|
|
||||||||
1 Department of Maternal and Fetal Health, The Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario M5G 1X5; and 2 Division of Nephrology, St. Michael's Hospital, Toronto, Ontario, Canada M5B 1W8
| |
ABSTRACT |
|---|
|
|
|---|
Podocytes are highly specialized cells that make up a major portion of the glomerular filtration barrier in the kidney. They are also believed to play a pivotal role in the progression of chronic renal disease due to diverse causes that include diabetes (3, 20, 24) and aging (1, 7). Despite the importance of podocytes for kidney function and disease, studies of this cell type have been hindered due to a lack of model systems. Recently, the gene responsible for congenital Finnish nephropathy was identified and named nephrin (13). Nephrin expression is restricted to slit diaphragms of podocytes (11, 30). Infants with congenital Finnish nephropathy develop massive proteinuria and subsequent kidney failure due to podocyte injury. We have identified a 1.25-kb DNA fragment from the human nephrin promoter and 5'-flanking region that is capable of directing podocyte-specific expression in transgenic mice; this represents the first glomerular-specific promoter to be identified. Use of this transgene will facilitate studies of the podocyte in vivo and allow the identification of transacting factors that are required for podocyte-specific expression.
podocyte; glomerulus; transgene; tissue-specific expression
| |
INTRODUCTION |
|---|
|
|
|---|
PROGRESSIVE RENAL DAMAGE OCCURS in a variety of disease states, even when the initiating injury is removed. Glomerulosclerosis and secondary tubulointerstitial fibrosis is the most common pathologic lesion identified in progressive renal failure (4). Together, these observations suggest that there is a common final pathway for many kidney diseases.
A number of studies have implicated the podocyte as a key cell in the progression of renal disease toward glomerulosclerosis (15, 16). Podocytes are mesodermally derived cells that are highly specialized and found only in the renal glomerulus. They exhibit unique characteristics such as foot processes and slit diaphragms, which are critical for glomerular filtration (21, 33). When podocytes are damaged, the foot processes fuse and eventually detach from the underlying glomerular basement membrane, leaving fewer cells to cover the capillary loops (16). Terminally differentiated podocytes are believed to be unable to divide in the adult kidney. Instead, they respond to glomerular injury through hypertrophy. Kriz has proposed that eventual loss of these hypertrophied podocytes leads to direct apposition of glomerular capillary endothelial cells to the overlying parietal epithelium, and obliteration of the filtration space (15, 16). Careful morphological studies have demonstrated a strong correlation between podocyte number and progression of glomerulosclerosis in diabetes (20). Although it has been reported that "dysregulated" glomerular visceral epithelial cells (podocytes) can proliferate in specific conditions such as collapsing glomerulopathy (2), these results remain controversial (14).
Despite the clinical importance of podocytes, their biology is still poorly understood. Previously, developing appropriate model systems to study podocytes in vitro has been difficult, as glomerular epithelial cells dedifferentiate in culture and lose their podocyte-specific markers. Recently, the gene responsible for congenital Finnish nephropathy was identified and named nephrin (13). Nephrin is a 135-kDa protein with homology to the immunoglobulin superfamily of cell adhesion molecules and is specifically located in the slit diaphragms of podocytes. Children who have mutations in the nephrin gene develop massive proteinuria and renal failure before age 2 yr (32).
Shih et al. (32) reported proteinuria and glomerular damage in mice that are homozygous null mutant for CD2AP (CD2-associated protein). These investigators demonstrated that CD2AP is expressed in podocytes and can associate with nephrin in vitro. The authors speculate that CD2AP links nephrin in the slit diaphragm to the intracellular cytoskeleton.
The purpose of the present study was to identify and characterize the podocyte-specific elements of the nephrin promoter. This promoter will be a valuable tool to study podocyte biology in vivo, with the hope of understanding its role in the development of glomerulosclerosis and ultimately enabling repopulation of the damaged glomerulus.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cloning the human nephrin promoter. The National Center for Biotechnology Information BLAST program was used to search the human chromosome 19 cosmid (Genbank accession no. AC002133)1 for location of the human nephrin cDNA. The predicted nephrin initiation codon was identified at position 27,309. We designed PCR oligonucleotide primers (shown below) to amplify 4 kb of the proximal 5' flanking sequence of the nephrin gene that includes the predicted initiation ATG and 57 bp of the first exon. DNA was amplified by PCR from human genomic DNA, as previously described (27). A 4-kb fragment was excised and subcloned into the PCR2.1 vector (Clontech). Subsequent sequence analysis revealed that only 1.25 kb of the proximal promoter and 5' flanking region was present in the plasmid, which suggests that DNA was lost during bacterial growth. The final nephrin transgene fragment begins at position 28,505 (GenBank accession no. AC002133)1 and ends at position 27,253. A 3.34-kb Sal I fragment from the pSDKlacZpA vector containing the lacZ-expression cassette was excised and cloned into the Xho I site of the nephrin/PCR2.1 vector to create the final nephrin-transgenic construct (26): sense oligonucleotide, 5' CTGGCTGAGACGCTGATGGCCTGA 3', and antisense oligonucleotide, 5' CCTTCAGTCAGCAGCCCCAGGAGCA 3'.
Generation of transgenic lines.
The nephrin construct was linearized with NotI, and gel purified by
using a Bio101 Geneclean kit. Transgenic DNA at a concentration of 2 ng/µl was injected into the pronucleus of one-cell embryos and
transferred to psuedopregnant female CD1 mice as described (10). Genomic DNA was isolated from tails of transgenic
mice and used for genotype analysis as described (26). DNA
was digested with EcoR I, and Southern blot analysis was
performed by using a probe for the
-galactosidase gene.
In situ analysis of embryonic kidneys.
Kidneys from 18.5-day postcoitum (dpc) embryos were dissected and fixed
in 4% paraformaldehyde overnight at 4°C, cryopreserved in 30%
sucrose overnight at 4°C, embedded in OCT compound (Tissue-Tek 4583),
and frozen at
70°C. Twelve-micrometer cryosections were cut on a
Leica Cryostat (model CM3050), and in situ hybridization was performed
as described elsewhere (12, 31). A 2.3-kb
fragment of the mouse nephrin gene from bp 1810 to 3728 (GenBank
accession no. AF168466)2 in
pBluescriptKS+ was used as a template for antisense- and sense digoxigenin-labeled RNA probes that were prepared according to manufacturer's (Boehringer Mannheim) instructions.
-Galactosidase staining of embryos and kidneys.
Kidneys or whole embryos from 9.5 to 18.5 dpc were fixed in 4%
paraformaldehyde and 1% glutaraldehyde and stained for
-galactosidase activity as described (25). Kidneys and
a variety of other tissues (lung, heart, gut, etc.) were also dissected
from postnatal day 0 and postnatal day 14 mice,
cut into small pieces, and fixed and stained with
-galactosidase by
whole mount as described above. Tissues were then embedded in paraffin,
and 5-µm sections were cut.
Sequence analysis of the promoter region. The 1.25-kb fragment of nephrin DNA that was used to generate transgenic lines was analyzed for transcription-factor binding sites by using the TRANSFAC Web site and the internet browser3 (9).
| |
RESULTS |
|---|
|
|
|---|
LacZ expression is restricted to podocytes in transgenic lines.
Six founder lines were identified by Southern blot analysis (Fig.
1). Three of these lines had a single
chromosomal integration of the transgene, while three had two or more
integrations of the transgene. Kidneys from one newborn founder male
and embryos and kidneys from the offspring of the other five founder
lines were dissected and stained for galactosidase activity. Offspring and kidneys from three of the six founder lines demonstrated lacZ expression. Of note, only one of the expressing lines had two sites of
integration of the transgene; the other two lines had a single
integration of the transgene. Offspring from the other three founder
lines and two nontransgenic-control littermates exhibited no lacZ
expression at any stage of development. In the three positive lines,
lacZ expression was found exclusively in podocytes of capillary-loop
stage and mature glomeruli (Fig. 2). No
staining was identified in podocyte precursors in S-shaped bodies or in
any other tissues at any embryonic or postnatal day studied. In
comparison, endogenous nephrin mRNA was detected in podocyte precursors
in S-shaped bodies, in podocytes from capillary-loop stage glomeruli,
and in mature podocytes (Fig. 3).
|
|
|
Transcription factor binding sites in the podocyte-specific
promoter.
The DNA fragment capable of directing podocyte-specific expression in
the glomerulus was searched for potential transcription factor binding
sites (Fig. 4). Within this 1.25-kb
fragment there is no TATA box, but GATA binding sites are seen. Of
note, there are several E-box consensus sequences that are recognition
sites for basic-helix-loop-helix proteins and a potential Pax-2 binding site. The transcription initiation site has been determined by primer
extension and is reported to occur 156 bp upstream of the initiating
codon (17).
|
| |
DISCUSSION |
|---|
|
|
|---|
Podocytes are an integral component of the glomerular filter and play a pivotal role in the progression of many renal diseases. In contrast to the mesangial cell, which is also found in the glomerulus but is not a structural component of the renal filter, the biological role of the podocyte in renal disease has not been studied extensively. In part, this has been due to the lack of cell-culture models. Although it has been possible to isolate glomerular epithelial cells from primary cultures, these cells lose their podocyte-specific characteristics after a few passages (23). Mundel et al. (22) have isolated SV40-transformed murine-podocyte cell lines that retain certain characteristics and markers of podocytes but cannot replace in vivo studies. As a first step in the development of molecular tools to study the podocyte in vivo, we report the first glomerular-specific promoter to be identified. In this paper, we demonstrate that a 1.25-kb fragment of genomic human DNA, which includes the predicted initiation codon and immediate 5'-flanking region of nephrin, directs podocyte-specific expression in vivo.
The expression pattern of our human lacZ transgene recapitulates the expression pattern of the endogenous murine nephrin gene with a few exceptions. In the mouse, nephrin mRNA is weakly expressed in podocyte precursors at the S-shaped body stage (Fig. 3A) and is strongly expressed in podocytes in capillary-loop stage and mature glomeruli (11; Fig. 3, B and C). In addition, Holzman et al. (11) describe nephrin expression in the spleen, and we also see weak expression in developing pancreas (data not shown). In contrast, we did not observe any expression of the nephrin transgene outside the renal podocyte. Furthermore, we did not detect lacZ expression until the capillary-loop stage podocyte; no lacZ expression was detected in S-shaped bodies. This may represent sensitivity of the lacZ-expression assay, absence of a regulatory element in the transgene, and/or interspecies expression differences as the human promoter was used for the transgenic studies. Because three of the six transgenic founder lines did not demonstrate any lacZ expression, it follows that expression of the 1.25-kb promoter of human nephrin is influenced by the chromosomal integration site. Although we observed these stable position effects, we did not observe any heterocellular expression of the transgene (19).
Given the limited size (1.25 kb) of the podocyte-specific promoter, it is of interest to identify putative cis-binding elements. Of note, a putative Pax-2 binding element and multiple canonical E-box consensus sequences exist. Pax-2 is a member of the paired box family of transcription factors; it is expressed in renal vesicles and is specifically downregulated in podocyte precursors at the S-shaped-body stage (6). Studies have shown that Pax-2 can act as both a transcriptional activator and a repressor (5, 8). Thus one might speculate that Pax-2 actively represses transcription of the nephrin gene in epithelial cells of the renal vesicle prior to podocyte differentiation. In addition, we and others have identified a basic-helix-loop-helix transcription factor, Pod1/capsulin/epicardin (18, 27, 29), which is highly expressed in podocyte precursors and mature podocytes. Similar to other bHLH proteins, Pod1 can bind to E-box consensus sequences in vitro (18). Although podocytes fail to differentiate terminally beyond the capillary-loop stage in Pod1 mutant mice, nephrin is still expressed in the mutant podocytes. These results demonstrate that Pod1 is not required to activate transcription of the nephrin gene (28; data not shown).
Lenkkeri et al. (17) reported promoter deletion mutations
in two patients with Finnish nephropathy. These occurred in the GA
repeat sequence between bp
292 to
327 of the proximal promoter. One
of these patients presented with an atypical course and did not require
renal transplantation until age 5 yr (17). It will be of
interest to determine whether mutations in this region affect expression of our transgene.
We have identified and begun to characterize the first glomerular-specific and podocyte-specific promoter. Identification and characterization of cis-acting elements in this promoter fragment will be useful to identify transcription factors required for podocyte-specific expression. Use of this transgene will allow genetic manipulation of the podocyte in vivo, characterization of its biological role in renal function and disease, and ultimately, testing of the hypothesis that the podocyte plays a pivotal role in the progression of renal injury toward glomerulosclerosis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Johanne Pellerin and Lois Schwartz for expert technical assistance.
| |
FOOTNOTES |
|---|
S. E. Quaggin is the recipient of a Clinician Scientist Award from the Medical Research Council of Canada, the Carl Gottschalk Scholar Award from the American Society for Nephrology, and is a Canadian Foundation for Innovation Researcher. This work was supported by a Medical Research Council of Canada grant to S. E. Quaggin.
Address for reprint requests and other correspondence: S. E. Quaggin (E-mail: quaggin{at}mshri.on.ca).
1 The nucleotide sequence for the human chromosome 19 cosmid can be accessed through the National Center for Biotechnology Information (NCBI) nucleotide database www.ncbi.nlm.nih.gov under NCBI accession no. AC002133.
2 The nucleotide sequence for the murine nephrin cDNA can be accessed through the NCBI nucleotide database under NCBI accession no. AF168466.
3 The TRANSFAC transcription factor site database can be accessed on: http://transfac.gbf.de/TRANSFAC (9).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 15 May 2000; accepted in final form 18 August 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abrass, CK.
The nature of chronic progressive nephropathy in aging rats.
Adv Ren Replace Ther
7:
4-10,
2000[ISI][Medline].
2.
Barisoni, L,
Kriz W,
Mundel P,
and
D'Agati V.
The dysregulated podocyte phenotype: a novel concept in the pathogenesis of collapsing idiopathic focal segmental glomerulosclerosis and HIV-associated nephropathy.
J Am Soc Nephrol
10:
51-61,
1999
3.
Coimbra, TM,
Janssen U,
Grone HJ,
Ostendorf T,
Kunter U,
Schmidt H,
Brabant G,
and
Floege J.
Early events leading to renal injury in obese zucker (fatty) rats with type II diabetes.
Kidney Int
57:
167-182,
2000[ISI][Medline].
4.
D'Agati, V.
The many masks of focal segmental glomerulosclerosis.
Kidney Int
46:
1223-1241,
1994[ISI][Medline].
5.
Dehbi, M,
Ghahremani M,
Lechner M,
Dressler G,
and
Pelletier J.
The paired-box transcription factor, PAX2, positively modulates expression of the Wilms' tumor suppressor gene (WT1).
Oncogene
13:
447-453,
1996[ISI][Medline].
6.
Dressler, GR,
Deutsch U,
Chowdhury K,
Nornes HO,
and
Gruss P.
Pax2, a new murine paired-box-containing gene and its expression in the developing excretory system.
Development
109:
787-795,
1990
7.
Floege, J,
Hackmann B,
Kliem V,
Kriz W,
Alpers CE,
Johnson RJ,
Kuhn KW,
Koch KM,
and
Brunkhorst R.
Age-related glomerulosclerosis and interstitial fibrosis in Milan normotensive rats: a podocyte disease.
Kidney Int
51:
230-243,
1997[ISI][Medline].
8.
Havik, B,
Ragnhildstveit E,
Lorens JB,
Saelemyr K,
Fauske O,
Knudsen LK,
and
Fjose A.
A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.
Biochem Biophys Res Commun
266:
532-541,
1999[ISI][Medline].
9.
Heinemeyer, T,
Wingender E,
Reuter I,
Hermjakob H,
Kel AE,
Kel OV,
Ignatieva EV,
Ananko EA,
Podkolodnaya OA,
Kolpakov FA,
Podkolodny NL,
and
Kolchanov NA.
Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL.
Nucleic Acids Res
26:
362-367,
1998
10.
Hogan, B,
Beddington R,
Costantini F,
and
Lacy E.
Manipulating the Mouse Embryo. Cold Spring Harbor, NY: Cold Spring Harbor, 1994.
11.
Holzman, LB,
St. John PL,
Kovari IA,
Verma R,
Holthofer H,
and
Abrahamson DR.
Nephrin localizes to the slit pore of the glomerular epithelial cell.
Kidney Int
56:
1481-1491,
1999[ISI][Medline].
12.
Hui, CC,
and
Joyner AL.
A mouse model of greig cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene.
Nat Genet
3:
241-246,
1993[ISI][Medline].
13.
Kestila, M,
Lenkkeri U,
Mannikko M,
Lamerdin J,
McCready P,
Putaala H,
Ruotsalainen V,
Morita T,
Nissinen M,
Herva R,
Kashtan CE,
Peltonen L,
Holmberg C,
Olsen A,
and
Tryggvason K.
Positionally cloned gene for a novel glomerular protein-nephrin-is mutated in congenital nephrotic syndrome.
Mol Cell
1:
575-582,
1998[ISI][Medline].
14.
Kihara, I,
Yaoita E,
Kawasaki K,
Yamamoto T,
Hara M,
and
Yanagihara T.
Origin of hyperplastic epithelial cells in idiopathic collapsing glomerulopathy.
Histopathology
34:
537-547,
1999[ISI][Medline].
15.
Kriz, W,
Kretzler M,
Nagata M,
Provoost AP,
Shirato I,
Uiker S,
Sakai T,
and
Lemley KV.
A frequent pathway to glomerulosclerosis: deterioration of tuft architecture-podocyte damage-segmental sclerosis.
Kidney Blood Press Res
19:
245-253,
1996[ISI][Medline].
16.
Kriz, W,
and
Lemley KV.
The role of the podocyte in glomerulosclerosis.
Curr Opin Nephrol Hypertens
8:
489-497,
1999[ISI][Medline].
17.
Lenkkeri, U,
Mannikko M,
McCready P,
Lamerdin J,
Gribouval O,
Niaudet PM,
Antignac CK,
Kashtan CE,
Homberg C,
Olsen A,
Kestila M,
and
Tryggvason K.
Structure of the gene for congenital nephrotic syndrome of the finnish type (NPHS1) and characterization of mutations.
Am J Hum Genet
64:
51-61,
1999[ISI][Medline].
18.
Lu, J,
Richardson JA,
and
Olson EN.
Capsulin: a novel bHLH transcription factor expressed in epicardial progenitors and mesenchyme of visceral organs.
Mech Dev
73:
23-32,
1998[ISI][Medline].
19.
Martin, DI,
and
Whitelaw E.
The vagaries of variegating transgenes.
Bioessays
18:
919-923,
1996[Medline].
20.
Meyer, TW,
Bennett PH,
and
Nelson RG.
Podocyte number predicts long-term urinary albumin excretion in Pima Indians with Type II diabetes and microalbuminuria.
Diabetologia
42:
1341-1344,
1999[ISI][Medline].
21.
Mundel, P,
and
Kriz W.
Structure and function of podocytes: an update.
Anat Embryol (Berl)
192:
385-397,
1995[Medline].
22.
Mundel, P,
Reiser J,
Borja AZ,
Pavenstadt H,
Davidson GR,
Kriz W,
and
Zeller R.
Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines.
Exp Cell Res
236:
248-258,
1997[ISI][Medline].
23.
Mundel, P,
Reiser J,
and
Kriz W.
Induction of differentiation in cultured rat and human podocytes.
J Am Soc Nephrol
8:
697-705,
1997[Abstract].
24.
Pagtalunan, ME,
Miller PL,
Jumping-Eagle S,
Nelson RG,
Myers BD,
Rennke HG,
Coplon NS,
Sun L,
and
Meyer TW.
Podocyte loss and progressive glomerular injury in type II diabetes.
J Clin Invest
99:
342-348,
1997[ISI][Medline].
25.
Partanen, J,
Puri MC,
Schwartz L,
Fischer KD,
Bernstein A,
and
Rossant J.
Cell autonomous functions of the receptor tyrosine kinase TIE in a late phase of angiogenic capillary growth and endothelial cell survival during murine development.
Development
122:
3013-3021,
1996[Abstract].
26.
Puri, MC,
Rossant J,
Alitalo K,
Bernstein A,
and
Partanen J.
The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells.
EMBO J
14:
5884-5891,
1995[ISI][Medline].
27.
Quaggin, SE,
Heuvel GBV,
and
Igarashi P.
Pod-1, a mesoderm-specific basic-helix-loop-helix protein expressed in mesenchymal and glomerular epithelial cells in the developing kidney.
Mech Dev
71:
37-48,
1998[ISI][Medline].
28.
Quaggin, SE,
Schwartz L,
Post M,
and
Rossant J.
The basic-helix-loop-helix protein Pod-1 is critically important for kidney and lung development.
Development
126:
5771-5783,
1999[Abstract].
29.
Robb, L,
Mifsud L,
Hartley L,
Biben C,
Copeland NG,
Gilbert DJ,
Jenkins NA,
and
Harvey RP.
Epicardin: a novel basic helix-loop-helix transcription factor gene expressed in epicardium, branchial arch myoblasts, and mesenchyme of developing lung, gut, kidney, and gonads.
Dev Dyn
213:
105-113,
1998[ISI][Medline].
30.
Ruotsalainen, V,
Ljungberg P,
Wartiovaara J,
Lenkkeri U,
Kestila M,
Jalanko H,
Holmberg C,
and
Tryggvason K.
Nephrin is specifically located at the slit diaphragm of glomerular podocytes.
Proc Natl Acad Sci USA
96:
7962-7967,
1999
31.
Schaeren-Wiemers, N,
and
Gerfin-Moser A.
A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labeled cRNA probes.
Histochemistry
100:
431-440,
1993[ISI][Medline].
32.
Shih, NY,
Li J,
Karpitskii V,
Nguyen A,
Dustin ML,
Kanagawa O,
Miner JH,
and
Shaw AS.
Congenital nephrotic syndrome in mice lacking CD2-associated protein.
Science
286:
312-315,
1999
33.
Wickelgren, I.
First components found for new kidney filter.
Science
286:
225-226,
1999
This article has been cited by other articles:
![]() |
L. Adler, E. Efrati, and I. Zelikovic Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Meier, J.-K. Park, D. Overheu, T. Kirsch, C. Lindschau, F. Gueler, M. Leitges, J. Menne, and H. Haller Deletion of Protein Kinase C-{beta} Isoform In Vivo Reduces Renal Hypertrophy but Not Albuminuria in the Streptozotocin-Induced Diabetic Mouse Model Diabetes, February 1, 2007; 56(2): 346 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. VanDeVoorde, D. Witte, J. Kogan, and J. Goebel Pierson Syndrome: A Novel Cause of Congenital Nephrotic Syndrome Pediatrics, August 1, 2006; 118(2): e501 - e505. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Benigni, C. Zoja, S. Tomasoni, M. Campana, D. Corna, C. Zanchi, E. Gagliardini, E. Garofano, D. Rottoli, T. Ito, et al. Transcriptional Regulation of Nephrin Gene by Peroxisome Proliferator-Activated Receptor-{gamma} Agonist: Molecular Mechanism of the Antiproteinuric Effect of Pioglitazone J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1624 - 1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Fenton, A. Shodeinde, and M. A. Knepper UT-A urea transporter promoter, UT-A{alpha}, targets principal cells of the renal inner medullary collecting duct Am J Physiol Renal Physiol, January 1, 2006; 290(1): F188 - F195. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cui, C. Li, M. Ema, J. Weinstein, and S. E. Quaggin Rapid Isolation of Glomeruli Coupled with Gene Expression Profiling Identifies Downstream Targets in Pod1 Knockout Mice J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3247 - 3255. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Guo, D. J. Morrison, J. D. Licht, and S. E. Quaggin WT1 Activates a Glomerular-Specific Enhancer Identified from the Human Nephrin Gene J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2851 - 2856. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gawlik and S. E. Quaggin Deciphering the Renal Code: Advances in Conditional Gene Targeting Physiology, October 1, 2004; 19(5): 245 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hoffmann, D. Podlich, B. Hahnel, W. Kriz, and N. Gretz Angiotensin II Type 1 Receptor Overexpression in Podocytes Induces Glomerulosclerosis in Transgenic Rats J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1475 - 1487. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Discenza and J. Pelletier Insights into the physiological role of WT1 from studies of genetically modified mice Physiol Genomics, February 13, 2004; 16(3): 287 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Michaud, L. I. Lemieux, M. Dube, B. C. Vanderhyden, S. J. Robertson, and C. R.J. Kennedy Focal and Segmental Glomerulosclerosis in Mice with Podocyte-Specific Expression of Mutant {alpha}-Actinin-4 J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1200 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Suzuki, T. Ito, E. Imai, M. Yamato, H. Iwatani, H. Kawachi, and M. Hori Retinoids Regulate the Repairing Process of the Podocytes in Puromycin Aminonucleoside-induced Nephrotic Rats J. Am. Soc. Nephrol., April 1, 2003; 14(4): 981 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Beltcheva, S. Kontusaari, S. Fetissov, H. Putaala, P. Kilpelainen, T. Hokfelt, and K. Tryggvason Alternatively Used Promoters and Distinct Elements Direct Tissue-Specific Expression of Nephrin J. Am. Soc. Nephrol., February 1, 2003; 14(2): 352 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Pavenstadt, W. Kriz, and M. Kretzler Cell Biology of the Glomerular Podocyte Physiol Rev, January 1, 2003; 83(1): 253 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Moeller, S. K. Sanden, A. Soofi, R. C. Wiggins, and L. B. Holzman Two Gene Fragments that Direct Podocyte-Specific Expression in Transgenic Mice J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1561 - 1567. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Quaggin A "Molecular Toolbox" for the Nephrologist J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1682 - 1685. [Full Text] [PDF] |
||||
![]() |
V. Eremina, M. A. Wong, S. Cui, L. Schwartz, and S. E. Quaggin Glomerular-Specific Gene Excision In Vivo J. Am. Soc. Nephrol., March 1, 2002; 13(3): 788 - 793. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |