|
|
||||||||
Departments of Pathology and Medicine, Northwestern University Medical School, Chicago, Illinois 60611
| |
ABSTRACT |
|---|
|
|
|---|
Expression and role of sodium glucose cotransporter (SGLT-1) in
tubulogenesis were investigated during renal development. A mouse
SGLT-1 cDNA was cloned, and it had substantial homology with human and
rat forms. Four mRNA transcripts were detected, which differed in size
from other species. SGLT-1 transcripts were detected at day
13 of gestation, and their expression increased during later
stages extending into the postnatal period. A high mRNA and protein
expression of SGLT-1 was seen in tubular segments of the inner cortex
and outer medulla at day 16, and it was developmentally regulated. Treatment with SGLT-1 antisense selectively decreased the
population of tubules in the metanephric explants. Expression of
glomerular mRNA and WGA binding were unchanged. SGLT-1 activity, as
measured by [14C]methyl-
-D-glucopyranoside
uptake, increased during gestation in the tubular segments where it is
expressed. Glucose uptake was inhibited by the treatment with SGLT-1
antisense and D-galactose. The data suggest that SGLT-1
exhibits a restricted spatiotemporal expression with functional
activity confined to the corresponding tubular segments, and it
selectively maintains renal tubulogenesis during development.
renal development
| |
INTRODUCTION |
|---|
|
|
|---|
THE SUBJECT OF RENAL DEVELOPMENT has been under intense investigation for several decades (2, 14, 33, 36, 38). The characteristics of renal development include intercalation of the ureteric epithelial bud into mesenchyme with induction of a phenotypic change, whereby the mesenchymal cells acquire the properties of epithelial cells. Certain epithelial cells differentiate into podocytes of the glomerulus, and others form cells that line the various segments of the renal tubules. While the glomerulus is being vascularized (2, 32), the differentiated tubular epithelial cells undergo membrane specialization, acquire intercellular junctional complexes, and thus become polarized with apical and basolateral domains (33, 38). Conceivably, the differentiation of the epithelial cells and the acquisition of the highly specialized membrane domains are governed by a number of factors or macromolecules, including the basement membrane proteins and their receptors, i.e., integrins (14). The latter apparently play a role in the anchorage of the cells onto the basal lamina and thus allow the tubules to maintain an open lumen and, in concert with the junctional complexes, serve to determine the polarity characteristics of the lining epithelial cells. Besides integrins and their ligands, basement membrane proteins and other cell adhesion molecules, like E-cadherin, the appearance of which coincides with expression of laminin, guide the establishment of polarity characteristics of certain membrane proteins, e.g., Na+ and K+-ATPase (38).
During this time frame, that is, about day 15 or 16 of mouse gestation, when these polarity characteristics are being established, the glomeruli and tubules begin to mature and acquire filtration and reabsorptive transport properties (3, 20, 37). The latter are believed to influence the handling of water, ions, amino acids, and sugars by the renal tubular epithelia (6, 7, 28, 41). This would indicate that many transporters and channels that are required to handle these molecules begin to be expressed at that stage of embryonic life. Although, the biology of numerous transporters has been extensively investigated in mature mammals, information relevant to embryonic life is rather limited (3, 10, 13, 20, 44). In view of these considerations, the developmental biology of one of the transporters that is involved in the transport of sugar as well as ions, i.e., the sodium glucose transporter (SGLT-1), was investigated, and its expression characteristics and relevance to tubulogenesis in metanephric development are described in this communication.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of mouse SGLT-1 cDNA clones.
First, SGLT-1 cDNA (347 bp) was isolated by PCR using sense
(5'-AGCGCCAGCACCCTCTTCACCATGG-3') and antisense (5'-CTGGGTTCC ATGCAGCTCCCGGTTCCATAGG-3') primers, and it was used for screening the mouse cDNA library (42). About 2 × 106 recombinants were screened with
[
-32P]dCTP-labeled mouse SGLT-1 cDNA. Five overlapping
clones were isolated, subcloned into pBluescript II KS(+) and
sequenced, followed by sequence homology and hydropathic analyses
(42).
Northern and Southern blot analyses.
Total RNA from embryonic kidneys at day 13, 16 and 19 (newborn) of gestation and from kidneys at 1- and
3-wk-old mice was extracted (42). In addition, RNA was
also extracted from adult human, mouse, and rat kidneys. Thirty
micrograms of RNA were subjected to agarose gel electrophoresis, and a
nylon filter membrane (Amersham, Arlington Heights, IL) blot was
prepared. It was hybridized with [
-32P]dCTP-labeled
mouse SGLT-1 cDNA, prepared by PCR using the following sense and
antisense primers: 5'-CCAAGATCATCTGTGGGGTC-3' and 5'-CTTCCTCCTCCTCCTTAG TC-3'. The 330-bp PCR product generated corresponds to the 3' end of
the mouse SGLT-1 cDNA. This region exhibits the most diversity among
the various Na+-coupled transporters (23), and
BLAST analyses revealed no significant homology (<15%) of the
330-bp SGLT-1 cDNA with other known sequences. The hybridization of the
filter was carried out under high-stringency conditions, i.e., at
65°C. The filter was also washed under high-stringency conditions,
and autoradiograms were prepared. The same nylon filter was hybridized
with a radiolabeled
-actin probe. The integrity of RNA was monitored
by visualization of the intact 18S and 28S bands on the nylon membrane
stained with methylene blue.
-32P]-radiolabeled mouse SGLT-1 probe under
high-stringency conditions, and autoradiograms were developed.
Tissue expression of SGLT-1 in the developing metanephros.
For mRNA expression, in situ hybridization experiments, using the
330-bp PCR product employed in Northern blot analysis, were performed.
The PCR product was ligated into pCR2.1 TA cloning vector. After the
insert from the construct with EcoR I was released, it was
subcloned into pBluescript KS(+) and used as a template for generating
sense- and antisense-riboprobes by employing riboprobe in vitro
transcription system (Promega, Madison, WI). The SGLT-1 cDNA was
linearized, and the riboprobes were synthesized by incorporating [
-33P]UTP (Amersham, Picataway, NJ), using T3 and T7
RNA polymerase. They were then used for in situ hybridization with
kidney tissue sections (22, 42). For protein expression
studies, a polyclonal anti-SGLT-1 antibody was used (Chemicon,
Temecula, CA), and after staining the tissues were processed for
immunofluorescence microscopy (42).
Antisense experiment. These experiments were performed to assess the role of SGLT-1 in renal development. A 34-mer sense/antisense oligonucleotide (ODN) was selected from the 442 bp upstream of the 3' end of the mouse SGLT-1 with the following sequence: 5'-GACTCCAACACAAACGGTACAGGTGCACGTCTGG -3'. Its specificity for the target nucleotide sequences was established by S1 nuclease protection assay (42). Two control nonsense 31-mer phosphorothioated ODNs (5'-TAATGATAGTATGATAGTAATGATAGTA AT-3' and 5'-GATCGATCGATCGATCGATCGATCGATCGAT-3') were also prepared.
Mouse kidneys, harvested at day 13 of gestation, were maintained in culture for 4 days, and the ODNs were added to the media daily at a concentration range of 0.5 to 1.5 µM, after which they were processed for various studies. Up to a concentration of 2.5 µM, the ODNs usually retain the translational blockade specificity with no discernible cytotoxic effects (9, 42).SGLT-1 mRNA expression in antisense ODN-treated metanephroi.
To assess the effect of antisense ODNs on mRNA expression, competitive
RT-PCR analyses were carried out (42). The sense and
antisense primers were: 5'-AGCGCCAGCACCCTCTTCACCATGG-3' and 5'-CTGGGTTCCATGCAGCTCCCGGTTCC-3'. Using these primers and
"wild-type" renal cDNA, the expected PCR product sizes would be 347 bp for mouse SGLT-1. A competitive "mutant" DNA construct
containing SGLT-1 sequences was synthesized by PCR using the following
sense and antisense primers, 5'
CCAGAAATGACTTCTGGAAGATGGTCCAGCGCCAGCACCCTCTTCACCATGGGAATGTCTCCTTTGAGGATG-3' and 5'-CGGTATGAG
CGCATCTCTGATACCAGCCCCTGGGTTCCATGCAGCTCCCGGTTCCCAGTGCTTCTTGGTG GGTAG-3', and the minigene construct as the target DNA.
The latter construct, containing sequences of other proteins,
is available in our laboratory (21). The sequences
specific for SGLT-1 are bolded and underscored. Using these primers,
the expected size of the competitive SGLT-1 DNA PCR product is 215 bp.
The nucleotide sequences upstream of the SGLT-1 primers are derived
from glomerular epithelial protein-1 (GLEPP-1), which is expressed in
the renal glomerulus (40). The GLEPP-1 mRNA expression
served as a control, with an expected 467-bp PCR product when wild-type
renal cDNA is used, while the expected size of the GLEPP-1 PCR product
would be 271 bp when the competitive mutant DNA template is used. The sequence of the PCR product generated by SGLT-1/GLEPP-1 primers was
confirmed, and it was then purified by gel electrophoresis and ligated
into pCR2.1 cloning vector (Invitrogen, San Diego, CA). This modified
minigene construct was used for the mRNA analyses of the SGLT-1 and
GLEPP-1. The unmodified original minigene construct, containing primer
sequences for
-actin, was used as the competitive mutant DNA
template with an expected 224-bp size of the PCR product (22). Finally, the RT-PCR analyses were carried out as
previously described (42).
SGLT-1 protein expression in antisense ODN-treated metanephric explants. To assess the translational blockade of SGLT-1, immunoprecipitation and -fluorescence studies were performed. For immunoprecipitation experiments, antisense-treated explants were labeled with 35S-methionine, and membrane proteins were extracted (22, 42). The extracts were then immunoprecipitated with the anti-SGLT-1 antibody (Chemicon, Temecula, CA). The controls included the untreated metanephroi and those treated with sense or nonsense ODNs. To ensure the effect of antisense ODN on the translational blockade of mouse SGLT-1, double the amount of immunoprecipitated radioactivity was used for SDS-PAGE analyses. Finally, the tissue expression of SGLT-1 in antisense and sense or nonsense ODN was assessed by immunofluorescence microscopy.
In situ tissue expression of wheat germ agglutinin and GLEPP-1. To evaluate the status of glomeruli in the antisense-treated explants, expression of wheat germ agglutinin (WGA) and GLEPP-1 was assessed (40). Cryostat sections stained with anti-SGLT-1 antibody were concomitantly stained with WGA conjugated with rhodamine (Sigma, St. Louis, MO). The sections derived from the midplane of the explant were examined. Finally, GLEPP-1 mRNA expression was determined in the antisense-treated explants by in situ tissue autoradiography. The 467-bp product generated above by PCR was used to prepare the GLEPP-1 riboprobe. The conditions for hybridization of GLEPP-1 riboprobe and preparation of the tissue autoradiograms were the same as previously described (21).
D-[14C]glucose uptake studies.
Glucose uptake experiments were carried out to assess whether there is
a correlation of functional activity of the SGLT-1 with its
developmental expression. Intact day 13 metanephroi and slices of day 16 and newborn kidneys were maintained in
culture for three days. The antisense or sense ODNs were added into the culture medium at a final concentration of 1.5 µM. Ninety minutes prior to the termination of the culture, the explants were transferred to culture media, composed of equal volumes of DME and F-12 (Sigma), and the final concentration of glucose and sodium was adjusted to 5 and
100 mM, respectively. An analog of glucose,
[14C]methyl-
-D-glucopyranoside (MeGlc, 25 µCi/ml, specific activity = 300 GBq/mmol) (17), was
added to the culture medium. To evaluate the specificity of the MeGlc
uptake, either 1 mM D-galactose or L-galactose
was added to some of the cultures. After the termination of the
culture, the explants were rinsed with ice-cold Na+-free
medium and processed for tissue autoradiography (21, 22, 42).
| |
RESULTS |
|---|
|
|
|---|
Characterization of mouse newborn SGLT-1 cDNA clones.
By combining the overlapping sequences of 5 clones, an open reading
frame consisting of 1,995 nucleotides was obtained, which had a deduced
translated product of 665 amino acids (Fig.
1). Mouse SGLT-1 had ~95 and ~86%
sequence homology with rat and human forms (18, 24),
respectively. In the mouse newborn cDNA, an A(U)nA mRNA
instability motif was present at 818 bp downstream from the 3' end of
the termination codon. The amino acid sequence had structural domains
similar to those of the human and rat. They included a six-residue
motif (RFGGKR) located in the extracellular domain of the SGLT-1, which
is involved in the binding and translocation of glucose. The protein
kinase C (PKC) motifs were also similar to other species; however, a
protein kinase A (PKA) motif, like that in the rat, was absent in mouse
SGLT-1. There were 2 potential N-linked glycosylation sites
(NXT/NXS) at the 248- and 306-amino acid residues, which seem to be
conserved across mammalian species. The N-linked
glycosylation site at Asn565 seen in rat was absent in the
mouse SGLT-1. The hydropathic analysis suggested that the
N-glycosylation site at the 248 residue be located in the
extracellular domain, a finding consistent with previous studies
(24).
|
Northern and Southern blot analyses.
An evaluation of SGLT-1 mRNA expression in human, mouse, and rat was
carried out in view of the differences in the transcript size and their
number reported for various species (16, 18, 24, 30). In
mouse, three major mRNA transcripts of ~4.7, ~3.2 and ~2.3-kb
size were seen (Fig. 2A,
lane 2). The midsize transcript (~3.2) seems to be a
doublet; thus it appears that the mouse SGLT-1 has four transcripts
(Fig. 2A, white dots in lane 2). In human SGLT-1,
three distinct transcripts were also observed; however, the transcript
size of the high- and intermediate-molecular-weight bands differed from
the mouse SGLT-1 (Fig. 2A, lane 1, asterisks). An
additional high-molecular-weight transcript was also discernible (Fig.
3A, lane 1, small
asterisk); however, its size was different from the mouse transcript.
In rat, four mRNA transcripts were also present (Fig. 3A,
lane 3, asterisks). The high- and low-molecular-weight transcripts were identical to that of the mouse. The intensity of the
bands of various transcripts in both human and rat was less compared
with that of mouse, which may be related to the fact that the blot was
hybridized with a mouse SGLT-1 probe. The amount of RNA loaded, most
likely, was comparable among the three species since the intensities of
the 28S and 18S bands (Fig. 2B), and of the
-actin (Fig.
2C) were similar. Like the mRNA transcripts, Southern blot
analyses revealed differences in the intensity and size of the bands,
suggesting a different genomic organization of the SGLT-1 gene among
the three species (Fig. 2, D, E and
F).
|
|
Developmental expression of SGLT-1 in the mouse kidney.
The SGLT-1 mRNA expression was detectable at day 13 of
gestation (Fig. 3A). Three major transcripts of ~4.7,
~3.2 and ~2.3 kb were observed. The SGLT-1 mRNA expression
progressively increased during the various stages of gestation
extending into the postnatal period, suggesting that it is
developmentally regulated. With increasing expression of the SGLT-1, a
fourth transcript of ~3.5 kb became discernible (Fig. 3A,
arrowhead). The loading of equal amounts of RNA was confirmed by the
methylene blue staining of the blot, where intensities of 28S and 18S
RNA were similar in all the 5 lanes (Fig. 3B). The
-actin
mRNA expression in the mouse kidneys remained essentially constant
(Fig. 3C).
|
Role of SGLT-1 in tubulogenesis of the mammalian metanephros
(antisense experiments).
The embryonic renal explants treated with 1.5 µM of nonsense or sense
ODN did not reveal any major morphological changes (Fig. 5, B vs. A, and
F vs. E). The ureteric bud branches exhibited normal iterations, and the glomeruli and tubules were well developed. The explants treated with antisense ODN exhibited an overall reduction in their size (Fig. 5, C and D). At a
concentration of 0.5 µM, nephron population was reduced, and the
mesenchyme was expanded (Fig. 5, C and G). The
reduction was confined to the tubules, although a mild decrease in the
number of glomeruli was observed as well. At 1.0 µM, a further
reduction in the number of nephrons was observed. At 1.5 µM
concentration of the antisense ODN, the size of explants was
significantly reduced (Fig. 5D), and the number of the
tubules was remarkably decreased (Fig. 5H). The glomerular
population was largely unaffected (Fig. 5H). The ureteric bud branches were rudimentary, and their normal dichotomous iterations were not seen.
|
|
Gene and protein expression studies in antisense-treated
metanephric explants.
In the nonsense-ODN-treated (control), a linearity in the ratios of
wild to mutant SGLT-1 DNA could be maintained when plotted against the
10
1 to 10
7 serial logarithmic dilutions of
the competitive (mutant) template DNA. Within this range of dilutions,
the bands of wild-type and mutant DNA were discernible for
densitometric analyses to obtain a ratio. The densitometric graphic
plots are not included here because they have been repeatedly shown in
our several previous publications (21, 22, 42), and thus
only the raw data, i.e., the electrophoretograms, are shown in Fig.
7. A ratio of 1 was obtained at dilutions
of 10
4-10
5 of the competitive
mutant DNA for control group (Fig. 7A, lanes 4 and 5). For the antisense-treated group, a ratio of 1 was obtained at dilutions of 10
5-10
6 of the
competitive DNA (Fig. 7A, lanes 5 and
6), suggesting a decrease in the order of about one to two logs of
the mRNA expression in the antisense-treated explants. However, for the
-actin, no significant differences in the linearity relationship in
the range of logarithmic dilutions of the competitive DNA between the
two groups (control and antisense) were observed (Fig. 7B).
Another control included the determination of mRNA expression of
GLEPP-1, a marker for glomeruli, particularly the glomerular podocytes (40). No significant differences were observed between the
control and SGLT-1 antisense-treated explants, and a ratio of 1 was
observed at a dilution of 10
4 of the competitive mutant
DNA in both the groups (Fig. 7C, lane 4). To
confirm that the GLEPP-1 mRNA was unaffected by the antisense treatment, in situ tissue autoradiograms were prepared. No significant reduction in mRNA expression and the population of renal glomeruli was
observed between the antisense (Fig. 7E) and the control
groups (Fig. 7D).
|
Glucose uptake by the developing mammalian metanephros.
The uptake of MeGlc was minimal in day 13 kidneys, and a
mild concentration of radioactivity was seen over the ureteric bud branches and tubular segments (Fig.
8A). In day 16 explants, an increase of MeGlc uptake was observed (Fig.
8E). The high concentration of radioactivity, associated
with MeGlc, was seen as clusters in the outer medulla and inner cortex
(Fig. 8E, arrowheads). Interestingly, this pattern of
radioactivity, confined to the clusters of tubules, simulated that
observed for the SGLT-1 mRNA expression in day 16 explants
(Fig. 4B). While most of the medulla was devoid of radioactivity associated with MeGlc, a mild uptake was seen in the
inner medulla. In day 19 or newborn explants, the clusters of radioactivity became prominent and enlarged (Fig. 8I,
arrowheads), suggesting increased uptake by the tubules of outer
medulla and inner cortex. Like in day 16, most of the
medulla was devoid of radioactivity, but foci of uptake were seen in
the inner medulla (Fig. 8I). To verify the specificity of
the MeGlc uptake antisense- and galactose-inhibitory experiments were
carried out. Inclusion of 1 mM D-galactose in the media
decreased the radioactivity associated with MeGlc in day 13 (Fig. 8B), 16 (Fig. 8F), and
19, or newborn (Fig. 8J) explants. The clusters
of radioactivity, reflecting the uptake by the tubules of the inner
cortex and outer medulla, were fewer and reduced in their size in
explants from day 16 and 19 kidneys (Fig. 8,
F and J, arrowheads). The radioactivity in the
inner medulla was also reduced. Inclusion of 1 mM
L-galactose in the media did not decrease the MeGlc uptake
and the autoradiograms were indistinguishable from the controls, i.e.,
Figs. 8, A, E, and I. Treatment of
explants with SGLT-1 antisense ODN reduced the radioactivity associated
with the MeGlc uptake in day 13 (Fig. 8C),
16 (Fig. 8G), and 19 (Fig.
8K) explants. The clusters of radioactivity were very few
and small, and the radioactivity in the medulla was lost (Fig. 8,
G and K). The tissue autoradiograms, prepared
from the explants treated with sense/nonsense ODNS, were indistinguishable from the controls.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the mammalian metanephros, glucose transport across the plasmalemma is mediated by a number of integral membrane proteins known as specific carriers. They are involved in the reabsorption of the glucose from the glomerular ultrafiltrate that is in transit through the proximal tubular segment of the nephron. The reabsorbed glucose is returned to the circulation to maintain its blood levels and to provide other cells with a source of energy for various metabolic requirements. By homology cDNA cloning techniques, a number of specific carrier proteins or transporters have been identified since a majority of them reveal substantial similarities in their structural and functional motifs (6, 7, 28, 41). At present about five facilitative-diffusion glucose transporters (GLUT-1 to GLUT-4 and GLUT-7) are believed to exist in mammalian cells. In addition, there are 3 more transporters involved in glucose uptake that are energized by an electrochemical gradient for Na+ ions across the cell membrane. They are known as sodium glucose cotransporters (SGLTs) since they couple Na+ and glucose during transport across the cell membrane. Although they (SGLT-1-SGLT-3) have similar, but not identical, structural motifs, their functional capacities and expressions expectedly vary in the different segments of the nephron (7, 41). Interestingly, a given cotransporter, e.g., SGLT-1, may exhibit minor differences in its structural motif across species lines, i.e., human vs. porcine or rabbit vs. rat; however, considerable variation in its mRNA transcript size and number has been reported (16, 18, 24, 30, 31). Along these lines a high sequence homology of the mouse SGLT-1 with that of the rat (~95%) and human (~86%) was observed in the present investigation (Fig. 1). Also, most of the structural motifs (glucose binding motif, glycosylation and phosphorylation sites, and leucine zipper) were conserved, except that, as in the rat, the PKA site was absent. Intriguingly, significant differences in their mRNA transcript size and number were observed (Fig. 2). Such variations have been thought to be related to the cross-hybridization of the selected DNA probe with other SGLTs. The fact that a SGLT-1-specific DNA probe and high-stringency conditions were used in this study for Northern blot hybridization makes it unlikely that the differences observed here among various species were related to cross-hybridization with other SGLTs. Conceivably, these differences may have originated during transcription. However, the possibility that they may also be related to the differential genomic organization of the SGLT-1 should be considered as well in view of the results of the Southern blot analysis of the restriction digests of the DNA, where notable differences among various species were observed (Fig. 2). Nevertheless, substantial homology of the SGLT-1 at the amino acid level would suggest similar functions that were acquired sometime during embryonic, neonatal, or postnatal life.
The data suggest that the SGLT-1 begins to be expressed in the metanephros during midgestation, i.e., day 13 (Fig. 3), the period ensuing the epithelial-mesenchymal interactions with the formation of nascent nephrons (2, 14, 33, 36, 38). It should be noted here that some of the facilitative glucose transporters, i.e., GLUT-1, are expressed as early as the 2-cell stage in the preimplantation mouse embryo (29). In the rat metanephros, SGLT-1 mRNA expression seems to occur late during gestation, where a single mRNA transcript of 4 kb has been described (44). In contrast, mouse SGLT-1 has at least three mRNA transcripts that are consistently observed quite early in the course of development. During gestation, not only the expression of these three transcripts progressively increased, but a fourth transcript also begins to be expressed at day 19 or in the newborn kidney. These findings suggest that SGLT-1 is developmentally regulated in the metanephros. Such a developmental regulation has also been elegantly demonstrated by in situ tissue autoradiography for various GLUTs, and interestingly, their highly restricted differential spatiotemporal distribution was observed in the embryonic, newborn, and adult rat kidney (10). The mouse SGLT-1 also seems to exhibit a restricted spatiotemporal expression in the embryonic and adult kidneys. By tissue autoradiography and immunofluorescence microscopy, at day 13, a mild expression could be seen in the ureteric bud branches, the precursor of the collecting ducts (Fig. 4 A and F). Whereas, at day 16, a dramatic increase in expression was seen in tubular segments of the inner cortex and outer medulla, and an intense radioactivity was observed in the form of clusters (Fig. 4B). Similarly, protein expression was seen in the corresponding tubular segments (Fig. 4G). In addition, a very mild protein expression in the medullary collecting ducts was observed. In subsequent stages, the SGLT-1 expression increased but remained confined to the tubular segments of the inner cortex and outer medulla. Conceivably, these tubular elements represent the S3 segments of the proximal tubules, a finding that is consistent with earlier observations in the rat (24). In the same investigation, the authors also observed that by SGLT-1, mRNA is expressed throughout the cortex, suggesting its distribution may extend beyond the S3 segment of the proximal tubule. Such a diffuse distribution of the SGLT-1 in the cortex has also been seen in other studies where immunohistochemical techniques were employed (11, 39). To this end, an argument was made that the antibodies raised were against the synthetic peptide with sequences homologous with other SGLTs (24). This explanation may be plausible. However, the antibody used in this investigation was raised against the synthetic peptide derived from the portion of the SGLT-1 that exhibits considerable diversity among the various SGLT isoforms; thus the findings reported are most likely an accurate reflection of the localization of SGLT-1 in the mouse metanephros. Moreover, congruence in the findings of the mRNA and protein expression, consistently observed throughout the course of mouse metanephric development, supports the fact that SGLT-1 is principally expressed in the S3 segment of the renal proximal tubule.
Since SGLT-1 seems to be developmentally regulated, the next question
which obviously needs to be addressed is whether it is involved in the
differentiation and maturation of the mammalian metanephros. The
functional activity of SGLT-1 is dependent on its phosphorylation
mediated by PKC, after which it is targeted at the apical membrane
domain of the cells undergoing differentiation (12). Thus
it seems that PKC is involved in the morphogenesis and differentiation
of the polarized epithelial phenotype associated with the functional
activity of the SGLT-1 transporter. Other support for the notion that
SGLT-1 may be involved in the morphogenetic developmental process comes
from the fact that a potential binding site for the hepatocyte nuclear
factor 1 (HNF-1) has been found in the promoter region of the rat
SGLT-1 (34). HNF-1 is a developmentally regulated
transcription factor responsible for the tissue-specific spatiotemporal
expression of several genes, and induction of the latter during
organogenesis and their sustained expression throughout embryonic life
extending into the postnatal period are well known (26).
In keeping with the above discussion, the relevance of this
cotransporter in renal tubulogenesis was investigated by employing
antisense technology. This technology has been successfully used in our
laboratory and by other investigators to study various embryonic
developmental processes (8, 22, 42). The treatment of
SGLT-1-specific antisense ODN resulted in dysmorphogenesis of the
embryonic metanephros. Intriguingly, tubulogenesis was preferentially
affected (Fig. 5). The fact that glomerulogenesis was largely
intact would suggest that the antisense ODN effect most likely was
specific. Furthermore, the fact that the binding of WGA to glomeruli
(Fig. 6) and the mRNA expression of GLEPP-1 and
-actin (Fig. 7) were
unaffected would support the specificity of the SGLT-1 antisense ODN.
The translational studies, where de novo synthesis of SGLT-1 protein
was selectively affected (Fig. 7), would indicate that it is the
deficiency of the SGLT-1 that led to an arrest in renal tubulogenesis.
The latter may be due to the apoptosis of the renal tubular epithelial
cells that are still in the process of being differentiated like that
observed under hyperglycemic condition (21). Usually, the
differentiation of the tubules continues even after the formation of
glomeruli, and perhaps because of this lag period SGLT-1 antisense
effect is selectively targeted at the tubules. In this scenario, the glomeruli may continue to mature while the formation of nascent tubules
would undergo remarkable regression. Interestingly, it is worth
mentioning here that a selective role in tubulogenesis has been
previously described for proteins that are exclusively expressed in the
tubules, i.e., tubulointerstitial nephritis antigen (TIN-ag)
(22). TIN-ag is one of the extracellular matrix proteins, and the latter are known as morphogenetic modulators that exert considerable influence on embryonic development (15).
Nevertheless, in view of the data of antisense experiments and the fact
that SGLT-1 has a consensus binding site for HNF-1 in its promoter region (34), it is reasonable to assume that it may be
involved in the differentiation of the renal tubules. Moreover, the
fact that it has been shown to be involved in the differentiation of intestinal epithelia (12), would strengthen the contention
that SGLT-1 is relevant to the differentiation of the renal tubules as well.
Since SGLT-1 seems to be potentially involved in renal-tubular differentiation its functional properties with respect to embryonic development need to be discussed since they play a vital role in glucose reabsorption. To study the uptake of glucose one may employ the traditional methods, e.g., brush-border membrane vesicles (5, 25), or isolated tubular fragments (4); although, more sophisticated methods, e.g., the Xenopus laevis oocyte system, are also available at present (16, 17, 44). These methods have yielded excellent results in terms of the kinetics of uptake, i.e., Michaelis-Menten constant and maximum velocity values; however, their applicability in the embryonic systems may be difficult, especially if one has to directly localize or visualize the uptake into a given compartment of the developing kidney. Studies in rabbits (5), lambs (35), and guinea pigs (27) suggest that the renal tubular epithelium of the fetal kidney is capable of glucose transport, at least during the late stages of gestation. Studies regarding murine fetal kidneys, especially for the earlier stages of gestation, have not been described in the literature. Although the data from other species, i.e., rabbits, lambs, and guinea pigs, can be extrapolated for mice and rat kidney, one has to exercise a certain degree of caution, since kinetic and specificity differences of the SGLT-1 have been reported among different mammalian species (19). The differential kinetics of the cotransporter may be related to the degree of phosphorylation of SGLT-1, which apparently may vary depending on the presence or absence of PKC and PKA motifs in various species (43). In any instance, one of the objectives of this investigation was to establish a correlation between the functionality of SGLT-1 with its developmental expression, and due to technical constraints, the method of in situ tissue autoradiography was chosen. In this method, intact or slices of embryonic metanephroi (days 13, 16, and 19) were incubated in culture with MeGlc, an analog of glucose that is handled by the Na+-glucose cotransporter (17). Such a method to measure the uptake of glucose has been described for other tissues, e.g., preimplantation embryos (29), and thus it seemed to us that these experiments would be feasible in embryonic kidneys as well. In day 13 metanephroi, minimal uptake was observed (Fig. 8A). A high glucose uptake by the tubules, reflected by the clusters of radioactivity in the inner cortex was observed in day 16 (Fig. 8E) and 19 (Fig. 8I) explants. This uptake was inhibited by D-galactose (Fig. 8B, F, and J), which is believed to be a specific inhibitor of glucose uptake mediated by SGLT-1 (24). The specificity of glucose uptake was further established by the antisense experiments, where a marked decrease in uptake was observed (Fig. 8C, G, and K). Conceivably, the mechanism(s) by which antisense oligonucleotide exerted its inhibitory effect may partly be similar to those of the hybrid-depletion experiments (44) and partly due to the inhibition of renal tubulogenesis. The latter possibility would be more applicable to day 13 metanephroi, while the former may be relevant to the experiments with day 16 and 19 explants. Since no discernible decrease in uptake was observed with L-galactose and sense- or nonsense- oligonucleotides, it is reasonable to assume that the effects observed are reflective of the SGLT-1-mediated glucose uptake. Regarding the SGLT-1-mediated effect, the issue of uptake in the medulla (Fig. 8, E and I) warrants some discussion. Since uptake in the medulla was inhibited with D-galactose and by SGLT-1-specific antisense oligonucleotide, it is likely that the uptake is mediated by SGLT-1. In support of this notion are two previous studies in which SGLT-1 mRNA and protein expression were localized to the inner medulla of the porcine and rat kidneys, respectively (31, 39). As already indicated, one certainly can argue about the validity of the findings of previous investigations on the grounds of cross-hybridization and reactivity of cDNA probes and of the antibodies. Alternatively, the uptake of Na+-dependent glucose in the renal medulla may be due to another closely related SGLT-1 isoform that is expressed in the medullary tubules and is yet to be identified.
In summary, it seems that SGLT-1 is developmentally regulated in the mouse metanephros, maintains renal tubulogenesis, and the degree of SGLT-1-mediated glucose uptake correlates with its developmental expression. Finally, it is anticipated that availability of mouse SGLT-1 cDNA should give impetus for the future in vivo genetic experiments to elucidate the role of this cotransporter in normal as well as abnormal growth related processes, i.e., metanephric development and diabetic nephropathy (1).
| |
ACKNOWLEDGEMENTS |
|---|
Supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-28492.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: Y. S. Kanwar, Dept. of Pathology, Northwestern Univ. Medical School, 303 E. Chicago Ave., Chicago, Illinois 60611 (E-mail: y-kanwar{at}nwu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 13 March 2000; accepted in final form 20 June 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abboud, HE.
Growth factors and diabetic nephropathy.
Kidney Int
52:
S3-S6,
1997.
2.
Abrahamson, DR,
Hyink RB,
St John PL,
and
Daniel TO.
Origins and formation of microvasculature in the developing kidney.
Kidney Int
67:
S7-S11,
1998.
3.
Aperia, A,
and
Celsi G.
Ontogenic process in nephron epithelia.
In: The Kidney, edited by Seldin DW,
and Giebisch G.. New York: Raven, 1992, p. 803-825.
4.
Barfuss, DW,
and
Schafer JA.
Differences in active and passive glucose transport along the proximal nephron.
Am J Physiol Renal Fluid Electrolyte Physiol
240:
F322-F332,
1981.
5.
Beck, JC,
Lipkowitz MS,
and
Abramson RG.
Characterization of the fetal glucose transporter in rabbit kidney.
J Clin Invest
82:
379-387,
1988.
6.
Bell, GI,
Kayano T,
Buse JB,
Burant CF,
Takeda J,
Lin D,
Fukumoto H,
and
Seino S.
Molecular biology of glucose transporters.
Diabetes
13:
198-208,
1990.
7.
Berger, UV,
Marciani P,
Peng JB,
and
Hediger MA.
The molecular basis of solute transport.
In: The Kidney, edited by Brenner BM.. Philadelphia, PA: Saunders, 2000, p. 247-276.
8.
Bronner-Fraser, M.
Neural crest cell formation and migration in the developing embryo.
FASEB J
8:
699-706,
1994[Abstract].
9.
Cazenave, C,
Stein CA,
Loreau N,
Thuong NT,
Neckers LM,
Subsinghe C,
Helene C,
Cohen S,
and
Toulme JJ.
Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotide.
Nucleic Acids Res
17:
4255-5273,
1989
10.
Chin, E,
Zhou J,
and
Bondy C.
Anatomical and developmental patterns of facilitative glucose transporter gene expression in the rat kidney.
J Clin Invest
91:
1810-1815,
1993.
11.
Cramer, SC,
Pardridge WM,
Hirayama BA,
and
Wright EM.
Colocalization of GLUT-2 glucose transporter, sodium/glucose cotransporter, and
-glutamyl transpeptidase in rat kidney with double-peroxidase immunocytochemistry.
Diabetes
41:
766-770,
1991[Abstract].
12.
Delezay, O,
Baghdiguian S,
and
Fantini J.
The development of Na(+)-dependent glucose transport during differentiation of an intestinal epithelial cell clone is regulated by protein kinase C.
J Biol Chem
270:
12536-12541,
1995
13.
Dwyer, KJ,
and
Pardridge WM.
Developmental modulation of blood-brain barrier and choroid plexus GLUT-1 glucose transporter messenger ribonucleic acid and immunoreactive protein in rabbits.
Endocrinology
132:
558-565,
1993
14.
Ekblom, P.
Renal Development.
In: The Kidney, edited by Seldin DW,
and Giebisch G.. New York: Raven, 1992, p. 475-501.
15.
Hay, ED.
Collagen and other matrix glycoproteins in embryogenesis.
In: Cell Biology of Extracellular Matrix, edited by Hay ED.. New York: Plenum, 1991, p. 419-462.
16.
Hediger, MA,
Coady MJ,
Ikeda TS,
and
Wright EM.
Expression cloning and cDNA sequencing of the Na+/glucose co-transporter.
Nature
330:
379-381,
1987[Medline].
17.
Hediger, MA,
Ikeda T,
Coady M,
Gundersen CB,
and
Wright EM.
Expression of size-selected mRNA encoding the intestinal Na/glucose cotransporter in Xenopus laevis oocytes.
Proc Natl Acad Sci USA
84:
2634-2637,
1987
18.
Hediger, MA,
Turk E,
and
Wright EM.
Homology of the human intestinal Na+/glucose and Escherichia coli Na+/proline cotransporters.
Proc Natl Acad Sci USA
86:
5748-5752,
1989
19.
Hirayama, BA,
Pilar Lostao M,
Panayotova-Heiermann M,
Loo DDF,
Turk E,
and
Wright EM.
Kinetic and specificity differences between rat, human and rabbit Na+-glucose cotransporters (SGLT-1).
Am J Physiol Gastrointest Liver Physiol
270:
G919-G926,
1996
20.
Horster, MF,
Braun GS,
and
Huber SM.
Embryonic renal epithelia: induction, nephrogenesis and cell differentiation.
Physiol Rev
79:
1157-1191,
1999
21.
Kanwar, YS,
Liu ZZ,
Kumar A,
Wada J,
and
Wallner EI.
D-glucose-induced dysmorphogenesis of embryonic kidney.
J Clin Invest
98:
2478-2488,
1996[Web of Science][Medline].
22.
Kanwar, YS,
Kumar A,
Yang Q,
Tian Y,
Wada J,
Kashihara N,
and
Wallner EI.
Tubulointerstitial nephritis antigen: an extracellular matrix protein that selectively regulates tubulogenesis vs glomerulogenesis during mammalian renal development.
Proc Natl Acad Sci USA
96:
11323-11328,
1999
23.
Kong, CT,
Yet SF,
and
Lever JE.
Cloning and expression of a mammalian Na+/amino acid cotransporter with sequence similarity to Na+/glucose cotransporters.
J Biol Chem
268:
1509-1512,
1993
24.
Lee, W,
Kanai Y,
Wells RG,
and
Hediger MA.
The high affinity Na+/glucose cotransporter.
J Biol Chem
269:
12032-12039,
1994
25.
Lee, WJ,
Peterson DR,
Sukowski EJ,
and
Hawkins RA.
Glucose transport by isolated plasma membranes of the bovine blood-brain barrier.
Am J Physiol Cell Physiol
272:
C1552-C1557,
1997
26.
Mendel, DB,
and
Crabtree GR.
HNF-1, a member of a novel class of dimerizing homeodomain proteins.
J Biol Chem
266:
677-680,
1991
27.
Merlet-Benichou, C,
Pegorier M,
Muffat-Joly M,
and
Augeron C.
Functional and morphologic patterns of renal maturation in the developing guinea pig.
Am J Physiol Renal Fluid Electrolyte Physiol
241:
F618-F624,
1981.
28.
Moe, OW,
Berry CA,
and
Rector Jr FC.
Renal transport of glucose, amino acids, sodium, chloride and water.
In: The Kidney, edited by Brenner BM.. Philadelphia, PA: Saunders, 2000, p. 375-416.
29.
Morita, Y,
Tsutsumi O,
Hosoya I,
Taketani Y,
Oka Y,
and
Kato T.
Expression and possible function of glucose transporter protein GLUT-1 during preimplantation mouse development from oocytes to blastocysts.
Biochem Biophys Res Commun
188:
8-15,
1992[Web of Science][Medline].
30.
Morrison, AI,
Panayotova-Heiermann M,
Feigl G,
Scholermann B,
and
Kinne RKH
Sequence comparison of the sodium-D-glucose cotransport systems in rabbit renal and intestinal epithelia.
Biochim Biophys Acta
1089:
121-123,
1991[Medline].
31.
Ohta, T,
Isselbacher KJ,
and
Rhoads DB.
Regulation of glucose transporters in LLC-PK1 cells: effects of D-glucose and monosaccharides.
Mol Cell Biol
10:
6491-6499,
1990
32.
Oliver, JA,
and
Al-awqati Q.
An endothelial growth factor involved in rat renal development.
J Clin Invest
102:
1208-1219,
1998[Web of Science][Medline].
33.
Orellana, SA,
and
Avner ED.
Cell and molecular biology of kidney development.
Semin Nephrol
18:
233-243,
1998[Web of Science][Medline].
34.
Rhoads, DB,
Rosenbaum DH,
Unsal H,
Isselbacher KJ,
and
Levitsky LL.
Circadian periodicity of intestinal Na+/glucose cotransporter 1 mRNA levels is transcriptionally regulated.
J Biol Chem
273:
9510-9516,
1998
35.
Robillard, JE,
Sessions C,
Kennedy RL,
and
Smith FG, Jr.
Maturation of glucose transport process by the fetal kidney.
Pediatr Res
12:
680-684,
1978[Web of Science][Medline].
36.
Saxen, L.
Organogenesis of the Kidney. New York: Cambridge University Press, 1987, p. 1-173.
37.
Spitzer, A,
and
Chevalier RL.
The developing kidney and the process of growth.
In: The Kidney, edited by Seldin DW,
and Giebisch G.. New York: Raven, 1992, p. 829-883.
38.
Stuart, RO,
and
Nigam SK.
Developmental biology of the kidney.
In: The Kidney, edited by Brenner BM.. Philadelphia, PA: Saunders, 2000, p. 68-92.
39.
Takata, K,
Kasahara T,
Kasahara M,
Ezaki O,
and
Hirano H.
Localization of Na+-dependent active type and erythrocyte/HepG2-type glucose transports in rat kidney: immunofluorescence and immunogold study.
J Histochem Cytochem
39:
287-298,
1991[Abstract].
40.
Thomas, PE,
Wharram B,
Goyal M,
Wiggins J,
Holzman L,
and
Wiggins R.
GLEPP-1, a renal glomerular epithelial cell (podocyte) membrane protein-tyrosine phosphatase. Identification, molecular cloning, and characterization in rabbit.
J Biol Chem
269:
19953-19961,
1994
41.
Turk, E,
and
Wright EM.
Membrane topology motifs in SGLT cotransporter family.
J Membr Biol
159:
1-20,
1997[Web of Science][Medline].
42.
Wada, J,
Kumar A,
Liu Z,
Ruoslahti E,
Reichardt L,
Marvaldi J,
and
Kanwar YS.
Cloning of mouse integrin
v-related matrix receptors in metanephric development.
J Cell Biol
32:
1161-1176,
1996.
43.
Wright, EM,
Hirsch JR,
Loo DDF,
and
Zampighi GA.
Regulation of Na+/glucose cotransporters.
J Exp Biol
200:
287-293,
1997[Abstract].
44.
You, G,
Lee WS,
Barros EJG,
Kanai Y,
Huo TL,
Khawaja S,
Wells RG,
Nigam SK,
and
Hediger MA.
Molecular characteristics of Na+-coupled glucose transporters in adult and embryonic rat kidney.
J Biol Chem
270:
29365-29371,
1995
This article has been cited by other articles:
![]() |
G. Tramonti, P. Xie, E. I. Wallner, F. R. Danesh, and Y. S. Kanwar Expression and functional characteristics of tubular transporters: P-glycoprotein, PEPT1, and PEPT2 in renal mass reduction and diabetes. Am J Physiol Renal Physiol, November 1, 2006; 291(5): F972 - F980. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Gatley Labeled Glucose Analogs in the Genomic Era J. Nucl. Med., July 1, 2003; 44(7): 1082 - 1086. [Full Text] [PDF] |
||||
![]() |
Y. S. Kanwar, Q. Yang, Y. Tian, S. Lin, J. Wada, S. Chugh, and S. K. Srivastava Relevance of renal-specific oxidoreductase in tubulogenesis during mammalian nephron development Am J Physiol Renal Physiol, April 1, 2002; 282(4): F752 - F762. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |