|
|
||||||||
Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870
| |
ABSTRACT |
|---|
|
|
|---|
The specificity
and the functional significance of the binding of a specific cytosolic
protein to a direct repeat of an eight-base AU sequence within the
3'-nontranslated region of the glutaminase (GA) mRNA were
characterized. Competition experiments established that the protein
that binds to this sequence is not an AUUUA binding protein. When
expressed in LLC-PK1-F+ cells, the half-life of
a
-globin reporter construct,
G-phosphoenolpyruvate carboxykinase, was only slightly affected (1.3-fold) by growth in
acidic (pH 6.9, 10 mM HCO
3) vs. normal
(pH 7.4, 25 mM HCO
3) medium. However,
insertion of short segments of GA mRNA containing the direct repeat or
a single eight-base AU sequence was sufficient to impart a fivefold pH-responsive stabilization to the chimeric mRNA. Furthermore, site-directed mutation of the direct repeat of the 8-base AU sequence in a
G-GA mRNA, which contains 956 bases of the
3'-nontranslated region of the GA mRNA, completely abolished the
pH-responsive stabilization of the wild-type
G-GA mRNA. Thus either
the direct repeat or a single eight-base AU sequence is both sufficient
and necessary to create a functional pH-response element.
LLC-PK1-F+ cells; proximal tubule; metabolic acidosis; renal ammoniagenesis
| |
INTRODUCTION |
|---|
|
|
|---|
METABOLIC ACIDOSIS IS CHARACTERIZED by a decrease in
blood pH and HCO
3 concentration. Mild
forms of acidosis occur in response to a high-protein diet, prolonged
exercise, or a sustained fast (14). More severe forms are associated
with clinical disorders such as diabetic ketoacidosis, genetic
acidurias, and acute renal failure. When metabolic acidosis is
sustained and uncompensated, it becomes life threatening. Increased
renal ammoniagenesis and gluconeogenesis from glutamine function as a
compensatory response to the onset of acidosis (7). In normal acid-base
balance, the kidney extracts and catabolizes very little, if any, of
the plasma glutamine (27). However, during metabolic acidosis, as much
as one-third of the plasma glutamine is extracted during a single pass
through the kidney (16, 27). The initial reactions in the primary
pathway of renal catabolism of glutamine are catalyzed by the
mitochondrial glutaminase (GA) and glutamate dehydrogenase (7). The
combined deamidation and deamination reactions yield two ammonium ions
and
-ketoglutarate. The ammonium ions serve as expendable cations
and are primarily excreted in the urine. This process facilitates the
excretion of acids while conserving essential Na+ and
K+ ions. The subsequent conversion of
-ketoglutarate to
glucose generates HCO
3 ions, which are
added to the blood and partially compensate the systemic acidosis (2).
During chronic metabolic acidosis, the activity of the rat renal
mitochondrial GA is increased 7- to 20-fold (6, 31). This
increase occurs solely within the proximal convoluted tubule. The
cell-specific increase in activity results from an increased rate of GA
synthesis (28) that correlates with an increased level of GA mRNA (17,
18, 29). However, the observed increases occur without increasing the
rate of transcription of the GA gene (17, 18). The selective
stabilization of the GA mRNA was initially demonstrated by stable
transfection of LLC-PK1-F+ cells
(12), a pH-responsive porcine proximal tubule-like cell line, with
various
-globin (
G) constructs (15). The parent construct, p
G,
produced a very stable mRNA that was expressed at high levels in cells
grown in normal medium (pH 7.4, 25 mM HCO
3). Neither the level of the
G
mRNA nor its half-life was affected by transfer of the cells to an
acidic medium (pH 6.9, 10 mM HCO
3). In
contrast, a chimeric construct, p
G-GA, which also encodes a
956-base segment of the 3'-nontranslated region of the GA mRNA,
was expressed at significantly lower levels when stable transfectants
of the LLC-PK1-F+ cells were grown in normal
medium. The decreased expression resulted from the more rapid turnover
(t1/2 = 4.6 h) of the
G-GA mRNA. Transfer of the
latter cells to acidic medium resulted in a pronounced stabilization
(6-fold) and a gradual induction of the
G-GA mRNA. These studies
indicated that the 3'-nontranslated region of the GA mRNA
contains a pH-response element (pH-RE).
More recent studies have shown that multiple segments of the GA mRNA
function as pH-responsive elements (pH-REs) (20). Experiments using
additional chimeric
G constructs indicated that a 340-base segment
of the GA mRNA, termed R-2, retained most of the functional characteristics of the 3'-nontranslated region. However, the
remainder of the 3'-nontranslated region also served as a weak
pH-RE. RNA gel shift analyses were used to identify a 48-kDa protein,
which binds with high affinity to the R-2 RNA. Mapping studies
demonstrated that the high-affinity binding site within the R-2 RNA
consisted of a direct repeat of an eight-base AU sequence. In the
present study, the function of the eight-base AU sequence was further analyzed. The resulting data suggest that either the direct repeat or a
single copy of the eight-base AU sequence is necessary and sufficient
to function as a pH-RE.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
[
-32P]dCTP and
[
-32P]UTP (specific activity 3,000 Ci/mmol)
were purchased from ICN Biochemicals or Amersham. Restriction enzymes, T7 RNA polymerase, and yeast tRNA were acquired from Boehringer Mannheim and New England Biolabs. The oligolabeling kit was from Pharmacia Biotechnology. GeneScreen Plus was purchased from New England
Nuclear. Gel-blotting paper was purchased from Schleicher and Schuell.
RNAsin was from Promega. DMEM/F-12 medium and Geneticin (G-418) were products of GIBCO-BRL. GENECLEAN was manufactured by
Bio101. Guanidine thiocyanate and sodium-N-lauryl sarcosine were obtained from Fluka. Formazol was purchased from Molecular Resource Center. Tissue culture plates were obtained from Dow Corning.
All other biochemicals were purchased from Sigma Chemical.
Construction of plasmids. The specificity of the RNA binding was characterized by using transcripts produced from two plasmids. pBS-GA(R-2I) (20) encodes a 29-base segment of the GA mRNA, which contains a direct repeat of the eight-base AU sequence. pBS-AUUUA encodes five direct repeats of the AUUUA pentamer. It was constructed by annealing the oligonucleotides 5'GTACCATTTATTTATTTATTTATTTAT3' and 5'CTAGATAAATAAATAAATAAATAAATG3' and inserting them into pBlueScript, which was previously digested with Asp 718 and Xba I. The bold letters in the oligonucleotide sequences designate partial Asp 718 and Xba I sites.
The various
G expression vectors that were used to test the function
of the pH-RE are illustrated in Fig. 1.
p
G contains a Rous sarcoma viral promoter followed by the coding
region of the rabbit
G gene, a multicloning site, and the
3'-nontranslated region and polyadenylation site of the bovine
growth hormone gene (15). The 3'-nontranslated region of the
phosphoenolpyruvate carboxykinase (PCK) cDNA was previously
cloned into the p
G vector to produce the p
G-PCK plasmid (15). The
direct insertion of GA sequences into p
G-PCK was difficult because
of the absence of a convenient restriction site. Therefore, the GA
fragments were first cloned into pGEM-PCK, a plasmid that contains the
3'-nontranslated region of the PCK cDNA. GA(R-2H) is a 76-bp
Asp 718/Hind III fragment that encodes both
8-base AU sequences, whereas GA(R-2F) is an 82-bp Ssp
I/BstE II fragment that encodes only the second
8-base AU sequence. The two fragments were isolated from pBS-GA (20), blunted with Klenow enzyme, and ligated separately into the Sma I site of pGEM-PCK. Xba I/Spe I fragments were
subsequently excised from the two pGEM constructs and ligated into the
Xba I site of the p
G vector to yield p
G-GA(R2-H)-PCK and
p
G-GA(R2-F)-PCK, respectively.
|
G-GA (15) contains a 956-bp Acc I/Drd I fragment
from pGA12 (25) inserted into the EcoR V site of p
G. The
inserted fragment includes nucleotides 2010-2965 of the GA cDNA
that encode the 3'-nontranslated region of the 3.4-kb rat GA
mRNA. pm
G-GA was synthesized by using the Quick-Change Site Directed
Mutagenesis kit from Stratagene to mutate the two 8-base pH-REs within
p
G-GA. The following oligonucleotides were used as primers: 5'
CAGTGTGACTCTTGCGCGATTGGCCGAATTACTACTAACTGTTC3' (forward) and
5'GAACAGTTAGTAGTAATTCGGCCAATCGCGCAAG- AGTCACACTG3'
(reverse). The mutated bases are shown in bold. The same mutations were
previously shown to disrupt the binding of the pH-REBP to the R-2I RNA
(20). The PCR reaction was performed by using annealing and elongation
temperatures of 50 and 68°C, respectively. The resulting plasmids
were initially screened by restricting with Ssp I (a site that
is mutated in m
G-GA) and confirmed by the dideoxyribonucleotide sequencing.
In vitro transcription.
The templates used to transcribe the R-2I and (AUUU)5A RNAs
were obtained by restricting pBS-GA(R-2I) and pBS-AUUUA with
BssH II and Xba I. The DNA templates were resolved on
8% acrylamide gels and eluted by the method of crush and soak (24). In
vitro transcription was performed by using a slight modification of a
previously described method (21). The radioactivity of the final
product was determined by scintillation counting, and the concentrations of labeled RNAs were determined from the specific radioactivity of the incorporated [
-32P]UTP.
The concentrations of unlabeled RNAs were determined by measuring the
absorbance at 260 nm and by using specific extinction coefficients
calculated from the nucleotide composition of the individual
transcripts. All transcripts were stored at
70°C and used
within 3-4 days.
RNA electrophoretic mobility shift assay. This assay was developed by introducing slight modifications to a previously described procedure (1). Cytosolic extracts of rat renal cortex were prepared as described previously (20). An aliquot of extract containing 3 µg of protein was preincubated for 10 min at room temperature with 0.5 µg of yeast tRNA in 10 µl of a reaction mixture containing 10 mM HEPES, pH 7.4, 25 mM potassium acetate, 2.5 mM magnesium acetate, 0.5% Nonidet P-40, 10% glycerol, 1 mM dithiothreitol, and 10 U RNAsin. Then, [32P]-labeled RNA and specified amounts of unlabeled RNAs were added as indicated. The reaction mixture was incubated at room temperature for 20 min, and the samples were then loaded onto a 5% polyacrylamide gel and subjected to electrophoresis at 170 V by using a 90 mM Tris, 110 mM boric acid, 2 mM EDTA running buffer. Gels were dried and exposed to either a film or a PhosphorImager screen. The addition of RNAsin was necessary to maintain the integrity of the probe during the initial incubation with the cytosolic extracts.
Isolation of stable cell lines. LLC-PK1-F+ cells (12) were obtained from Gerhard Gstraunthaler and cultured in a 50:50 mixture of Dulbecco's modified Eagle's and Ham's F-12 media containing 5 mM glucose and 10% fetal bovine serum at 37°C in a 5% CO2-95% air atmosphere. Cell lines expressing the various chimeric mRNAs were produced by transfection with calcium phosphate-precipitated DNA (3). A confluent 10-cm plate of cells was split 1:4 and grown for 24 h. The medium was replaced 1 h before the addition of 20 µg of calcium phosphate-precipitated DNA. The precipitated DNA was allowed to interact with the cells for 18 h, and then the cells were washed twice with 5 ml of phosphate-buffered saline. After washing, 10 ml of selection medium containing 0.5 mg/ml G-418 were added to the growing cells. The medium was changed every 2 days. About 10-14 days later, the G-418-resistant colonies were treated with trypsin and grown in medium containing 0.2 mg/ml G-418.
mRNA half-life analysis.
The various transfected LLC-PK1-F+ cell lines
were grown for 10-14 days in medium containing 0.2 mg/ml G-418.
They were then maintained in medium without G-418 for 24 h and
subsequently treated for 8 h in normal or acidic media. At time
0, 65 µM 5-6-dichloro-1-
-ribofuranosylbenzimidazole (DRB), a specific inhibitor of RNA polymerase II transcription (10),
was added to each plate. At 0, 3, 6, or 9 h post-DRB treatment, total
cellular RNA was isolated as described previously (5). RNA
concentrations were determined by measuring the absorbance at 260 nm.
Northern analysis.
A 507-bp fragment of rabbit
-globin cDNA was excised from pRSV-
G
(11) with Hind III and Bgl II. A 2.0-kb
fragment of the 18 S ribosomal RNA cDNA from Acanthamoeba
castellanii was excised from pAr2 with Hind III and
EcoR 1 (8). The fragments were separated on 1% agarose gels,
excised, and purified by using GENECLEAN. The synthesis of oligolabeled
cDNA probes and Northern analysis was performed as described previously
(15).
| |
RESULTS |
|---|
|
|
|---|
Previous experiments have demonstrated that a direct repeat of an
eight-base AU-rich sequence within the rat GA mRNA functions as a
high-affinity protein binding site (20). Competition studies were
conducted to test whether the protein that binds to this sequence is a
previously identified AU-rich element binding protein (4). The initial
identification of a protein that binds to an AU-rich element was
performed by using four contiguous AUUUA motifs (26). Such motifs
function as instability elements in mRNAs that encode various cytokines
and immediate early-response proteins (23). At least nine other
proteins were subsequently identified to bind to related sequences (4).
There are no AUUUA motifs present within the 29-base sequence (R-2I)
from the GA mRNA that contains the direct repeat of the 8-base AU-rich
elements. However, this segment is very AU rich and may associate with
an AUUUA binding protein. The pBS-AUUUA plasmid was specifically constructed to test this hypothesis. It contains the sequence (ATTT)5A and thus encodes five contiguous copies of the
AUUUA motif or three overlapping copies of the UUAUUUAUU motif (32). The specificity of the binding was tested by comparing the ability of
cold R-2I or (AUUU)5A RNA to compete the interaction
observed with [32P]-labeled R-2I probe (Fig.
2). A 25-fold excess of cold R-2I RNA was
sufficient to effectively compete the shifted band. However, no
apparent competition was evident even when a 150-fold excess of cold
(AUUU)5A RNA was added. Therefore, the protein that binds to the R-2I RNA apparently is not a previously characterized AU-rich element binding protein that recognizes the various AUUUA destabilizing motifs.
|
Studies were performed to establish the functionality of the identified
binding site. Either one or two of the eight-base AU-rich sequences
were introduced into a chimeric mRNA that has a moderate rate of
turnover and is minimally responsive to changes in extracellular pH.
The chimeric mRNA chosen for these studies contained the coding
region of
G mRNA and the 3'-nontranslated region of PCK
mRNA (15). LLC-PK1-F+ cells were stably
transfected with p
G-PCK, and the apparent half-life of the
G-PCK
mRNA was measured in cells treated with normal (pH 7.4, 25 mM
HCO
3) or acidic (pH 6.9, 10 mM HCO
3) media. Half-life studies were
performed by using DRB to inhibit transcription (10). The apparent
half-life of the
G-PCK mRNA was determined to be 8.5 and 11.3 h in
cells grown in normal and acidic media, respectively (Fig.
3). This difference is not a significant
pH-responsive stabilization. Thus the
G-PCK mRNA constitutes an
appropriate control mRNA for the functional studies.
|
The R-2H segment of the pGA cDNA was inserted just upstream of the PCK
sequence in the p
G-PCK plasmid (Fig. 1). This 76-bp fragment extends
from position 2574 to position 2649 of the GA cDNA and
contains both 8-base AU sequences. The p
G-GA(R-2H)-PCK plasmid was
stably transfected into LLC-PK1-F+ cells, and
the half-life of the chimeric mRNA was measured by using normal and
acidic media (Fig. 4). The apparent
half-life of the
G-GA(R-2H)-PCK mRNA was 6.0 h in cells grown in pH
7.4 medium, but the mRNA was significantly stabilized when the cells were grown in pH 6.9 medium. Because no significant decrease in the
level of the the
G-GA(R-2H)-PCK mRNA was observed after 9 h, it was
not possible to calculate an accurate half-life. However, the half-life
in pH 6.9 medium must be at least 30 h, which would produce a 20%
decrease in 9 h. Thus the insertion of the 76-base segment is
sufficient to impart pH-responsiveness to the
G-PCK mRNA.
|
The R-2F segment of the pGA cDNA was also inserted just upstream of the
PCK sequence in the p
G-PCK plasmid (Fig. 1). This segment contains
82-bp and extends from the Ssp I site at position 2602 to the BstE II site at position 2683 of the
GA cDNA. It contains only the second of the two 8-base AU-rich
sequences of the pH-RE. Again, the half-life of the
G-GA(R-2F)-PCK
mRNA in cells grown in normal medium was 5.7 h and was increased to
>30 h by transfer of the cells to acidic medium (Fig.
5). Thus a single eight-base AU sequence is
also sufficient to act as an effective pH-RE.
|
The two 8-base AU-rich elements encoded within the p
G-GA cDNA were
mutated to further assess their role in mediating the increased
stability of the
G-GA mRNA that occurs in response to a decrease in
extracellular pH. Both the wild-type and the mutated p
G-GA
constructs were transfected into LLC-PK1-F+
cells that were derived from the same split. The half-life of the
G-GA mRNA in cells grown in pH 7.4 media was 5.8 h, whereas the
half-life increased to 15 h when the cells were transferred to acidic
medium (Fig. 6). Thus a 2.6-fold
pH-responsive stabilization of the half-life of the
G-GA mRNA was
observed. The mutated
G-GA mRNA had a half-life of 7.0 h in
LLC-PK1-F+ cells grown in normal medium, and it
remained unchanged in cells grown in acidic media (Fig.
7). Thus the mutation of the two 8-base AU
sequences completely abolished the stabilization of the
G-GA mRNA.
This result indicates that the pH-RE is necessary for the pH-responsive
stabilization of the GA mRNA. The data for the experiments that test
the function of the pH-RE are summarized in Table
1.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In previous studies (15, 20), a
G reporter construct, which encodes
a very stable mRNA, was used to demonstrate that the
3'-nontranslated region of the GA mRNA contains both an
instability element and a pH-RE. To determine whether shorter segments
of the GA mRNA function as the pH-RE, it was necessary to utilize a
reporter construct that encodes a mRNA that has a moderate half-life. Thus the p
G-PCK expression vector (15) was used to determine whether
the eight-base AU sequences from the GA mRNA can function as a pH-RE.
When stably transfected into LLC-PK1-F+ cells,
this vector expresses a high level of
G-PCK mRNA, a chimera that
contains the coding region of
-globin mRNA and the
3'-nontranslated region of the PCK mRNA. The level of the
transgenic mRNA can be readily quantified by using a
G cDNA probe
without interference from the endogenous PCK mRNA. Furthermore, the
G-PCK mRNA has a relatively rapid half-life that is only slightly
stabilized when the transfected cells are transferred to acidic medium
(15). In the present study, only a 30% increase in the stability of the
G-PCK mRNA was observed. Thus the
G-PCK mRNA exhibits the properties necessary to study the function of a pH-RE.
Surprisingly, the insertion of either the direct repeat of the
eight-base AU sequence or only the second of the two elements produced an identical pH-responsive stabilization. The
G-GA(R-2H)-PCK and the
G-GA(R-2F)-PCK mRNAs were both degraded
with a half-life of ~6 h in cells maintained in pH 7.4 medium. When
the cells were transferred to pH 6.9 medium, both half-lives were
increased to >30 h. Thus the insertion of only a single eight-base AU
sequence is sufficient to function as an effective pH-RE. Mutation of
either eight-base AU sequence to introduce five G and C bases greatly reduced the binding activity of the pH-REBP in RNA gel shift
experiments (20). However, binding to the R-2F RNA, which contained
only the second of the eight-base AU sequences, was only slightly
reduced compared with the binding observed with the R-2H RNA. The
results of the functional assay are consistent with the latter
observation. Therefore, the context of the eight-base AU sequence may
significantly affect the binding properties and function of the pH-RE.
In a second set of experiments, the identical mutations used in the
previous binding studies (20) were introduced into the direct repeat of
the pH-RE encoded in the p
G-GA plasmid. In total, 10 of the 16 A and
U residues were converted to G and C residues. Because the size of the
encoded mRNA was not altered by the mutagenesis, any observed changes
in the pH responsiveness could not be due to alterations in the length
or relative positioning of elements within the chimeric mRNA. In the
present study, the half-life of the
G-GA mRNA was 5.8 h in cells
grown in normal medium, and it increased to 15 h in cells grown in
acidic medium. This reflects a 2.6-fold increase in stability, which is
slightly less than previously observed (15). However, the observed
stabilization was both significant and sufficient to study the effects
of the mutation. The difference in the observed half-lives of the
G-GA mRNA in the two studies could be due to the use of cells with a
different split number or to slight changes in growth conditions. To
control such variables, the wild-type and the mutated p
G-GA plasmids
were transfected into cells that were split the same number of times in
culture and that were grown under identical conditions.
The half-life of the m
G-GA mRNA (7.0 h) in cells grown in normal
medium is only slightly greater than the half-life of the wild-type
G-GA mRNA (6.0 h). This observation suggests that the pH-RE
contributes very little to the inherent instability of the GA mRNA.
This hypothesis is consistent with the effect of insertion of different
segments of the 3'-nontranslated region of the GA mRNA on the
stability of various reporter mRNAs. The insertion of large segments of
GA mRNA sequences caused a reduction of the half-life of
G mRNA from
~30 to 4-7 h (15). In contrast, insertion of the R-2H and R-2F
segments into the
G-PCK mRNA only reduced stability from 8.5 to 6.0 h. However, mutation of the two 8-base AU sequences caused the complete
loss of a pH-responsive stabilization of the
G-GA mRNA. The
half-life of m
G-GA mRNA was 7.0 h in cells grown in either normal or
acidic medium. Thus the two 8-base AU sequences are necessary to impart
a pH-responsive stabilization to the
G-GA mRNA.
All of the functional studies were performed by using LLC-PK1-F+ cells, a pH-responsive line of porcine proximal tubule-like cells (12). These cells express two distinct GA mRNAs, which contain different 3'-nontranslated regions (22). Recent studies indicate that the levels of only the 4.5-kb porcine GA mRNA are increased when the LLC-PK1-F+ cells are transferred to acidic medium and that this increase results from a stabilization of the mRNA (13). Thus one would predict that the 3'-nontranslated region of the 4.5-kb porcine GA mRNA contains a pH-RE. Unfortunately, this segment of the 4.5-kb GA mRNA has not, as yet, been cloned and sequenced.
Two GA mRNAs are expressed in rat kidney (17), a 3.4-kb mRNA and a more abundant 4.7-kb mRNA. The previous studies to identify the pH-RE (15, 20) have focused solely on the 3'-nontranslated region of the 3.4-kb GA mRNA. A search for the direct repeat of the pH-RE (UUUAAAUAUUAAAAUA) within the remainder of the 3'-nontranslated region that is unique to the 4.7-kb rat GA mRNA revealed no homologous sequences. However, two separate eight-base pH-REs were found within this sequence. Both of the putative pH-REs contained a single mismatch from the identified eight-base pH-RE. The levels of both the 3.4- and 4.7-kb GA mRNAs are coordinately induced and repressed during onset or recovery from acidosis, respectively (17, 18). Thus the direct repeat of the pH-REs that is located within the portion of the 3'-nontranslated region that is common to both forms of the GA mRNA probably acts as the primary cis-acting element. The individual pH-REs within the 3'-nontranslated region of the rat GA mRNA probably act as redundant sites that enhance the pH-responsive stabilization.
The pH-RE may mediate the stability of other mRNAs that are also induced in response to onset of metabolic acidosis. For example, rat renal glutamate dehydrogenase (GDH) activity is also increased in the proximal convoluted tubule in response to metabolic acidosis (30). The increase in the level of GDH mRNA occurs with kinetics similar to that observed for the GA mRNA (19). The 3'-nontranslated region of the GDH mRNA (9) contains four AU-rich 8-base sequences that have an 88% identity to either of the two pH-REs that constitute the direct repeat within the GA mRNA. Preliminary experiments indicate that the pH-RE binding protein partially purified from cytosolic extracts of rat renal cortex binds with high affinity to two of the four AU-rich elements within the 3'-nontranslated region of the GDH mRNA (J. Schroeder, A. Tang, and N. P. Curthoys, unpublished observations). Thus it will be interesting to determine whether either or both of these sequences can also function as a pH-RE.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by Public Health Service Grant DK-37124 from the National Institute of Diabetes and Digestive and Kidney Diseases.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: N. P. Curthoys, Dept. of Biochemistry and Molecular Biology, Colorado State Univ., Ft. Collins, CO 80523-1870 (E-mail: NCurth{at}lamar.ColoState.edu).
Received 16 September 1999; accepted in final form 17 January 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alberta, JA,
Rundell K,
and
Stiles CD.
Identification of an activity that interacts with the 3'-untranslated region of c-myc mRNA and the role of its target sequence in mediating rapid mRNA degradation.
J Biol Chem
269:
4532-4538,
1994
2.
Brosnan, JT,
Vinay P,
Gougoux A,
and
Halperin ML.
Renal ammonia production and its implications for acid-base balance
In: pH Homeostasis, Mechanism and Control, edited by Haussinger D.. New York: Academic, 1988, p. 281-304.
3.
Chen, C,
and
Okayama H.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol Cell Biol
7:
2745-2752,
1987
4.
Chen, C-YA,
and
Shyu A-B.
AU-rich elements: characterization and importance in mRNA degradation.
Trends Biochem Sci
20:
465-470,
1995[Web of Science][Medline].
5.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
6.
Curthoys, NP,
and
Lowry OH.
The distribution of glutaminase isoenzymes in the various structures of the nephron in normal, acidotic and alkalotic rat kidney.
J Biol Chem
248:
162-167,
1973
7.
Curthoys, NP,
and
Watford M.
Regulation of glutaminase activity and glutamine metabolism.
Annu Rev Nutr
15:
133-159,
1995[Web of Science][Medline].
8.
D'Alessio, JM,
Harris GH,
Perna PJ,
and
Paule MR.
Ribosomal ribonucleic acid repeat unit of Acanthamoeba castellanii: cloning and restriction edonuclease map.
Biochemistry
20:
3822-3827,
1981[Medline].
9.
Das, AT,
Moerer P,
Charles R,
Moorman AFM,
and
Lamaers WH.
Nucleotide sequence of rat liver glutamate dehyrogenase cDNA.
Nucleic Acids Res
17:
2355,
1989
10.
Dubois, MF,
Nguyen VT,
Bellier S,
and
Bensuade O.
Inhibitors of transcription such as 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole and isoquinoline sulfonamide derivaties (H-8 and H-7) promote dephosphorylation of the carboxyl-terminal domain of RNA polymerase II largest subunit.
J Biol Chem
269:
13331-13336,
1994
11.
Gorman, CM,
Moffat LF,
and
Howard BH.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol Cell Biol
2:
1044-1051,
1982
12.
Gstraunthaler, G,
and
Handler JS.
Isolation, growth and characterization of a gluconeogenic strain of renal cells.
Am J Physiol Cell Physiol
252:
C232-C238,
1987
13.
Gstraunthaler, G,
Holcomb T,
Feifel E,
Liu W,
Spitaler N,
and
Curthoys NP.
Differential expression and acid-base regulation of glutaminase mRNAs in gluconeogenic LLC-PK1-FBPase+ cells.
Am J Physiol Renal Physiol
278:
F227-F237,
2000
14.
Halperin, ML.
Metabolic aspects of metabolic acidosis.
Clin Invest Med
16:
294-305,
1993[Web of Science][Medline].
15.
Hansen, WR,
Barsic-Tress N,
Taylor L,
and
Curthoys NP.
The 3'-nontranslated region of the rat renal glutaminase mRNA contains a pH-responsive stability element.
Am J Physiol Renal Fluid Electrolyte Physiol
271:
F126-F131,
1996
16.
Hughey, RP,
Rankin BB,
and
Curthoys NP.
Acute acidosis and renal arteriovenous differences of glutamine in normal and adrenalectomized rats.
Am J Physiol Renal Fluid Electrolyte Physiol
238:
F199-F204,
1980.
17.
Hwang, J-J,
and
Curthoys NP.
Effect of acute alterations in acid-base balance on rat renal glutaminase and phosphoenolpyruvate carboxykinase gene expression.
J Biol Chem
266:
9392-9396,
1991
18.
Hwang, J-J,
Perera S,
Shapiro RA,
and
Curthoys NP.
Mechanism of altered renal glutaminase gene expression in response to chronic acidosis.
Biochemistry
30:
7522-7526,
1991[Medline].
19.
Kaiser, S,
Hwang-J J,
Smith H,
Banner C,
Welbourne TC,
and
Curthoys NP.
Effect of altered acid-base balance and of various agonists of the levels of renal glutamate dehydrogenase mRNA.
Am J Physiol Renal Fluid Electrolyte Physiol
262:
F507-F512,
1992
20.
Laterza, OF,
Hansen WR,
Taylor L,
and
Curthoys NP.
Identification of an mRNA-binding protein and the specific elements that may mediate the pH-responsive induction of renal glutaminase mRNA.
J Biol Chem
272:
22481-22488,
1997
21.
Melton, DA,
Kreig PA,
Rebogliati MR,
Manniatis T,
Zinn K,
and
Green MR.
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res
12:
7035-7056,
1984
22.
Porter, D,
Hansen WR,
Taylor L,
and
Curthoys NP.
Differential expression of multiple glutaminase mRNAs in LLC-PK1-F+ cells.
Am J Physiol Renal Fluid Electrolyte Physiol
269:
F363-F373,
1995
23.
Ross, J.
mRNA stability in mammalian cells.
Microbiol Rev
59:
423-450,
1995
24.
Sambrook, J,
Fritsch EF,
and
Manniatis T.
Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989, p. 6.1-6.48.
25.
Shapiro, RA,
Farrell L,
Srinivasan M,
and
Curthoys NP.
Isoloation, characterization, and in vitro expression of a cDNA that encodes the kidney isoenzyme of the mitochondrial glutaminase.
J Biol Chem
266:
18792-18796,
1991
26.
Shaw, G,
and
Kamen R.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:
659-667,
1986[Web of Science][Medline].
27.
Squires, EJ,
Hall DE,
and
Brosnan JT.
Arteriovenous differences for amino acids and lactate across kidneys of normal and acidic rats.
Biochem J
160:
125-128,
1976[Web of Science][Medline].
28.
Tong, J,
Harrison G,
and
Curthoys NP.
The effect of metabolic acidosis on the synthesis and turnover of rat renal phosphate-dependent glutaminase.
Biochem J
233:
139-144,
1986[Web of Science][Medline].
29.
Tong, J,
Shapiro RA,
and
Curthoys NP.
Changes in the levels of translatable glutaminase mRNA during onset and recovery from metabolic acidosis.
Biochemistry
26:
2773-2777,
1987[Medline].
30.
Wright, PA,
and
Knepper MA.
Glutamate dehydrogenase activities in microdissected rat nephron segments: effects of acid-base loading.
Am J Physiol Renal Fluid Electrolyte Physiol
259:
F53-F59,
1990
31.
Wright, PA,
and
Knepper MA.
Phosphate-dependent glutaminase activity in rat renal cortical and medullary tubule segments.
Am J Physiol Renal Fluid Electrolyte Physiol
259:
F961-F970,
1990
32.
Zubiaga, AM,
Belasco JG,
and
Greenberg ME.
The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.
Mol Cell Biol
15:
2219-2230,
1995[Abstract].
This article has been cited by other articles:
![]() |
M. Andratsch, E. Feifel, L. Taylor, M. O'Hayre, H. Schramek, N. P. Curthoys, and G. Gstraunthaler TGF-beta signaling and its effect on glutaminase expression in LLC-PK1-FBPase+ cells Am J Physiol Renal Physiol, September 1, 2007; 293(3): F846 - F853. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Curthoys, L. Taylor, J. D. Hoffert, and M. A. Knepper Proteomic analysis of the adaptive response of rat renal proximal tubules to metabolic acidosis Am J Physiol Renal Physiol, January 1, 2007; 292(1): F140 - F147. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Schroeder, H. Ibrahim, L. Taylor, and N. P. Curthoys Role of deadenylation and AUF1 binding in the pH-responsive stabilization of glutaminase mRNA Am J Physiol Renal Physiol, March 1, 2006; 290(3): F733 - F740. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang and S. R. Price Differential regulation of branched-chain {alpha}-ketoacid dehydrogenase kinase expression by glucocorticoids and acidification in LLC-PK1-GR101 cells Am J Physiol Renal Physiol, March 1, 2004; 286(3): F504 - F508. [Abstract] [Full Text] |
||||
![]() |
J. M. Schroeder, W. Liu, and N. P. Curthoys pH-responsive stabilization of glutamate dehydrogenase mRNA in LLC-PK1-F+ cells Am J Physiol Renal Physiol, August 1, 2003; 285(2): F258 - F265. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. D. Porter, H. Ibrahim, L. Taylor, and N. P. Curthoys Complexity and species variation of the kidney-type glutaminase gene Physiol Genomics, June 3, 2002; 9(3): 157 - 166. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Curthoys and G. Gstraunthaler Mechanism of increased renal gene expression during metabolic acidosis Am J Physiol Renal Physiol, September 1, 2001; 281(3): F381 - F390. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |