|
|
||||||||
Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100, Israel
| |
ABSTRACT |
|---|
|
|
|---|
Aldosterone is the major corticosteroid
regulating Na+ absorption in tight epithelia and acts
primarily by activating the epithelial Na+ channel (ENaC)
through unknown induced proteins. Recently, it has been reported that
aldosterone induces the serum- and glucocorticoid-dependent kinase
sgk and that coexpressing ENaC with this kinase in Xenopus laevis oocytes increases the amiloride-sensitive Na+
current (Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J,
Buse P, Firestone GL, Verrey F, and Pearce D. Proc Natl Acad Sci
USA 96: 2514-2519, 1999). The present study was done to
further characterize regulation of sgk by aldosterone in native
mammalian epithelia and to examine its effect on ENaC. With both in
vivo and in vitro protocols, an almost fivefold increase in the
abundance of sgk mRNA has been demonstrated in rat kidney and
colon but not in lung. Induction of sgk by aldosterone was
detected in kidney cortex and medulla, whereas the papilla expressed a
constitutively high level of the kinase. The increase in sgk
mRNA was detected as early as 30 min after the hormonal application and
was independent of de novo protein synthesis. The observed aldosterone
dose-response relationships suggest that the response is mediated, at
least in part, by occupancy of the mineralocorticoid receptor.
Coexpressing sgk and ENaC in Xenopus oocytes evoked a
fourfold increase in the amiloride-blockable Na+ channel
activity. A point mutation in the
-subunit known to impair
regulation of the channel by Nedd4 (Y618A) had no significant effect on
the response to sgk.
epithelial sodium channel; Xenopus laevis oocytes; kidney collecting duct
| |
INTRODUCTION |
|---|
|
|
|---|
THE APICAL SURFACE OF MANY tight epithelia expresses a
Na+-selective channel primarily characterized by its high
affinity to the diuretic inhibitor amiloride (12, 17, 24). This
channel, termed ENaC (epithelial Na+ channel), mediates
Na+ absorption in kidney collecting duct, distal colon,
lung, and exocrine glands. It has been cloned by functional expression
and is composed of three homologous subunits denoted
,
, and
ENaC (6). The central role of ENaC in determining extracellular fluid
and electrolyte homeostasis has been established by the phenotypic
analysis of ENaC-knockout mice and the identification of genetic
diseases associated with mutations in ENaC subunits (for review, see
Ref. 18). Elucidating the molecular mechanism underlying channel
activation by one of these mutations led to the identification of Nedd4
as a key regulator of ENaC (10, 15, 33, 35, 37). These studies have
demonstrated specific interactions between PY motifs in the COOH tails
of ENaC subunits and WW domains in Nedd4. Such interactions determine
the lifetime of ENaC in the apical surface by controlling its
ubiquitination and degradation.
ENaC is also a major target to the natriferic action of the mineralocorticoid aldosterone. The hormonal response is mediated by altered gene expression, leading to an increase in ENaC activity, which develops over several hours (11, 40). Many studies have established that this response is only partly mediated by an enhanced transcription of the channel protein (for review, see Refs. 12 and 40). Hence, it is generally believed that the initial response to aldosterone requires the synthesis of regulatory proteins that control ENaC translation, cell surface expression, or single-channel properties (12, 25, 40).
Several mRNA species, the abundance of which in epithelial cells is elevated by aldosterone, have been reported (4, 8, 28, 31, 36). One recently identified aldosterone-induced protein is the serum- and glucocorticoid-dependent serine/threonine kinase (sgk) (8, 26, 43). This kinase is known to be regulated by serum, glucocorticoids, hypertonicity, secretagogs, and other factors (9, 19, 41, 42). Chen et al. (8) have demonstrated that sgk mRNA and protein are strongly and rapidly elevated in amphibian A6 cells and in rat kidney after stimulation by dexamethasone and aldosterone, respectively. More importantly, coexpressing sgk and ENaC in Xenopus laevis oocytes resulted in a marked increase in channel activity. Similar observations have been reported by Naray-Fejes-Toth et al. (26) by using primary cultures from rabbit cortical collecting duct (CCD).
The present study aims to further characterize effects of aldosterone
on sgk mRNA in native mammalian epithelia and explore possible
mechanisms by which the kinase activates ENaC. The following two issues
were addressed. 1) How does aldosterone affect the abundance of
sgk mRNA in different kidney segments, distal colon, and lung?
Effects of aldosterone on the expression of ENaC subunits are very
different in these tissues (3, 30, 38). 2) What is the time
course and steroid specificity of the response in the native epithelia?
