AJP - Renal AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 278: F1013-F1021, 2000;
0363-6127/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, R.
Right arrow Articles by Desir, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, R.
Right arrow Articles by Desir, G. V.
Vol. 278, Issue 6, F1013-F1021, June 2000

KCNA10: a novel ion channel functionally related to both voltage-gated potassium and CNG cation channels

Rainer Lang1,*, George Lee2,*, Weimin Liu2, Shulan Tian2, Hamid Rafi2, Marcelo Orias2, Alan S. Segal1, and Gary V. Desir2

2 Yale University School of Medicine and West Haven Veterans Affairs Medical Center, New Haven, Connecticut 06510; and 1 University of Vermont, Burlington, Vermont 05446


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Our laboratory previously cloned a novel rabbit gene (Kcn1), expressed in kidney, heart, and aorta, and predicted to encode a protein with 58% amino acid identity with the K channel Shaker Kv1.3 (Yao X et al. Proc Natl Acad Sci USA 92: 11711-11715, 1995). Because Kcn1 did not express well (peak current in Xenopus laevis oocytes of 0.3 µA at +60 mV), the human homolog (KCNA10) was isolated, and its expression was optimized in oocytes. KCNA10 mediates voltage-gated K+ currents that exhibit minimal steady-state inactivation. Ensemble currents of 5-10 µA at +40 mV were consistently recorded from injected oocytes. Channels are closed at the holding potential of -80 mV but are progressively activated by depolarizations more positive than -30 mV, with half-activation at +3.5 ± 2.5 mV. The channel displays an unusual inhibitor profile because, in addition to being blocked by classical K channel blockers (barium tetraethylammonium and 4-aminopyridine), it is also sensitive to inhibitors of cyclic nucleotide-gated (CNG) cation channels (verapamil and pimozide). Tail-current analysis shows a reversal potential shift of 47 mV/decade change in K concentration, indicating a K-to-Na selectivity ratio of at least 15:1. The phorbol ester phorbol 12-myristate 13-acetate, an activator of protein kinase C, inhibited whole cell current by 42%. Analysis of single-channel currents reveals a conductance of ~11 pS. We conclude KCNA10 is a novel human voltage-gated K channel with features common to both K-selective and CNG cation channels. Given its distribution in renal blood vessels and heart, we speculate that KCNA10 may be involved in regulating the tone of renal vascular smooth muscle and may also participate in the cardiac action potential.

potassium channel; patch clamp; cyclic nucleotide voltage-gated; vasoregulation; Xenopus laevis oocyte; human


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

POTASSIUM CHANNELS, a diverse family of membrane proteins, play a pivotal role in regulating membrane potential and contribute to many vital cellular processes. Previously, our laboratory cloned a novel rabbit K channel gene (Kcn1) that is related to the Shaker superfamily. The protein encoded by the longest open reading frame has 58% amino acid identity with Kv1.3 (20), and its predicted secondary structure is identical to that of Shaker-related K channels, including intracellular NH2 and COOH termini, six transmembrane segments, a voltage sensor (S4), and a pore (P) region. Unlike Shaker proteins, however, Kcn1 contains a putative cyclic nucleotide (CN)-binding domain at the COOH terminus, suggesting that protein function could potentially be regulated by cyclic nucleotides. Kcn1, therefore, may be a member of a new class of ion channels, which includes HERG (16), Eag (3, 7), and ATK1 (15), and BCNG-1 (14) with structural features common to both voltage-gated Shaker-like K channels and cyclic nucleotide-gated (CNG) nonselective cation channels.

These proteins may play important roles in mediating the effects of substances, such as nitric oxide (NO), that increase intracellular cyclic nucleotides. For example, in rat pulmonary artery rings, cGMP-dependent but not -independent relaxation was inhibited by the classic K channel blockers tetraethylammonium (TEA) and charybdotoxin (CTX) (2). Furthermore, in whole cell patch-clamp studies, NO and cGMP increased whole cell K current, suggesting that the final common pathway shared by NO and the nitrovasodilators is cGMP-dependent K channel activation (2). This new class of channels may also participate in hormone secretion. It was recently demonstrated that adrenocorticotopic hormone (ACTH) regulates cortisol synthesis/secretion by adrenal zona fasciculata cells by inhibiting a K current (Iac) that combines features of voltage-gated K channels with those of CNG nonselective cation channels (6, 18). Finally, it has been suggested that some members of this class of ion channels modulate membrane excitability in the brain. Indeed, BCNG-1, a novel, brain-specific ion channel protein isolated by interactive cloning with the SH3 domain of N-src, contains a well-conserved CNG-binding domain (14).

Kcn1 gene expression, assessed by RNAse protection assay and PCR of dissected nephron segments, was strongest in heart, aorta, and renal blood vessels (19, 20). When expressed in Xenopus laevis oocytes, Kcn1 yielded small currents (0.2-0.4 µA); thus we were unable to accurately assess its kinetic and pharmacological properties. The clone expressed poorly either because its message was unstable and/or inefficiently translated in oocytes, or that an additional subunit was required. The human homolog of Kcn1 (KCNA10) was cloned by library screening (12). KCNA10 is 90% identical to Kcn1 at the amino acid level, and its secondary structure is the same, including a putative cGMP-binding domain at the COOH terminus. Expression of KCNA10 was optimized in oocytes such that it is now possible to consistently record whole cell currents of 5-10 µA at +40 mV. This paper describes the basic kinetic and pharmacological properties of the channel.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

Cloning of KCNA10 cDNA in High-Expression Vector

The coding region of KCNA10 (accession no. U96110) was amplified by PCR with a proofreading polymerase and a sense primer containing a BamH 1 site and an antisense primer with a Xba 1 site: sense, 5'CGGGGATCCCTCCCCTAGAATGGATGTG3' ; antisense, 5' TCTAGAAAGAGACAGGATGGACCCAAGAAGCC3'. The amplified product was cut with BamH 1 and Xba 1 and ligated into PGH19, a high-expression vector, on the basis of pGEM (Promega, Madison, WI), containing 60 bp of the 5'UTR of X. laevis beta -globin and 300 bp of the 3'UTR. The construct was sequenced by the dideoxynucleotide chain termination method of Sanger et al. (13) to ensure that mutations were not introduced during amplification. Nucleotide and protein sequence analyses were carried out by using MacVector (Oxford Molecular Group PLC) and Lasergene (DNASTAR, Madison, WI). cRNA was synthesized with T7 after linearization with Not1.

Expression of KCNA10 in X. Laevis Oocytes

Oocyte preparation. Stage V-VI oocytes from X. laevis were harvested from ovarian lobes and repeatedly washed in Ca2+-free OR2 (in mM: 82.5 NaCl, 2 KCl, 1 MgCl2, and 5 HEPES, pH 7.5). Oocytes were defolliculated by incubation with type IA collagenase (2 mg/ml) in Ca2+-free OR2 for 90-120 min at room temperature. After a second washing with Ca2+ -free OR2, the oocytes were stored in ND96 (in mM: 96 NaCl, 2 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES, pH 7.5) with penicillin (100 U/ml)/streptomycin (100 µg/ml), and sodium pyruvate (550 mg/l) at 19°C. The vegetal poles of selected oocytes were injected with either 50 ng of 5' capped KCNA10 cRNA or RNAse-free water as control.

Two-microelectrode voltage clamp. Whole cell currents were recorded by using standard two-microelectrode voltage clamp. Current measurements were made after a 3- to 14-day incubation period, and expressed potassium currents were compared with those from water-injected control oocytes. For voltage clamping, oocytes were impaled with two microelectrodes filled with 1 M KCl (resistance 0.5-2 MOmega ). Oocyte current-voltage (I-V) relationships were obtained by applying command voltage-ramp or step protocols and measuring the resulting membrane current with a current-to-voltage amplifier (OC-725, Warner Instruments, Hamden, CT). Data acquisition was controlled by either PULSE 8.1 (Heka Elektronik) or pClamp 5.5 (Axon Instruments, Foster City, CA). Currents were filtered at 1-2 kHz and digitized to hard disk at 2.5-5 ksamples/s. Data were analyzed by using PULSE-Fit (Heka Elektronik), Origin 5.0 (Microcal Software, Northampton, MA), and Igor-Pro (WaveMetrics, Lake Oswego, OR). The extracellular recording solution was ND96 unless otherwise noted. For ion-substitution experiments, the chloride-salt of the test cation was substituted for NaCl, and ion selectivity was measured by using tail-current analysis.

Patch clamp. To prepare cells for patch clamping, oocytes were placed in a hypertonic K-aspartate solution so that the vitelline membrane could be removed manually by using fine forceps. Devitellinized oocytes were placed in a recording chamber containing ND96 (Na-ND96 or K-ND96) bath. Patch pipettes were filled with Na-MES (2 mM K+) and had resistances of 4-8 MOmega . Single KCNA10 channel currents in the cell-attached and inside-out configuration were amplified with an EPC-9 computer-controlled patch-clamp amplifier (Heka Elektronik). For display, currents were filtered at 400 Hz and records were analyzed by using the programs mentioned above and software written in our laboratory (1). All chemicals were purchased from Sigma Chemical (St. Louis, MO). ShK-Dap22 was a generous gift from Dr. Mike Pennington (Bachem).


    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

KCNA10 is a Voltage-Gated K Channel

As noted, KCNA10 contains regions homologous to the voltage sensor of Shaker-like K channels; so we first tested the hypothesis that KCNA10 is a voltage-gated channel. Figure 1A shows representative ensemble currents indicating that KCNA10 behaves as a voltage-gated channel when expressed in an oocyte bathed in Na-ND96. From a holding potential of -80 mV, successive depolarizing steps (from -60 to +40 mV, see Fig. 1, inset) reveal voltage-gated outward currents elicited beyond a threshold voltage of about -30 mV. Replacing bath Cl- with an impermeant anion such as gluconate does not affect recorded currents (data not shown), indicating that the outward current is carried by K+. KCNA10 current exhibits minimal steady-state inactivation. Figure 1B shows the I-V curve resulting from this voltage protocol. The voltage for half-maximal activation (V1/2) was obtained by fitting the resultant conductances to the Boltzmann equation. A representative conductance-voltage (G-V) plot (Fig. 1C, n = 6 cells) shows that the V1/2 is about +3.6 mV. The maximal conductance occurs around +40 mV. To estimate the cation selectivity of KCNA10, tail currents from +30 mV were examined at voltages from -100 to +20 mV. A plot of reversal potential vs. bath K concentration ([K]) is shown in Fig. 2. The zero-current K-to-Na permeability ratio, based on a linear fit of the observed change in reversal potential per decade change in external [K], is PK/PNa = 15. Substitution of gluconate for chloride did not change the magnitude of the outward current. These results indicate that KCNA10 expresses a highly selective voltage-gated K channel. They are consistent with the fact that KCNA10 has a voltage gate (S4) and a pore region that are nearly identical to those of Shaker voltage-gated K channels.



View larger version (2218K):
[in this window]
[in a new window]
  		Fig. 1.   KCNA10 is a voltage-gated K channel. A: whole cell KCNA10 currents recorded from a Xenopus laevis oocyte under 2-electrode voltage clamp, showing that KCNA10 behaves as a voltage-gated channel with a threshold voltage around -10 mV. Note that ensemble KCNA10 currents exhibit minimal steady-state inactivation. Inset: voltage protocol with holding potential of -80 mV and test pulses from -60 to +50 mV in 10-mV steps. B: current-voltage (I-V) relationship for ensemble KCNA10 currents subjected to voltage protocol shown in A. C: whole cell normalized conductance-voltage (G-V) curve for hKCNA10. The G-V plot from 6 cells and their mean (fit by a Boltzmann function) are shown. The half-maximal conductance occurs at half-maximal activation (V1/2) = +3.64 mV. Gmax, maximal G; Vcommand, command voltage.



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 2.   KCNA10 is K selective. Selectivity for K+ compared with Na+ was assessed by applying the tail-analysis voltage protocol (inset) to expressing oocytes in varying bath K concentrations ([K]). Slope of linear fit of data is 47 mV/decade (a perfect K electrode would have a slope of 58 mV/decade), indicating that KCNA10 prefers K+ to Na+ by at least 15:1.

Activation Parameters and Ionic Selectivity

Peak current was 5.5 ± 1.5 µA (n = 30) at a membrane potential of +40 mV, and time-dependent inactivation was not observed. Activation parameters were determined by using the Pulse-Fit program (Heka), and the observed currents were fitted to a variant of the Hodgkin-Huxley equation. The time constant of activation (tau act) was determined by using voltage steps from -60 to +40 mV from a holding potential of -80 mV. An example of an activation curve (from -80 to +40 mV) fit by an exponential is shown in Fig. 3A, whereas Fig. 3B shows tau act as a function of voltage. In Fig. 3B (left), we now show the tau act vs. voltage from the raw data fit with single exponentials. From Fig. 3 it may be seen that tau act approaches 20 ms at the most depolarized voltages. In Fig. 3B (right), these data are normalized and fit with the mean single exponential, which shows that the average "voltage constant" for the pooled data is 16.0 ± 0.5 mV. This voltage constant indicates that tau act decreases e-fold for each 16 mV of depolarization. Compared with other Kv channels, KCNA10 activates relatively slowly (18 ms for KCNA10 vs. 2 ms for Kv1.5, Table 1). Although outward current was voltage gated, compared with most Kv channels the threshold voltage for activation of KCNA10 is shifted to the right (Table 1). Indeed, currents were not observed at voltages more hyperpolarized than -20 mV. It should be noted that these results reflect the kinetic behavior of the alpha -subunit alone. Presently, there are no data supporting the existence of additional subunits. However, because many Kv channels have been shown to be heteromultimeric in vivo, it is likely that KCNA10 also interacts with an alpha -subunit, which might modulate its kinetic behavior.



View larger version (1818K):
[in this window]
[in a new window]
  		Fig. 3.   Activation of KCNA10 is voltage dependent. A: whole cell activation curve for hKCNA10 fit by a single exponential. In this example, voltage is stepped from -80 to +40 mV, resulting in a nearly exponential rise [time constant of activation (tau act) = 13 ms] of voltage-gated current toward a steady-state current of 9 µA. B: tau act vs. voltage for hKCNA10 measured in 6 oocytes (left). Points for each cell are fit with a single exponential. Right: raw data have been normalized, and mean single exponential fit (dashed curve) shows a mean "voltage constant" of 16.0 ± 0.5 mV (n = 6), indicating that tau act decreases e-fold with every 16 mV of depolarization. At strong depolarizations, tau act approaches 20 ms.


                              
View this table:
[in this window]
[in a new window]
  		Table 1.   Comparison of kinetics properties of KCNA10 with those of other Kv channels

Inhibitor Profile

K channel blockers with broad selectivity [barium, 4-aminopyridine (4-AP) and TEA] when added to the bath solution all resulted in reversible inhibition of KCNA10 currents (Table 2). The inhibitory effects of barium and 4-AP occurred within 30 s, whereas maximal inhibition by TEA took up to 15 min. At a voltage of +40 mV, 2 mM 4-AP decreased current by 64.6 ± 5.8% (n = 7), whereas 5 mM barium inhibited it by 47.7 ± 10.9% (n = 4). The dose-response curve for TEA was determined as shown in Fig. 4. The inhibition constant Ki for TEA was 53 mM. More selective blockers of K channels were also tested. Application of 30 nM apamin did not affect KCNA10 currents (data not shown). However, 200 nM of CTX (n = 5) caused an immediate and reversible blockade of outward current (Table 2) without any change in activation kinetics. ShK-Dap22 (mutant of ShK, a polypeptide isolated from the sea anemone Stichodactyla helianthus) is a very selective and potent (Ki = 50 pM) inhibitor of Kv1.3 (8). Fifty-picomolar ShK-Dap22 had no effect on KCNA10 current.

                              
View this table:
[in this window]
[in a new window]
  		Table 2.   Inhibitor profile of KCNA10 at +40 mV



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 4.   Dose-response curves for KCNA10. Dose-response curves for inhibitors of K channels [tetraethylammonium (TEA), ketoconazole] and CNG cation channels (verapamil, pimozide) were determined. Data were obtained at +40 mV. IgorPro was used to determine best fit for data. Single exponential fits are shown for verapamil, TEA, and ketoconazole. A double exponential fit is shown for pimozide. Pimozide was the most potent inhibitor of KCAN10 current.

Although the precise physiological role of KCNA10 in the heart is not yet known, it is expressed there and its kinetic properties would permit it to participate in cardiac repolarization. Therefore, known inhibitors of cardiac ion channels, such as ketoconazole, lanthanum, and cobalt, were tested for their ability to block KCNA10 current. Ketoconazole, a drug used to treat fungal infections, has been associated with Q-T prolongation and torsade de pointes when given in combination with the antihistamine terfenadine (Seldane). This is partly due to the fact ketoconazole also uses the cytochrome P-450 metabolic pathway and causes the plasma concentration of terfenadine to increase. In addition, it was recently shown that at concentrations within the therapeutic range, ketoconazole also blocks two K channels, HERG (IC50 = 49 µM) and Kv1.5 (IC50 = 107 µM), known to participate in cardiac repolarization (14). In X. laevis oocytes, 0.3 µM ketoconazole inhibited KCNA10 current by 34 ± 2.3% (n = 11, Fig. 4), suggesting that KCNA10 is significantly more sensitive to the action of ketoconazole than either HERG or Kv1.5. The addition of 2 mM of cobalt blocked KCNA10 current (Fig. 5) and affected the activation kinetics by increasing tau act (Table 2). Lanthanum at a concentration of 100 µM had no effect on KCNA10 current.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 5.   Cobalt affects kinetics of activation. Addition of 2 mM of cobalt to extracellular solution (n = 3) increases tau act and voltage dependence of activation.

KCNA10 has structural features common to both voltage-gated K channels and CNG channels. Therefore, antagonists of CNG cation channels (pimozide and verapamil) were also tested for their ability to block KCNA10 currents. The most potent and specific blockers of CNG channels are the diphenylbutylpiperidines including penfluridol, fluspirelene, and pimozide. Pimozide inhibited KCNA10 current, with a Ki of 300 nM (Table 2). Although less potent, verapamil also inhibited KCNA10 current, with a Ki of 53 µM (n = 5, Fig. 4). Inhibition by verapamil was immediate. In the presence of verapamil, KCNA10 exhibited C-type inactivation (current at 0.8 s less than peak, Fig. 6, A and B), suggesting that the block occurs in the open configuration. Furthermore, although peak current returned to control levels after washout, current at 0.8 s was still less than peak (Fig. 6C), indicating that verapamil can block KCNA10 from the cytoplasmic side. Verapamil has been reported to affect Kv1.3 similarly (10). Interestingly, Kv1.3 and KCNA10 are located on chromosome 1 at p13.1 and are probably the result of gene duplication (12). Taken together, these data strongly suggest that KCNA10 has pharmacological properties common to both voltage-gated K channels and CNG cation channels. They confirm the notion, initially suggested by the presence of a putative cyclic nucleotide-binding domain at the COOH terminus, that KCNA10 belongs to a novel class of K channels that displays some of the properties classically associated with CNG channels.


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 6.   Verapamil inhibits KCNA10 and alters its kinetics. Effect of 100 µM verapamil on KCNA10 ensemble currents is shown in a representative experiment. A and B: note that in addition to blocking ~50% of current amplitude, kinetics of inactivation are altered. C: persistence of this kinetic effect after washout of drug suggests that verapamil blocks channel from the cytoplasmic side.

Regulation by Second Messengers

Either cAMP and/or cGMP can directly activate CNG nonselective cation channels. The cyclic nucleotides bind to a domain located at the COOH terminus (5) of these channels. Unlike CNG currents, the Iac current (K-selective channel in AZF cells) is inhibited by cAMP through a mechanism that depends on ATP hydrolysis (8). Although the molecular identity of the Iac channel is not yet known, it is postulated to be a heteromultimer. Heterologous expression (X. laevis oocytes, mammalian cells) of cloned pore-forming subunits (alpha ) of CNG channels mediates nonselective cation currents that are gated directly by cyclic nucleotides (5). In contrast, alpha -subunits of K channels known to contain putative cyclic nucleotide-binding domains (EAG, HERG, BCNG-1, ATK1) do not appear to be directly regulated by cyclic nucleotides when expressed in heterologous systems. This raises the possibility that auxiliary (beta ) subunits are needed for the action of cyclic nucleotides on the alpha -subunits of these channels.

To test whether cyclic nucleotides modulated KCNA10 current, membrane-permeant forms of cGMP and cAMP [8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) and 8-bromoadenosine 3',5'-cyclic monophosphate (8-BrcAMP), respectively] were added to the oocyte bath. Baseline peak current was decreased slightly (14.93 ± 4.33%, n = 11) by 2 mM 8-BrcGMP (Fig. 7A) and was unaffected by 2 mM 8-BrcAMP (n = 8) (Fig. 7B). Additional experiments were also performed to examine possible effects of cyclic nucleotides. With regard to cAMP, 1) oocytes were treated with a cocktail of forskolin (10 mM), dibutyryl-cAMP or 8-BrcAMP (2 mM), and IBMX (100 mM); and 2) cAMP was directly applied to excised membrane patches. Neither had any significant effect. With regard to cGMP, 1) oocytes were treated with membrane-permeant 8-BrcGMP (2 mM); 2) oocytes were treated with a cocktail of S-nitroso-N-penicillamine (10 mM; a NO donor) and zaprinast (100 mM; a cGMP phosphodiesterase inhibitor); 3) oocytes were directly injected with cGMP such that the intracellular concentration was ~1 mM; and 4) cGMP was applied directly to excised membrane patches. Again, none of these maneuvers significantly altered the currents recorded. These data suggest that the activity of the alpha -subunit of KCNA10 is not regulated by cyclic nucleotides. These results are similar to those observed for other K channels that contain cyclic nucleotide-binding domains, indicating, as previously mentioned, that accessory subunits may be required.



View larger version (1417K):
[in this window]
[in a new window]
  		Fig. 7.   Effect of cyclic nucleotides on KCNA10 current. Currents are measured before and 20 min after membrane-permeant forms of either cGMP or cAMP were added to bath. A: 2 mM of 8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) decreased current by 14.93 ± 4.3% (n = 11) from control levels. B: addition of 2 mM 8-bromoadenosin-3',5'-cyclic monophosphate (8-BrcAMP) did not affect expressed current (n = 8).

The effect of internal calcium on channel activity was also tested. Intracellular Ca2+ concentration ([Ca2+]) was controlled by varying extracellular [Ca2+] in presence the calcium ionophore ionomycin. Up to 200 µM external Ca2+ did not affect channel activity (data not shown), thereby suggesting that KCNA10 activity is not regulated by intracellular calcium. These results are not surprising because the predicted amino acid sequence lacks a calcium-binding domain. However, they do not rule out the possibility that KCNA10 activity could be regulated by calcium in vivo, particularly if KCNA10 is a heteromultimeric complex.

Computer analysis of the amino acid sequence of KCNA10 indicates the presence of five putative protein kinase C (PKC) phosphorylation sites. Therefore, the effect of PKC on KCNA10 current was examined by the addition of 10 nM phorbol ester phorbol 12-myristate 13-acetate (PMA), an activator of PKC. Peak K current began to decline irreversibly within 5 min, and by 20 min the mean decline was 42 ± 2.8%, (n = 5). Figure 8, A and B, depicts a typical experiment, showing that PMA inhibits KCNA10 current without affecting its kinetics parameters. The effect of PMA was specific because application of 12-(1-pyrene)dodecanoic acid and 4-PMA, phorbol esters that do not activate PKC, did not affect KCNA10 currents (Fig. 8, A and C). These results, which were also confirmed in cell-attached macropatches, suggest that phosphorylation by PKC modulates channel activity. However, we cannot exclude the possibility that part of the decrease in current by PMA is due to internalization of some of the oocyte's plasma membrane (17). Inhibition of K channel activity by PKC has been reported for other Kv channels (4, 9) and also for maxi-K channels (11). Mutational analysis of the putative PKC sites is presently underway to determine whether any of them mediate the inhibitory effect observed with PMA.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 8.   Phosphorylation by protein kinase C (PKC) reduces KCNA10 current. A and B: addition of 10 nM phorbol 12-myristate 13-acetate (PMA), an activator of PKC, causes KCNA10 current to decrease by an average of 42% without affecting kinetic properties of current. Inactive analogs of PMA [e.g., 4alpha -PMA and 12-(1-pyrene)dodecanoic acid (PDA)] did not affect KCNA10 currents. C: I-V curves for currents shown in A and B.

Single KCNA10 Channels

Oocytes expressing >2 µA of voltage-gated K current at +40 mV under two-electrode voltage clamp were subsequently devitellinized for patch clamp experiments. Figure 9A shows typical KCNA10 single-channel currents recorded from an inside-out membrane patch excised into K-ND96 (96 mM K+). The patch pipette was filled with Na-MES with 2 mM K+. From a holding potential of -80 mV, the command voltage was stepped to the potentials indicated to elicit voltage-gated KCNA10 currents. Under these conditions, KCNA10 channels were apparent at -40 mV. Compared with the apparent threshold voltage for KCNA10 in whole cell recordings, the considerably more negative threshold observed in single-channel recording may be due in large part to the higher resolution of the latter. Fit of the single-channel I-V plot shown in Fig. 9B indicates the KCNA10 single-channel conductance is ~11 pS (linear fit between -40 and +40 mV). Oocytes that were not injected, injected with water, injected with other clones, or injected and did not express hKCNA10 never exhibited single-channel currents like those shown in Fig. 9.



View larger version (4214K):
[in this window]
[in a new window]
  		Fig. 9.   Single-channel conductance of hKCNA10 is ~11 pS. A: representative single hKCNA10 channel currents recorded from an inside-out membrane patch excised from an oocyte that expressed 2.5 mA of whole cell current at +40 mV. In this experiment, extracellular (pipette) solution is Na-MES (2 mM K+), and cytoplasmic (bath) solution is K-ND96 (96 mM K+). The command potential is indicated next to each trace. Seal resistance (Rseal) was 44 GOmega . B: single-channel I-V plot for hKCNA10. Slope of best-fit line yields a unitary channel conductance of 11.3 pS. Reversal potential extrapolated from this line is -96 mV, very close to calculated reversal potential of K (EK) of -98.3 mV, indicating that hKCNA10 is highly K selective.

Conclusion

hKCNA10 is a voltage-gated channel highly selective for K with a single-channel conductance of ~11 pS. Current is inhibited not only by classical K channel inhibitors but also by specific blockers of CNG cation channels. hKCNA10 belongs to a new class of K channel that includes HERG, Eag ATK1, and BCNG-1 These channels have structural features and pharmacological properties common to both voltage-gated Shaker K channels and cyclic nucleotide-gated nonselective cation channels.


    ACKNOWLEDGEMENTS

G. V. Desir was supported by a Veteran Administration Merit Review Award from the National Institute of Diabetes and Digestive and Kidney Diseases (DK-48105B) and is an American Heart Association Established Investigator.


    FOOTNOTES

* R. Lang and G. Lee contributed equally to this work.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: G. V. Desir, Dept. of Medicine, Sect. of Nephrology, Yale Univ. School of Medicine, 2073 LMP, 333 Cedar St., New Haven CT 06510 (E-mail gary.desir{at}yale.edu).

Received 19 July 1999; accepted in final form 11 February 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

1.   Ahmad, I, Korbmacher C, Segal AS, Cheung P, Boulpaep EL, and Barnstable CJ. Mouse cortical collecting duct cells show nonselective cation channel activity and express a gene related to the cGMP-gated rod photoreceptor channel. Proc Natl Acad Sci USA 89: 10262-10266, 1992[Abstract/Free Full Text].

2.   Archer, SL, Huang JM, Hampl V, Nelson DP, Shultz PJ, and Weir EK. Nitric oxide and cGMP cause vasorelaxation by activation of a charybdotoxin-sensitive K channel by cGMP-dependent protein kinase. Proc Natl Acad Sci USA 91: 7583-7587, 1994[Abstract/Free Full Text].

3.   Bruggemann, A, Pardo LA, Stuhmer W, and Pongs DO. Ether-a-go-go encodes a voltage-gated channel permeable to K+ and Ca2+ and modulated by cAMP. Nature 365: 445-448, 1993[Medline].

4.   Chandy, GK, and Gutman GA. Voltage-gated potassium channel genes. In: Handbook of Receptors and Channels, edited by North AR.. Boca Raton, FL: CRC, 1995, p. 1-71.

5.   Dhallan, RS, Yau KW, Schrader KA, and Reed RR. Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons. Nature 347: 184-187, 1990[Medline].

6.   Gomora, JC, and Enyeart JJ. Ca2+ depolarizes adrenal cortical cells through selective inhibition of an ATP-activated K+ current. Am J Physiol Cell Physiol 275: C1526-C1537, 1998[Abstract/Free Full Text].

7.   Guy, RH, Warmke J, Drysdale R, and Ganetzky B. Similarities in amino acid sequences of Drosophila eag and cyclic nucleotide-gated channels (Abstract). Science 254: 730, 1991[Free Full Text].

8.   Kalman, K, Pennington MW, Lanigan MD, Ngyen A, Rauer H, Mahnir V, Paschetto K, Kem WR, Grissmer S, Gutmen GA, Christian EP, Cahalan MD, Norton RS, and Chandy KG. ShK-dap22, a potent Kv1.3-specific immunosuppressive polypeptide. J Biol Chem 273: 32697-32707, 1998[Abstract/Free Full Text].

9.   Levin, G, Chikvashvili D, Singer-Lahat D, Peretz T, Thornhill WB, and Lotan I. Phosphorylation of a K+ channel a subunit modulates the inactivation conferred by a beta  subunit---involvement of cytoskeleton. J Biol Chem 271: 29321-29328, 1996[Abstract/Free Full Text].

10.   Lin, CS, Boltz RC, Blake JT, Nguyen M, Talento A, Fischer PA, Springer MS, Sigal NH, Slaughter RS, Garcia ML, Kaczorowski GJ, and Koo GC. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation. J Exp Med 177: 637-645, 1993[Abstract/Free Full Text].

11.   Minami, K, Fukuzawa K, Nakaya Y, Zeng X-R, and Inoue I. Mechanism of activation of the Ca2+-activated K+ channel by cyclic AMP in cultured porcine coronary artery smooth muscle cells. Life Sci 53: 1129-1135, 1993[Web of Science][Medline].

12.   Orias, M, Bray-Ward P, Curran ME, Keating MT, and Desir GV. Genomic localization of the human gene for KCNA10, a cGMP-activated K channel. Genomics 42: 33-37, 1997[Web of Science][Medline].

13.   Sanger, F, Nicklen S, and Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 560-564, 1977[Abstract/Free Full Text].

14.   Santoro, B, Grant SGN, Bartsch D, and Dandel ER. Interactive cloning with the SH3 domain of N-src identifies a new brain specific ion channel protein, with homology to Eag and cycic nucleotide-gated channels. Proc Natl Acad Sci USA 94: 14815-14820, 1997[Abstract/Free Full Text].

15.   Sentenac, H, Bonneaud N, Minet M, Lacroute F, Salmon J-M, Gaymard F, and Grignon C. Cloning and expression in yeast of a plant potassium ion transport system. Science 256: 663-665, 1992[Abstract/Free Full Text].

16.   Trudeau, MC, Warmke JW, Ganetzky B, and Robertson GA. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science 269: 92-96, 1995[Abstract/Free Full Text].

17.   Vasilets, LA, Schmalzing G, Madefessel K, and Haase W. Activation of protein kinase C by phorbol ester induces downregulation of the Na+/K(+)-ATPase in oocytes of Xenopus laevis. J Membr Biol 118: 131-142, 1990[Web of Science][Medline].

18.   Xu, L, and Enyeart JJ. Purine and pyrimidine nucleotides inhibit a noninactivating K+current and depolarize adrenal corticdal cells through a G protein-coupled receptor. Mol Pharmacol 55: 364-376, 1999[Abstract/Free Full Text].

19.   Yao, X, Engel D, Tung F, and Desir GV. Genomic structure and regulation of a cyclic nucleotide-gated K+ channel. Am J Physiol Renal Fluid Electrolyte Physiol 271: F37-F41, 1996[Abstract/Free Full Text].

20.   Yao, X, Segal AS, Welling P, Zhang Z, McNicholas CM, Engel D, Boulpaep EL, and Desir GV. Primary structure and functional expression of a cGMP-gated potassium channel. Proc Natl Acad Sci USA 92: 11711-11715, 1995[Abstract/Free Full Text].

Am J Physiol Renal Fluid Electrolyte Physiol 278(6):F1013-F1021
0363-6127/00 $5.00 Copyright © 2000 the American Physiological Society


This article has been cited by other articles:


Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. Gao, A. D. Portugal, J. Liu, S. Negash, W. Zhou, J. Tian, R. Xiang, L. D. Longo, and J. U. Raj
Preservation of cGMP-induced relaxation of pulmonary veins of fetal lambs exposed to chronic high altitude hypoxia: role of PKG and Rho kinase
Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L889 - L896.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurophysiol.Home page
H. M. Brew, J. X. Gittelman, R. S. Silverstein, T. D. Hanks, V. P. Demas, L. C. Robinson, C. A. Robbins, J. McKee-Johnson, S. Y. Chiu, A. Messing, et al.
Seizures and Reduced Life Span in Mice Lacking the Potassium Channel Subunit Kv1.2, but Hypoexcitability and Enlarged Kv1 Currents in Auditory Neurons
J Neurophysiol, September 1, 2007; 98(3): 1501 - 1525.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
D. A. Gray, G. Frindt, Y.-Y. Zhang, and L. G. Palmer
Basolateral K+ conductance in principal cells of rat CCD
Am J Physiol Renal Physiol, March 1, 2005; 288(3): F493 - F504.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
S. C. Hebert, G. Desir, G. Giebisch, and W. Wang
Molecular Diversity and Regulation of Renal Potassium Channels
Physiol Rev, January 1, 2005; 85(1): 319 - 371.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
S. J. Fountain, A. Cheong, R. Flemming, L. Mair, A. Sivaprasadarao, and D. J. Beech
Functional up-regulation of KCNA gene family expression in murine mesenteric resistance artery smooth muscle
J. Physiol., April 1, 2004; 556(1): 29 - 42.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
K. E. Broderick, M. R. MacPherson, M. Regulski, T. Tully, J. A. T. Dow, and S. A. Davies
Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in Drosophila
Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1207 - C1218.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. Manikkam, Y. Li, B. M. Mitchell, D. E. Mason, and L. C. Freeman
Potassium Channel Antagonists Influence Porcine Granulosa Cell Proliferation, Differentiation, and Apoptosis
Biol Reprod, July 1, 2002; 67(1): 88 - 98.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
S. Tian, W. Liu, Y. Wu, H. Rafi, A. S. Segal, and G. V. Desir
Regulation of the voltage-gated K+ channel KCNA10 by KCNA4B, a novel beta -subunit
Am J Physiol Renal Physiol, July 1, 2002; 283(1): F142 - F149.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
Q. Leng, R. W. Mercier, B.-G. Hua, H. Fromm, and G. A. Berkowitz
Electrophysiological Analysis of Cloned Cyclic Nucleotide-Gated Ion Channels
Plant Physiology, February 1, 2002; 128(2): 400 - 410.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
M. R. MacPherson, V. P. Pollock, K. E. Broderick, L. Kean, F. C. O'Connell, J. A. T. Dow, and S. A. Davies
Model Organisms: New Insights Into Ion Channel and Transporter Function.: L-type calcium channels regulate epithelial fluid transport in Drosophila melanogaster
Am J Physiol Cell Physiol, February 1, 2001; 280(2): C394 - C407.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan
Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities
Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, R.
Right arrow Articles by Desir, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, R.
Right arrow Articles by Desir, G. V.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online