACT |
|---|
|
|
|---|
Urinary bladder instillation of ovalbumin into presensitized guinea pigs stimulates rapid development of local bladder inflammation. Substance P is an important mediator of this inflammatory response, as substance P antagonists largely reverse the process. Vacuolization of the subapical endosomal compartment of the transitional epithelial cells lining the bladder suggests that changes in endosomal trafficking and fusion are also part of the inflammatory response. To test directly for substance P mediation of changes in endosomal fusion, we reconstituted fusion of transitional cell endosomes in vitro using both cuvette-based and flow cytometry energy transfer assays. Bladders were loaded with fluorescent dyes by a hypotonic withdrawal protocol before endosomal isolation by gradient centrifugation. Endosomal fusion assayed by energy transfer during in vitro reconstitution was both cytosol and ATP dependent. Fusion was confirmed by the increase in vesicle size on electron micrographs of fused endosomal preparations compared with controls. In inflamed bladders, dye uptake was inhibited 20% and endosomal fusion was inhibited 50%. These changes are partly mediated by the neurokinin-1 (NK1) receptor (NK1R), as 4 mg/kg of CP-96,345, a highly selective NK1 antagonist, increased fusion in inflamed bladders but had no effect on control bladders. The receptor-mediated nature of this effect was demonstrated by the expression of substance P receptor mRNA in rat bladder lumen scrapings and by the detection of the NK1R message in guinea pig subapical endosomes by Western blot analysis. The NK1Rs were significantly upregulated following induction of an inflammatory response in the bladder. These results demonstrate that 1) in ovalbumin-induced inflammation in the guinea pig bladder, in vitro fusion of apical endosomes is inhibited, showing endocytotic processes are altered in inflammation; 2) pretreatment in vivo with an NK1R antagonist blocks this inhibition of in vitro fusion, demonstrating a role for NK1R in this process; and 3) the NK1R is present in higher amounts in apical endosomes of inflamed bladder, suggesting changes in translation or trafficking of the NK1R during the inflammatory process. This suggests that NK1R can change the fusion properties of membranes in which it resides.
energy transfer; fluorescence; inflammation; urinary bladder; endosomes; membrane fusion
| |
INTRODUCTION |
|---|
|
|
|---|
ALTHOUGH BLADDER INFLAMMATION cripples countless thousands of patients annually, the etiology and pathogenesis of this disease complex remains largely indeterminate (42). Inflammation of the bladder wall includes changes in every tissue layer, manifested by complex changes at the macroscopic, microscopic, and biochemical level (5, 38, 42, 45). Infiltration of exogenous inflammatory cells is accompanied by endogenous production of prostanoids, cytokines, and numerous other inflammatory mediators (4, 45). Although the etiology of bladder inflammation remains uncertain, several popular theories involving urinary infection and urinary antigens (45) imply a central role for the interface between urine in the urinary bladder and the transitional epithelial cells lining the bladder lumen (41).
Several lines of experimental evidence confirm the unique structure and functional properties of the apical membrane compartment of transitional epithelial cells that line the lumen of the urinary bladder. The unique functional attributes of the subapical endosomal pathway of transitional epithelial cells include the rapid endocytotic recycling of a massive 70% of the apical surface membrane, which occurs in seconds during contraction due to emptying, and is unprecedented in any other tissue (38). Furthermore, during histological examination of bladders in animal models of bladder inflammation, the subapical endosomal pathway of transitional epithelial cells is disrupted with marked vacuolization. This suggests that a defect contributing to bladder inflammation may lie, at least in part, in the subapical compartment of transitional epithelial cells.
All the tools necessary to directly assess differences in the functional properties of endosomes in inflamed compared with normal bladders are now available. Subapical endosomes from transitional epithelial cells have been isolated in high purity (14), fusion of mammalian endosomes has been reconstituted in vitro (21, 23, 28), and simple animal models of bladder inflammation have been defined (4, 5, 45). We chose to study an ovalbumin sensitization model of inflammation because of its simplicity and unequivocal endocytotic delivery of antigens across the bladder mucosa (45). In this model, guinea pigs are sensitized to ovalbumin by three intraperitoneal injections of the protein spread over 5 days. Twenty days after the last injection, antigenic challenge by instillation of bladder with ovalbumin leads to inflammation of the bladder wall. The profile of inflammatory mediator release from bladders isolated from these animals demonstrates substantial release of substance P (4, 5), decreased micturition volume with increased micturition frequency (30), and increased bladder permeability (31). In the current study, the first aim is to optimally reconstitute fusion of endosomes isolated from transitional epithelial cells in vitro. Then, we can use the ovalbumin sensitization model to test for inhibition of fusion as a mediator of vacuolization early in the pathogenesis of bladder inflammation.
Investigation of the chemical mediators of bladder inflammation has emphasized the central importance of substance P [also known as neurokinin-1 (NK1)] as a quantitatively important mediator of bladder inflammation (4, 5, 38). Substance P, which is constitutively released by normal bladders, and degraded by peptidases in situ, is hugely increased in inflamed bladders (4). Instillation of substance P into normal bladders induces inflammation (4, 5). Substance P binds a classic seven-transmembrane domain G-protein linked receptor whose sequence and structure are known (26, 47). Substance P receptors are present in bronchial epithelia, as well as bladder nerve endings, but it is unknown whether they are present in the endosomes from transitional epithelial cells of the bladder (8, 15, 40). Substance P participates in the inflammatory response of the bladder, as substance P content increases in inflamed bladders (40) and substance P antagonists reduce bladder inflammation (29), but the anatomic sites of activity remain ill defined. The second phase of the current study is to test for substance P receptors in subapical endosomes and to determine directly whether they participate in inflammatory inhibition of endosomal fusion. Together these studies demonstrate that the inflammatory response of the urinary bladder includes vacuolation of the subapical compartment of transitional epithelial cells, in association with substance P-dependent inhibition of endosomal fusion.
| |
METHODS AND MATERIALS |
|---|
|
|
|---|
Animals, Reagents, and Antibodies
Male New Zealand White rabbits (1.0-1.5 kg; Bakkon's Rabbitry, Madison, WI), and Hartley albino guinea pigs (500-800; g; Sprague-Dawley, Cleveland, OH) were anesthetized with pentobarbital sodium on the day of the experiment.All reagents were from Sigma Chemical (St. Louis, MO) unless otherwise stated. All fluorescence measurements were made in the presence of 7 µl/3 ml of anti-fluorescein antibodies to quench extravesicular fluorescein fluorescence (18, 19, 23).
