AJP - Renal Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 279: F1027-F1032, 2000;
0363-6127/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, M. A.
Right arrow Articles by Quaggin, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, M. A.
Right arrow Articles by Quaggin, S. E.
Vol. 279, Issue 6, F1027-F1032, December 2000

Identification and characterization of a glomerular-specific promoter from the human nephrin gene

M. Andrew Wong1, Shiying Cui1, and Susan E. Quaggin1,2

1 Department of Maternal and Fetal Health, The Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario M5G 1X5; and 2 Division of Nephrology, St. Michael's Hospital, Toronto, Ontario, Canada M5B 1W8


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Podocytes are highly specialized cells that make up a major portion of the glomerular filtration barrier in the kidney. They are also believed to play a pivotal role in the progression of chronic renal disease due to diverse causes that include diabetes (3, 20, 24) and aging (1, 7). Despite the importance of podocytes for kidney function and disease, studies of this cell type have been hindered due to a lack of model systems. Recently, the gene responsible for congenital Finnish nephropathy was identified and named nephrin (13). Nephrin expression is restricted to slit diaphragms of podocytes (11, 30). Infants with congenital Finnish nephropathy develop massive proteinuria and subsequent kidney failure due to podocyte injury. We have identified a 1.25-kb DNA fragment from the human nephrin promoter and 5'-flanking region that is capable of directing podocyte-specific expression in transgenic mice; this represents the first glomerular-specific promoter to be identified. Use of this transgene will facilitate studies of the podocyte in vivo and allow the identification of transacting factors that are required for podocyte-specific expression.

podocyte; glomerulus; transgene; tissue-specific expression


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

PROGRESSIVE RENAL DAMAGE OCCURS in a variety of disease states, even when the initiating injury is removed. Glomerulosclerosis and secondary tubulointerstitial fibrosis is the most common pathologic lesion identified in progressive renal failure (4). Together, these observations suggest that there is a common final pathway for many kidney diseases.

A number of studies have implicated the podocyte as a key cell in the progression of renal disease toward glomerulosclerosis (15, 16). Podocytes are mesodermally derived cells that are highly specialized and found only in the renal glomerulus. They exhibit unique characteristics such as foot processes and slit diaphragms, which are critical for glomerular filtration (21, 33). When podocytes are damaged, the foot processes fuse and eventually detach from the underlying glomerular basement membrane, leaving fewer cells to cover the capillary loops (16). Terminally differentiated podocytes are believed to be unable to divide in the adult kidney. Instead, they respond to glomerular injury through hypertrophy. Kriz has proposed that eventual loss of these hypertrophied podocytes leads to direct apposition of glomerular capillary endothelial cells to the overlying parietal epithelium, and obliteration of the filtration space (15, 16). Careful morphological studies have demonstrated a strong correlation between podocyte number and progression of glomerulosclerosis in diabetes (20). Although it has been reported that "dysregulated" glomerular visceral epithelial cells (podocytes) can proliferate in specific conditions such as collapsing glomerulopathy (2), these results remain controversial (14).

Despite the clinical importance of podocytes, their biology is still poorly understood. Previously, developing appropriate model systems to study podocytes in vitro has been difficult, as glomerular epithelial cells dedifferentiate in culture and lose their podocyte-specific markers. Recently, the gene responsible for congenital Finnish nephropathy was identified and named nephrin (13). Nephrin is a 135-kDa protein with homology to the immunoglobulin superfamily of cell adhesion molecules and is specifically located in the slit diaphragms of podocytes. Children who have mutations in the nephrin gene develop massive proteinuria and renal failure before age 2 yr (32).

Shih et al. (32) reported proteinuria and glomerular damage in mice that are homozygous null mutant for CD2AP (CD2-associated protein). These investigators demonstrated that CD2AP is expressed in podocytes and can associate with nephrin in vitro. The authors speculate that CD2AP links nephrin in the slit diaphragm to the intracellular cytoskeleton.

The purpose of the present study was to identify and characterize the podocyte-specific elements of the nephrin promoter. This promoter will be a valuable tool to study podocyte biology in vivo, with the hope of understanding its role in the development of glomerulosclerosis and ultimately enabling repopulation of the damaged glomerulus.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning the human nephrin promoter. The National Center for Biotechnology Information BLAST program was used to search the human chromosome 19 cosmid (Genbank accession no. AC002133)1 for location of the human nephrin cDNA. The predicted nephrin initiation codon was identified at position 27,309. We designed PCR oligonucleotide primers (shown below) to amplify 4 kb of the proximal 5' flanking sequence of the nephrin gene that includes the predicted initiation ATG and 57 bp of the first exon. DNA was amplified by PCR from human genomic DNA, as previously described (27). A 4-kb fragment was excised and subcloned into the PCR2.1 vector (Clontech). Subsequent sequence analysis revealed that only 1.25 kb of the proximal promoter and 5' flanking region was present in the plasmid, which suggests that DNA was lost during bacterial growth. The final nephrin transgene fragment begins at position 28,505 (GenBank accession no. AC002133)1 and ends at position 27,253. A 3.34-kb Sal I fragment from the pSDKlacZpA vector containing the lacZ-expression cassette was excised and cloned into the Xho I site of the nephrin/PCR2.1 vector to create the final nephrin-transgenic construct (26): sense oligonucleotide, 5' CTGGCTGAGACGCTGATGGCCTGA 3', and antisense oligonucleotide, 5' CCTTCAGTCAGCAGCCCCAGGAGCA 3'.

Generation of transgenic lines. The nephrin construct was linearized with NotI, and gel purified by using a Bio101 Geneclean kit. Transgenic DNA at a concentration of 2 ng/µl was injected into the pronucleus of one-cell embryos and transferred to psuedopregnant female CD1 mice as described (10). Genomic DNA was isolated from tails of transgenic mice and used for genotype analysis as described (26). DNA was digested with EcoR I, and Southern blot analysis was performed by using a probe for the beta -galactosidase gene.

In situ analysis of embryonic kidneys. Kidneys from 18.5-day postcoitum (dpc) embryos were dissected and fixed in 4% paraformaldehyde overnight at 4°C, cryopreserved in 30% sucrose overnight at 4°C, embedded in OCT compound (Tissue-Tek 4583), and frozen at -70°C. Twelve-micrometer cryosections were cut on a Leica Cryostat (model CM3050), and in situ hybridization was performed as described elsewhere (12, 31). A 2.3-kb fragment of the mouse nephrin gene from bp 1810 to 3728 (GenBank accession no. AF168466)2 in pBluescriptKS+ was used as a template for antisense- and sense digoxigenin-labeled RNA probes that were prepared according to manufacturer's (Boehringer Mannheim) instructions.

beta -Galactosidase staining of embryos and kidneys. Kidneys or whole embryos from 9.5 to 18.5 dpc were fixed in 4% paraformaldehyde and 1% glutaraldehyde and stained for beta -galactosidase activity as described (25). Kidneys and a variety of other tissues (lung, heart, gut, etc.) were also dissected from postnatal day 0 and postnatal day 14 mice, cut into small pieces, and fixed and stained with beta -galactosidase by whole mount as described above. Tissues were then embedded in paraffin, and 5-µm sections were cut.

Sequence analysis of the promoter region. The 1.25-kb fragment of nephrin DNA that was used to generate transgenic lines was analyzed for transcription-factor binding sites by using the TRANSFAC Web site and the internet browser3 (9).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

LacZ expression is restricted to podocytes in transgenic lines. Six founder lines were identified by Southern blot analysis (Fig. 1). Three of these lines had a single chromosomal integration of the transgene, while three had two or more integrations of the transgene. Kidneys from one newborn founder male and embryos and kidneys from the offspring of the other five founder lines were dissected and stained for galactosidase activity. Offspring and kidneys from three of the six founder lines demonstrated lacZ expression. Of note, only one of the expressing lines had two sites of integration of the transgene; the other two lines had a single integration of the transgene. Offspring from the other three founder lines and two nontransgenic-control littermates exhibited no lacZ expression at any stage of development. In the three positive lines, lacZ expression was found exclusively in podocytes of capillary-loop stage and mature glomeruli (Fig. 2). No staining was identified in podocyte precursors in S-shaped bodies or in any other tissues at any embryonic or postnatal day studied. In comparison, endogenous nephrin mRNA was detected in podocyte precursors in S-shaped bodies, in podocytes from capillary-loop stage glomeruli, and in mature podocytes (Fig. 3).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   Transgenic construct and Southern blot analysis of transgenic mice. A: schematic diagram of the human nephrin lacZ-transgene construct. The gray-shaded box represents the 1.25-kb fragment of genomic DNA from the promoter region of the human nephrin gene. The arrow represents the transcription initiation site (TIS); nucleotide positions are indicated relative to the TIS. The lacZ-expression cassette contains an SDK oligonucleotide and is followed by the polyadenylation signal from SV40 (pA). B: Southern blot analysis of genomic DNA from 2 founder lines. Genomic DNA was isolated from mouse tails and digested with EcoR I, which cuts the transgene once internally. The blot was hybridized with a lacZ probe. Lanes 2 and 7 demonstrate founder lines with 1 and 2 sites of chromosomal integration, respectively. Both of these founder lines expressed the lacZ reporter gene specifically in podocytes (po). Left: DNA molecular wt standards for 7 and 3 kb.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2.   LacZ expression in transgenic mouse kidneys at embryonic day 18.5. Embryonic mouse kidneys from offspring of the founder line shown in Fig. 1 (lane 2) were dissected at day 18.5 and stained with beta -galactosidase by whole mount. The kidneys were embedded in paraffin and sectioned. A: the 1.25-kb nephrin fragment directs expression of the lacZ reporter gene to glomeruli and specifically to po (B, C). pa, Parietal epithelial cells; me, mesangial cells.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 3.   mRNA expression of the endogenous murine nephrin gene. A digoxigenin-labeled antisense 2.3-kb probe from the 3' end of the murine nephrin cDNA was used for in situ analysis of embryonic day 18.5 mouse kidneys. Murine nephrin is weakly expressed in po precursors of an S-shaped body (developing glomerulus, A), but is highly expressed in po in capillary-loop stage (B) and mature glomeruli (C). In contrast, no staining was seen in samples hybridized with the sense digoxigenin-labeled probe (not shown).

Transcription factor binding sites in the podocyte-specific promoter. The DNA fragment capable of directing podocyte-specific expression in the glomerulus was searched for potential transcription factor binding sites (Fig. 4). Within this 1.25-kb fragment there is no TATA box, but GATA binding sites are seen. Of note, there are several E-box consensus sequences that are recognition sites for basic-helix-loop-helix proteins and a potential Pax-2 binding site. The transcription initiation site has been determined by primer extension and is reported to occur 156 bp upstream of the initiating codon (17).


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4.   DNA sequence of the 1.25-kb po-specific promoter. The sequence of the proximal promoter region of the human nephrin gene is shown. The predicted initiation ATG is shown in bold with an asterisk. The reported transcription start site is shown with double asterisks. Within this region we were unable to identify a TATA box, but several GATA and E-box consensus sites are shown. In addition, a putative Pax-2 binding site was identified and is shown. The GA repeat sequence is underlined. Mutations in this region of the promoter were reported in 2 patients with congenital Finnish nephropathy (17).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Podocytes are an integral component of the glomerular filter and play a pivotal role in the progression of many renal diseases. In contrast to the mesangial cell, which is also found in the glomerulus but is not a structural component of the renal filter, the biological role of the podocyte in renal disease has not been studied extensively. In part, this has been due to the lack of cell-culture models. Although it has been possible to isolate glomerular epithelial cells from primary cultures, these cells lose their podocyte-specific characteristics after a few passages (23). Mundel et al. (22) have isolated SV40-transformed murine-podocyte cell lines that retain certain characteristics and markers of podocytes but cannot replace in vivo studies. As a first step in the development of molecular tools to study the podocyte in vivo, we report the first glomerular-specific promoter to be identified. In this paper, we demonstrate that a 1.25-kb fragment of genomic human DNA, which includes the predicted initiation codon and immediate 5'-flanking region of nephrin, directs podocyte-specific expression in vivo.

The expression pattern of our human lacZ transgene recapitulates the expression pattern of the endogenous murine nephrin gene with a few exceptions. In the mouse, nephrin mRNA is weakly expressed in podocyte precursors at the S-shaped body stage (Fig. 3A) and is strongly expressed in podocytes in capillary-loop stage and mature glomeruli (11; Fig. 3, B and C). In addition, Holzman et al. (11) describe nephrin expression in the spleen, and we also see weak expression in developing pancreas (data not shown). In contrast, we did not observe any expression of the nephrin transgene outside the renal podocyte. Furthermore, we did not detect lacZ expression until the capillary-loop stage podocyte; no lacZ expression was detected in S-shaped bodies. This may represent sensitivity of the lacZ-expression assay, absence of a regulatory element in the transgene, and/or interspecies expression differences as the human promoter was used for the transgenic studies. Because three of the six transgenic founder lines did not demonstrate any lacZ expression, it follows that expression of the 1.25-kb promoter of human nephrin is influenced by the chromosomal integration site. Although we observed these stable position effects, we did not observe any heterocellular expression of the transgene (19).

Given the limited size (1.25 kb) of the podocyte-specific promoter, it is of interest to identify putative cis-binding elements. Of note, a putative Pax-2 binding element and multiple canonical E-box consensus sequences exist. Pax-2 is a member of the paired box family of transcription factors; it is expressed in renal vesicles and is specifically downregulated in podocyte precursors at the S-shaped-body stage (6). Studies have shown that Pax-2 can act as both a transcriptional activator and a repressor (5, 8). Thus one might speculate that Pax-2 actively represses transcription of the nephrin gene in epithelial cells of the renal vesicle prior to podocyte differentiation. In addition, we and others have identified a basic-helix-loop-helix transcription factor, Pod1/capsulin/epicardin (18, 27, 29), which is highly expressed in podocyte precursors and mature podocytes. Similar to other bHLH proteins, Pod1 can bind to E-box consensus sequences in vitro (18). Although podocytes fail to differentiate terminally beyond the capillary-loop stage in Pod1 mutant mice, nephrin is still expressed in the mutant podocytes. These results demonstrate that Pod1 is not required to activate transcription of the nephrin gene (28; data not shown).

Lenkkeri et al. (17) reported promoter deletion mutations in two patients with Finnish nephropathy. These occurred in the GA repeat sequence between bp -292 to -327 of the proximal promoter. One of these patients presented with an atypical course and did not require renal transplantation until age 5 yr (17). It will be of interest to determine whether mutations in this region affect expression of our transgene.

We have identified and begun to characterize the first glomerular-specific and podocyte-specific promoter. Identification and characterization of cis-acting elements in this promoter fragment will be useful to identify transcription factors required for podocyte-specific expression. Use of this transgene will allow genetic manipulation of the podocyte in vivo, characterization of its biological role in renal function and disease, and ultimately, testing of the hypothesis that the podocyte plays a pivotal role in the progression of renal injury toward glomerulosclerosis.


    ACKNOWLEDGEMENTS

We thank Johanne Pellerin and Lois Schwartz for expert technical assistance.


    FOOTNOTES

S. E. Quaggin is the recipient of a Clinician Scientist Award from the Medical Research Council of Canada, the Carl Gottschalk Scholar Award from the American Society for Nephrology, and is a Canadian Foundation for Innovation Researcher. This work was supported by a Medical Research Council of Canada grant to S. E. Quaggin.

Address for reprint requests and other correspondence: S. E. Quaggin (E-mail: quaggin{at}mshri.on.ca).

1 The nucleotide sequence for the human chromosome 19 cosmid can be accessed through the National Center for Biotechnology Information (NCBI) nucleotide database www.ncbi.nlm.nih.gov under NCBI accession no. AC002133.

2 The nucleotide sequence for the murine nephrin cDNA can be accessed through the NCBI nucleotide database under NCBI accession no. AF168466.

3 The TRANSFAC transcription factor site database can be accessed on: http://transfac.gbf.de/TRANSFAC (9).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 15 May 2000; accepted in final form 18 August 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Abrass, CK. The nature of chronic progressive nephropathy in aging rats. Adv Ren Replace Ther 7: 4-10, 2000[Web of Science][Medline].

2.   Barisoni, L, Kriz W, Mundel P, and D'Agati V. The dysregulated podocyte phenotype: a novel concept in the pathogenesis of collapsing idiopathic focal segmental glomerulosclerosis and HIV-associated nephropathy. J Am Soc Nephrol 10: 51-61, 1999[Abstract/Free Full Text].

3.   Coimbra, TM, Janssen U, Grone HJ, Ostendorf T, Kunter U, Schmidt H, Brabant G, and Floege J. Early events leading to renal injury in obese zucker (fatty) rats with type II diabetes. Kidney Int 57: 167-182, 2000[Web of Science][Medline].

4.   D'Agati, V. The many masks of focal segmental glomerulosclerosis. Kidney Int 46: 1223-1241, 1994[Web of Science][Medline].

5.   Dehbi, M, Ghahremani M, Lechner M, Dressler G, and Pelletier J. The paired-box transcription factor, PAX2, positively modulates expression of the Wilms' tumor suppressor gene (WT1). Oncogene 13: 447-453, 1996[Web of Science][Medline].

6.   Dressler, GR, Deutsch U, Chowdhury K, Nornes HO, and Gruss P. Pax2, a new murine paired-box-containing gene and its expression in the developing excretory system. Development 109: 787-795, 1990[Abstract/Free Full Text].

7.   Floege, J, Hackmann B, Kliem V, Kriz W, Alpers CE, Johnson RJ, Kuhn KW, Koch KM, and Brunkhorst R. Age-related glomerulosclerosis and interstitial fibrosis in Milan normotensive rats: a podocyte disease. Kidney Int 51: 230-243, 1997[Web of Science][Medline].

8.   Havik, B, Ragnhildstveit E, Lorens JB, Saelemyr K, Fauske O, Knudsen LK, and Fjose A. A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription. Biochem Biophys Res Commun 266: 532-541, 1999[Web of Science][Medline].

9.   Heinemeyer, T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, and Kolchanov NA. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26: 362-367, 1998[Abstract/Free Full Text].

10.   Hogan, B, Beddington R, Costantini F, and Lacy E. Manipulating the Mouse Embryo. Cold Spring Harbor, NY: Cold Spring Harbor, 1994.

11.   Holzman, LB, St. John PL, Kovari IA, Verma R, Holthofer H, and Abrahamson DR. Nephrin localizes to the slit pore of the glomerular epithelial cell. Kidney Int 56: 1481-1491, 1999[Web of Science][Medline].

12.   Hui, CC, and Joyner AL. A mouse model of greig cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene. Nat Genet 3: 241-246, 1993[Web of Science][Medline].

13.   Kestila, M, Lenkkeri U, Mannikko M, Lamerdin J, McCready P, Putaala H, Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, Holmberg C, Olsen A, and Tryggvason K. Positionally cloned gene for a novel glomerular protein-nephrin-is mutated in congenital nephrotic syndrome. Mol Cell 1: 575-582, 1998[Web of Science][Medline].

14.   Kihara, I, Yaoita E, Kawasaki K, Yamamoto T, Hara M, and Yanagihara T. Origin of hyperplastic epithelial cells in idiopathic collapsing glomerulopathy. Histopathology 34: 537-547, 1999[Web of Science][Medline].

15.   Kriz, W, Kretzler M, Nagata M, Provoost AP, Shirato I, Uiker S, Sakai T, and Lemley KV. A frequent pathway to glomerulosclerosis: deterioration of tuft architecture-podocyte damage-segmental sclerosis. Kidney Blood Press Res 19: 245-253, 1996[Web of Science][Medline].

16.   Kriz, W, and Lemley KV. The role of the podocyte in glomerulosclerosis. Curr Opin Nephrol Hypertens 8: 489-497, 1999[Web of Science][Medline].

17.   Lenkkeri, U, Mannikko M, McCready P, Lamerdin J, Gribouval O, Niaudet PM, Antignac CK, Kashtan CE, Homberg C, Olsen A, Kestila M, and Tryggvason K. Structure of the gene for congenital nephrotic syndrome of the finnish type (NPHS1) and characterization of mutations. Am J Hum Genet 64: 51-61, 1999[Web of Science][Medline].

18.   Lu, J, Richardson JA, and Olson EN. Capsulin: a novel bHLH transcription factor expressed in epicardial progenitors and mesenchyme of visceral organs. Mech Dev 73: 23-32, 1998[Web of Science][Medline].

19.   Martin, DI, and Whitelaw E. The vagaries of variegating transgenes. Bioessays 18: 919-923, 1996[Medline].

20.   Meyer, TW, Bennett PH, and Nelson RG. Podocyte number predicts long-term urinary albumin excretion in Pima Indians with Type II diabetes and microalbuminuria. Diabetologia 42: 1341-1344, 1999[Web of Science][Medline].

21.   Mundel, P, and Kriz W. Structure and function of podocytes: an update. Anat Embryol (Berl) 192: 385-397, 1995[Medline].

22.   Mundel, P, Reiser J, Borja AZ, Pavenstadt H, Davidson GR, Kriz W, and Zeller R. Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236: 248-258, 1997[Web of Science][Medline].

23.   Mundel, P, Reiser J, and Kriz W. Induction of differentiation in cultured rat and human podocytes. J Am Soc Nephrol 8: 697-705, 1997[Abstract].

24.   Pagtalunan, ME, Miller PL, Jumping-Eagle S, Nelson RG, Myers BD, Rennke HG, Coplon NS, Sun L, and Meyer TW. Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 99: 342-348, 1997[Web of Science][Medline].

25.   Partanen, J, Puri MC, Schwartz L, Fischer KD, Bernstein A, and Rossant J. Cell autonomous functions of the receptor tyrosine kinase TIE in a late phase of angiogenic capillary growth and endothelial cell survival during murine development. Development 122: 3013-3021, 1996[Abstract].

26.   Puri, MC, Rossant J, Alitalo K, Bernstein A, and Partanen J. The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells. EMBO J 14: 5884-5891, 1995[Web of Science][Medline].

27.   Quaggin, SE, Heuvel GBV, and Igarashi P. Pod-1, a mesoderm-specific basic-helix-loop-helix protein expressed in mesenchymal and glomerular epithelial cells in the developing kidney. Mech Dev 71: 37-48, 1998[Web of Science][Medline].

28.   Quaggin, SE, Schwartz L, Post M, and Rossant J. The basic-helix-loop-helix protein Pod-1 is critically important for kidney and lung development. Development 126: 5771-5783, 1999[Abstract].

29.   Robb, L, Mifsud L, Hartley L, Biben C, Copeland NG, Gilbert DJ, Jenkins NA, and Harvey RP. Epicardin: a novel basic helix-loop-helix transcription factor gene expressed in epicardium, branchial arch myoblasts, and mesenchyme of developing lung, gut, kidney, and gonads. Dev Dyn 213: 105-113, 1998[Web of Science][Medline].

30.   Ruotsalainen, V, Ljungberg P, Wartiovaara J, Lenkkeri U, Kestila M, Jalanko H, Holmberg C, and Tryggvason K. Nephrin is specifically located at the slit diaphragm of glomerular podocytes. Proc Natl Acad Sci USA 96: 7962-7967, 1999[Abstract/Free Full Text].

31.   Schaeren-Wiemers, N, and Gerfin-Moser A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labeled cRNA probes. Histochemistry 100: 431-440, 1993[Web of Science][Medline].

32.   Shih, NY, Li J, Karpitskii V, Nguyen A, Dustin ML, Kanagawa O, Miner JH, and Shaw AS. Congenital nephrotic syndrome in mice lacking CD2-associated protein. Science 286: 312-315, 1999[Abstract/Free Full Text].

33.   Wickelgren, I. First components found for new kidney filter. Science 286: 225-226, 1999[Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 279(6):F1027-F1032
0363-6127/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Adler, E. Efrati, and I. Zelikovic
Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene
Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Meier, J.-K. Park, D. Overheu, T. Kirsch, C. Lindschau, F. Gueler, M. Leitges, J. Menne, and H. Haller
Deletion of Protein Kinase C-{beta} Isoform In Vivo Reduces Renal Hypertrophy but Not Albuminuria in the Streptozotocin-Induced Diabetic Mouse Model
Diabetes, February 1, 2007; 56(2): 346 - 354.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
R. VanDeVoorde, D. Witte, J. Kogan, and J. Goebel
Pierson Syndrome: A Novel Cause of Congenital Nephrotic Syndrome
Pediatrics, August 1, 2006; 118(2): e501 - e505.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Benigni, C. Zoja, S. Tomasoni, M. Campana, D. Corna, C. Zanchi, E. Gagliardini, E. Garofano, D. Rottoli, T. Ito, et al.
Transcriptional Regulation of Nephrin Gene by Peroxisome Proliferator-Activated Receptor-{gamma} Agonist: Molecular Mechanism of the Antiproteinuric Effect of Pioglitazone
J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1624 - 1632.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. A. Fenton, A. Shodeinde, and M. A. Knepper
UT-A urea transporter promoter, UT-A{alpha}, targets principal cells of the renal inner medullary collecting duct
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F188 - F195.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Cui, C. Li, M. Ema, J. Weinstein, and S. E. Quaggin
Rapid Isolation of Glomeruli Coupled with Gene Expression Profiling Identifies Downstream Targets in Pod1 Knockout Mice
J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3247 - 3255.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic
The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
G. Guo, D. J. Morrison, J. D. Licht, and S. E. Quaggin
WT1 Activates a Glomerular-Specific Enhancer Identified from the Human Nephrin Gene
J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2851 - 2856.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
A. Gawlik and S. E. Quaggin
Deciphering the Renal Code: Advances in Conditional Gene Targeting
Physiology, October 1, 2004; 19(5): 245 - 252.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Hoffmann, D. Podlich, B. Hahnel, W. Kriz, and N. Gretz
Angiotensin II Type 1 Receptor Overexpression in Podocytes Induces Glomerulosclerosis in Transgenic Rats
J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1475 - 1487.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. T. Discenza and J. Pelletier
Insights into the physiological role of WT1 from studies of genetically modified mice
Physiol Genomics, February 13, 2004; 16(3): 287 - 300.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J.-L. Michaud, L. I. Lemieux, M. Dube, B. C. Vanderhyden, S. J. Robertson, and C. R.J. Kennedy
Focal and Segmental Glomerulosclerosis in Mice with Podocyte-Specific Expression of Mutant {alpha}-Actinin-4
J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1200 - 1211.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Suzuki, T. Ito, E. Imai, M. Yamato, H. Iwatani, H. Kawachi, and M. Hori
Retinoids Regulate the Repairing Process of the Podocytes in Puromycin Aminonucleoside-induced Nephrotic Rats
J. Am. Soc. Nephrol., April 1, 2003; 14(4): 981 - 991.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
O. Beltcheva, S. Kontusaari, S. Fetissov, H. Putaala, P. Kilpelainen, T. Hokfelt, and K. Tryggvason
Alternatively Used Promoters and Distinct Elements Direct Tissue-Specific Expression of Nephrin
J. Am. Soc. Nephrol., February 1, 2003; 14(2): 352 - 358.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. Pavenstadt, W. Kriz, and M. Kretzler
Cell Biology of the Glomerular Podocyte
Physiol Rev, January 1, 2003; 83(1): 253 - 307.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. J. Moeller, S. K. Sanden, A. Soofi, R. C. Wiggins, and L. B. Holzman
Two Gene Fragments that Direct Podocyte-Specific Expression in Transgenic Mice
J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1561 - 1567.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. E. Quaggin
A "Molecular Toolbox" for the Nephrologist
J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1682 - 1685.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
V. Eremina, M. A. Wong, S. Cui, L. Schwartz, and S. E. Quaggin
Glomerular-Specific Gene Excision In Vivo
J. Am. Soc. Nephrol., March 1, 2002; 13(3): 788 - 793.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, M. A.
Right arrow Articles by Quaggin, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, M. A.
Right arrow Articles by Quaggin, S. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online