In addition, we have further characterized effects of sgk on
ENaC activity in Xenopus laevis oocytes. The results obtained
indicate that aldosterone increases the abundance of sgk mRNA
in distal colon and kidney cortex or medulla but not in kidney papilla
or lung. The effect is evoked, at least in part, by occupancy of the
mineralocorticoid receptor, and its time course fits the early
activation of channels by aldosterone. A point mutation in
rENaC,
known to impair the regulation of ENaC by Nedd4, has no effect on the
response to sgk.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animal treatment and RNA isolation.
Experiments were carried out using 8- to 10-wk-old male Wistar
rats. Manipulations of plasma mineralocorticoids were done by the
following treatments. 1) Subcutaneous implantation of
osmotic minipumps (model 2001, Alza, Palo Alto, CA) was performed
and pumps were filled with aldosterone dissolved in polyethylene glycol 300 to a concentration designed to achieve delivery rates of ~10 µg · kg
1 · h
1.
They were preincubated in saline for 24 h, to avoid a lag time in
aldosterone secretion. 2) Rats were fed a
Na+-deficient diet (ration 909902, ICN, Cleveland, OH) for
2 wk. Some of the Na+-deprived rats were resalinated for 24 h by feeding them a normal chow and including 110 mM NaCl in their
drinking water. 3) Subcutaneous injections of dexamethasone
suspended in corn oil (6 mg/kg) were done.
Plasmids and constructs.
An IMAGE Consortium clone, which includes the whole coding region of
sgk (mouse embryo, ID 570181, accession number aa389214), was
obtained from Research Genetics (Huntsville, AL) and fully sequenced.1 Its deduced amino
acid sequence corresponds to a 431-amino acid polypeptide with >90%
identity to rat and human sgk. Northern blot hybridizations
were done by using an 0.8-kb Nhe I fragment corresponding to
the most 3' untranslated region of this cDNA. This area is 88%
identical to rat sgk and has no significant homology to any
other kinase registered in public databases. For functional expression
in Xenopus oocytes, the above insert was subcloned into a
modified pBluescript SK+ vector between the 5' and 3'
untranslated regions of Xenopus
-globin (16). cDNAs coding
for the
-,
-, and
-rENaC in pSPORT-1, were kindly provided by
B. C. Rossier, (Institute of Pharmacology, Univ. of Lausanne).
3-Phosphoinositide-dependent protein kinase (PDK1) cDNA was kindly
provided by D. R. Alessi (Dept. of Biochemistry, Univ. of Dundee).
-subunit (Y618A) was introduced by
generating two PCR products with overlapping sequences and reamplifying them with the outside primers. The mutating oligonucleotides used were
ACGCTGACTCACTGAGGCTGCAGCCGC and CTCAGGGAGTCAGCGTTGGGAGGTG. The
resulting construct was verified by sequencing.
Functional expression in Xenopus oocytes.
cRNAs coding for the three channel subunits and sgk
were transcribed in vitro from linearized plasmids. Stage IV-V
Xenopus oocytes were injected with cRNA mixtures containing ~2.5
ng of each construct and maintained at 17°C in a
low-Na+ medium composed of (in mM) 10 NaCl, 86 choline
chloride, 2 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES
(pH = 7.6), as well as 100 U/ml penicillin and 100 µg/ml
streptomycin. Electrophysiological measurements were performed
48-96 h after the injection by means of the two-electrode voltage-clamp technique by using a CA1 Dagan amplifier. The amplified signal was digitized by using the Digidata 1200 (Axon Instruments) and
stored and analyzed by using pCLAMP 6 software (Axon Instruments). The
external recording solution was composed of (in mM) 96 NaCl, 2 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES (pH 7.4) ± 5 µM
amiloride dissolved in DMSO. Current traces in the presence of
amiloride were subtracted from the current traces in the absence of
amiloride, and the resulting amiloride-sensitive current traces were
used in the analysis. Normalization of current amplitudes was done to
traces at
100 mV in oocytes injected with 

or

(Y618A)
without sgk. Data are presented as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
Initial experiments have assessed effects of aldosterone on the
expression of sgk mRNA in rat distal colon. Under proper
conditions, this tissue can be maintained in vitro for at least 2 h,
with no significant loss of cell viability or RNA integrity. Hence, it
enables the study of regulation of RNA in native cells, exposed to
well-defined steroid concentrations. Figure
1 depicts representative Northern blots of
sgk cDNA with colonic RNA extracted after different manipulations. Data averaged from several independent RNA preparations are summarized in Fig. 2. In agreement with
previous studies in dexamethasone-treated A6 cells (8) and primary CCD
cultures (26), aldosterone evoked a marked (~5-fold) increase in the abundance of sgk mRNA. The effect was rapid, and substantial
induction was already apparent 30 min after the mineralocorticoid was
introduced (Figs. 1A and 2A). Unlike the
above-described studies, the message abundance increased monotonously
during the incubation period, and no saturation was apparent. More than
50% of the induction in sgk was evoked by 10 nM aldosterone
(Fig. 2B). This dose is well within the range of diet-induced
variations in plasma aldosterone. It also suggests that at least part
of the response is mediated by the mineralocorticoid receptor (see
DISCUSSION). Further support for involvement of the
mineralocorticoid receptor is provided by the inhibitory action of RU
26752, a specific mineralocorticoid antagonist (22) (Fig. 1C).
This figure also demonstrates that the translational inhibitor
cycloheximide does not block (and in fact increases) the induction of
sgk by aldosterone. Thus the response observed is a primary
one, not mediated by other aldosterone-induced transcription factors.
|
|
Subsequent experiments have studied expression of sgk in rats
perfused in vivo with aldosterone, through use of an osmotic minipump.
Such treatment enables investigation of the regulation of sgk
in kidney and lung, which cannot be done in vitro, as well as the study
of more chronic effects of the steroid. In kidney, the highest level of
sgk mRNA was detected in the papilla with much lower values in
the medulla and cortex (Fig. 3). Perfusing rats with aldosterone evoked an almost threefold increase in the abundance of sgk mRNA in the cortex and medulla but no
significant change in the papilla (Fig. 3, Table
1). As in the in vitro experiments the
response was rapid, and maximal change was observed 90 min after the
perfusion was initiated. The plasma level of aldosterone increased
under these conditions from 0.89 nM in the control rats, to 11.8 and
19.5 nM in rats implanted with the pumps for 90 and 180 min,
respectively. Other experiments have shown a marked induction of
sgk by feeding rats a low-Na+ diet for 2 wk. This
effect could be reversed by 24-h resalination (not shown). The lung
appeared to express a much lower level of sgk, and no induction
by aldosterone could be seen (Figs. 3 and 4). However, a significant elevation of
sgk mRNA in lung could be evoked by a maximal dose of
dexamethasone. This observation is in agreement with the fact that
Na+ transport in this tissue is under the control of
glucocorticoids (7, 39). Even under maximal stimulation, expression of
sgk in the lung was much lower than in the other epithelia.
|
|
|
Recent studies have demonstrated that PDK1 can activate sgk by phosphorylating it (21, 27). This enzyme also appears to be involved in the regulation of ENaC by insulin (29). It was therefore of interest to test whether PDK1, too, is under the transcriptional control of aldosterone. Perfusing rats for 3 h with either aldosterone or dexamethasone did not affect abundance of PDK1 mRNA in colon, kidney medulla, or lung (data not shown).
A mediating role for sgk in the natriferic action of
aldosterone is inferred from the finding that coexpressing amphibian ENaC and sgk in Xenopus oocytes elevates the
macroscopic amiloride-blockable current (8, 26). A similar response was
observed in the present study, with the mouse sgk clone used in
the above hybridizations (Fig. 5). A major
pathway that controls cell surface expression (and activity) of ENaC in
Xenopus oocytes involves interactions between its PY motifs and
Nedd4 (15, 33, 35, 37). Mutating the corresponding tyrosine on the
-subunit into alanine was shown to increase channel activity and
also block its downregulation by cell Na+ (20). To test for
a possible role of the above mechanism in the response to sgk,
we have compared the sgk-induced activation of the wild-type
channel and the
Y618A mutant (Fig. 5). In both cases a similar
sgk-dependent potentiation of the current was apparent, arguing
against an involvement of the above mechanism in the response to
sgk.
|
| |
DISCUSSION |
|---|
|
|
|---|
Sgk has been recently identified as an aldosterone-induced mRNA and protein in amphibian A6 cells and mammalian kidney. Its putative mediating role in the hormonal stimulation of Na+ transport is strongly supported by the observation that coexpressing ENaC and sgk in Xenopus oocytes elevates the macroscopic amiloride-blockable current (8, 26). The present study further explored regulation of sgk mRNA by aldosterone and its possible interaction with ENaC. One purpose was to explore the steroid specificity and time course in mammalian native epithelia. Previous work has been done either in amphibian A6 cells by using the synthetic glucocorticoid dexamethasone or in primary collecting duct culture (8, 26). Demonstration of a mineralocorticoid response is important in establishing a role for sgk in Na+ homeostasis, in particular because its induction by glucocorticoid is well established and not specific to epithelial tissues (5, 23, 43).
One set of measurements was done by in vitro incubation of distal colon with defined amounts of corticosteroids and for specific periods of time. These experiments have established that, as in A6 cells and primary CCD cultures, induction of sgk in distal colon is apparent within 30 min; i.e., it precedes the initial increase in Na+ transport. Previous studies by several groups have identified different phases in the response to aldosterone (for review, see Ref. 40). In particular, the increase in apical Na+ permeability involves an acute activation of preexisting channels, and a chronic induction of ENaC mRNA and presumably protein (1-3, 13). Thus the time course depicted in Fig. 2A suggests a mediating role of sgk in the "early" activation of Na+ channels.
Aldosterone can bind to both mineralocorticoid (high-affinity) and glucocorticoid (low-affinity) receptors. Maximal stimulation of Na+ transport may require at least a partial occupancy of the glucocorticoid receptor or glucocorticoid/mineralocorticoid heterodimers (13, 14). As shown in Fig. 2B about one-half of the response was evoked by 10 nM aldosterone. At this concentration the mineralocorticoid receptor is mostly occupied [diffusion coefficient (Kd) = 4.1 nM (34)] whereas population of the glucocorticoid receptor is low [Kd = 25-60 nM (32)]. Maximal induction of sgk was seen for >100 nM aldosterone. At this concentration substantial occupancy of the glucocorticoid receptor will take place.
Experiments in which rats were perfused in vivo with aldosterone through osmotic minipumps confirmed the rapid induction of sgk; i.e., stimulation after 90 min was equal to or greater than the response at 180 min. The increase in sgk mRNA was apparent even after a chronic hyperaldosteronism (i.e., 2-wk salt deprivation), but its magnitude was considerably lower than in the acute response. In vivo experiments have also established induction of sgk by aldosterone in kidney cortex and medulla but not in papilla or lung (Fig. 3). The response seen in cortex and medulla was somewhat smaller than in the distal colon (cf. Table 1). This quantitative difference may stem from the heterogeneity of the segmental kidney preparations that also pool nephron segments in which sgk is constitutively expressed. Indeed, we have observed high, aldosterone-independent abundance of sgk in the papilla. It may reflect a role of this kinase in the osmotic adaptation of the inner medullary collecting duct (41, 42).
In the last set of experiments sgk was coexpressed with the
three ENaC subunits in Xenopus oocytes. These experiments have confirmed recent findings (8, 26) and provided initial insight into the
underlying mechanism. We observed that mutating Y618 in the
-subunit
to alanine does not prevent the sgk-induced increase in channel
activity. This point mutation has been shown to increase ENaC cell
surface expression by preventing its binding to Nedd4 and
ubiquitination (33, 35, 37). It also prevents feedback inhibition of
channels by high cell Na+ (20). The fact that this mutation
does not prevent the response to sgk argues against a mediating
role of the above mechanisms. However, it is still possible that Nedd4
is involved in the sgk-dependent activation of channels,
through the
- or
-subunits. It is also interesting to note that
the sgk-induced increase in channel activity reported in this
study has been measured in oocytes maintained for
48 h at 10 mM
Na+. Under these conditions, downregulation of ENaC cell
surface expression by interaction with Nedd4 and cell Na+
is minimal (20).
In conclusion, the present study establishes that sgk is an early aldosterone-induced gene in rat kidney and colon and provides some information on the mechanism by which the kinase activates the Na+ channel.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by research grants from the MINERVA foundation, Germany (to H. Garty), The Israel Science Foundation (to H. Garty and E. Reuveny), and the Ebner Family Biomedical Research Foundation (to E. Reuveny).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
1 This sequence is available under accession number AF205855.
Address for reprint requests and other correspondence: H. Garty, Dept. of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100, Israel (E-mail: h.garty{at}weizmann.ac.il).
Received 30 July 1999; accepted in final form 11 November 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Asher, C,
Eren R,
Kahn L,
Yeger O,
and
Garty H.
Expression of the amiloride-blockable Na+ channel by RNA from control versus aldosterone-stimulated tissue.
J Biol Chem
267:
16061-16065,
1992
2.
Asher, C,
and
Garty H.
Aldosterone increases the apical Na+ permeability of toad bladder by two different mechanisms.
Proc Natl Acad Sci USA
85:
7413-7417,
1988
3.
Asher, C,
Wald H,
Rossier BC,
and
Garty H.
Aldosterone-induced increase in the abundance of Na+ channel subunits.
Am J Physiol Cell Physiol
271:
C605-C611,
1996
4.
Attali, B,
Latter H,
Rachamim N,
and
Garty H.
A corticosteroid-induced gene expressing an "IsK-like" K+ channel activity in Xenopus oocytes.
Proc Natl Acad Sci USA
92:
6092-6096,
1995
5.
Buse, P,
Tran SH,
Luther E,
Phu PT,
Aponte GW,
and
Firestone GL.
Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, sgk, in mammary tumor cells. A novel convergence point of anti-proliferative and proliferative cell signaling pathways.
J Biol Chem
274:
7253-7263,
1999
6.
Canessa, CM,
Schild L,
Buell G,
Thorens B,
Gautschi I,
Horisberger J-D,
and
Rossier BC.
Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits.
Nature
367:
463-467,
1994[Medline].
7.
Champigny, G,
Voilley N,
Lingueglia E,
Friend V,
Barbry P,
and
Lazdunski M.
Regulation of expression of the lung amiloride-sensitive Na+ channel by steroid hormones.
EMBO J
13:
2177-2181,
1994[Web of Science][Medline].
8.
Chen, SY,
Bhargava A,
Mastroberardino L,
Meijer OC,
Wang J,
Buse P,
Firestone GL,
Verrey F,
and
Pearce D.
Epithelial sodium channel regulated by aldosterone-induced protein sgk.
Proc Natl Acad Sci USA
96:
2514-2519,
1999
9.
Delmolino, LM,
and
Castellot JJJ
Heparin suppresses sgk, an early response gene in proliferating vascular smooth muscle cells.
J Cell Physiol
173:
371-379,
1997[Web of Science][Medline].
10.
Dinudom, A,
Harvey KF,
Komwatana P,
Young JA,
Kumar S,
and
Cook DI.
Nedd4 mediates control of an epithelial Na+ channel in salivary duct cells by cytosolic Na+.
Proc Natl Acad Sci USA
95:
7169-7173,
1998
11.
Garty, H.
Regulation of Na+ permeability by aldosterone.
Semin Nephrol
12:
24-29,
1992[Web of Science][Medline].
12.
Garty, H,
and
Palmer LG.
Epithelial Na+ channels: function, structure, and regulation.
Physiol Rev
77:
359-396,
1997
13.
Garty, H,
Peterson-Yantorno K,
Asher C,
and
Civan MM.
Effects of corticoid agonists and antagonists on the apical Na+ permeability of toad urinary bladder.
Am J Physiol Renal Fluid Electrolyte Physiol
266:
F108-F116,
1994
14.
Geering, K,
Claire M,
Gaeggeler H-P,
and
Rossier BC.
Receptor occupancy vs. induction of Na-K-ATPase and Na transport by aldosterone.
Am J Physiol Cell Physiol
248:
C102-C108,
1985
15.
Goulet, CC,
Volk KA,
Adams CM,
Prince LS,
Stokes JB,
and
Snyder PM.
Inhibition of the epithelial Na+ channel by interaction of Nedd4 with a PY motif deleted in Liddle's syndrome.
J Biol Chem
273:
30012-30017,
1998
16.
Guillemare, E,
Honoré E,
Pradier L,
Lesage F,
Schweitz H,
Attali B,
Barhanin J,
and
Lazdunski M.
Effects of the level of mRNA expression on biophysical properties, sensitivity to neurotoxins, and regulation of the brain delayed-rectifier K+ channel Kv1.2.
Biochemistry
31:
12463-12468,
1992[Medline].
17.
Horisberger, JD.
Amiloride-sensitive Na channels.
Current Opin Cell Biol
10:
443-449,
1998[Web of Science][Medline].
18.
Hummler, E,
and
Horisberger JD.
Genetic disorders of membrane transport. V. The epithelial sodium channel and its implication in human diseases.
Am J Physiol Gastrointest Liver Physiol
276:
G567-G571,
1999
19.
Imaizumi, K,
Tsuda M,
Wanaka A,
Tohyama M,
and
Takagi T.
Differential expression of sgk mRNA, a member of the Ser/Thr protein kinase gene family, in rat brain after CNS injury.
Brain Res Mol Brain Res
26:
189-196,
1994[Medline].
20.
Kellenberger, S,
Gautschi I,
Rossier BC,
and
Schild L.
Mutations causing Liddle syndrome reduce sodium-dependent downregulation of the epithelial sodium channel in the Xenopus oocyte expression system.
J Clin Invest
101:
2741-2750,
1998[Web of Science][Medline].
21.
Kobayashi, T,
and
Cohen P.
Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2.
Biochem J
339:
319-328,
1999.
22.
Lazar, G,
and
Agarval M.
Evidence for an antagonist specific receptor that does not bind mineralocorticoid agonists.
Biochem Biophys Res Commun
134:
261-265,
1986[Web of Science][Medline].
23.
Maiyar, AC,
Phu PT,
Huang AJ,
and
Firestone GL.
Repression of glucocorticoid receptor transactivation and DNA binding of a glucocorticoid response element within the serum/glucocorticoid- inducible protein kinase (sgk) gene promoter by the p53 tumor suppressor protein.
Mol Endocrinol
11:
312-329,
1997
24.
Matalon, S,
and
Brodovich HO.
Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties, and physiological significance.
Ann Rev Physiol
61:
627-661,
1999[Web of Science][Medline].
25.
May, A,
Puoti A,
Gaeggeler HP,
Horisberger JD,
and
Rossier BC.
Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells.
J Am Soc Nephrol
8:
1813-1822,
1997[Abstract].
26.
Naray-Fejes-Toth, A.,
Canessa C,
Cleaveland ES,
Aldrich G,
and
Fejes-Toth G.
sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on epithelial Na+ channels.
J Biol Chem
274:
16973-16978,
1999
27.
Park, J,
Leong ML,
Buse P,
Maiyar AC,
Firestone GL,
and
Hemmings BA.
Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway.
EMBO J
18:
3024-3033,
1999[Web of Science][Medline].
28.
Rachamim, N,
Latter H,
Asher C,
Wald H,
and
Garty H.
Dexamethasone enhances expression of mitochondrial oxidative-phosphorylation genes in rat distal colon.
Am J Physiol Cell Physiol
269:
C1305-C1310,
1995
29.
Record, RD,
Froelich LL,
Vlahos CJ,
and
Blazer-Yost BL.
Phosphatidylinositol 3-kinase activation is required for insulin-stimulated sodium transport in A6 cells.
Am J Physiol Endocrinol Metab
274:
E611-E617,
1998
30.
Renard, S,
Voillet N,
Bassilana F,
Lazdunski M,
and
Barbry P.
Localization and regulation by steroids of the
,
and
subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney.
Pflügers Arch
430:
299-307,
1995[Web of Science][Medline].
31.
Rokaw, MD,
Benos DJ,
Palevsky PM,
Cunningham SA,
West ME,
and
Johnson JP.
Regulation of a sodium channel-associated G-protein by aldosterone.
J Biol Chem
271:
4491-4496,
1996
32.
Rossier, BC,
Geering K,
Atkinson J,
and
Roch-Ramel F.
Renal receptors.
In: The Kidney: Physiology and Pathophysiology, edited by Seldin D. W.,
and Giebisch G.. New York: Raven, 1985, p. 775-806.
33.
Schild, L,
Lu Y,
Gautschi I,
Schneeberger E,
Lifton RP,
and
Rossier BC.
Identification of a PY motif in the epithelial Na channel subunits as a target sequence for mutations causing channel activation found in Liddle's syndrome.
EMBO J
15:
2381-2387,
1996[Web of Science][Medline].
34.
Schulman, G,
Miller-Diener A,
Litwack G,
and
Bastl CP.
Characterization of the rat colonic aldosterone receptor and its activation process.
J Biol Chem
261:
12102-12108,
1986
35.
Snyder, PM,
Price MP,
Mcdonald FJ,
Adams CM,
Volk KA,
Zeiher BG,
Stokes JB,
and
Welsh MJ.
Mechanism by which Liddle's syndrome mutations increase activity of a human epithelial Na+ channel.
Cell
83:
969-978,
1995[Web of Science][Medline].
36.
Spindler, B,
Mastroberardino L,
Custer M,
and
Verrey F.
Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia.
Pflügers Arch
434:
323-331,
1997[Web of Science][Medline].
37.
Staub, O,
Dho S,
Henry PC,
Correa J,
Ishikawa T,
Mcglade J,
and
Rotin D.
WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle's syndrome.
EMBO J
15:
2371-2380,
1996[Web of Science][Medline].
38.
Stokes, JB,
and
Sigmund RD.
Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue, and steroid heterogeneity.
Am J Physiol Cell Physiol
274:
C1699-C1707,
1998
39.
Tchepichev, S,
Ueda J,
Canessa C,
Rossier BC,
and
O'brodovich H.
Lung epithelial Na channel subunits are differentially regulated during development and by steroids.
Am J Physiol Cell Physiol
269:
C805-C812,
1995
40.
Verrey, F.
Transcriptional control of sodium transport in tight epithelia by adrenal steroids.
J Memb Biol
144:
93-110,
1995[Web of Science][Medline].
41.
Waldegger, S,
Barth P,
Forrest JNJ,
Greger R,
and
Lang F.
Cloning of sgk serine-threonine protein kinase from shark rectal gland
a gene induced by hypertonicity and secretagogues.
Pflügers Arch
436:
575-580,
1998[Web of Science][Medline].
42.
Waldegger, S,
Barth P,
Raber G,
and
Lang F.
Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume.
Proc Natl Acad Sci USA
94:
4440-4445,
1997
43.
Webster, MK,
Goya L,
Ge Y,
Maiyar AC,
and
Firestone GL.
Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum.
Mol Cell Biol
13:
2031-2040,
1993
This article has been cited by other articles:
![]() |
G. Gamba The thiazide-sensitive Na+-Cl- cotransporter: molecular biology, functional properties, and regulation by WNKs Am J Physiol Renal Physiol, October 1, 2009; 297(4): F838 - F848. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Ackermann, K. M. Boini, H. Volkl, M. Bhandaru, P. M. Bareiss, L. Just, V. Vallon, K. Amann, D. Kuhl, Y. Feng, et al. SGK1-sensitive renal tubular glucose reabsorption in diabetes Am J Physiol Renal Physiol, April 1, 2009; 296(4): F859 - F866. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Artunc, O. Nasir, K. Amann, K. M. Boini, H.-U. Haring, T. Risler, and F. Lang Serum- and glucocorticoid-inducible kinase 1 in doxorubicin-induced nephrotic syndrome Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1624 - F1634. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla and K. R. Hallows Mechanisms of ENaC Regulation and Clinical Implications J. Am. Soc. Nephrol., October 1, 2008; 19(10): 1845 - 1854. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Naray-Fejes-Toth, C. Boyd, and G. Fejes-Toth Regulation of epithelial sodium transport by promyelocytic leukemia zinc finger protein Am J Physiol Renal Physiol, July 1, 2008; 295(1): F18 - F26. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fejes-Toth, G. Frindt, A. Naray-Fejes-Toth, and L. G. Palmer Epithelial Na+ channel activation and processing in mice lacking SGK1 Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1298 - F1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al. Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol Rev, October 1, 2006; 86(4): 1151 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Boini, A. M. Hennige, D. Y. Huang, B. Friedrich, M. Palmada, C. Boehmer, F. Grahammer, F. Artunc, S. Ullrich, D. Avram, et al. Serum- and glucocorticoid-inducible kinase 1 mediates salt sensitivity of glucose tolerance. Diabetes, July 1, 2006; 55(7): 2059 - 2066. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, G. Henke, C. Sandu, R. Rexhepaj, A. Hussain, B. Friedrich, T. Risler, M. Metzger, L. Just, T. Skutella, et al. Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1 Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1114 - G1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Staub and D. Rotin Role of Ubiquitylation in Cellular Membrane Transport Physiol Rev, April 1, 2006; 86(2): 669 - 707. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Mullins, M. A. Bailey, and J. J. Mullins Hypertension, Kidney, and Transgenics: A Fresh Perspective Physiol Rev, April 1, 2006; 86(2): 709 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, F. Artunc, D. Sandulache, R. Rexhepaj, B. Friedrich, T. Risler, J. A. McCormick, K. Dawson, J. Wang, D. Pearce, et al. Renal function of gene-targeted mice lacking both SGK1 and SGK3 Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R945 - R950. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, K. M. Boini, B. Friedrich, M. Metzger, L. Just, H. Osswald, P. Wulff, D. Kuhl, V. Vallon, and F. Lang Blunted hypertensive effect of combined fructose and high-salt diet in gene-targeted mice lacking functional serum- and glucocorticoid-inducible kinase SGK1 Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R935 - R944. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McCormick, V. Bhalla, A. C. Pao, and D. Pearce SGK1: A Rapid Aldosterone-Induced Regulator of Renal Sodium Reabsorption Physiology, April 1, 2005; 20(2): 134 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vallon, P. Wulff, D. Y. Huang, J. Loffing, H. Volkl, D. Kuhl, and F. Lang Role of Sgk1 in salt and potassium homeostasis Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R4 - R10. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. de la Rosa, T. G. Paunescu, W. J. Els, S. I. Helman, and C. M. Canessa Mechanisms of Regulation of Epithelial Sodium Channel by SGK1 in A6 Cells J. Gen. Physiol., September 27, 2004; 124(4): 395 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-X. Wang, C. McCrudden, Y.-P. Dai, B. Horowitz, J. R. Hume, and I. A. Yamboliev Hypotonic activation of volume-sensitive outwardly rectifying chloride channels in cultured PASMCs is modulated by SGK Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H533 - H544. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Markadieu, D. Blero, A. Boom, C. Erneux, and R. Beauwens Phosphatidylinositol 3,4,5-trisphosphate: an early mediator of insulin-stimulated sodium transport in A6 cells Am J Physiol Renal Physiol, August 1, 2004; 287(2): F319 - F328. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Palmada, M. Dieter, A. Speil, C. Bohmer, A. F. Mack, H. J. Wagner, K. Klingel, R. Kandolf, H. Murer, J. Biber, et al. Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1 Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G143 - G150. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Coric, N. Hernandez, D. A. de la Rosa, D. Shao, T. Wang, and C. M. Canessa Expression of ENaC and serum- and glucocorticoid-induced kinase 1 in the rat intestinal epithelium Am J Physiol Gastrointest Liver Physiol, April 1, 2004; 286(4): G663 - G670. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gumz, M. P. Popp, C. S. Wingo, and B. D. Cain Early transcriptional effects of aldosterone in a mouse inner medullary collecting duct cell line Am J Physiol Renal Physiol, October 1, 2003; 285(4): F664 - F673. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. de la Rosa, T. Coric, N. Todorovic, D. Shao, T. Wang, and C. M Canessa Distribution and regulation of expression of serum- and glucocorticoid-induced kinase-1 in the rat kidney J. Physiol., September 1, 2003; 551(2): 455 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing and B. Kaissling Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human Am J Physiol Renal Physiol, April 1, 2003; 284(4): F628 - F643. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Helms, G. Fejes-Toth, and A. Naray-Fejes-Toth Hormone-regulated transepithelial Na+ transport in mammalian CCD cells requires SGK1 expression Am J Physiol Renal Physiol, March 1, 2003; 284(3): F480 - F487. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Maiyar, M. L.L. Leong, and G. L. Firestone Importin-alpha Mediates the Regulated Nuclear Targeting of Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by Recognition of a Nuclear Localization Signal in the Kinase Central Domain Mol. Biol. Cell, March 1, 2003; 14(3): 1221 - 1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, S. Masilamani, K. Beutler, H. Hager, S. Nielsen, and M. A. Knepper Sodium transporter abundance profiling in kidney: effect of spironolactone Am J Physiol Renal Physiol, November 1, 2002; 283(5): F923 - F933. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Schafer Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct Am J Physiol Renal Physiol, August 1, 2002; 283(2): F221 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Rozansky, J. Wang, N. Doan, T. Purdy, T. Faulk, A. Bhargava, K. Dawson, and D. Pearce Hypotonic induction of SGK1 and Na+ transport in A6 cells Am J Physiol Renal Physiol, July 1, 2002; 283(1): F105 - F113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Stockand New ideas about aldosterone signaling in epithelia Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Urbach and B. J Harvey Rapid and non-genomic reduction of intracellular [Ca2+] induced by aldosterone in human bronchial epithelium J. Physiol., November 15, 2001; 537(1): 267 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Otulakowski, T. Freywald, Y. Wen, and H. O'Brodovich Translational activation and repression by distinct elements within the 5'-UTR of ENaC alpha -subunit mRNA Am J Physiol Lung Cell Mol Physiol, November 1, 2001; 281(5): L1219 - L1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chigaev, G. Lu, H. Shi, C. Asher, R. Xu, H. Latter, R. Seger, H. Garty, and E. Reuveny In vitro phosphorylation of COOH termini of the epithelial Na+ channel and its effects on channel activity in Xenopus oocytes Am J Physiol Renal Physiol, June 1, 2001; 280(6): F1030 - F1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Robert-Nicoud, M. Flahaut, J.-M. Elalouf, M. Nicod, M. Salinas, M. Bens, A. Doucet, P. Wincker, F. Artiguenave, J.-D. Horisberger, et al. Transcriptome of a mouse kidney cortical collecting duct cell line: Effects of aldosterone and vasopressin PNAS, February 15, 2001; (2001) 51603198. [Abstract] [Full Text] |
||||
![]() |
M. Robert-Nicoud, M. Flahaut, J.-M. Elalouf, M. Nicod, M. Salinas, M. Bens, A. Doucet, P. Wincker, F. Artiguenave, J.-D. Horisberger, et al. Transcriptome of a mouse kidney cortical collecting duct cell line: Effects of aldosterone and vasopressin PNAS, February 27, 2001; 98(5): 2712 - 2716. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Faletti, N. Perrotti, S. I. Taylor, and B. L. Blazer-Yost sgk: an essential convergence point for peptide and steroid hormone regulation of ENaC-mediated Na+ transport Am J Physiol Cell Physiol, March 1, 2002; 282(3): C494 - C500. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, S. D. Auerbach, R. F. Husted, K. A. Volk, S. Ageloff, M. A. Knepper, J. B. Stokes, and C. P. Thomas Alveolar Epithelial Ion and Fluid Transport: Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L631 - L641. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |