AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 278: F970-F977, 2000;
0363-6127/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laterza, O. F.
Right arrow Articles by Curthoys, N. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laterza, O. F.
Right arrow Articles by Curthoys, N. P.
Vol. 278, Issue 6, F970-F977, June 2000

Specificity and functional analysis of the pH-responsive element within renal glutaminase mRNA

Omar F. Laterza and Norman P. Curthoys

Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The specificity and the functional significance of the binding of a specific cytosolic protein to a direct repeat of an eight-base AU sequence within the 3'-nontranslated region of the glutaminase (GA) mRNA were characterized. Competition experiments established that the protein that binds to this sequence is not an AUUUA binding protein. When expressed in LLC-PK1-F+ cells, the half-life of a beta -globin reporter construct, beta G-phosphoenolpyruvate carboxykinase, was only slightly affected (1.3-fold) by growth in acidic (pH 6.9, 10 mM HCO-3) vs. normal (pH 7.4, 25 mM HCO-3) medium. However, insertion of short segments of GA mRNA containing the direct repeat or a single eight-base AU sequence was sufficient to impart a fivefold pH-responsive stabilization to the chimeric mRNA. Furthermore, site-directed mutation of the direct repeat of the 8-base AU sequence in a beta G-GA mRNA, which contains 956 bases of the 3'-nontranslated region of the GA mRNA, completely abolished the pH-responsive stabilization of the wild-type beta G-GA mRNA. Thus either the direct repeat or a single eight-base AU sequence is both sufficient and necessary to create a functional pH-response element.

LLC-PK1-F+ cells; proximal tubule; metabolic acidosis; renal ammoniagenesis


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

METABOLIC ACIDOSIS IS CHARACTERIZED by a decrease in blood pH and HCO-3 concentration. Mild forms of acidosis occur in response to a high-protein diet, prolonged exercise, or a sustained fast (14). More severe forms are associated with clinical disorders such as diabetic ketoacidosis, genetic acidurias, and acute renal failure. When metabolic acidosis is sustained and uncompensated, it becomes life threatening. Increased renal ammoniagenesis and gluconeogenesis from glutamine function as a compensatory response to the onset of acidosis (7). In normal acid-base balance, the kidney extracts and catabolizes very little, if any, of the plasma glutamine (27). However, during metabolic acidosis, as much as one-third of the plasma glutamine is extracted during a single pass through the kidney (16, 27). The initial reactions in the primary pathway of renal catabolism of glutamine are catalyzed by the mitochondrial glutaminase (GA) and glutamate dehydrogenase (7). The combined deamidation and deamination reactions yield two ammonium ions and alpha -ketoglutarate. The ammonium ions serve as expendable cations and are primarily excreted in the urine. This process facilitates the excretion of acids while conserving essential Na+ and K+ ions. The subsequent conversion of alpha -ketoglutarate to glucose generates HCO-3 ions, which are added to the blood and partially compensate the systemic acidosis (2).

During chronic metabolic acidosis, the activity of the rat renal mitochondrial GA is increased 7- to 20-fold (6, 31). This increase occurs solely within the proximal convoluted tubule. The cell-specific increase in activity results from an increased rate of GA synthesis (28) that correlates with an increased level of GA mRNA (17, 18, 29). However, the observed increases occur without increasing the rate of transcription of the GA gene (17, 18). The selective stabilization of the GA mRNA was initially demonstrated by stable transfection of LLC-PK1-F+ cells (12), a pH-responsive porcine proximal tubule-like cell line, with various beta -globin (beta G) constructs (15). The parent construct, pbeta G, produced a very stable mRNA that was expressed at high levels in cells grown in normal medium (pH 7.4, 25 mM HCO-3). Neither the level of the beta G mRNA nor its half-life was affected by transfer of the cells to an acidic medium (pH 6.9, 10 mM HCO-3). In contrast, a chimeric construct, pbeta G-GA, which also encodes a 956-base segment of the 3'-nontranslated region of the GA mRNA, was expressed at significantly lower levels when stable transfectants of the LLC-PK1-F+ cells were grown in normal medium. The decreased expression resulted from the more rapid turnover (t1/2 = 4.6 h) of the beta G-GA mRNA. Transfer of the latter cells to acidic medium resulted in a pronounced stabilization (6-fold) and a gradual induction of the beta G-GA mRNA. These studies indicated that the 3'-nontranslated region of the GA mRNA contains a pH-response element (pH-RE).

More recent studies have shown that multiple segments of the GA mRNA function as pH-responsive elements (pH-REs) (20). Experiments using additional chimeric beta G constructs indicated that a 340-base segment of the GA mRNA, termed R-2, retained most of the functional characteristics of the 3'-nontranslated region. However, the remainder of the 3'-nontranslated region also served as a weak pH-RE. RNA gel shift analyses were used to identify a 48-kDa protein, which binds with high affinity to the R-2 RNA. Mapping studies demonstrated that the high-affinity binding site within the R-2 RNA consisted of a direct repeat of an eight-base AU sequence. In the present study, the function of the eight-base AU sequence was further analyzed. The resulting data suggest that either the direct repeat or a single copy of the eight-base AU sequence is necessary and sufficient to function as a pH-RE.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. [alpha -32P]dCTP and [alpha -32P]UTP (specific activity 3,000 Ci/mmol) were purchased from ICN Biochemicals or Amersham. Restriction enzymes, T7 RNA polymerase, and yeast tRNA were acquired from Boehringer Mannheim and New England Biolabs. The oligolabeling kit was from Pharmacia Biotechnology. GeneScreen Plus was purchased from New England Nuclear. Gel-blotting paper was purchased from Schleicher and Schuell. RNAsin was from Promega. DMEM/F-12 medium and Geneticin (G-418) were products of GIBCO-BRL. GENECLEAN was manufactured by Bio101. Guanidine thiocyanate and sodium-N-lauryl sarcosine were obtained from Fluka. Formazol was purchased from Molecular Resource Center. Tissue culture plates were obtained from Dow Corning. All other biochemicals were purchased from Sigma Chemical.

Construction of plasmids. The specificity of the RNA binding was characterized by using transcripts produced from two plasmids. pBS-GA(R-2I) (20) encodes a 29-base segment of the GA mRNA, which contains a direct repeat of the eight-base AU sequence. pBS-AUUUA encodes five direct repeats of the AUUUA pentamer. It was constructed by annealing the oligonucleotides 5'GTACCATTTATTTATTTATTTATTTAT3' and 5'CTAGATAAATAAATAAATAAATAAATG3' and inserting them into pBlueScript, which was previously digested with Asp 718 and Xba I. The bold letters in the oligonucleotide sequences designate partial Asp 718 and Xba I sites.

The various beta G expression vectors that were used to test the function of the pH-RE are illustrated in Fig. 1. pbeta G contains a Rous sarcoma viral promoter followed by the coding region of the rabbit beta G gene, a multicloning site, and the 3'-nontranslated region and polyadenylation site of the bovine growth hormone gene (15). The 3'-nontranslated region of the phosphoenolpyruvate carboxykinase (PCK) cDNA was previously cloned into the pbeta G vector to produce the pbeta G-PCK plasmid (15). The direct insertion of GA sequences into pbeta G-PCK was difficult because of the absence of a convenient restriction site. Therefore, the GA fragments were first cloned into pGEM-PCK, a plasmid that contains the 3'-nontranslated region of the PCK cDNA. GA(R-2H) is a 76-bp Asp 718/Hind III fragment that encodes both 8-base AU sequences, whereas GA(R-2F) is an 82-bp Ssp I/BstE II fragment that encodes only the second 8-base AU sequence. The two fragments were isolated from pBS-GA (20), blunted with Klenow enzyme, and ligated separately into the Sma I site of pGEM-PCK. Xba I/Spe I fragments were subsequently excised from the two pGEM constructs and ligated into the Xba I site of the pbeta G vector to yield pbeta G-GA(R2-H)-PCK and pbeta G-GA(R2-F)-PCK, respectively.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of various chimeric constructs used for functional analysis of pH-responsive element (pH-RE). Segments of cDNAs that encode portions of 3'-nontranslated region (UTR) of glutaminase (GA) and phosphoenolpyruvate carboxykinase (PCK) mRNAs were inserted into pbeta -globin (beta G) construct. Lengths of chimeric mRNAs are drawn to scale. 1 and 2, Presence of first and second 8-base AU sequence from 3'-nontranslated region of GA mRNA, respectively; XX, mutated AU sequences.

pbeta G-GA (15) contains a 956-bp Acc I/Drd I fragment from pGA12 (25) inserted into the EcoR V site of pbeta G. The inserted fragment includes nucleotides 2010-2965 of the GA cDNA that encode the 3'-nontranslated region of the 3.4-kb rat GA mRNA. pmbeta G-GA was synthesized by using the Quick-Change Site Directed Mutagenesis kit from Stratagene to mutate the two 8-base pH-REs within pbeta G-GA. The following oligonucleotides were used as primers: 5' CAGTGTGACTCTTGCGCGATTGGCCGAATTACTACTAACTGTTC3' (forward) and 5'GAACAGTTAGTAGTAATTCGGCCAATCGCGCAAG- AGTCACACTG3' (reverse). The mutated bases are shown in bold. The same mutations were previously shown to disrupt the binding of the pH-REBP to the R-2I RNA (20). The PCR reaction was performed by using annealing and elongation temperatures of 50 and 68°C, respectively. The resulting plasmids were initially screened by restricting with Ssp I (a site that is mutated in mbeta G-GA) and confirmed by the dideoxyribonucleotide sequencing.

In vitro transcription. The templates used to transcribe the R-2I and (AUUU)5A RNAs were obtained by restricting pBS-GA(R-2I) and pBS-AUUUA with BssH II and Xba I. The DNA templates were resolved on 8% acrylamide gels and eluted by the method of crush and soak (24). In vitro transcription was performed by using a slight modification of a previously described method (21). The radioactivity of the final product was determined by scintillation counting, and the concentrations of labeled RNAs were determined from the specific radioactivity of the incorporated [alpha -32P]UTP. The concentrations of unlabeled RNAs were determined by measuring the absorbance at 260 nm and by using specific extinction coefficients calculated from the nucleotide composition of the individual transcripts. All transcripts were stored at -70°C and used within 3-4 days.

RNA electrophoretic mobility shift assay. This assay was developed by introducing slight modifications to a previously described procedure (1). Cytosolic extracts of rat renal cortex were prepared as described previously (20). An aliquot of extract containing 3 µg of protein was preincubated for 10 min at room temperature with 0.5 µg of yeast tRNA in 10 µl of a reaction mixture containing 10 mM HEPES, pH 7.4, 25 mM potassium acetate, 2.5 mM magnesium acetate, 0.5% Nonidet P-40, 10% glycerol, 1 mM dithiothreitol, and 10 U RNAsin. Then, [32P]-labeled RNA and specified amounts of unlabeled RNAs were added as indicated. The reaction mixture was incubated at room temperature for 20 min, and the samples were then loaded onto a 5% polyacrylamide gel and subjected to electrophoresis at 170 V by using a 90 mM Tris, 110 mM boric acid, 2 mM EDTA running buffer. Gels were dried and exposed to either a film or a PhosphorImager screen. The addition of RNAsin was necessary to maintain the integrity of the probe during the initial incubation with the cytosolic extracts.

Isolation of stable cell lines. LLC-PK1-F+ cells (12) were obtained from Gerhard Gstraunthaler and cultured in a 50:50 mixture of Dulbecco's modified Eagle's and Ham's F-12 media containing 5 mM glucose and 10% fetal bovine serum at 37°C in a 5% CO2-95% air atmosphere. Cell lines expressing the various chimeric mRNAs were produced by transfection with calcium phosphate-precipitated DNA (3). A confluent 10-cm plate of cells was split 1:4 and grown for 24 h. The medium was replaced 1 h before the addition of 20 µg of calcium phosphate-precipitated DNA. The precipitated DNA was allowed to interact with the cells for 18 h, and then the cells were washed twice with 5 ml of phosphate-buffered saline. After washing, 10 ml of selection medium containing 0.5 mg/ml G-418 were added to the growing cells. The medium was changed every 2 days. About 10-14 days later, the G-418-resistant colonies were treated with trypsin and grown in medium containing 0.2 mg/ml G-418.

mRNA half-life analysis. The various transfected LLC-PK1-F+ cell lines were grown for 10-14 days in medium containing 0.2 mg/ml G-418. They were then maintained in medium without G-418 for 24 h and subsequently treated for 8 h in normal or acidic media. At time 0, 65 µM 5-6-dichloro-1-beta -ribofuranosylbenzimidazole (DRB), a specific inhibitor of RNA polymerase II transcription (10), was added to each plate. At 0, 3, 6, or 9 h post-DRB treatment, total cellular RNA was isolated as described previously (5). RNA concentrations were determined by measuring the absorbance at 260 nm.

Northern analysis. A 507-bp fragment of rabbit beta -globin cDNA was excised from pRSV-beta G (11) with Hind III and Bgl II. A 2.0-kb fragment of the 18 S ribosomal RNA cDNA from Acanthamoeba castellanii was excised from pAr2 with Hind III and EcoR 1 (8). The fragments were separated on 1% agarose gels, excised, and purified by using GENECLEAN. The synthesis of oligolabeled cDNA probes and Northern analysis was performed as described previously (15).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Previous experiments have demonstrated that a direct repeat of an eight-base AU-rich sequence within the rat GA mRNA functions as a high-affinity protein binding site (20). Competition studies were conducted to test whether the protein that binds to this sequence is a previously identified AU-rich element binding protein (4). The initial identification of a protein that binds to an AU-rich element was performed by using four contiguous AUUUA motifs (26). Such motifs function as instability elements in mRNAs that encode various cytokines and immediate early-response proteins (23). At least nine other proteins were subsequently identified to bind to related sequences (4). There are no AUUUA motifs present within the 29-base sequence (R-2I) from the GA mRNA that contains the direct repeat of the 8-base AU-rich elements. However, this segment is very AU rich and may associate with an AUUUA binding protein. The pBS-AUUUA plasmid was specifically constructed to test this hypothesis. It contains the sequence (ATTT)5A and thus encodes five contiguous copies of the AUUUA motif or three overlapping copies of the UUAUUUAUU motif (32). The specificity of the binding was tested by comparing the ability of cold R-2I or (AUUU)5A RNA to compete the interaction observed with [32P]-labeled R-2I probe (Fig. 2). A 25-fold excess of cold R-2I RNA was sufficient to effectively compete the shifted band. However, no apparent competition was evident even when a 150-fold excess of cold (AUUU)5A RNA was added. Therefore, the protein that binds to the R-2I RNA apparently is not a previously characterized AU-rich element binding protein that recognizes the various AUUUA destabilizing motifs.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2.   Specificity of RNA binding to pH-REBP. RNA gel-shift analysis was performed by using 30 fmol [32P]-labeled R-2I RNA incubated with 2 µg of BSA (lane 1) or 2 µg of cytosolic extract from rat renal cortex (lanes 2-8). Specificity of binding to pH-REBP was analyzed by comparing effect of increasing amounts (25-, 75-, 150-fold excess) of unlabeled R-2I (lanes 3-5) or (AUUU)5A (lanes 6-8) RNAs. Samples were run in native polyacrylamide gel. The gel was then dried and exposed to a PhosphorImager screen.

Studies were performed to establish the functionality of the identified binding site. Either one or two of the eight-base AU-rich sequences were introduced into a chimeric mRNA that has a moderate rate of turnover and is minimally responsive to changes in extracellular pH. The chimeric mRNA chosen for these studies contained the coding region of beta G mRNA and the 3'-nontranslated region of PCK mRNA (15). LLC-PK1-F+ cells were stably transfected with pbeta G-PCK, and the apparent half-life of the beta G-PCK mRNA was measured in cells treated with normal (pH 7.4, 25 mM HCO-3) or acidic (pH 6.9, 10 mM HCO-3) media. Half-life studies were performed by using DRB to inhibit transcription (10). The apparent half-life of the beta G-PCK mRNA was determined to be 8.5 and 11.3 h in cells grown in normal and acidic media, respectively (Fig. 3). This difference is not a significant pH-responsive stabilization. Thus the beta G-PCK mRNA constitutes an appropriate control mRNA for the functional studies.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Half-life analysis of beta G-PCK mRNA. A: total RNA was isolated from LLC-PK1-F+ cells stably transfected with pbeta G-PCK. Cells were either maintained in normal (pH 7.4) medium or transferred to acidic (pH 6.9) medium for 8 h and then treated with 65 µM 5-6-dichloro-1-beta -ribofuranosylbenzimidazole (DRB) for 0, 3, 6, and 9 h. Samples containing 15 µg of total RNA were analyzed by Northern blotting and hybridized with a [32P]-labeled beta -globin probe. B: relative levels of beta G-PCK mRNA were determined by PhosphorImager analysis. The blot was then reprobed with a [32P]-labeled 18 S rRNA cDNA. The level of beta G-PCK mRNA was divided by the corresponding level of 18 S rRNA to correct for errors in sample loading. The log of normalized data was then plotted vs. time of treatment with DRB. Values are means ± SE of data obtained from 3 separate determinations.

The R-2H segment of the pGA cDNA was inserted just upstream of the PCK sequence in the pbeta G-PCK plasmid (Fig. 1). This 76-bp fragment extends from position 2574 to position 2649 of the GA cDNA and contains both 8-base AU sequences. The pbeta G-GA(R-2H)-PCK plasmid was stably transfected into LLC-PK1-F+ cells, and the half-life of the chimeric mRNA was measured by using normal and acidic media (Fig. 4). The apparent half-life of the beta G-GA(R-2H)-PCK mRNA was 6.0 h in cells grown in pH 7.4 medium, but the mRNA was significantly stabilized when the cells were grown in pH 6.9 medium. Because no significant decrease in the level of the the beta G-GA(R-2H)-PCK mRNA was observed after 9 h, it was not possible to calculate an accurate half-life. However, the half-life in pH 6.9 medium must be at least 30 h, which would produce a 20% decrease in 9 h. Thus the insertion of the 76-base segment is sufficient to impart pH-responsiveness to the beta G-PCK mRNA.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4.   Half-life analysis of beta G-GA(R-2H)-PCK mRNA. A: total RNA was isolated from LLC-PK1-F+ cells stably transfected with pbeta G-GA(R-2H)-PCK that were grown and treated as described in Fig. 3. B: relative levels of beta G-GA(R-2H)-PCK mRNA were determined and normalized vs. level of 18 S rRNA as described in Fig. 3. The log of normalized data was then plotted vs. time of treatment with DRB. Values are means ± SE of data obtained from 3 separate determinations.

The R-2F segment of the pGA cDNA was also inserted just upstream of the PCK sequence in the pbeta G-PCK plasmid (Fig. 1). This segment contains 82-bp and extends from the Ssp I site at position 2602 to the BstE II site at position 2683 of the GA cDNA. It contains only the second of the two 8-base AU-rich sequences of the pH-RE. Again, the half-life of the beta G-GA(R-2F)-PCK mRNA in cells grown in normal medium was 5.7 h and was increased to >30 h by transfer of the cells to acidic medium (Fig. 5). Thus a single eight-base AU sequence is also sufficient to act as an effective pH-RE.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5.   Half-life analysis of beta G-GA(R-2F)-PCK mRNA. A: total RNA was isolated from LLC-PK1-F+ cells stably transfected with pbeta G-GA(R-2F)-PCK that were grown and treated as described in Fig. 3. B: relative levels of beta G-GA(R-2F)-PCK mRNA were determined and normalized vs. level of 18 S rRNA as described in Fig. 3. The log of normalized data was then plotted vs. time of treatment with DRB. Values are means ± 1/2 of the range of data obtained from 2 separate determinations.

The two 8-base AU-rich elements encoded within the pbeta G-GA cDNA were mutated to further assess their role in mediating the increased stability of the beta G-GA mRNA that occurs in response to a decrease in extracellular pH. Both the wild-type and the mutated pbeta G-GA constructs were transfected into LLC-PK1-F+ cells that were derived from the same split. The half-life of the beta G-GA mRNA in cells grown in pH 7.4 media was 5.8 h, whereas the half-life increased to 15 h when the cells were transferred to acidic medium (Fig. 6). Thus a 2.6-fold pH-responsive stabilization of the half-life of the beta G-GA mRNA was observed. The mutated beta G-GA mRNA had a half-life of 7.0 h in LLC-PK1-F+ cells grown in normal medium, and it remained unchanged in cells grown in acidic media (Fig. 7). Thus the mutation of the two 8-base AU sequences completely abolished the stabilization of the beta G-GA mRNA. This result indicates that the pH-RE is necessary for the pH-responsive stabilization of the GA mRNA. The data for the experiments that test the function of the pH-RE are summarized in Table 1.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Half-life analysis of beta G-GA mRNA. A: total RNA was isolated from LLC-PK1-F+ cells stably transfected with pbeta G-GA that were grown and treated as described in Fig. 3. B: relative levels of beta G-GA mRNA were determined and normalized vs. level of 18 S rRNA as described in Fig. 3. The log of normalized data was then plotted vs. time of treatment with DRB. Values are means ± SE of data obtained from 3 separate determinations.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of mutation of pH-RE on half-life of beta G-GA mRNA. A: total RNA was isolated from LLC-PK1-F+ cells stably transfected with pmbeta G-GA that were grown and treated as described in Fig. 3. B: relative levels of mbeta G-GA mRNAs were determined and normalized vs. level of 18 S rRNA as described in Fig. 3. The log of normalized data was then plotted vs. time of treatment with DRB. Each point is the mean ± SE of data obtained from 4 separate determinations.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Comparison of the apparent half-life values of the various chimeric beta -globin mRNAs


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In previous studies (15, 20), a beta G reporter construct, which encodes a very stable mRNA, was used to demonstrate that the 3'-nontranslated region of the GA mRNA contains both an instability element and a pH-RE. To determine whether shorter segments of the GA mRNA function as the pH-RE, it was necessary to utilize a reporter construct that encodes a mRNA that has a moderate half-life. Thus the pbeta G-PCK expression vector (15) was used to determine whether the eight-base AU sequences from the GA mRNA can function as a pH-RE. When stably transfected into LLC-PK1-F+ cells, this vector expresses a high level of beta G-PCK mRNA, a chimera that contains the coding region of beta -globin mRNA and the 3'-nontranslated region of the PCK mRNA. The level of the transgenic mRNA can be readily quantified by using a beta G cDNA probe without interference from the endogenous PCK mRNA. Furthermore, the beta G-PCK mRNA has a relatively rapid half-life that is only slightly stabilized when the transfected cells are transferred to acidic medium (15). In the present study, only a 30% increase in the stability of the beta G-PCK mRNA was observed. Thus the beta G-PCK mRNA exhibits the properties necessary to study the function of a pH-RE.

Surprisingly, the insertion of either the direct repeat of the eight-base AU sequence or only the second of the two elements produced an identical pH-responsive stabilization. The beta G-GA(R-2H)-PCK and the beta G-GA(R-2F)-PCK mRNAs were both degraded with a half-life of ~6 h in cells maintained in pH 7.4 medium. When the cells were transferred to pH 6.9 medium, both half-lives were increased to >30 h. Thus the insertion of only a single eight-base AU sequence is sufficient to function as an effective pH-RE. Mutation of either eight-base AU sequence to introduce five G and C bases greatly reduced the binding activity of the pH-REBP in RNA gel shift experiments (20). However, binding to the R-2F RNA, which contained only the second of the eight-base AU sequences, was only slightly reduced compared with the binding observed with the R-2H RNA. The results of the functional assay are consistent with the latter observation. Therefore, the context of the eight-base AU sequence may significantly affect the binding properties and function of the pH-RE.

In a second set of experiments, the identical mutations used in the previous binding studies (20) were introduced into the direct repeat of the pH-RE encoded in the pbeta G-GA plasmid. In total, 10 of the 16 A and U residues were converted to G and C residues. Because the size of the encoded mRNA was not altered by the mutagenesis, any observed changes in the pH responsiveness could not be due to alterations in the length or relative positioning of elements within the chimeric mRNA. In the present study, the half-life of the beta G-GA mRNA was 5.8 h in cells grown in normal medium, and it increased to 15 h in cells grown in acidic medium. This reflects a 2.6-fold increase in stability, which is slightly less than previously observed (15). However, the observed stabilization was both significant and sufficient to study the effects of the mutation. The difference in the observed half-lives of the beta G-GA mRNA in the two studies could be due to the use of cells with a different split number or to slight changes in growth conditions. To control such variables, the wild-type and the mutated pbeta G-GA plasmids were transfected into cells that were split the same number of times in culture and that were grown under identical conditions.

The half-life of the mbeta G-GA mRNA (7.0 h) in cells grown in normal medium is only slightly greater than the half-life of the wild-type beta G-GA mRNA (6.0 h). This observation suggests that the pH-RE contributes very little to the inherent instability of the GA mRNA. This hypothesis is consistent with the effect of insertion of different segments of the 3'-nontranslated region of the GA mRNA on the stability of various reporter mRNAs. The insertion of large segments of GA mRNA sequences caused a reduction of the half-life of beta G mRNA from ~30 to 4-7 h (15). In contrast, insertion of the R-2H and R-2F segments into the beta G-PCK mRNA only reduced stability from 8.5 to 6.0 h. However, mutation of the two 8-base AU sequences caused the complete loss of a pH-responsive stabilization of the beta G-GA mRNA. The half-life of mbeta G-GA mRNA was 7.0 h in cells grown in either normal or acidic medium. Thus the two 8-base AU sequences are necessary to impart a pH-responsive stabilization to the beta G-GA mRNA.

All of the functional studies were performed by using LLC-PK1-F+ cells, a pH-responsive line of porcine proximal tubule-like cells (12). These cells express two distinct GA mRNAs, which contain different 3'-nontranslated regions (22). Recent studies indicate that the levels of only the 4.5-kb porcine GA mRNA are increased when the LLC-PK1-F+ cells are transferred to acidic medium and that this increase results from a stabilization of the mRNA (13). Thus one would predict that the 3'-nontranslated region of the 4.5-kb porcine GA mRNA contains a pH-RE. Unfortunately, this segment of the 4.5-kb GA mRNA has not, as yet, been cloned and sequenced.

Two GA mRNAs are expressed in rat kidney (17), a 3.4-kb mRNA and a more abundant 4.7-kb mRNA. The previous studies to identify the pH-RE (15, 20) have focused solely on the 3'-nontranslated region of the 3.4-kb GA mRNA. A search for the direct repeat of the pH-RE (UUUAAAUAUUAAAAUA) within the remainder of the 3'-nontranslated region that is unique to the 4.7-kb rat GA mRNA revealed no homologous sequences. However, two separate eight-base pH-REs were found within this sequence. Both of the putative pH-REs contained a single mismatch from the identified eight-base pH-RE. The levels of both the 3.4- and 4.7-kb GA mRNAs are coordinately induced and repressed during onset or recovery from acidosis, respectively (17, 18). Thus the direct repeat of the pH-REs that is located within the portion of the 3'-nontranslated region that is common to both forms of the GA mRNA probably acts as the primary cis-acting element. The individual pH-REs within the 3'-nontranslated region of the rat GA mRNA probably act as redundant sites that enhance the pH-responsive stabilization.

The pH-RE may mediate the stability of other mRNAs that are also induced in response to onset of metabolic acidosis. For example, rat renal glutamate dehydrogenase (GDH) activity is also increased in the proximal convoluted tubule in response to metabolic acidosis (30). The increase in the level of GDH mRNA occurs with kinetics similar to that observed for the GA mRNA (19). The 3'-nontranslated region of the GDH mRNA (9) contains four AU-rich 8-base sequences that have an 88% identity to either of the two pH-REs that constitute the direct repeat within the GA mRNA. Preliminary experiments indicate that the pH-RE binding protein partially purified from cytosolic extracts of rat renal cortex binds with high affinity to two of the four AU-rich elements within the 3'-nontranslated region of the GDH mRNA (J. Schroeder, A. Tang, and N. P. Curthoys, unpublished observations). Thus it will be interesting to determine whether either or both of these sequences can also function as a pH-RE.


    ACKNOWLEDGEMENTS

This work was supported by Public Health Service Grant DK-37124 from the National Institute of Diabetes and Digestive and Kidney Diseases.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: N. P. Curthoys, Dept. of Biochemistry and Molecular Biology, Colorado State Univ., Ft. Collins, CO 80523-1870 (E-mail: NCurth{at}lamar.ColoState.edu).

Received 16 September 1999; accepted in final form 17 January 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alberta, JA, Rundell K, and Stiles CD. Identification of an activity that interacts with the 3'-untranslated region of c-myc mRNA and the role of its target sequence in mediating rapid mRNA degradation. J Biol Chem 269: 4532-4538, 1994[Abstract/Free Full Text].

2.   Brosnan, JT, Vinay P, Gougoux A, and Halperin ML. Renal ammonia production and its implications for acid-base balance In: pH Homeostasis, Mechanism and Control, edited by Haussinger D.. New York: Academic, 1988, p. 281-304.

3.   Chen, C, and Okayama H. High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7: 2745-2752, 1987[Abstract/Free Full Text].

4.   Chen, C-YA, and Shyu A-B. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20: 465-470, 1995[ISI][Medline].

5.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[ISI][Medline].

6.   Curthoys, NP, and Lowry OH. The distribution of glutaminase isoenzymes in the various structures of the nephron in normal, acidotic and alkalotic rat kidney. J Biol Chem 248: 162-167, 1973[Abstract/Free Full Text].

7.   Curthoys, NP, and Watford M. Regulation of glutaminase activity and glutamine metabolism. Annu Rev Nutr 15: 133-159, 1995[ISI][Medline].

8.   D'Alessio, JM, Harris GH, Perna PJ, and Paule MR. Ribosomal ribonucleic acid repeat unit of Acanthamoeba castellanii: cloning and restriction edonuclease map. Biochemistry 20: 3822-3827, 1981[Medline].

9.   Das, AT, Moerer P, Charles R, Moorman AFM, and Lamaers WH. Nucleotide sequence of rat liver glutamate dehyrogenase cDNA. Nucleic Acids Res 17: 2355, 1989[Free Full Text].

10.   Dubois, MF, Nguyen VT, Bellier S, and Bensuade O. Inhibitors of transcription such as 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole and isoquinoline sulfonamide derivaties (H-8 and H-7) promote dephosphorylation of the carboxyl-terminal domain of RNA polymerase II largest subunit. J Biol Chem 269: 13331-13336, 1994[Abstract/Free Full Text].

11.   Gorman, CM, Moffat LF, and Howard BH. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2: 1044-1051, 1982[Abstract/Free Full Text].

12.   Gstraunthaler, G, and Handler JS. Isolation, growth and characterization of a gluconeogenic strain of renal cells. Am J Physiol Cell Physiol 252: C232-C238, 1987[Abstract/Free Full Text].

13.   Gstraunthaler, G, Holcomb T, Feifel E, Liu W, Spitaler N, and Curthoys NP. Differential expression and acid-base regulation of glutaminase mRNAs in gluconeogenic LLC-PK1-FBPase+ cells. Am J Physiol Renal Physiol 278: F227-F237, 2000[Abstract/Free Full Text].

14.   Halperin, ML. Metabolic aspects of metabolic acidosis. Clin Invest Med 16: 294-305, 1993[ISI][Medline].

15.   Hansen, WR, Barsic-Tress N, Taylor L, and Curthoys NP. The 3'-nontranslated region of the rat renal glutaminase mRNA contains a pH-responsive stability element. Am J Physiol Renal Fluid Electrolyte Physiol 271: F126-F131, 1996[Abstract/Free Full Text].

16.   Hughey, RP, Rankin BB, and Curthoys NP. Acute acidosis and renal arteriovenous differences of glutamine in normal and adrenalectomized rats. Am J Physiol Renal Fluid Electrolyte Physiol 238: F199-F204, 1980.

17.   Hwang, J-J, and Curthoys NP. Effect of acute alterations in acid-base balance on rat renal glutaminase and phosphoenolpyruvate carboxykinase gene expression. J Biol Chem 266: 9392-9396, 1991[Abstract/Free Full Text].

18.   Hwang, J-J, Perera S, Shapiro RA, and Curthoys NP. Mechanism of altered renal glutaminase gene expression in response to chronic acidosis. Biochemistry 30: 7522-7526, 1991[Medline].

19.   Kaiser, S, Hwang-J J, Smith H, Banner C, Welbourne TC, and Curthoys NP. Effect of altered acid-base balance and of various agonists of the levels of renal glutamate dehydrogenase mRNA. Am J Physiol Renal Fluid Electrolyte Physiol 262: F507-F512, 1992[Abstract/Free Full Text].

20.   Laterza, OF, Hansen WR, Taylor L, and Curthoys NP. Identification of an mRNA-binding protein and the specific elements that may mediate the pH-responsive induction of renal glutaminase mRNA. J Biol Chem 272: 22481-22488, 1997[Abstract/Free Full Text].

21.   Melton, DA, Kreig PA, Rebogliati MR, Manniatis T, Zinn K, and Green MR. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 12: 7035-7056, 1984[Abstract/Free Full Text].

22.   Porter, D, Hansen WR, Taylor L, and Curthoys NP. Differential expression of multiple glutaminase mRNAs in LLC-PK1-F+ cells. Am J Physiol Renal Fluid Electrolyte Physiol 269: F363-F373, 1995[Abstract/Free Full Text].

23.   Ross, J. mRNA stability in mammalian cells. Microbiol Rev 59: 423-450, 1995[Abstract/Free Full Text].

24.   Sambrook, J, Fritsch EF, and Manniatis T. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989, p. 6.1-6.48.

25.   Shapiro, RA, Farrell L, Srinivasan M, and Curthoys NP. Isoloation, characterization, and in vitro expression of a cDNA that encodes the kidney isoenzyme of the mitochondrial glutaminase. J Biol Chem 266: 18792-18796, 1991[Abstract/Free Full Text].

26.   Shaw, G, and Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46: 659-667, 1986[ISI][Medline].

27.   Squires, EJ, Hall DE, and Brosnan JT. Arteriovenous differences for amino acids and lactate across kidneys of normal and acidic rats. Biochem J 160: 125-128, 1976[ISI][Medline].

28.   Tong, J, Harrison G, and Curthoys NP. The effect of metabolic acidosis on the synthesis and turnover of rat renal phosphate-dependent glutaminase. Biochem J 233: 139-144, 1986[ISI][Medline].

29.   Tong, J, Shapiro RA, and Curthoys NP. Changes in the levels of translatable glutaminase mRNA during onset and recovery from metabolic acidosis. Biochemistry 26: 2773-2777, 1987[Medline].

30.   Wright, PA, and Knepper MA. Glutamate dehydrogenase activities in microdissected rat nephron segments: effects of acid-base loading. Am J Physiol Renal Fluid Electrolyte Physiol 259: F53-F59, 1990[Abstract/Free Full Text].

31.   Wright, PA, and Knepper MA. Phosphate-dependent glutaminase activity in rat renal cortical and medullary tubule segments. Am J Physiol Renal Fluid Electrolyte Physiol 259: F961-F970, 1990[Abstract/Free Full Text].

32.   Zubiaga, AM, Belasco JG, and Greenberg ME. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol Cell Biol 15: 2219-2230, 1995[Abstract].


Am J Physiol Renal Fluid Electrolyte Physiol 278(6):F970-F977
0363-6127/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Andratsch, E. Feifel, L. Taylor, M. O'Hayre, H. Schramek, N. P. Curthoys, and G. Gstraunthaler
TGF-beta signaling and its effect on glutaminase expression in LLC-PK1-FBPase+ cells
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F846 - F853.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. P. Curthoys, L. Taylor, J. D. Hoffert, and M. A. Knepper
Proteomic analysis of the adaptive response of rat renal proximal tubules to metabolic acidosis
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F140 - F147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. M. Schroeder, H. Ibrahim, L. Taylor, and N. P. Curthoys
Role of deadenylation and AUF1 binding in the pH-responsive stabilization of glutaminase mRNA
Am J Physiol Renal Physiol, March 1, 2006; 290(3): F733 - F740.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Wang and S. R. Price
Differential regulation of branched-chain {alpha}-ketoacid dehydrogenase kinase expression by glucocorticoids and acidification in LLC-PK1-GR101 cells
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F504 - F508.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. M. Schroeder, W. Liu, and N. P. Curthoys
pH-responsive stabilization of glutamate dehydrogenase mRNA in LLC-PK1-F+ cells
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F258 - F265.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
L. D. Porter, H. Ibrahim, L. Taylor, and N. P. Curthoys
Complexity and species variation of the kidney-type glutaminase gene
Physiol Genomics, June 3, 2002; 9(3): 157 - 166.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. P. Curthoys and G. Gstraunthaler
Mechanism of increased renal gene expression during metabolic acidosis
Am J Physiol Renal Physiol, September 1, 2001; 281(3): F381 - F390.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laterza, O. F.
Right arrow Articles by Curthoys, N. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laterza, O. F.
Right arrow Articles by Curthoys, N. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online