Preparation of Rabbit and Guinea Pig Bladder Endosomes
The urinary bladder was harvested from anesthetized rabbits and guinea pigs through a midline abdominal incision. The rabbit was chosen for its abundant subapical bladder endosomes (32), and the guinea pig was chosen for the excellent inflammatory models available (4, 5, 38) The early endosomal pathway of bladders were loaded with fluorescein or rhodamine dextran by hypotonic withdrawal as previously described (14). Bladder endosomes were prepared by a series of differential sucrose gradient enrichments (14). The final highly purified endosomal preparation is homogenous for entrapped markers and the presence of H+-ATPase activity on flow cytometry analysis (14).Flow Cytometry Analysis of Endosomal Fractions
Flow cytometry analysis of subcellular particles was performed on a Becton-Dickinson FACStar Plus flow cytometer, as described previously (21-23, 28). Excitation was performed at 488 nm with a Coherent 6-W argon ion laser. Excitation was measured at 530 and 580 nm with 30-nm band-pass filters by use of photomultipliers and logarithmic amplifiers. The very different Stokes shifts of fluorescein and phycoerythrin allow independent measurement of their emission at 530 and 580 nm exciting both dyes at 488 nm with minimal (<5%) electronic compensation of crossover. Data was recorded on a model HP340 Hewlett-Packard personal computer and converted to IBM format for analysis with PC-LYSYS
software (version 1.3, revision
E, Becton-Dickinson). To colocalize entrapped fluorescein dextran taken
up by endocytosis, as well as uroplakins, guinea pig endosomal
fractions prepared loaded with fluorescein dextran were
stained with a rabbit polyclonal anti-uroplakin III antibody (34).
Endosomes were incubated for 4-14 h stepwise in 50% goat serum, a
log dilution curve (1:10 to 1:100,000) of primary anti-uroplakin III
antiserum (a gift of Dr. T. T. Sun, New York, NY), and
affinity-purified preabsorbed goat-anti-rabbit phycoerthyrein
conjugated secondary (Sigma Chemical). All immunochemicals were diluted
in PBS, and one or two washes with PBS separated each step. Control
sera used for comparison was preimmune serum.
Ovalbumin Protocol To Sensitize Guinea Pig Bladders
Injecting 1 ml of 10 mg/ml ovalbumin ip daily for three doses (5, 45) sensitized female guinea pigs. Control animals were injected with vehicle. Three weeks after the third dose, the guinea pigs responded to bladder ovalbumin instillation with local inflammation. On the evening prior to the experiment, the guinea pigs were temporarily anesthetized with a single intramuscular injection of 35 mg/kg ketamine (Ketaset) and 5 mg/kg xylazine (Rompun). Once surgical anesthesia was achieved, pigs received 4 mg/kg CP-96,345 or saline vehicle intraperitoneally, as a single dose, 1 h prior to antigen challenge by bladder ovalbumin instillation. Then, 0.5-3.0 ml of 1 mg/ml ovalbumin was instilled into the urinary bladder via a urethral catheter and held in the lumen for ~2 h by leaving a syringe on the end of the catheter. The catheter was removed as the animals awakened.On the day of the experiment, 12 h after bladder instillation of ovalbumin, the guinea pigs were anesthetized with 25-40 mg/kg ip pentobarbital sodium. The bladder was harvested, endosomal dye uptake was stimulated by hypotonic withdrawal (14), endosomes were isolated (14), and fusion of endosomes was reconstituted in vitro (21, 23, 28).
Cytosol Preparation
Cytosol was prepared by homogenizing rabbit renal cortex, in a modified fusion buffer (23). The buffer contained 370 µM ATP and 2 mM dithiothreitol to stabilize N-ethylmaleimide (NEM)-sensitive factor (NSF) (6), 100 mM KCl, 85 mM sucrose, 1.5 mM MgCl2, and 20 mM EGTA, pH 7.4 with Tris. The tissue was first coarsely ground in a Waring blender and then further homogenized with a glass-Teflon tissue grinder. The homogenate was spun at 100,000 g for 1 h at 4°C. The supernatant known as cytosol was frozen in aliquots at
70°C and thawed on ice immediately prior to use.
Reconstitution Of Endosomal Fusion In Vitro: Energy Transfer Fusion Assay
To perform fusion, fluorescein-dextran (0.8 mg/ml) and rhodamine-dextran (1.6 mg/ml)-containing endosomes had NSF deactivated by treating them with 1 mM NEM on ice for 15 min (20, 23, 28). Then, 10 µl of fluorescein-containing endosomes and 10 µl of rhodamine-containing endosomes were placed on the opposite sides of a single well in a 96-well plate. To each well was added 60 µl of fusion buffer consisting of 100 mM KCl, 85 mM sucrose, 20 mM HEPES, 1.5 mM MgCl2, 1.5 mM ATP, 1 mM dithiothreitol, 20 µM EGTA, and an ATP regenerating system (8.0 mM creatine phosphate and 50 mg/ml creatine phosphokinase), pH 7.4, with Tris. Fusion was begun by adding 20 µl of cytosol to all wells except the NEM controls. The 96-well plate was incubated over moist heat in a shaking 37°C water bath for times as noted.Following removal from the water bath, samples were placed on ice to inhibit further fusion. A volume of fusion buffer titrated to pH 8.0 with KOH and containing 10 µM nigericin was added to double the volume of the fusion assay. By collapsing any vesicle acidification gradient secondary to the action of H+-ATPase or other causes, this assured optimal pH-dependent fluorescein fluorescence for fluorometric and flow cytometry measurements (23, 28).
Fluorometry analysis of fusion of vesicle populations in a cuvette by energy transfer. Fluorometry was performed on a Cambridge Technologies fluorometric plate reader. Excitation was performed at 490 ± 4 nm. Although a little below optimal fluorescein excitation, the efficiency loss at this wavelength was modest (<10%), and crossover rhodamine excitation was below 3% of its maximum (23). Energy transfer emission was measured at the rhodamine-dextran peak of 590 ± 4 nm, at which the fluorescein tail is at <5% peak emission (23). To control for cytosol autofluorescence, the negative controls tubes received 20 µl of cytosol immediately prior to plate reading. Repeat measures on duplicate samples, to determine reproducibility of the fluorometry fusion assay, had a Pearson correlation coefficient of 0.99 for n = 20.
Flow cytometry analysis of fusion of vesicle populations on a particle-by-particle basis. Samples from the cuvette-based assay of endosomal fusion were also analyzed by flow cytometry, which allows assessment of the distribution of the fluorescent signature used to report fusion. Flow cytometry was performed as for colocalization of fluorescein and phycoerthyrein signals above, with the exception that a 577- to 677-nm band-pass filter (optimal for energy transfer) replaced the 575- to 605-nm band-pass (optimal for phycoerythrein).
Electron Microscopy of Rabbit Endosomal Preparations
For electron microscopy analysis of endosomal fusion, following fusion, or NEM inhibition of controls, samples were fixed for electron microscopy with 2.5% glutaraldehyde in PBS (23, 28). The samples were then transferred to 1% osmium tetroxide in 0.05 M sodium phosphate (pH 7.2) for several hours, then dehydrated in an acetone series followed by embedding in Epon. Lead-stained thin sections were examined and photographed using a Philips model EM/200 electron microscope.Histology of Urinary Bladder With and Without Inflammation
Bladders are sectioned in 1- to 2-mm wide longitudinal strips, pinned to a cardboard surface in a relaxed state, and fixed by immersion in Bouin's fixative for 4 to 8 h (4, 5, 45). Tissues are rinsed in 50% and 70% alcohol and paraffin-embedded using a 7-h cycle. Serial 5-mm thick sections, including all layers of the bladder wall are mounted on poly-L-lysine-coated glass slides, dewaxed with xylene and alcohol, and exposed to Inhibisol (1,1,1-trichloroethane) for histochemical analysis. Sections are stained with hematoxylin and eosin, toluidine blue, Gemesia, or Alcian blue as appropriate (4, 5, 45).Detection of Substance P Receptor in Bladder Epithelium by RT-PCR
Rat bladder lumens were scraped with a glass slide to remove the transitional epithelium, pelleted by centrifugation, and snap-frozen at
70°C until RNA was isolated. Total RNA was first isolated,
followed by isolation of poly(A)+ RNA as previously
described (8, 32). Following reverse transcription, 10-20% of
each cDNA was amplified (Robocycler 40; Stratagene, La Jolla, CA) using
95°C denaturation, 63°C annealing, and 72°C extension
temperatures as previously described (32). Amplification was for a
total of 30 cycles, with the first three cycles having extended
denaturation and annealing times. Positive and negative strand PCR
primers, respectively, were derived from published sequences
representing bases 58-489 of the 5' end of the
cDNA for the substance P receptor (432-bp fragment):
CCAACACCTCCACCAACACTTCTG and GGACCCAGATGACAAAGATGACCACTT (27-29).
The PCR primers were derived from distinct exons to eliminate the
possibility of amplifying genomic DNA. This portion of the substance
P/NK1 receptor is highly distinctive, with little homology to the
neurokinin-2 or -3 receptors (NK2R and NK3R). Twenty percent of the PCR
reaction was electrophoresed on agarose/ethidium bromide gels and
visualized under ultraviolet light, so that a comparison of amplified
gene fragments could be made to DNA standards (Hae III digested
X174 DNA, Promega) electrophoresed on the same gel. Representative
fragments amplified for each gene in question were isolated from gels
and direct sequenced as described below to assure identity of the PCR
product. In addition, 5% of the same cDNA was subjected to PCR for
expression of the housekeeping mRNA, glyceraldehyde-3-phosphate
dehydrogenase, to assure that similar amounts of input RNA and that
similar efficiencies of reverse transcription were being compared.
Western Blot Analysis of Substance P Receptor
Substance P receptor antibody (a gift of Dr. J.-Y. Couraud, Paris VII University, Gif-sur-Yvette, France) was an idiotypic antibody (anti-PS-3) raised to 11 amino acids of the receptor binding site (11). This antibody recognizes the neurokinin-1 (NK1) receptor (NK1R) (11). SDS-PAGE was performed on a 10% gel using 4 µg protein per lane of highly enriched urinary bladder endosomes, a 1:1,000 dilution of primary anti-idiotypic antiserum, and revealed with the peroxidase-based ECL system (ECL, Springfield, IL). Protein content of endosomes was determined using bicinchoninic acid reagent (Pierce, Rockford, IL) to allow equal total protein loading on each gel lane. Density of protein bands on the gels was analyzed using NIH Image software.Confocal Microscopy of Ovalbumin Distribution
Fluorescein-ovalbumin was loaded into guinea pig bladders by instilling 1 ml of 1 mg/ml into the bladder of an anesthetized pig. After 60 min the bladder was washed vigorously through the catheter. The bladder was harvested and pieces cut of the entire bladder length. Slices of guinea pig bladder were fixed in 4% paraformaldehyde at room temperature for 1 h, washed in PBS, and permeabilized with ice-cold absolute methanol for 10 min. After repeat washing, tissues were stained with 1 U rhodamine phalloidin over night at 4°C. Bladder, lung, and rectum pieces were mounted on slides and examined using a Bio-Rad confocal microscope.Statistics
Statistical analyses were performed by one-way ANOVA and Scheffé's post hoc comparison. Data are expressed as means ± SE.| |
RESULTS |
|---|
|
|
|---|
Purity of Endosomal Fractions in the Guinea Pig
To determine the purity of the endosomal fraction isolated from guinea pig urinary bladder by discontinuous gradient centrifugation, flow cytometry was utilized to assay for entrapped fluorescein dextran and uroplakin III on a particle-by-particle basis. This has previously demonstrated that rabbit endosomes can be isolated >98% pure by simple gradient centrifugation methods (14). Studies depicted in Fig. 1 examined each membrane particle harvested from a discontinuous sucrose gradient for the presence of entrapped endosomal fluid phase uptake of fluorescein-dextran and the presence of the bladder-specific protein, uroplakin III, which is heavily concentrated in endosomes (14). Figure 1A defines the level of autofluorescence and nonspecific binding by examining the fluorescent emission of bladders exposed to nonfluorescent dextran and labeled with preimmune serum. Each panel in Fig. 1 depicts 2,000 membrane vesicles with fluorescein fluorescence, and phycoerythrein goat anti-rabbit secondary antibody fluorescence on the horizontal axes, and number of particles per channel up out of the page. When bladders are incubated in fluorescein dextran and labeled with a rabbit polyclonal anti-uroplakin III antiserum, there is greater than a log shift in fluorescence intensity such that more than 99% of the membrane vesicles are endosomal, as evidenced by the presence of entrapped fluorescein and uroplakin III antibody staining (Fig. 1B; control, 12 ± 7; uroplakin III, 243 ± 31 fluorescence channels; n = 4, P < 0.05).
|
Optimization and Validation of Urinary Bladder Endosomal Fusion Reconstituted In Vitro
The principal of the fusion assayed is diagrammed in Fig. 2A (21, 23, 28). Endosomes loaded with either fluorescein or rhodamine dextrans are mixed in a tube. Laser light at 488 nm excites fluorescein dextran entrapped in endosomes but not rhodamine dextran. The rhodamine dextran can only be excited by the emission of the fluorescein dextran and only if the intermolecular fluorescein rhodamine distance is less than 10 nm, which is less than the distance across a single bilipid membrane. These "spectroscopic ruler" effects of energy transfer between two different fluorescent dextrans make energy transfer uniquely suitable for assays of fusion: if energy transfer is observed, then the donor and acceptor molecules are unequivocally within 1-6 nm in the same membrane-bound compartment (23). Energy transfer will not occur across a 7.5-nm lipid bilayer membrane. Fusion can be assayed in an entire population of vesicles in a cuvette, or on a vesicle-by-vesicle basis using small particle flow cytometry analysis. These assays have recently been optimized and validated (23).
|
Determination of optimal cytosol concentration for rabbit urinary bladder endosomes is depicted in Fig. 2B. Fusion is heavily cytosol concentration dependent with a unimodal Gaussian distribution peaking at 20% cytosol (n = 6). Above and below 20% cytosol, there is potent inhibition of fusion. NEM-treated membranes, which do not fuse, define the "negative control" level of autofluorescence. Just as cytosol is inhibitory above its optimal concentration, so is ATP. When examined at the peak 25% cytosol concentration, optimal concentration of ATP in rabbit urinary bladder endosomes is biphasic with peaks at 0 mM and 1.0 mM exogenous ATP (Fig. 2C). Zero added ATP actually contains 370 µM ATP in the 20% of its volume comprising cytosol: ATP is indispensable to stabilize NSF in the cytosol (6) and has a final concentration of 74 µM (0.074 mM). Optimization of fusion of guinea pig bladder endosomes has virtually identical optima (data not shown).
Electron micrographs of rabbit urinary bladder endosomes before and
after fusion confirm that the changes in fluorescence signatures are
indicative of endosomal fusion. Prior to fusion, the endosomes are
relatively small, immersed in a background of polymerized microtubules
and other elements in the cytosol (Fig. 3A). Following fusion, the
average vesicle size increases more that sevenfold (average diameter
increases 7.2 ± 0.4-fold, n = 100 vesicles counted,
arbitrary units) (Fig. 3B).
|
Bladder Inflammation is Associated With Both Decreased Dye Uptake and Inhibition of Endosomal Fusion
Flow cytometry analysis of entrapped fluorescein dextran in endosomes prepared by differential centrifugation from control and inflamed bladders on an endosome-by-endosome basis demonstrated that >98% of the membranes in each fraction contained entrapped fluorescein (see Fig. 1). Quantitation of the entrapped fluorescein showed a 20% reduction in the uptake of fluorescent dye in the inflamed bladders (407 ± 3 arbitrary fluorescent units, mean of n = 4 bladders with 2,000 individual endosomes observations in each bladders) compared with control bladders (505 ± 20 arbitrary fluorescent units; n = 4, P < 0.01). Compared with control bladders, there was no difference in the dye uptake in bladders treated with CP-96,345 (414 ± 15 arbitrary fluorescent units, n = 4), or bladder challenged with ovalbumin and treated with CP-96,345 (438 ± 31 arbitrary fluorescent units, n = 4). There is a difference in dye uptake between ovalbumin with and without CP-96,345.Endosomal fusion was reconstituted in vitro in inflamed and noninflamed
bladders, analyzed both by cuvette-based assays on whole populations of
endosomes and by flow cytometry analysis on an endosome-by-endosome
basis. This includes techniques to control for differences in dye
uptake such as ratioing fluorescein to rhodamine signals. In
cuvette-based assays, endosomal fusion was significantly inhibited in
inflamed bladders (11.8 ± 2.5 arbitrary fluorescent units/mg protein)
compared with control bladders (27.8 ± 3.9 arbitrary fluorescent
units/mg protein; n = 4, P = 0.014, each n
represents the mean of 2,000 observations on endosomes derived from a
different bladder) (Fig. 4). By flow
cytometry analysis of fusion in control bladders (59.2 ± 4.4 arbitrary fluorescent units) provides an independent measure of
inhibition in inflamed bladders (25.0 ± 2.8 arbitrary fluorescent
units; n = 5, P = 0.00017) (Fig. 4). Measurements of
energy transfer demonstrate that in endosomes from inflamed bladders,
much less fusion is observed. Rhodamine fluorescence by energy transfer
is seen as a single bell-shaped curve in the unfused control, but there
is a half-log shift to the right on fusion, as the fluorescein emission
now excites the rhodamine dye (Fig.
5A; 12 ± 4 control, 37 ± 6 fused, arbitrary fluorescence units, P < 0.05). In
endosomes from inflamed bladders. The unfused controls and fused
histograms are very similar (Fig. 5B; 11 ± 5 compared with 12 ± 7 arbitrary channels).
|
|
Aside from the fact that the decrease in fusion in endosomes isolated from inflamed bladders is much greater than the 20% attributable to less dye uptake, ratioing fluorescein to rhodamine measurements in the cuvette assay to control for dye uptake confirms inhibition of fusion in inflamed (1.00 ± 0.03) compared with control bladders (1.50 ± 0.07 arbitrary fluorescence units; n = 4, P < 0.05). Hence, direct functional assay of endosomal fusion by reconstitution in vitro demonstrates that fusion of subapical endosomes is inhibited during bladder inflammation.
Substance P Receptor Mediates Inhibition of Fusion During Bladder Inflammation
To determine whether substance P receptor plays a role in the inhibition of fusion observed during bladder inflammation using the ovalbumin presensitization model in guinea pigs, we examined the effects of CP-96,345, a selective substance P receptor antagonist. Groups of inflamed and control guinea pigs were prepared presensitized to ovalbumin or vehicle treated. On the evening of antigenic challenge by bladder instillation of ovalbumin, groups of guinea pigs were treated with 4 mg/kg of the nonpeptide substance P antagonist, CP-96,345, 1 h prior to ovalbumin instillation. The selective substance P receptor antagonist, CP-96,345, was administered in vivo, but endosome fusion was assessed by a cuvette assay; CP-96,345 increased fusion in inflamed bladders to 22.2 ± 8.1 arbitrary fluorescence units (n = 4, P < 0.04), but had no effect on control bladders (25.8 ± 5.5 arbitrary fluorescence units, n = 4) (Fig. 4). Hence, the inflammatory response of the urinary bladder includes vacuolation of the subapical compartment of transitional epithelial cells, in association with substance P receptor-dependent inhibition of endosomal fusion.Light Microscopy of Transitional Epithelial Cells Effects of Inflammation
The transitional epithelial cells lining the urinary bladder form a contiguous stratified layer of rounded to club-shaped cells with homogeneous cytoplasm on light microscopy at relatively low (×160, Fig. 6A) in the relaxed bladder. At 16 h postovalbumin inflammatory challenge of animals presensitized to ovalbumin, the epithelium is not yet ulcerated, but the subapical region of the transitional epithelial cells is full of large clear vacuoles seen at relatively low (×160, Fig. 6B) or higher power (×1,600, Fig. 6, C and D). The submucosa is replete with inflammatory cells, edema, and vascular congestion. Treatment with CP-96,345 prevents the vacuolization following inflammatory challenge (×1,600, Fig. 6E). CP-96,345 alone is not associated with any manifest histological changes (×1,600, Fig. 6F).
|
Detection of Substance P Receptor mRNA in Bladder Epithelium by RT-PCR
The ability of the substance P receptor antagonist, CP-96,345, to effectively increase endosomal fusion in inflamed bladders strongly suggested that this is a substance P receptor-mediated event. We therefore determined whether the substance P receptor was present in rat bladder transitional epithelium by mRNA analysis. As shown in Fig. 7, two different preparations of urinary bladder (lanes 2 and 3, UB) expressed significant substance P receptor mRNA, which was identical in size to that amplified from rat brain (lane 1, BR), but substance P receptors were absent in control cells (lymphocytes, lane LY). The amplified material was mRNA, since no amplification occurred in similar reactions where reverse transcriptase was omitted from the cDNA reaction (lane 4, UB
RT). Clearly, the transitional epithelium of the rat urinary bladder expresses substance P receptor mRNA.
|
Western Blot Analysis of Substance P Receptor in Guinea Pig Bladder Endosomes
Western blot analysis of endosomes for the substance P receptor with an anti-idiotypic antibody (11), which recognizes the substance P receptor, showing a single band at close to 100 kDa molecular mass (Fig. 8). Comparison of optical density of the circa 100 kDa band shows significantly more receptor in the inflamed (624 ± 252 arbitrary optical units) compared with control bladders (313 ± 99, n = 3, P < 0.05)
|
Confocal Microscopy Analysis of Ovalbumin Distribution
To demonstrate whether ovalbumin instilled into the guinea pig bladder enters the mucosa, fluorescein-ovalbumin was instilled into a normal bladder and confocal analysis of various tissues was performed. Images of the urinary bladder (Fig. 9A) demonstrate the fluorescein ovalbumin, shown in green on the surface, and throughout the endosomal pathway of the transitional epithelial cells. Rhodamine phalloidin, which binds to actin filaments and shows red in the images, displays the background cytoskeletal structure. None of the ovalbumin dye passes systemically to the lungs (Fig. 9B). A small amount of the ovalbumin dye is detectable in the rectum (Fig. 9C), although it is unclear whether this is secondary to local or vascular spread.
|
| |
DISCUSSION |
|---|
|
|
|---|
This study provides two lines of evidence that mammalian urinary bladder endosomal fusion can be reconstituted in vitro. Evidence for fusion was derived both from electron microscopic assay of the increase in the size of endosomal structures following fusion, as well as cuvette-based and flow cytometry assays of fusion based on energy transfer between entrapped fluorophores. Energy transfer is known as a "spectroscopic ruler" providing unequivocal evidence of mixing of the endosome contents. This is because energy transfer will only occur at distances less than 10 Å, which is less than the distance across a single cell membrane (23). The marked ATP and cytosol dependence of the energy transfer measurements validates that we are measuring true fusion events and not merely vesicle aggregation artifacts (41). Urinary bladder endosomes therefore join a short list of mammalian membranes whose fusion has been reconstituted in vitro. These membranes include rat liver microsomes (15), rat renal cortical endosomes (21, 23), and rat renal papillary endosomes (28).
Our studies of endosomal fusion differ from most other laboratories in our approach to fusion assays (21, 23, 28). First, to dissect the tissue-specific mechanisms of endosomal fusion, we utilize endosomes freshly isolated directly from the differentiated mammalian tissues. Second, rather then relying on compartment-specific delivery of endosomal markers in a postnuclear supernatant (3, 6, 20), we fuse highly purified endosomal fractions. Last, we reconstitute endosomal fusion directly in the test tube. This powerful approach allows direct dissection of the molecular mechanisms of endosomal fusion.
The current study also provides fresh understanding of endosomal trafficking and fusion in inflamed bladders. Reduced endocytotic uptake of fluorescein-dextran suggests changes in the kinetics of endosomal trafficking accompany inflammation. In keeping with this suggestion, inflammation was associated with an inhibition of endosomal fusion far beyond what can be explained by the reduced dye uptake. Inhibition of endosomal fusion in the inflamed bladders was confirmed even when ratioing procedures that correct for differences in dye uptake were employed for analysis of the data. Changes in endosomal fusion are postulated to be directly linked to changes in membrane trafficking via changes in membrane thermodynamics (44).
Our observation that administration of the substance P receptor antagonist CP-96,345 largely restores the fusion deficit associated with bladder inflammation extends previous observations that receptors can change the fusion properties of membranes in which they reside (21). A specific peptide sequence in the cytosolic tail of megalin, a single transmembrane domain giant glycoprotein receptor for gentamicin and other polybasic drugs, can potently effect the fusion properties of renal intermicrovillar clefts using an in vitro reconstitution of endosomal fusion (21). The sequence that determines receptor internalization is also the sequence active in changing membrane fusion properties (21). This suggests that resident receptors can modulate membrane fusion properties and, taken together with our current observations on the substance P receptor, suggests that the substance P receptor may also mediate membrane fusion properties. To directly determine whether the substance P receptor plays a role in the inflammatory inhibition of endosomal fusion, fusion was assayed in guinea pigs administered the specific substance P (NK1) receptor competitive antagonist CP-96,345. There was no detectable nonspecific effect of CP-96,345 on basal endosomal fusion, but the compound largely corrected the inhibition of fusion in endosomes isolated from inflamed bladders. This provides direct evidence that amelioration of bladder inflammation with CP-96,345 (29) also ameliorates the defect in endosomal fusion.
Substance P receptors have been suggested to traffic into endosomes as a mechanism of desensitization (18). Substance P administration is associated with internalization of NK1Rs into endosomes in endothelial cells of postcapillary venules in the rat tracheal mucosa (9). To complement the functional evidence for the presence of the substance P receptor in urinary bladder endosomes, we tested for the receptor using specific antibody probes. Western blot analysis of the urinary bladder endosomes with an NK1R-specific serum (11) revealed a predominant band close to 100 kDa. Western blot analysis of rat brain substance P receptor (39) demonstrated an identical pattern, suggesting abundant glycosylation to explain an observed molecular mass much greater than the 40 kDa predicted from the amino acid sequence (12, 25, 47). Hence, structural data derived from specific antisera extend the functional evidence that the NK1R isoform is present in the bladder and that this receptor traffics into endosomes.
Several lines of evidence suggest that substance P plays a role as an inflammatory mediator in tissues other than the urinary bladder. SR-140333, a selective NK1 antagonist, inhibits antigen-induced edema formation in rat skin (26). Tachykinin receptors mediate mouse ear edema formation and plasma extravasation induced by substance P, neurokinin A, and neurokinin B (27). Although substance P was described almost 20 years ago as a histamine-releasing agent, the mechanism of its action on mast cells is still not fully understood. Most of the physiological effects of substance P and related neuropeptides depend on their COOH- and NH2-terminal peptide sequence acting on neurokinin (NK1, NK2, or NK3) receptors (12, 18, 33). Moreover, a central role of substance P receptors in inflammation was recently demonstrated by abolition of antigen-induced cell migration in mice with gene-target disruption of NK1Rs (10).
Identification and cloning of several proteins that participate in the final common pathway of cellular membrane fusion has laid emphasis on the central role of membrane fusion events in maintenance of cell polarity, vectored delivery of cellular constituents, and diverse membrane trafficking events (3, 42, 43). The thermodynamics of the interactions of the proteins mediating fusion has been postulated to have dramatic effects on cellular organelle structure, such as dissolution and reformation of the Golgi complex with inhibition and restoration of fusion competence in the cell cytoplasm (44). This thesis predicts that the dramatic changes in endosomal fusion we observe with inflammation should be accompanied by structural changes in the pathway. Vacuolization of the subapical endosomal pathway associated with fusion on light microscopy of the urinary bladder is consistent with this prediction.
Substance P is also directly linked to bladder inflammation. Investigation of the chemical mediators of bladder inflammation has emphasized the central importance of substance P. Not only is substance P released by inflamed bladders (4), but instillation of substance P into normal bladders induces inflammation (5).
In human bladder detrusor smooth muscle, early functional studies indicated the presence of NK2Rs (16, 48). However, more recently, an iodinated form of substance P was shown to bind a single class of binding sites, with a potency order of displacement characteristic for the NK1R (1). Functional studies on guinea pig bladder contraction report effects consistent with mediation by both NK1R and NK2R, but not NK3R (13, 35). We extend and complement these observation by demonstrating for the first time the presence of NK1R antigenicity in guinea pig transitional cell endosomes on Western blot analysis, as well as the presence of NK1R mRNA in rat bladder scrapings by RT-PCR with sequence confirmation of receptor specificity.
Several lines of evidence suggest a central role for substance P and the NK1 receptor as mediators of inflammation in diverse tissues. The development and utilization of NK1R knockout mice has demonstrated the central mechanistic role of this receptor in Clostridium difficile-induced enteritis (13a), acute pancreatitis (3a) and associated lung injury (3a), granulomatous response in murine schistosomiasis mansoni (6a), and mast cell-dependent edema formation (12a). In the urinary bladder, NK1R antagonists have been used to demonstrate substance P participation in experimental cystitis (23, 24). In addition, the finding that bladder biopsies from patients with interstitial cystitis present increased nerve density (20), substance P fibers (21), and NK1Rs (22) further indicates the participation of this peptide in cystitis.
Colocalization of entrapped fluorescein-dextran as an endosomal marker with uroplakin antibody binding demonstrates that our membrane fraction is a highly enriched preparation of transitional cell endosomes (14, 34). This emphasizes that the fusion changes we observe during bladder inflammation, and their reversal with NK1R-competitive antagonists, are acting in the subapical endosomal compartment of transitional epithelial cells. NK1Rs have been reported in the urothelium previously (37); we now demonstrate their central functional importance during bladder inflammation and the major role of membrane fusion events as a mediator of these changes.
Several lines of evidence link specific motifs in other seven transmembrane domain receptors to changes in endosomal fusion (2, 24). A peptide sequence representing the internalization motif in the cytosolic tail of the AT1a isoform of ANG II receptors in rat renal endosomes potently modulates membrane fusion events. Similarly, specific defined sequences in the cytosolic domain of the bradykinin BK2 receptor can potently modulate endosomal fusion in rat urinary bladder endosomes (24). This data extends these observations in a new direction, by linking NK1R blockade to reversible changes in membrane fusion, and dye uptake, in the complex setting of bladder inflammation. This suggests that part of the defect occurring during inflammation of the bladder lies in the mucosa, inflammatory changes in the mucosa are dependent on membrane fusion events, and substance P is a central mediator of each of these changes in membrane fusion and trafficking.
This study introduces a new concept in the pathophysiology of bladder inflammation. Using reconstitution of endosomal fusion in vitro as a tool, part of the defect occurring during bladder inflammation is localized to the subapical endosomal compartment of transitional epithelial cells. Bladder inflammation is associated with changes in endosomal dye uptake and fusion properties. A central role is suggested for specific proteins resident in this compartment, in particular the substance P receptor. This demonstrates directly new mechanisms by which substance P, acting as an inflammatory mediator, affords direct effects on basic membrane properties that determine membrane trafficking, cell polarity, and ultimately the integrity of the epithelium.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Rebecca R. Majewski and Amy M. Amendt-Raduege for excellent technical assistance.
| |
FOOTNOTES |
|---|
* T. G. Hammond and R. Saban contributed equally to this work.
Supported by National Institutes of Health Grants RO1-DK-51392 (to T. G. Hammond and R. Saban), RO1-DK-43556 (to T. G. Hammond, H. W. Harris, Jr., and M. L. Zeidel), RO1-DK-49471 (to R. Saban, D. E. Bjorling), and AI-32976 (to K. L. Bost), by the Tulane University Chancellor's Program in Women's Health (to T. G. Hammond and K. L. Bost), and by the Interstitial Cystitis Association (to T. G. Hammond). T. G. Hammond is the recipient of a Veterans Affairs Research Associate Career Development Award.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: T. G. Hammond, Nephrology Section SL45, Tulane Univ. School of Medicine, 1430 Tulane Ave., New Orleans, LA 70112 (E-mail: thammond{at}mailhost.tcs.tulane.edu).
Received 23 July 1998; accepted in final form 2 November 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Appell, K. C.,
B. J. Fragale,
J. Loscigm,
S. Singh,
and
B. E. Tomczuk.
Antagonists that demonstrate species differences in neurokinin-1 receptors.
Mol. Pharmacol.
41:
772-778,
1992[Abstract].
2.
Becker, B.,
H. F. Cheng,
T. Hammond,
and
R. C. Harris.
An association between angiotensin II receptor-mediated endocytosis, arachidonic acid release and sodium flux in a proximal tubule model (Abstract).
J. Am. Soc. Nephrol.
7:
1307,
1996.
3.
Bennett, M. K.,
and
R. H. Scheller.
The molecular machinery for secretion is conserved from yeast to neurons.
Proc. Natl. Acad. Sci. USA
90:
2559,
1993
3a.
Bhatia, M.,
A. K. Saluja,
B. Hofbauer,
J. L. Frossard,
H. S. Lee,
I. Castagliuolo,
C. C. Wang,
N. Gerard,
C. Pothoulakis,
and
M. L. Steer.
Role of substance P and the neurokinin 1 receptor in acute pancreatitis and pancreatitis-associated lung injury.
Proc. Natl. Acad. Sci. USA
95:
4760-4765,
1998
4.
Bjorling, D. E.,
M. R. Saban,
M. J. Zine,
M. Haak-Frendscho,
F. M. Graziano,
and
R. Saban.
In vitro passive sensitization of guinea pig, rhesus monkey and human bladders as a model of noninfectious cystitis.
J. Urol.
152:
1603-1608,
1994[Web of Science][Medline].
5.
Bjorling, D. E.,
M. R. Saban,
and
R. Saban.
Effect of octreotide, a somatostatin analogue, on release of inflammatory mediators from isolated guinea pig bladder.
J. Urol.
158:
258-264,
1997[Web of Science][Medline].
6.
Block, M. R.,
B. S. Glick,
C. A. Wilcox,
F. T. Wieland,
and
J. E. Rothman.
Purification of an N-ethylmaleimide-sensitive protein catalyzing vesicle transport.
Proc. Natl. Acad. Sci. USA
85:
7852-7856,
1988
6a.
Blum, A. M.,
A. Metwali,
M. Kim-Miller,
J. Li,
K. Qadir,
D. E. Elliott,
B. Lu,
Z. Fabry,
N. Gerard,
and
J. V. Weinstock.
The substance P receptor is necessary for a normal granulomatous response in murine schistosomiasis mansoni.
J. Immunol.
162:
6080-6085,
1999
7.
Bost, K. L.,
and
M. J. Mason.
Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages.
J. Immunol.
155:
285-296,
1995[Abstract].
8.
Bost, K. L.
Inducible preprotachykinin mRNA expression in mucosal lymphoid organs following oral immunization with Salmonella.
J. Neuroimmunol.
62:
59-67,
1995[Web of Science][Medline].
9.
Bowden, J. J.,
A. M. Garland,
P. Baluk,
P. Lefevre,
E. F. Grady,
S. R. Vigna,
N. W. Bunnett,
and
D. M. McDonald.
Direct observation of substance P-induced internalization of neurokinin-1 (NK1) receptors at sites of inflammation.
Proc. Natl. Acad. Sci. USA
91:
8964-8968,
1994
10.
Bozic, C. R.,
B. Lu,
U. E. Hopen,
G. Gerard,
and
N. P. Gerard.
Neurogenic amplification of immune complex inflammation.
Science
273:
1722-1725,
1996
11.
Bret-Dibat, J. L.,
D. Zouaoui,
O. Dery,
F. Zerari,
J. Grassi,
S. Maillet,
M. Conrath,
and
J. Y. Courand.
Antipeptide polyclonal antibodies that recognize a substance P-binding site in mammalian tissues: a biochemical and immunocytochemical study.
J. Neurochem.
63:
333-343,
1994[Web of Science][Medline].
12.
Buck, S. H.
The Tachykinin Receptors. Totowa, NJ: Humana, 1994.
12a.
Cao, T.,
N. P. Gerard,
and
S. D. Brain.
Use of NK(1) knockout mice to analyze substance P-induced edema formation.
Am. J. Physiol. Regulatory Integrative Comp. Physiol.
277:
R476-R481,
1999
13.
Carruette, A.,
S. M. Moussaoui,
A. Champion,
D. Cottez,
P. Goniot,
and
C. Garret.
Comparison in different tissue preparations of the in vitro pharmacological profile of RP 67580, a new non-peptide substance P antagonist.
Neuropeptides
23:
245-250,
1992[Web of Science][Medline].
13a.
Castagliuolo, I.,
M. Riegler,
A. Pasha,
S. Nikulasson,
B. Lu,
C. Gerard,
N. P. Gerard,
and
C. Pothoulakis.
Neurokinin-1 (NK-1) receptor is required in Clostridium difficile-induced enteritis.
J. Clin. Invest.
101:
1547-1550,
1998[Web of Science][Medline].
14.
Chang, A.,
T. G. Hammond,
T. T. Sun,
and
M. L. Zeidel.
Permeability properties of the mammalian bladder apical membrane.
Am. J. Physiol. Cell Physiol.
267:
C1483-C1492,
1994
15.
Comerford, J. G.,
and
A. P. Dawson.
The effect of limited proteolysis on GTP-dependent Ca2+ efflux and GTP-dependent fusion in rat liver microsomal vesicles.
Biochem. J.
258:
823-829,
1989[Web of Science][Medline].
16.
Dion, S.,
N. Rouissi,
F. Nantel,
G. Drapeau,
D. Regoli,
E. Naline,
and
C. Advenier.
Receptors for neurokinins in human bronchus and urinary bladder are of the NK-2 type.
Eur. J. Pharmacol.
178:
215-219,
1990[Web of Science][Medline].
17.
Galli, T.,
P. S. McPherson,
and
P. De Camilli.
The V0 sector of the V-ATPase, synaptobrevin, and synaptophysin are associated on synaptic vesicles in a Triton X-100-resistant, freeze-thawing sensitive, complex.
J. Biol. Chem.
271:
2193-2198,
1996
18.
Garland, A. M.,
E. F. Grady,
D. G. Payan,
S. R. Vigna,
and
N. W. Burnett.
Agonist-induced internalization of the substance P (NK1) receptor expressed in epithelial cells.
Biochem. J.
303:
177-186,
1994.
19.
Greeno, E. W.,
P. Mantyh,
G. M. Vercellotti,
and
C. F. Moldow.
Functional neurokinin 1 receptors for substance P are expressed by human vascular endothelium.
J. Exp. Med.
177:
1269-1276,
1993
20.
Gruenberg, J. E.,
and
K. E. Howell.
Reconstitution of vesicle fusions occurring in endocytosis with a cell-free system.
EMBO J.
5:
3091-3101,
1986[Web of Science][Medline].
21.
Hammond, T. G.,
R. R. Majewski,
J. H. Kaysen,
F. O. Goda,
G. L. Navar,
F. Pontillon,
and
P. J. Verroust.
Gentamicin inhibits rat renal cortical homotypic endosomal fusion: role of megalin.
Am. J. Physiol. Renal Physiol.
272:
F117-F123,
1997
22.
Hammond, T. G.,
R. R. Majewski,
D. J. Morre,
K. Schell,
and
L. W. Morrissey.
Forward scatter pulse width signals resolve multiple populations of endosomes.
Cytometry
14:
411-420,
1993[Web of Science][Medline].
23.
Hammond, T. G.,
R. R. Majewski,
K. E. Muse,
T. D. Oberley,
L. W. Morrissey,
and
A. M. Amendt-Raduege.
Energy transfer assays of rat renal cortical endosomal fusion: evidence for superfusion.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
267:
F1021-F1033,
1994
24.
Hammond, T. G., M. R. Saban, and R. Saban.
The bradykinin-2 receptor directly effects endosomal fusion via
cytosolic domains. Proc. Int. Res. Symp. Interstitial Cystitis,
Washington DC, October 30-31, 1997, p. 65.
25.
Herbert, J. M.,
and
A. Bernat.
Effect of SR 140333, a selective NK1 antagonist on antigen induced oedema formation in rat skin.
J. Lipid Mediat. Cell Signal.
13:
223-232,
1996[Web of Science][Medline].
26.
Hershey, A. D.,
and
J. E. Krause.
Molecular characterization of a functional cDNA encoding the rat substance P receptor.
Science
247:
958-962,
1990
27.
Inoue, H.,
N. Nagata,
and
Y. Koshihara.
Involvement of tachykinin receptors in oedema formation and plasma extravasation induced by substance P, neurokinin A, and neurokinin B in mouse ear.
Inflamm. Res.
45:
316-323,
1996[Web of Science][Medline].
28.
Jo, I.,
H. W. Harris,
A. M. Amendt-Raduege,
R. R. Majewski,
and
T. G. Hammond.
Rat kidney papilla contains abundant synaptobrevin protein that participates in the fusion of anti-diuretic hormone (ADH) water channel-containing endosomes in vitro.
Proc. Natl. Acad. Sci. USA
92:
1876-1880,
1995
29.
Kataeva, G.,
A. Agro,
and
A. M. Stanisz.
Substance-P-mediated intestinal inflammation: inhibitory effects of CP 96,345 and SMS 201-995.
Neuoimmunomodulation
1:
350-356,
1994[Medline].
30.
Kim, Y. S.,
P. A. Longhurst,
A. J. Wein,
and
R. M. Levin.
Effects of sensitization on female guinea pig urinary bladder function: in vivo and in vitro studies.
J. Urol.
146:
454-460,
1991[Web of Science][Medline].
31.
Kim, Y. S,
R. M. Levin,
A. J. Wein,
and
P. A. Longhurst.
Effects of sensitization on the permeability of the urothelium in the guinea pig urinary bladder.
J. Urol.
147:
270-276,
1992[Web of Science][Medline].
32.
Kincy-Cain, T.,
and
K. L. Bost.
Increased susceptibility of mice to Salmonella infection following in vivo treatment with the substance P antagonist, Spantide II.
J. Immunol.
157:
255-264,
1996[Abstract].
33.
Knodell, R. G.,
and
L. E. Rosenthal.
Stress-related mucosal damage: critical evaluation of potential new therapeutic agents.
Pharmacotherapy
7:
104S-109S,
1987[Medline].
34.
Lin, J. H,
X. R. Wu,
G. Kreibichi,
and
T. T. Sun.
Precursor sequence, processing, and urothelium-specific expression of a major 15-kDa protein subunit of asymmetric unit membrane.
J. Biol. Chem.
269:
1775-1784,
1994
35.
Longmore, J.,
and
R. G. Hill.
Characterization of NK receptors in guinea-pig urinary bladder smooth muscle: use of selective antagonists.
Eur. J. Pharmacol.
222:
167-170,
1992[Web of Science][Medline].
36.
Lu, B.,
M. Figini,
C. Emanueli,
P. Geppetti,
E. F. Grady,
N. Gaerard,
J. Ansell,
D. G. Payan,
G. Gerard,
and
N. Bunnett.
The control of microvascular permeability and blood pressure by neutral endopeptidase.
Nat. Med.
3:
9040-907,
1997.
37.
Marchand, J. E.,
G. R Sant,
and
R. M. Kream.
Increased expression of substance P receptor-encoding mRNA in bladder biopsies from patients with interstitial cystitis.
Br. J. Urol.
81:
224-228,
1998[Web of Science][Medline].
38.
Minsky, B. D.,
and
F. J. Chlapowski.
Morphometric analysis of the translocation of lumenal membrane between cytoplasm and cell surface of transitional epithelial cells during the expansion-contraction cycles of mammalian urinary bladder.
J. Cell Biol.
77:
685-697,
1978
39.
Moussaoui, S. M.,
E. Hermans,
A. M. Mathieu,
B. Bonici,
F. Clerc,
F. Guinet,
C. Garret,
and
P. M. Laduron.
Polyclonal antibodies against the rat NK1 receptor: characterization and localization in the spinal cord.
Neuroreport
3:
1073-1076,
1992[Web of Science][Medline].
40.
Pang, X.,
J. Marchand,
G. R. Sant,
R. M. Kream,
and
T. C. Theoharides.
Increased number of substance P positive nerve fibres in interstitial cystitis.
Br. J. Urol.
75:
744-750,
1995[Web of Science][Medline].
41.
Rand, R. P.,
B. Kachar,
and
T. S. Reese.
Dynamic morphology of calcium-induced interactions between phosphatidylserine vesicles.
Biophys. J.
47:
483-489,
1985[Web of Science][Medline].
42.
Ruggieri, M. R,
M. J. Chelsky,
S. I. Rosen,
T. J. Shickley,
and
P. M. Hanno.
Current findings and future research avenues in the study of interstitial cystitis.
Urol. Clin. North Am.
21:
163-176,
1994[Web of Science][Medline].
43.
Rothman, J. E.
Mechanisms of intracellular protein transport.
Nature
372:
55-63,
1994[Medline].
44.
Rothman, J. E.,
and
G. Warren.
Implications of the SNARE hypothesis for intracellular membrane topology and dynamics.
Curr. Biol.
4:
220-233,
1994[Web of Science][Medline].
45.
Saban, R,
B. J. Undem,
I. M. Keith,
M. R. Saban,
M. W. Tengowski,
F. M. Graziano,
and
D. E. Bjorling.
Differential release of prostaglandins and leukotrienes by sensitized guinea pig urinary bladder layers upon antigen challenge.
J. Urol.
152:
544-549,
1994[Web of Science][Medline].
46.
Walsh, D. A.,
M. Salmon,
P. I. Mapp,
J. Wharton,
N. Garrett,
D. R. Blake,
and
J. M. Polak.
Microvascular substance P binding to normal and inflamed rat and human synovium.
J. Pharmacol. Exp. Ther.
267:
951-960,
1993
47.
Yokota, Y.,
Y. Sakai,
K. Tanaka,
T. Fujiwara,
K. Tsuchida,
R. Shigemoto,
A. Kakizuka,
H. Ohkubo,
and
S. Nakanishi.
Molecular characterization of a functional cDNA for rat substance P receptor.
J. Biol. Chem.
264:
17649-17652,
1989
48.
Zeng, X. P.,
and
E. Burcher.
Tachykinin NK-2 receptors in child urinary bladder.
J. Urol.
155:
1104-1107,
1996[Web of Science][Medline].
This article has been cited by other articles:
![]() |
I. Dozmorov, M. R. Saban, N. P. Gerard, B. Lu, N.-B. Nguyen, M. Centola, and R. Saban Neurokinin 1 receptors and neprilysin modulation of mouse bladder gene regulation Physiol Genomics, February 6, 2003; 12(3): 239 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Saban, N. P. Gerard, M. R. Saban, N.-B. Nguyen, D. J. DeBoer, and B. K. Wershil Mast cells mediate substance P-induced bladder inflammation through an NK1 receptor-independent mechanism Am J Physiol Renal Physiol, October 1, 2002; 283(4): F616 - F629. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Saban, R. Saban, T. G. Hammond, M. Haak-Frendscho, H. Steinberg, M. W. Tengowski, and D. E. Bjorling LPS-sensory peptide communication in experimental cystitis Am J Physiol Renal Physiol, February 1, 2002; 282(2): F202 - F210. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. SABAN, M. R. SABAN, N.-B. NGUYEN, T. G. HAMMOND, and B. K. WERSHIL Mast cell regulation of inflammation and gene expression during antigen-induced bladder inflammation in mice Physiol Genomics, October 10, 2001; 7(1): 35 - 43. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |