AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 279: F440-F448, 2000;
0363-6127/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (44)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, R.
Right arrow Articles by Paul, R. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, R.
Right arrow Articles by Paul, R. V.
Vol. 279, Issue 3, F440-F448, September 2000

A functional angiotensin II receptor-GFP fusion protein: evidence for agonist-dependent nuclear translocation

Ruihua Chen1, Yurii V. Mukhin1, Maria N. Garnovskaya1,2, Thomas E. Thielen1, Yoshihiro Iijima2, Cancan Huang 3, John R. Raymond1,2, Michael E. Ullian1,4, and Richard V. Paul1,4

1 Division of Nephrology and the 3 Department of Microbiology and Immunology, Medical University of South Carolina, and 4 Medical Specialty Service and 2 Research Service, Ralph H. Johnson Department of Veterans Affairs Medical Center, Charleston, South Carolina 29425


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We constructed an expression vector for a fusion protein [ANG II type 1a receptor-green fluorescent protein (AT1aR-GFP)] consisting of enhanced GFP attached to the COOH terminus of the rat AT1aR. Chinese hamster ovary (CHO) cells transfected with AT1aR-GFP demonstrated specific, high-affinity 125I-labeled ANG II binding (IC50 21 nM). ANG II exposure stimulated sodium-proton exchange and cytoplasmic calcium release to a similar extent in cells transfected with AT1aR or AT1aR-GFP; these responses were desensitized by prior exposure to ANG II and were sensitive to the AT1R blocker losartan. ANG II-driven internalization of AT1aR-GFP in transfected CHO cells was demonstrated both by radioligand binding and by laser scanning confocal microscopy. Colocalization of GFP fluorescence with that of the nuclear stain TOTO-3 in confocal images was increased more than twofold after 1 h of ANG II exposure. We conclude that AT1aR-GFP exhibits similar pharmacological behavior to that of the native AT1aR. Our observations also support previous evidence for the presence of AT1aR in the nucleus and suggest that the density of AT1aR in the nucleus may be regulated by exposure to its ligand.

green fluorescent protein; losartan; confocal microscopy; internalization


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TRAFFICKING OF MANY G PROTEIN-COUPLED RECEPTORS (GPCRs) to and from the plasma membrane is fundamentally important to the regulation of the transduction of their signals. The AT1 subtype of ANG II receptor is no exception. Previous studies from our group in vascular smooth muscle cells (VSMC), a major ANG II target tissue, have indicated that upregulation or downregulation of cell surface AT1 receptor (AT1R) density is directly related to downstream signal intensity (27, 29, 30). Therefore, there appears to be no "spare" AT1R in VSMC, and processes that cause net insertion or removal of AT1R from the membrane may be expected to affect directly the intensity of hormone action.

Engineering of green fluorescent protein (GFP), which confers luminescence on the jellyfish Aequoria victoria, to enhance its usefulness as an optical probe in mammalian cells has been pioneered over the past few years by Tsien and colleagues (25, 26). Among many other applications, a number of functional GPCR-GFP fusion proteins have recently been reported (2, 3, 5, 6, 14, 15, 18, 20, 24). These fusion proteins, whose movements can be observed within living cells by fluorescence microscopy, have begun to provide information about the trafficking of their cognate receptors that could previously be inferred only from indirect methods, or could not be obtained at all.

Present options for visualizing the intracellular distribution of the AT1R are limited. Anti-receptor antibodies, generally raised against synthetic peptide sequences, have been used by some groups for immunofluorescence studies, but these techniques can be used only in fixed and permeabilized cells or tissues. The availability of antisera is often limited, and their specificity in some cases may be open to question. Techniques that depend on ligand binding, such as the use of ANG II labeled with radionuclides (19), gold particles (1), or fluorescent labels (10) have been primarily responsible for present knowledge of AT1R trafficking. Unfortunately, these techniques are intrinsically limited in their ability to provide real-time information about receptor movements and cannot be used to track unbound receptors.

To overcome these problems we constructed an expression vector for a rat ANG II type 1a receptor-green fluorescent protein (AT1aR-GFP) fusion protein. The purpose of this study was to compare the functional characteristics of the fusion protein to that of the wild-type receptor from which it was derived. We also examined the subcellular distribution of the fusion protein after treatment of transfected cells with vehicle or ANG II.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of the expression vector for AT1aR-GFP fusion protein. The plasmid pCa18b, containing the rat AT1aR cDNA (17) was kindly provided by Dr. Kenneth E. Bernstein, Emory University. A set of PCR primers (tctgagaccaactcaacccag, ctccacctcaaaacaagacgcag) was designed to amplify the coding region of AT1aR from pCa18b. The PCR product was cloned into pCR II-Topo (Invitrogen, Carlsbad, CA). The insert was excised by Xho 1/BamH 1 digestion and subcloned into the expression vector pEGFP-N3 [enhanced GFP (EGFP); Clontech Laboratories, Palo Alto, CA] to form the expression construct for AT1aR-GFP. pEGFP-N3 encodes a red-shifted variant of wild-type GFP which has been optimized for higher expression in mammalian cells. An AT1aR expression construct was generated by ligating an Hind III/Xba fragment from pCa18b into the expression vector pcDNA3.1(+) (Invitrogen). The fidelity of both expression vectors to the AT1aR was verified by sequencing.

Transient and stable transfection. Transfection was carried out by using FuGene 6 transfection reagent (GIBCO-BRL, Grand Island, NY), using 10 µg of plasmid DNA in 3 µl of transfection reagent per 75-cm2 flask to treat Chinese hamster ovary (CHO)-K1 cells (American Type Culture Collection, Bethesda, MD) at 60% confluence. The transfection mixture remained in the media for 24 h until trypsinization of cells for seeding onto appropriate experimental culture plates or coverslips. pEGFP-N3 contains a neomycin resistance gene. Individual lines that stably expressed AT1aR-GFP were obtained by selection with G418 (1 mg/ml) and limited dilution. Transient transfections were used for experiments involving direct comparison of AT1aR and AT1aR-GFP and also for imaging because the GFP signal was generally superior in transiently transfected cells. Stable AT1aR-GFP-expressing lines were used for radioligand binding, and signaling measurements in experiments in which direct comparison with AT1aR (e.g., Fig. 2 below) were not considered useful.

Radioligand binding. Binding experiments were performed on intact, stably transfected confluent cells in 12-well plates as previously described (28). The binding buffer consisted of 50 mM Tris, 100 mM NaCl, 5 mM KCl, 5 mM MgCl2, 0.25% bovine serum albumin, and 0.5 mg/ml bacitracin (pH 7.4). 125I-ANG II (20 fmol) was added to all wells, and unlabeled ANG II was added to appropriate wells for competition and determination of nonspecific binding. Incubation at 4°C was carried out for 90 min to obtain surface binding equilibrium. Cell monolayers were then washed three times with ice-cold saline, solubilized with 0.1% sodium dodecyl sulfate-0.1 N NaOH and counted for gamma radioactivity. For measurement of agonist-dependent receptor internalization, cells were exposed to ANG II at 37°C for the indicated period and then chilled to 4°C for 5-min exposure to acid glycine buffer (50 mM glycine, 150 mM NaCl, pH 3) to dissociate ligand from cell surface receptors, according to the method previously established for vascular smooth muscle cells in our laboratory (28). After washing three times with ice-cold binding buffer, radioligand binding was then carried out as described above.

To measure changes in radioligand binding on exposure to guanine nucleotide analog, GTP-gamma -S, radioligand binding studies were performed in crude membrane preparations. Cells were grown and transfected in 10-cm petri dishes. After washing twice with PBS, cells were scraped in 10 ml ice-cold PBS, transferred to centrifuge tubes, and centrifuged at 1,200 g for 5 min. The pellet was resuspended in homogenization buffer (5 mM Tris · Hcl, 1 mM MgCl2, 100 µg/ml bacitracin, 10 µM phenylmethylsulfonyl fluoride, pH 7.4) and homogenized for 20 s in a Polytron (Brinkmann Instruments). The homogenate was centrifuged at 200 g for 2 min to remove unbroken cells and nuclei, and the supernatant was centrifuged at 38,000 g for 10 min before resuspension of the pellet in binding buffer. Radioligand binding was carried out by using 20 fmol of 125I-ANG II, 50 µg of membrane protein per ml buffer, and specified concentrations of GTP-gamma -S at room temperature for 90 min.

Microphysiometry. The method for determination of Na+/H+ exchange activity by measuring the rate of decrease in extracellular pH by using a Cytosensor microphysiometer (Molecular Devices, Sunnyvale, CA) has been established in our laboratory (8). The Cytosensor is capable of measuring proton efflux from relatively small numbers of living cells grown on permeable supports in close proximity to the specialized solid-state pH-sensing elements of the device. The cells are bathed in a small volume of continuously flowing supernatant whose composition can be switched to add drugs or hormones at any point during the experiment. CHO-K1 cells were transfected at 60% confluence, trypsinized 24 h later, and seeded onto porous 3-µm polycarbonate membranes at a density of 300,000 cells/insert. The next day, the inserts were mounted in the microphysiometer and proton efflux measurements were obtained in the presence and absence of ANG II and various other compounds.

Fluorometric Imaging Plate Reader analysis of calcium transients. The Fluorometric Imaging Plate Reader (FLIPR; Molecular Devices) is a high-throughput optical screening tool for cell-based fluorometric assays (21). The FLIPR records transient optical signals (such as those produced by intracellular calcium-sensitive fluorescent dyes) from cells cultured in 96-well plates. All wells can be monitored simultaneously at sampling intervals of 1 s or less for each well. The night before assay, cells that had been transfected 24 h earlier were seeded into the 96-well clear-bottom black plates (Corning Costar, Cambridge, MA), at a density of 60,000 cells/well, by using 150 µl of F12 medium supplemented with 10% fetal bovine serum (FBS). Before the FLIPR analyses, cells were incubated with 5 µM fluo-3 (Molecular Probes, Eugene, OR) in dye loading buffer (Hanks' buffered saline solution pH 7.4, containing 20 mM HEPES, 2.5 mM probenecid, 1% FBS) for 1 h in the cell culture incubator. Fluo-3 was reconstituted at 2 mM in DMSO. A 25-µl aliquot was mixed with 20% pluoronic acid, and then with the dye loading buffer. Cells were washed at least four times and exposed to test reagents dissolved in dye loading buffer. When an antagonist was tested, cells were exposed to the antagonist for 10 min before agonist was added.

Measurement of inositol phosphate generation in response to ANG II. Cells in six-well plates were incubated with 5-10 µCi myo-[2-3H]inositol · 2 ml-1 · well-1 in inositol-deficient growth medium for 24 h. Preliminary studies revealed that steady-state uptake of [3H]myo-inositol occurred after 24 h and ranged from 100,000 to 500,000 counts · min-1 · well-1. After cells were washed free of unincorporated [3H]myo-inositol, 10 mM LiCl in phosphate-buffered saline was added for 10 min and then ANG II was added for 30 s, both at 37°C. Reactions were terminated by the addition of 1 ml of ice-cold 20% trichloroacetic acid. Protein precipitates were discarded, and supernatants were extracted three times with equal volumes of diethyl ether. The upper ether phase was discarded. Samples were adjusted to pH 7 with 50 mM Tris base and transferred to 20-mm columns of AG1-X8 anion exchange resin (Bio-Rad, Richmond, CA) at room temperature. Radioactivity elutable with water and with borax (5 mM sodium borate and 60 mM sodium formate) was discarded. Total inositol phosphates were eluted with 12 ml of 1.0 M ammonium formate in 0.1 M formic acid, and 2-ml aliquots were counted in a scintillation counter.

Confocal microscopy and image analysis. Transfected cells were fixed with 4% formaldehyde at room temperature for 20 min, unless otherwise noted. Tetramethylrhodamine-concanavalin A (rhodamine-Con A; Molecular Probes) was used to label the cell surface in some experiments. Cells were incubated with 10 µg/ml rhodamine-Con A at 4°C in PBS and washed with ice-cold PBS four times before fixation. For staining with the nuclear dye TOTO-3 (Molecular Probes), cells were washed three times with PBS and incubated with 0.5% Triton X-100 and 5 µM TOTO-3 in PBS at room temperature for 30 min. They were then washed four times with PBS before fixation.

Microscopic images were acquired by using an Olympus microscope workstation equipped with a laser scanning confocal unit (Onchrome, Chino, CA), 15-mW krypton and argon lasers, and a ×63 Plan Apochromat/1.4 NA or ×40 Plan Neofluor/1.3 NA oil immersion objective. GFP fluorescence was excited by using the 488-nm argon laser emission line and collected using a standard fluorescein isothiocyanate filter set (530 ± 30 nm). Rhodamine-Con A was excited at 568 nm with the krypton laser, and images were collected with a 605-nm bandpass filter. TOTO-3 was excited with 647-nm krypton laser emission, and images were acquired with a 700-nm bandpass filter.

For image analysis the images (originally 8 bits/pixel) were binarized, with a threshold intensity for positivity of 50% of the dynamic range of the whole image. Images of four separate experiments by using AT1aR-GFP-transfected CHO cells were analyzed with the proprietary software of the microscope workstation (ULTRAVIEW, Olympus America). In each experiment two to seven coverslips were incubated with 100 nM ANG II and the same number with vehicle for 1 h before fixation with formaldehyde. Nonoverlapping fields of cells, each containing a minimum of 4 and median of 11 GFP-expressing cells, were randomly selected from each coverslip for pixel counts. By using the same criteria, fields of control cells were selected from each of eight coverslips of vehicle and ANG II-treated cells were transfected with pEGFP-N3 alone.

Data analysis. Error bars in all data presented portray the SE. Statistical compilation and hypothesis testing was performed with commercial microcomputer software (StatView, Brainpower, Sepulveda, CA).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Figure 1 (left) shows that the fusion protein can be readily visualized within transiently transfected cells by using fluorescence microscopy. In AT1aR-GFP-transfected cells, fluorescent signal was much more prominent within the cytoplasm than the nucleus, although a fluorescent rim around the nucleus, perhaps representing the nuclear membrane, was visible in the majority of cells. There was no particular preferential distribution of the fusion protein to the plasma membrane. In many CHO cells, fluorescence appeared to cluster in a cytoplasmic area adjacent to the nucleus, which may represent the Golgi apparatus. Cells transfected with GFP alone also showed cytoplasmic but not nuclear fluorescence (Fig. 1, right).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1.   Fluorescence micrographs of Chinese hamster ovary (CHO) or human embryonic kidney (HEK)-293 cells transiently transfected with ANG II type 1a receptor-green fluorescent protein (AT1aR-GFP). Cells were fixed by a brief exposure to 100% methanol at room temperature.

All of the data in Fig. 2 was obtained from CHO cells stably transfected with AT1aR-GFP. Figure 2A summarizes the 125I-ANG II binding results. Specific and saturable binding of 125I-ANG II to AT1aR-GFP was demonstrated by competition for binding with unlabeled ANG II. Total binding was ~1%, and nonspecific binding was <0.3% of added counts. Curve fitting of these data (4-parameter weighted fitting by using the computer program SigmaPlot, Jandel Scientific, La Jolla, CA) indicates an apparent dissociation constant (Kd) of 21 nM. The apparent Kd was somewhat higher than the apparent Kd of 2-4 nM for the native AT1aR observed in previous studies in our laboratory by using rat aortic VSMC (28). Nevertheless, interaction with ANG II concentrations in physiologically meaningful ranges appears to be preserved in AT1aR-GFP.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   A: Competitive inhibition of 125I-labeled ANG II (125I-ANG II) binding to cells stably transfected with AT1aR-GFP by unlabeled ANG II (B/B0). Mock-transfected cells showed no detectable specific binding (data not shown). B: Concentration dependence of inhibition of binding of 125I-ANG II to AT1aR-GFP in crude membranes by addition of guanine nucleotide analog (GTP-gamma -S) (1-1,000 nM). For comparison, inhibition by excess unlabeled ANG II is also shown. C: Stimulation of inositol phosphate release by ANG II in a CHO cell line stably transfected with AT1aR-GFP. The numbers in parentheses indicate the percent of basal inositol phosphate release observed at each concentration of ANG II.

To obtain the data summarized in Fig. 2B, membranes from cells transfected with AT1aR-GFP were treated with various concentrations of the nonhydrolyzable GTP-gamma -S. Normally, the dissociation of the G protein from the receptor that follows G protein activation causes a decrease in the binding affinity of the AT1R for its ligand (9). This behavior was preserved in AT1aR-GFP, suggesting at least some degree of intact G protein interaction with the fusion protein. In VSMC, the AT1aR is coupled via Gq to phospholipase C activation, which releases inositol phosphates from membrane phospholipids (29). Figure 2C summarizes our measurements of the stimulation of inositol phosphate turnover by AT1aR-GFP. The concentration-dependent stimulation of inositol phosphate release by ANG II is also consistent with intact G protein coupling to AT1aR-GFP.

Figure 3 demonstrates that the calcium signals associated with ANG II stimulation of transiently AT1aR-GFP and AT1aR-transfected CHO cells are similar in amplitude, shape, and duration. To generate Fig. 4, concentration-response relationships of AT1aR- and AT1aR-GFP-transfected CHO cells to ANG II and losartan were compiled from intracellular calcium peaks recorded with the FLIPR in individual wells of cells. Consistent with the binding data, AT1aR appeared to have a slightly higher sensitivity than AT1aR-GFP to very low concentrations of ANG II, e.g., 0.1 nM. However, the overall concentration-response relationships of the two receptors, as well as their ability to be blocked by losartan, were otherwise very similar.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Coupling of AT1aR-GFP and AT1aR to calcium signaling in transfected CHO cells. Data were obtained by using transiently transfected CHO cells loaded with fluo 3 as detailed in MATERIALS AND METHODS. Each panel (A: AT1aR; B: AT1aR-GFP) shows a subset of the individual well calcium transients (graphed within each cell as relative fluorescence intensity vs. time) recorded from a 96-well plate over a 10-min period by the Fluorometric Imaging Plate Reader (FLIPR).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Concentration-response relationships derived from the complete FLIPR data obtained from the experiment shown in Fig. 3. One 96-well plate was devoted to AT1aR-GFP (A), and one to AT1aR (B); each point represents one of these 192 wells. Intermediate losartan concentrations have been omitted for clarity. The response shown here was the relative height of the peak intracellular calcium transient, normalized to a standard well (100 nM ANG II, no losartan) on the same plate.

Another prominent effect of ANG II on many target cells is intracellular alkalinization that is consequent on activation of sodium-hydrogen exchange (31). We measured proton efflux from AT1aR-GFP transfected CHO cells by using the Cytosensor microphysiometer. We found that ANG II-stimulated proton efflux in AT1aR-GFP-transfected cells could be abolished either by excess losartan or by blockade of sodium-hydrogen exchange with ethyl isopropyl amiloride (Fig. 5A). The potency and efficacy of ANG II to stimulate proton efflux was similar in these cells and in cells transfected with AT1aR alone (Fig. 5B).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5.   A: Stimulation of proton efflux by 100 nM ANG II in cells transfected with AT1aR-GFP, as measured by the Cytosensor. The response was completely blocked by 1 µM losartan (middle panel) or the relatively selective type 1 Na/H exchanger blocker ethyl isopropyl amiloride (EIPA), 1 µM (right panel). B: Concentration-response relationships for the effect of ANG II on proton efflux in cells transfected with AT1aR or AT1aR-GFP. Response is expressed as the percent increase over basal efflux before ANG II exposure.

Desensitization is a prominent pharmacological characteristic of the AT1aR. Figure 6 indicates that this is also a characteristic of AT1aR-GFP. Cells transfected with AT1aR or AT1aR-GFP, and loaded with fluo-3, were examined with the FLIPR in 96-well plates. AT1aR and AT1aR-GFP demonstrated indistinguishable desensitization of intracellular calcium responses after prior exposure to ANG II. We have also observed desensitization and recovery of the proton efflux response to ANG II on the Cytosensor, which was similar in AT1aR-GFP- and AT1aR-transfected cells (data not shown).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Desensitization of calcium responses to addition of 100 nM ANG II in AT1aR (A) or AT1aR-GFP (B) transfected cells, demonstrated with the FLIPR. The top tracing in each panel is averaged from 8 wells of vehicle-treated cells. The bottom tracing is averaged from 8 wells of cells previously exposed to 100 nM ANG II for 1 min, ending 4 min before stimulation.

The above data indicate that the addition of the GFP moiety to the COOH terminus of the AT1aR 1) resulted in a fusion protein which can be readily expressed and visualized and 2) did not alter any of the functional activities of the receptor that we examined to any significant extent. These findings are necessary, but not sufficient, to establish the usefulness of the fusion protein to study AT1R receptor kinetics within the cell. The native AT1aR is known from ligand binding studies to undergo sequestration from the plasma membrane into intracellular compartments after exposure to its ligand in both VSMC and in transfected COS cells (12, 28). Consequently, we tested whether AT1aR-GFP membrane trafficking could be similarly regulated.

Figure 7 illustrates the effect of prior incubation with ANG II to downregulate cell surface binding of 125I-ANG II in a CHO cell line stably transfected with AT1aR-GFP. Acid washing in glycine buffer (pH 3.0) was used to remove bound ANG II before radioligand binding (28). The data are expressed as percent of specific binding to control cells, which were also acid-washed but were exposed to vehicle rather than ANG II. The results indicate a reduction by ~60% in cell surface ANG II binding, consistent with agonist-dependent internalization of AT1aR-GFP.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7.   Specific binding of 125I-ANG II to intact cells previously incubated with 100 nM ANG II for 3 h, normalized to vehicle-exposed controls.

To obtain Fig. 8, GFP-transfected CHO cells were treated with vehicle or 100 nM ANG II for 30 min before fixation. Rhodamine-Con A, a plant lectin that binds glycoproteins, was then applied and washed off (see MATERIALS AND METHODS). Because the cells were not permeabilized, the rhodamine-Con A adhered to plasma membrane proteins and was used as a specific fluorescent label for this compartment (23). Confocal images of fixed cells were then acquired by using the argon laser (488 nm) and the fluorescein filter set for GFP, and the krypton laser (568 nm) and rhodamine filter set for Con A. The images shown in Fig. 9 were constructed by superimposing the confocal GFP and rhodamine images on the phase contrast image of the same field. Localization of AT1aR-GFP to the plasma membrane is indicated by a yellow signal in vehicle-treated cells (left), resulting from superimposed red and green label. In cells treated with ANG II (right), plasma membrane GFP signal was relatively diminished, and GFP signal was seen in the center of many cells. This shift of GFP signal from the plasma membrane to the interior of the treated cells represents visual confirmation of significant internalization of AT1aR-GFP after 30 min of exposure to ANG II, compared with vehicle-treated control.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 8.   Internalization of AT1aR-GFP in response to ANG II or vehicle treatment (30 min, 100 nM ANG II) in transfected CHO cells. After incubation, the cells were fixed with paraformaldehyde, then labeled with rhodamine-concanavalin A (rhodamine-Con A). AT1aR fluorescence is shown in green, and rhodamine-Con A in red. Phase contrast images of the cells are also superimposed here. Left: vehicle-treated cells. Superimposition of AT1aR-GFP (green) and rhodamine-Con A (red) fluorescence in confocal images yields a yellow pseudocolor at the plasma membrane. Right: After 60 min of ANG II treatment, AT1aR-GFP fluorescence was observed in a nuclear or perinuclear distribution in many cells.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 9.   Top: Superimposition of confocal images of GFP fluorescence (shown in green) and TOTO-3 nuclear staining (red) in CHO cells expressing AT1aR-GFP (A) or GFP alone (B). Cells were incubated with vehicle or ANG II for 60 min at 37°C before fixation and staining with TOTO-3. Yellow pixels within the nuclei represent colocalization of GFP and TOTO-3 fluorescence (bottom). Quantitation of the number of GFP-positive pixels coincident with TOTO-3-positive pixels is expressed as a percentage of the total GFP-positive pixels in each low-power field. * ANG II significantly different from control, P = 0.011 by Mann-Whitney U-test.

Our experiments in rhodamine-Con A-labeled cells suggested that AT1aR-GFP was being relocated to a nuclear or perinuclear compartment on ANG II exposure. To examine this finding in more detail, we counterstained the nuclei of fixed, transiently AT1aR-GFP-transfected CHO cells with the nucleic acid stain TOTO-3 iodide (Molecular Probes), a dye that has its excitation and emission peaks at much longer wavelengths than GFP. The images in Fig. 9 (A and B) were obtained by superimposing confocal images of GFP and TOTO-3 fluorescence. The left panel shows exclusion of AT1aR-GFP from the nucleus in cells not exposed to ANG II. The right panel demonstrates GFP signal within the nuclei of ANG II-exposed cells. Figure 9 (bottom left) was generated by counting superimposed GFP-positive and TOTO-3-positive pixels in low-power fields containing GFP-expressing cells, chosen at random from four replicate experiments. Results are expressed as a percentage of total GFP-positive pixels. The results indicate a greater than twofold and statistically significant increase in GFP fluorescence within nuclei. Cells transfected with GFP alone (Fig. 9, bottom right) demonstrated lower basal colocalization of GFP and TOTO-3 fluorescence, with no change in this parameter after ANG II treatment.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We found that the functional characteristics of AT1aR-GFP were similar to those of the native AT1aR in all of the parameters we examined, including ligand binding, response to agonist/antagonist, G protein coupling, activation of signal transduction pathways, and desensitization. AT1aR-GFP was readily visualized in transfected cells and was visibly internalized after exposure of these cells to ANG II. Its GFP moiety produced a fluorescent signal that was readily separable from that of rhodamine and TOTO-3, which enabled us to use these red dyes to separately label cell membranes and nuclei. AT1aR-GFP was specifically detected by immunoblotting with a readily available commercial antiserum to GFP, which should facilitate immunoprecipitation experiments (data not shown). In addition, incorporation of GFP should allow flow cytometric analysis of receptor expression and facilitate fluorescence-activated cell sorting of cells based on fusion protein expression levels, although these applications were not specifically tested in the present study.

Although the intracellular COOH terminus of the AT1R is relatively short, site-directed mutagenesis studies of the AT1R have assigned several important functions of the receptor to this domain. For example, a short sequence within this region, containing a cluster of serine and threonine residues (T332-S338) is a site of ligand-dependent phosphorylation that is crucial for receptor internalization (13). Tail-deletion mutants of AT1R demonstrate impaired desensitization (11). It is somewhat surprising, therefore, that concatenation of the 26-kDa GFP to the COOH terminus of the AT1aR results in a receptor that is similar to the wild-type in its internalization and desensitization responses. Nevertheless, the GFP moiety has been attached to the COOH-terminus of the receptor in all the functional G protein-coupled receptor-GFP fusion proteins reported to date. In one report, attempted attachment of GFP to the NH2 terminus of the cholecystokinin receptor resulted in lack of expression, while GFP attachment to the other end of the receptor resulted in high expression of a functional product (23). Thus despite its proximity to the COOH-terminal domains of wild-type G protein-coupled receptors in the primary structure of the fusion proteins, the presence of the relatively bulky GFP has not necessarily hindered the functional performance of these domains.

One intriguing finding of the present studies was the suggestion of increased nuclear localization of AT1aR-GFP after ligand stimulation (Figs. 8 and 9). We doubt that the finding represents a fixation artifact, because such artifacts should have affected ANG II-treated and untreated cells equally. It is conceivable that the GFP moiety rather than the AT1R moeity of the fusion protein somehow targets AT1aR-GFP to the nucleus. By using other commercially available GFP expression vectors, our group has observed preferential localization of fluorescent signal within the nuclei of the same CHO cell line used for the present experiments (T. Pettus and J. Raymond, unpublished observations). However, in the present study our control transfections with the pEGFP-N3 expression vector alone produced little GFP fluorescence within the nuclei. Presumably, sequence variations among various GFP expression vectors may result in the generation of nuclear localization signals in some variants but not others.

If the GFP domain of the fusion protein did not target the construct to the nucleus, the most parsimonious conclusion is that the AT1aR sequence did. There is considerable precedent from other studies to suspect functional nuclear localization of some ANG II receptors. For example, specific 125I-ANG II binding sites have been detected in isolated hepatocyte nuclei (4, 22). Furthermore, treatment of isolated hepatocyte nuclei with ANG II has been reported to induce renin and angiotensinogen mRNA (7). Radiolabeled ANG II was reported many years ago to appear rapidly within vascular smooth muscle and cardiac muscle cell nuclei of animals injected intravenously with this compound (19). Of more direct relevance to the present findings, ligand-induced targeting of AT1R immunoreactivity to the nucleus has recently been reported in cultured rat neurons by Lu and colleagues (16). These investigators observed an increase in nuclear AT1R immunoreactivity within 15 min after ANG II stimulation and identified a putative nuclear localization sequence in the COOH-terminal tail of AT1R.

In summary, AT1aR-GFP appears to be a promising new tool for investigation of the cellular kinetics of the AT1aR, with the potential to overcome many limitations of traditional radioligand binding and immunofluorescence techniques. In particular, the intrinsic fluorescence of GFP should make AT1aR-GFP, like other GFP fusion proteins, a vehicle for investigation of the movement of receptors in real time within living cells. The initial observations of fixed cells reported here show that GFP signal appeared within nuclei after exposure of AT1aR-GFP-transfected cells to ANG II. Our findings lend additional support, therefore, to previous suggestions that ANG II receptors and/or their ligand can appear in the nucleus. However, the present findings do not provide evidence either for or against agonist-dependent translocation of receptors specifically from the plasma membrane to the nucleus, which presumably would be required for a direct effect of the ligand-stimulated or ligand-bound AT1aR on gene expression. Serial observations of agonist-dependent trafficking of AT1aR-GFP in living cells should be capable of determining more about the intracellular compartment of origin of receptors that wind up in the nucleus.


    ACKNOWLEDGEMENTS

The indispensable technical assistance of Georgiann Collinsworth is gratefully acknowledged.


    FOOTNOTES

This work was supported by Dialysis Clinics, Inc., the Mid-Atlantic Affiliate of the American Heart Association, the Research Service of the Department of Veterans Affairs, and National Institutes of Health Grants R01-DK-52448 and S10-RR-13005 (to J. R. Raymond). M. N. Garnovskaya is an Associate Investigator of the Research Service of the Department of Veterans Affairs. Equipment for the project was provided by a REAP award from the Department of Veterans Affairs.

Address for reprint requests and other correspondence: R. V. Paul, Div., of Nephrology, MUSC, 829 CSB, Charleston, SC 29425 (E-mail: paulr{at}musc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 17 November 1999; accepted in final form 18 May 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Anderson, KM, and Peach MJ. Receptor binding and internalization of a unique biologically active angiotensin II-colloidal gold conjugate: morphological analysis of angiotensin II processing in isolated vascular strips. J Vasc Res 31: 10-17, 1994[ISI][Medline].

2.   Awaji, T, Hirasawa A, Kataoka M, Shinoura H, Nakayama Y, Sugawara T, Izumi S, and Tsujimoto G. Real-time optical monitoring of ligand-mediated internalization of alpha1b-adrenoceptor with green fluorescent protein. Mol Endocrinol 12: 1099-1111, 1998[Abstract/Free Full Text].

3.   Barak, LS, Ferguson SS, Zhang J, Martenson C, Meyer T, and Caron MG. Internal trafficking and surface mobility of a functionally intact beta2-adrenergic receptor-green fluorescent protein conjugate. Mol Pharmacol 51: 177-184, 1997[Abstract/Free Full Text].

4.   Booz, GW, Conrad KM, Hess AL, Singer HA, and Baker KM. Angiotensin-II-binding sites on hepatocyte nuclei. Endocrinology 130: 3641-3649, 1992[Abstract].

5.   Carter, RE, and Sorkin A. Endocytosis of functional epidermal growth factor receptor-green fluorescent protein chimera. J Biol Chem 273: 35000-35007, 1998[Abstract/Free Full Text].

6.   Drmota, T, Gould GW, and Milligan G. Real time visualization of agonist-mediated redistribution and internalization of a green fluorescent protein-tagged form of the thyrotropin-releasing hormone receptor. J Biol Chem 273: 24000-24008, 1998[Abstract/Free Full Text].

7.   Eggena, P, Zhu H, Clegg K, and Barrett J. Nuclear angiotensin receptors induce transcription of renin and angiotensinogen mRNA. Hypertension 22: 496-501, 1993[Abstract/Free Full Text].

8.   Garnovskaya, M, Gettys T, van Biesen T, Prpic V, Chuprun J, and Raymond J. 5-HT1A receptor activates Na+/H+ exchange in CHO-K1 cells through Gialpha2 and Gialpha3. J Biol Chem 272: 7770-7776, 1997[Abstract/Free Full Text].

9.   Glossmann, H, Baukal A, Aguilera G, and Catt KJ. Radioligand assay for angiotensin II receptors. Methods Enzymol 109: 110-126, 1985[ISI][Medline].

10.   Haller, H, Lindschau C, Quass P, and Luft F. Intracellular actions of angiotensin II in vascular smooth muscle cells. J Am Soc Nephrol 10: S75-S83, 1999.

11.   Hunyady, L. Molecular mechanisms of angiotensin II receptor internalization. J Am Soc Nephrol 10: S47-S56, 1999.

12.   Hunyady, L, Baukal AJ, Balla T, and Catt KJ. Independence of type I angiotensin II receptor endocytosis from G protein coupling and signal transduction. J Biol Chem 269: 24798-24804, 1994[Abstract/Free Full Text].

13.   Hunyady, L, Bor M, Balla T, and Catt KJ. Identification of a cytoplasmic Ser-Thr-Leu motif that determines agonist-induced internalization of the AT1 angiotensin receptor. J Biol Chem 269: 31378-31382, 1994[Abstract/Free Full Text].

14.   Kallal, L, Gagnon AW, Penn RB, and Benovic JL. Visualization of agonist-induced sequestration and down-regulation of a green fluorescent protein-tagged beta2-adrenergic receptor. J Biol Chem 273: 322-328, 1998[Abstract/Free Full Text].

15.   Liu, CH, Thangada S, Lee MJ, Van Brocklyn JR, Spiegel S, and Hla T. Ligand-induced trafficking of the sphingosine-1-phosphate receptor EDG-1. Mol Biol Cell 10: 1179-1190, 1999[Abstract/Free Full Text].

16.   Lu, D, Yang H, Shaw G, and Raizada M. Angiotensin II-induced nuclear targeting of the angiotensin type 1 (AT1) receptor in brain neurons. Endocrinology 139: 365-375, 1998[Abstract/Free Full Text].

17.   Murphy, TJ, Alexander RW, Griendling KK, Runge MS, and Bernstein KE. Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 351: 233-236, 1991[Medline].

18.   Pace, AJ, Gama L, and Breitwieser GE. Dimerization of the calcium-sensing receptor occurs within the extracellular domain and is eliminated by Cys - Ser mutations at Cys101 and Cys236. J Biol Chem 274: 11629-11634, 1999[Abstract/Free Full Text].

19.   Robertson, A, and Kairallah P. Angiotensin II-rapid localization in nuclei of smooth and cardiac muscle. Science 172: 1138-1139, 1971[Abstract/Free Full Text].

20.   Schlein, R, Lorenz D, Oksche A, Wiesner B, Hermosilla R, Ebert J, and Rosenthal W. Polarized cell surface expression of the green fluorescent protein-tagged vasopressin V2 receptor in Madin-Darby canine kidney cells. FEBS Lett 441: 170-176, 1998[ISI][Medline].

21.   Sullivan, E, Tucker E, and Dale I. Measurement of [Ca2+] using the fluorometric imaging plate reader (FLIPR). Methods Mol Biol 114: 125-133, 1999[Medline].

22.   Tang, SS, Rogg H, Schumacher R, and Dzau V. Characterization of nuclear angiotensin-II binding sites in rat liver and comparison with plasma membrane receptors. Endocrinology 131: 374-380, 1992[Abstract].

23.   Tarasova, NI, Stauber RH, Choi JK, Hudson EA, Czerwinski G, Miller JL, Pavlakis GN, Michejda CJ, and Wank SA. Visualization of G protein-coupled receptor trafficking with the aid of the green fluorescent protein. Endocytosis and recycling of cholecystokinin receptor type A. J Biol Chem 272: 14817-14824, 1997[Abstract/Free Full Text].

24.   Tarasova, NI, Stauber RH, and Michejda CJ. Spontaneous and ligand-induced trafficking of CXC-chemokine receptor 4. J Biol Chem 273: 15883-15886, 1998[Abstract/Free Full Text].

25.   Tsien, RY. The green fluorescent protein. Annu Rev Biochem 67: 509-544, 1998[ISI][Medline].

26.   Tsien, RY, and Miyawaki A. Seeing the machinery of live cells. Science 280: 1954-1955, 1998[Free Full Text].

27.   Ullian, ME, and Fine JJ. Mechanisms of enhanced angiotensin II-stimulated signal transduction in vascular smooth muscle by aldosterone. J Cell Physiol 161: 201-208, 1994[ISI][Medline].

28.   Ullian, ME, and Linas SL. Role of receptor cycling in the regulation of angiotensin II surface receptor number and angiotensin II uptake in rat vascular smooth muscle cells. J Clin Invest 84: 840-846, 1989.

29.   Ullian, ME, and Linas SL. Angiotensin II surface receptor coupling to inositol trisphosphate formation in vascular smooth muscle cells. J Biol Chem 265: 195-200, 1990[Abstract/Free Full Text].

30.   Ullian, ME, Raymond JR, Willingham MC, and Paul RV. Regulation of vascular angiotensin II receptors by EGF. Am J Physiol Cell Physiol 273: C1241-C1249, 1997[Abstract/Free Full Text].

31.   Ye, M, Flores G, and Batlle D. Angiotensin II and angiotensin-(1-7) effects on free cytosolic sodium, intracellular pH, and the Na(+)-H+ antiporter in vascular smooth muscle. Hypertension 27: 72-78, 1996[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 279(3):F440-F448
0363-6127/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
X. C. Li and J. L. Zhuo
Intracellular ANG II directly induces in vitro transcription of TGF-{beta}1, MCP-1, and NHE-3 mRNAs in isolated rat renal cortical nuclei via activation of nuclear AT1a receptors
Am J Physiol Cell Physiol, April 1, 2008; 294(4): C1034 - C1045.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. A. Morinelli, J. R. Raymond, A. Baldys, Q. Yang, M.-h. Lee, L. Luttrell, and M. E. Ullian
Identification of a putative nuclear localization sequence within ANG II AT1A receptor associated with nuclear activation
Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1398 - C1408.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
J. L Zhuo and X. C Li
Review: Novel roles of intracrine angiotensin II and signalling mechanisms in kidney cells
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2007; 8(1): 23 - 33.
[Abstract] [PDF]


Home page
J Biomol ScreenHome page
B. F. O'Dowd, M. Alijaniaram, X. Ji, T. Nguyen, R. M. Eglen, and S. R. George
Using Ligand-Induced Conformational Change to Screen for Compounds Targeting G-Protein-Coupled Receptors
J Biomol Screen, March 1, 2007; 12(2): 175 - 185.
[Abstract] [PDF]


Home page
Mol. Biol. CellHome page
H.-J. Liao and G. Carpenter
Role of the Sec61 Translocon in EGF Receptor Trafficking to the Nucleus and Gene Expression
Mol. Biol. Cell, March 1, 2007; 18(3): 1064 - 1072.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. M. Baker and R. Kumar
Intracellular angiotensin II induces cell proliferation independent of AT1 receptor
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C995 - C1001.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
B. Boivin, C. Lavoie, G. Vaniotis, A. Baragli, L.-R. Villeneuve, N. Ethier, P. Trieu, B. G. Allen, and T. E. Hebert
Functional {beta}-adrenergic receptor signalling on nuclear membranes in adult rat and mouse ventricular cardiomyocytes
Cardiovasc Res, July 1, 2006; 71(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
H. Haller, J.-K. Park, C. Lindschau, M. Meyer, and J. Menne
Intrarenal renin-angiotensin system -- important player of the local milieu
Journal of Renin-Angiotensin-Aldosterone System, June 1, 2006; 7(2): 122 - 125.
[PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. D. Pendergrass, D. B. Averill, C. M. Ferrario, D. I. Diz, and M. C. Chappell
Differential expression of nuclear AT1 receptors and angiotensin II within the kidney of the male congenic mRen2.Lewis rat
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1497 - F1506.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. L. Lavoie, X. Liu, R. A. Bianco, T. G. Beltz, A. K. Johnson, and C. D. Sigmund
Evidence Supporting a Functional Role for Intracellular Renin in the Brain
Hypertension, March 1, 2006; 47(3): 461 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Das, Y. Skomorovska-Prokvolit, F.-Z. Wang, and P. E. Pellett
Infection-Dependent Nuclear Localization of US17, a Member of the US12 Family of Human Cytomegalovirus-Encoded Seven-Transmembrane Proteins
J. Virol., February 1, 2006; 80(3): 1191 - 1203.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Sherrod, X. Liu, X. Zhang, and C. D. Sigmund
Nuclear localization of angiotensinogen in astrocytes
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2005; 288(2): R539 - R546.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. SPAT and L. HUNYADY
Control of Aldosterone Secretion: A Model for Convergence in Cellular Signaling Pathways
Physiol Rev, April 1, 2004; 84(2): 489 - 539.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. V. Mukhin, M. N. Garnovskaya, M. E. Ullian, and J. R. Raymond
ERK Is Regulated by Sodium-Proton Exchanger in Rat Aortic Vascular Smooth Muscle Cells
J. Biol. Chem., January 16, 2004; 279(3): 1845 - 1852.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. N. Re
Intracellular Renin and the Nature of Intracrine Enzymes
Hypertension, August 1, 2003; 42(2): 117 - 122.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. N. Re
Implications of intracrine hormone action for physiology and medicine
Am J Physiol Heart Circ Physiol, March 1, 2003; 284(3): H751 - H757.
[Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Marrache, F. Gobeil Jr., S. G. Bernier, J. Stankova, M. Rola-Pleszczynski, S. Choufani, G. Bkaily, A. Bourdeau, M. G. Sirois, A. Vazquez-Tello, et al.
Proinflammatory Gene Induction by Platelet-Activating Factor Mediated Via Its Cognate Nuclear Receptor
J. Immunol., December 1, 2002; 169(11): 6474 - 6481.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. Hunyady, A. J. Baukal, Z. Gaborik, J. A. Olivares-Reyes, M. Bor, M. Szaszak, R. Lodge, K. J. Catt, and T. Balla
Differential PI 3-kinase dependence of early and late phases of recycling of the internalized AT1 angiotensin receptor
J. Cell Biol., June 17, 2002; (2002) 200111013.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
L. G. Navar, L. M. Harrison-Bernard, A. Nishiyama, and H. Kobori
Regulation of Intrarenal Angiotensin II in Hypertension
Hypertension, February 1, 2002; 39(2): 316 - 322.