AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 280: F449-F456, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Vol. 280, Issue 3, F449-F456, March 2001

Genetic deletion of COX-2 prevents increased renin expression in response to ACE inhibition

Hui-Fang Cheng1, Jun-Ling Wang1, Ming-Zhi Zhang2, Su-Wan Wang1, James. A. McKanna2, and Raymond C. Harris1

George M. O'Brien Kidney and Urologic Diseases Center and Division of Nephrology, 1 Department of Medicine and 2 Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cyclooxygenase-2 (COX-2) is expressed in macula densa (MD) and surrounding cortical thick ascending limb of the loop of Henle (cTALH) and is involved in regulation of renin production. We and others have previously found that selective COX-2 inhibitors can inhibit renal renin production (Cheng HF, Wang JL, Zhang MZ, Miyazaki Y, Ichikawa I, McKanna JA, and Harris RC. J Clin Invest 103: 953-961, 1999; Harding P, Sigmon DH, Alfie ME, Huang PL, Fishman MC, Beierwaltes WH, and Carretero OA. Hypertension 29: 297-302, 1997; Traynor TR, Smart A, Briggs JP, and Schnermann J. Am J Physiol Renal Physiol 277: F706-F710, 1999; Wang JL, Cheng HF, and Harris RC. Hypertension 34: 96-101, 1999). In the present studies, we utilized mice with genetic deletions of the COX-2 gene in order to investigate further the potential role of COX-2 in mediation of the renin-angiotensin system (RAS). Age-matched wild-type (+/+), heterozygotes (+/-), and homozygous null mice (-/-) were administered the angiotensin-converting enzyme inhibitor (ACEI), captopril, for 7 days. ACEI failed to significantly increase plasma renin activity, renal renin mRNA expression, and renal renin activity in (-/-) mice. ACEI increased the number of cells expressing immunoreactive renin in the (+/+) mice both by inducing more juxtaglomerular cells to express immunoreactive renin and by recruiting additional renin-expressing cells in the more proximal afferent arteriole. In contrast, there was minimal recruitment of renin-expressing cells in the more proximal afferent arteriole of the -/- mice. In summary, these results indicate that ACEI-mediated increases in renal renin production were defective in COX-2 knockout (K/O) mice and provide further indication that MD COX-2 is an important mediator of the renin-angiotensin system.

macula densa; juxtaglomerular; angiotensin-converting enzyme; cyclooxygenase-2


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE MACULA DENSA IS A PLAQUE of morphologically unique tubular epithelial cells localized at the distal end of the thick ascending limb of Henle (TALH) that participates in regulation of renin secretion and tubuloglomerular feedback (TGF) (10). At low flow rates (functional volume depletion), sodium concentrations of ascending loop of Henle tubular fluid fall as low as 20 meq/l. A decrease in luminal NaCl is sensed by the macula densa, which then signals the juxtaglomerular cells to increase production and secretion of renin. (21, 22). Administration of nonselective cyclooxygenase inhibitors can elicit a hyporeninemic state, and studies using an isolated perfused juxtaglomerular preparation indicated that nonsteroidal anti-inflammatory drugs' administration prevented the increases in renin release mediated by macula densa sensing of decreases in luminal NaCl (9).

There are two separate gene products with cyclooxygenase activity, cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2). The gene for COX-1, the "constitutive" cyclooxygenase, encodes a 2.7- to 2.9-kb transcript, whereas the gene for COX-2, the "inducible" cyclooxygenase, encodes a 4.5-kb transcript, which increases in response to inflammatory or mitogenic stimuli. In the kidney, COX-1 has been localized to mesangial cells, arteriolar endothelial cells, parietal epithelial cells of Bowman's capsule, and cortical and medullary collecting ducts (12, 24). There is also localized expression of COX-2 in the developing and adult kidney. In situ hybridization and immunohistochemical localization have documented that COX-2 expression is localized to two cell types in normal adult rat kidney: 1) occasional macula densa cells and surrounding cTALH cells; and 2) a subset of medullary interstitial cells near the papillary tip. No COX-2 immunoreactivity was detected in arterioles, glomeruli, cortical, or medullary collecting ducts. Immunoreactive COX-1 cannot be detected in cortical thick limb or macula densa (12, 24).

The role of COX-2 in mediating macula densa-mediated renin release has been suggested by studies demonstrating that high-renin states such as dietary salt depletion, administration of angiotensin-converting enzyme (ACE) inhibitors, administration of loop diuretics, and experimental renovascular hypertension all increased macula densa/cTALH COX-2 expression (3, 12, 15, 29, 32), and selective COX-2 inhibitors prevented increases in renin production and release in response to dietary salt restriction, ACE inhibition, and an experimental model of renovascular hypertension (3, 11, 29). Furthermore, in an isolated perfused juxtaglomerular preparation, Traynor et al. (27) demonstrated that renin release, in response to lowering the perfusate NaCl concentration, was blocked by a COX-2 selective inhibitor but not by a COX-1-selective inhibitor (27). To elucidate further the possible role of macula densa COX-2 expression in regulation of renin expression, the present studies were performed in mice with genetic deletion of functional COX-2 (4).


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and genotyping. Mice with genetic deletion of the COX-2 gene maintained on a mixed B6/129 background were originally generated by Dinchuk et al. (4), and heterozygous breeding pairs were obtained from Jackson Laboratories (Bar Harbor, ME). Mice were genotyped by PCR, and the genotype of all mice used in these studies was confirmed by Southern hybridization with a specific internal probe. For PCR, the employed primer pairs were IMR013 (CTTGGGTGGAGAGGCTATTC) and IMR014 (AGGTGAGATGACA GGAGATC) and 0IMR546 (ATCTCAGCACTGCATCCTGC) and IMR547 (CACCATAG AATCCAGTCCGG). PCR was performed for 30 cycles at 95°C for 45 s, 55°C for 60 s, and 72°C for 120 s, followed by a 10-min extension at 72°C. Because the 1.6-kb phosphoglycerate kinase neocassette replaced a genomic fragment encompassing exon 1 and surrounding introns, the neoprimers-0IMR013 and 0IMR014 amplified a 280-bp product in homozygous or heterozygous mice; while the COX-2 primers 0IMR546 and 0IMR547 generated a 922-bp product from the wild-type and heterozygous mice (Fig. 1A). For Southern analysis, DNA samples were digested with Afl II, then electrophoresed in agarose gels and transferred to nylon transfer membranes. The blots were hybridized as described (17) with an internal probe. Wild-type (+/+), heterozygous (+/-), and homozygous (-/-) knockout offspring are indicated as Fig. 1B. Age-matched male adult (6wk) COX-2 +/+, +/-, and -/- mice were maintained with or without captopril in the drinking water (400 mg/l) for 7 days.


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 1.   Genotyping of cyclooxygenase-2 (COX-2)-knockout mice. A: PCR screen. genomic DNA was amplified with primer pairs (see METHODS) 0IMR013 and 0IMR014 and 0IMR546 and 0IMR547. PCR was performed for 30 cycles at 95°C for 45 s, 55°C for 60 s, and 72°C for 120 s, followed by a 10-min extension at 72°C. A 280-bp fragment of the Neo gene was amplified in homozygous null (-/-) or heterozygote (+/-) mice, whereas the COX-2-specific primers amplified a 922-bp product from the age-matched wild-type (+/+) and +/- mice. B: Southern blotting. DNA samples were digested with Afl II, then hybridized with an internal probe. A 2.5-kb band was recognized in wild-type (+/+) mice, whereas a 9.0-kb band was recognized in (-/-) mice. C: immunoreactive COX-2 expression. A: +/+ mice without captopril; B: +/+ mice with captopril. Arrows indicate immunoreactive COX-2 expression in macula densa; C: -/- mice without captopril; D: -/- mice with captopril. Arrowheads indicate macula densa (image width = 175 µm). D: COX-2 expression in renal cortex quantification of COX-2 immunoblotting of +/+ and +/- mice with and without captopril. (n = 5/group; *P < 0.05; **P < 0.01).

RNA extraction and Northern blotting. Renal cortex RNA was extracted by the acid guanidium thiocyanate-phenol chloroform method, as described previously (3). RNA samples were electrophoresed in a denatured agarose gel and transferred to nitrocellulose membranes and hybridized with a 1.4-kb 32P-labeled cDNA fragment of rat renin (29). The membranes were then stripped and rehybridized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Immunohistochemistry. Kidneys were perfused in situ with saline containing 0.02% sodium nitrite and heparin (10 U/ml) and fixed by perfusion for renin immunohistochemistry with FLPA (3.7% formaldehyde, 1.4% lysine, 0.01 M sodium metaperiodate, 0.04 M sodium phosphate, and 1% acetic acid) and for COX-2 immunohistochemistry with GPAS (2.5% glutaraldehyde, 0.011 M sodium metaperiodate, 0.04 M sodium phosphate, 1% acetic acid, and 0.1 M NaCl) as previously described (33). The kidneys were then dehydrated with a graded series of ethanols and embedded in paraffin. Sections (4-µm thick) were mounted on glass slides and immunostained with polyclonal rabbit anti-renin antiserum (1-6,000 dilution), which is a generous gift from Prof. T. Inagami, Vanderbilt University, or with polyclonal rabbit anti-murine COX-2 anti-serum (Cayman, Ann Arbor, MI) diluted to 2.5 ng/ml. Vectastain ABC-Elite was used to localize the primary antibodies with a chromogen of oxidized diaminobenzidine, followed by a light toluidine blue counterstain.

For quantitation, renin-positive renal cortical cells were counted. Multiple sections from each kidney were counted; quantitation of renin immunoreactivity was performed by using Bioquant real color image analysis system (R&M Biometrics, Nashville, TN). Digitized color video images were adjusted to discriminate the brown diaminobenzidine reaction product, and areas were calculated as previously described (12).

Immunoblotting. Renal cortex was homogenized with radioimmunoprecipitation assay buffer and centrifuged, an aliquot was taken for protein measurement, and the rest was heated to 100°C for 5 min with sample buffer. Renal cortical microsomes were isolated as previously described (12). Equal volumes of protein were separated on 8% SDS-PAGE under reducing conditions and transferred to Immobilon-P transfer membranes (Milipore, Bedford, MA). The blots were blocked overnight with 100 mM Tris · HCl, pH 7.4, containing 5% nonfat dry milk, 3% albumin, and 0.5% Tween 20, followed by incubation for 16 h with the primary antibody. The secondary biotinylated antibody, was detected by using avidin and biotinylated horseradish peroxidase (Pierce) and exposed on film by using enhanced chemiluminescence (Amersham).

Renin activity. Blood was collected on ice at the time of death in EDTA (1 mg/ml blood). The plasma was separated and frozen at -20°C until assayed. For renal tissue renin, the kidneys were homogenized in 0.1 M Tris · HCl, pH 7.4, containing (in mM) 3.4 8-hydroxyquinolone sulfate, 0.25 EDTA, 0.1 phenylmethysulfonyl fluoride, 1.6 dimercaprol, 5 sodium tetrathionate, and 0.1% Triton X-100. The concentration of protein was determined with a bicinchoninic acid protein assay kit (Pierce, Rockford, IL). After centrifugation of the homogenate, the supernatant was incubated for 1 h with excess exogenous renin substrate (rat plasma obtained from rats nephrectomized 48 h before collection). Renin was analyzed by radioimmunoassay with an [125I]ANG I kit (New England Nuclear).

Statistical analysis. All values are presented as means ± SE. ANOVA and Bonferroni t-tests were used for statistical analysis, and differences were considered significant when P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In control +/+ mice, there was sparse cortical immunoreactive COX-2 expression in macula densa cells and surrounding cTALH. Treatment with the ACE inhibitor captopril increased expression of macula densa COX-2 expression, similar to that seen in rats (Fig. 1C) (3). In +/+ mice, captopril treatment increased renal cortical COX-2 expression 4.0 ± 0.2-fold (n = 5; P < 0.01) (Fig. 1D). In control +/- mice, renal cortical COX-2 expression was 0.66 ± 0.10 of that seen in +/+ mice, and captopril treatment led to a 2.1 ± 0.3-fold increase (n = 5; P < 0.05) (Fig. 1D). As expected, no immunoreactive COX-2 was detected in -/- mice under control conditions or in response to captopril treatment (Fig. 1C).

Renal renin mRNA was normalized with GAPDH and expressed as degree of difference from control (+/+ mice without captopril treatment). There was no significant difference in the basal level of renin mRNA among the three genotypes [1.2 ± 0.2-fold control in +/- and 1.4 ± 0.2 in -/- mice, respectively, n = 4, not significant (NS)]. In response to treatment with captopril, renin mRNA expression was significantly increased in +/+ mice (5.2 ± 0.2-fold control, n = 4, P < 0.05) and was numerically but not significantly increased in the +/- mice (3.0 ± 0.7-fold control with captopril treatment, n = 4, P = 1.5, NS) but was minimally altered in -/- mice (1.5 ± 0.2-fold control, n = 4, NS) (Fig. 2).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of captopril on renal renin mRNA expression. Animals were administered captopril (400 mg/l) in drinking water for 7 days. Renin mRNA was detected by Northern blotting and normalized to glyceraldehyde-3-phosphate dehydrogenase mRNA expression (n = 4; *P < 0.05). Inset: representative experiment. Lane 1, +/+ without captopril; lane 2, +/+ with captopril; lane 3, +/- without captopril; lane 4, +/- with captopril; lane 5, -/- without captopril; lane 6, -/- with captopril.

Plasma renin activity (PRA) was measured at the time of death (±7 days of captopril treatment). Captopril treatment significantly increased PRA in +/+ mice (10.6 ± 1.7 to 29.9 ± 6.1 ng ANG I · ml-1 · h-1, n = 5, P < 0.05) and +/- mice (5.1 ± 2.1 to 24.9 ± 5.1 ng ANG I · ml-1 · h-1, n = 5, P < 0.05) but did not lead to statistically significant increases in -/- mice (5.2 ± 0.9 to 12.6 ± 1.7 ng ANG I · ml-1 · h-1, n = 5, NS) (Fig. 3). Significant increases in renal renin activity were observed in the +/+ mice (9.3 ± 1.4 to 20.9 ± 3.0 ng ANG I · mg protein-1 · h-1, n = 5, P < 0.05), but there were no significant alterations in +/- mice (8.7 ± 1.4 to 10.3 ± 1.6 ng ANG I · mg protein-1 · h-1, n = 5, NS) or -/- mice (6.9 ± 0.5 to 8.8 ± 1.2 ng ANG I · mg protein-1 · h-1, n = 5, NS) (Fig. 4).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3.   Plasma renin activity in response to captopril treatment. Animals were treated as described in Fig. 2 (n = 5, *P < 0.05).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   Renal renin activity in response to captopril treatment. Animals were treated as described in Fig. 2. Renal renin activity was determined as described in METHODS. (n = 5, **P < 0.01).

In the absence of captopril treatment, immunoreactive renin was localized to the juxtaglomerular (JG) cells in all three groups of mice (Fig. 5A). The number of renin-expressing JG cells, as determined by the area of renin immunoreactivity normalized to the area of renal cortex, was numerically higher but not statistically significant in +/+ mice compared with -/- mice (+/+ mice: 0.972 ± 0.131; +/- mice: 1.166 ± 0.12; -/- mice: 0.565 ± 0.083 immunoreactive renin area/cortex area × 10-4; n = 4-6; NS) (Fig. 5B). The ACEI increased immunoreactive renin expression significantly in +/+ mice (4.426 ± 0.436 ir renin area/cortex area × 10-4; n = 5; P < 0.01) and +/- mice (4.012 ± 0.274 immunoreactive renin area/cortex area × 10-4n = 5, P < 0.01) but not in -/- mice (0.494 ± 0.078 immunoreactive renin area/cortex area × 10-4; n = 7; NS) (Fig. 5B). The increases in the number of cells expressing immunoreactive renin in the +/+ and +/- mice with captopril treatment were the result of more JG-expressing renin and the recruitment of additional renin-expressing cells in the more proximal afferent arteriole (Fig. 5A). In contrast, there was minimal, if any, recruitment of renin-expressing cells in the more proximal afferent arteriole of the -/- mice.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 5.   A: immunoreactive renin expression in +/+ mice without (A) or with (B) captopril; in +/- mice without (C) or with (D) captopril; and in -/- mice without (E) or with (F) captopril. Arrows in B, D, and F indicate afferent arteriole proximal to juxtaglomerular region, with evidence of renin upregulation in +/+ and +/- mice (image width = 700 µm). B: quantitative renal cortical immunoreactive renin expression in response to captopril treatment. Results are expressed as the area of renin-immunoreactive cells or cell clusters normalized for the cortical area of the fixed sections (n = 4-7, **P < 0.01).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

There is increasing evidence for a role of prostanoids derived from COX-2 in regulation of renin expression and secretion. COX-2 is selectively expressed in macula densa and surrounding cTALH, and expression increases significantly in high-renin states (3, 12, 15, 29, 32). PGE2 and PGI2 administration increase renin secretion in in vitro preparations (5, 14, 18, 30) and in primary cultures of juxtaglomerular cells (16). Inhibition of prostaglandin production with selective COX-2 inhibitors inhibits renin production and secretion (3, 11, 27, 29). The present studies determined that mice with genetic deletion of the COX-2 gene failed to increase renin expression in response to inhibition of ANG II production with an ACE inhibitor, further indicating an important role for COX-2 in regulation of renin.

In previous studies, we determined that administration of either an ACE inhibitor or an angiotensin type 1 (AT1)R antagonist to rats led to increases in cortical COX-2 expression in vivo and murine double nullizygotes for the two AT1R subtypes expressed abundant COX-2 immunoreactivity (2). In rats treated with ACE inhibitors, elevations in plasma and kidney renin were significantly inhibited by simultaneous treatment with a selective COX-2 inhibitor.

ANG II is known to inhibit renal renin production and release by a so-called "short loop feedback inhibition" (23). Administration of either ACE inhibitors or AT1 receptor antagonists results in increases in both renin mRNA and immunoreactive protein in the kidney, in the absence of any detectable alteration in intravascular volume or renal hemodynamics (1, 6, 10). Of interest, the increases in expression of renin have been shown to occur not only by an increase in the content of renin in individual juxtaglomerular cells but also by recruitment of both additional juxtaglomerular cells and more proximal afferent arteriolar cells that do not normally produce renin (6, 7). Such a change in the pattern of renin expression is seen in immature kidney (8), as well as in renovascular hypertension (26) and after adrenalectomy (25). It is of note that increased macula densa/cTALH COX-2 expression is also seen in all of these conditions (3, 13, 29, 33, 34).

Studies in chimeric mice carrying "regional" null mutation of the angiotensin type 1A (AT1a) receptor, the AT1 receptor subtype exclusively present in mouse JG cells, indicated that changes in the JG were proportional to the degree of chimerism, but the degree of JG hypertrophy/hyperplasia and the expression of renin mRNA and protein were not different in individual JG cells that did or did not express AT1a receptors. Therefore, the presence or absence of AT1 receptors on JG cells was not the determining factor of whether ANG II could regulate JG renin synthesis. (19). Our previous studies suggested an alternative or additional mechanism by which ANG II might inhibit renal renin production and release, namely, feedback inhibition of macula densa/cTALH COX-2 expression (3). The present studies provide further evidence that the increased renin expression blocking production of ANG II is dependent on COX-2 expression.

A potential limitation of these studies that must be considered is the renal abnormalities present in the COX-2-deficient mice. These mice display a postnatal renal developmental abnormality manifested by a reduction in functioning glomeruli and a significantly reduced size and development of superficial cortical (subcapsular) glomeruli (4, 17, 20). These mice ultimately develop chronic renal insufficiency secondary to progressive glomerular sclerosis, although we have not observed the extensive early mortality originally described (4, 20). For the present studies, we employed young mice (6-8 wk) that did not demonstrate severe glomerular lesions. Furthermore, we have recently determined that rats that had undergone subtotal (5/6) nephrectomy were still able to increase renal renin expression in response to administration of an ACE inhibitor (28). In addition, a recent report has indicated that COX-2-deficient mice displayed an inability to increase renal renin expression in response to dietary salt restriction (31).

In the mouse, regulation of plasma renin is dependent on limiting concentrations of angiotensinogen rather than renin. In addition, certain mice strains (e.g., 129Sv) have an additional renin gene (REN2) expressed in submandibular glands, whereas other strains (e.g., C57Bl6) do not, and all of the animals used in this study were of a mixed 129Sv/C57Bl6 background. Therefore, differences in plasma renin activity in these animals may not necessarily reflect differences in renal renin production. A more complete analysis of whether PRA can increase in (-/-) mice in response to physiological stimuli must await successful backcrossing to a REN2 strain. However, for determination of kidney renin activity, an excess of angiotensinogen was provided, so differences between wild-type and COX-2-deficient mice represent differences in the amount of active enzyme produced by REN1. For the COX-2-deficient mice, in response to exposure to the ACE inhibitor, there was a consistent lack of increase in renal renin mRNA, immunoreactive renin, and renal renin activity. The physiological significance of the relative lack of increase in renin activity in the heterozygous mice is still uncertain, because renin mRNA and immunoreactive renin did increase, albeit not to the levels seen in the wild-type mice. It is of note that both basal and captopril-stimulated renal cortical COX-2 activity were at intermediate levels in heterozygous mice compared with wild-type mice (Fig. 1D), similar to the pattern of renal renin expression.

In summary, the failure of mice with genetic deletions of COX-2 to increase renal renin expression in response to exposure to an ACE inhibitor is consistent with previous studies demonstrating that COX-2-specific inhibitors prevent macula densa-mediated increases in renin production and secretion. The determination of whether prostanoids derived from macula densa COX-2 directly interact with JG cells or act through intermediate signals and the identification of the specific prostanoids involved must await further studies.


    ACKNOWLEDGEMENTS

This work was supported by the Vanderbilt George O'Brien Kidney and Urologic Diseases Center (National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-39261) and by funds from the Department of Veterans Affairs.


    FOOTNOTES

Address for reprint requests and other correspondence: R. C. Harris, Div. of Nephrology, S 3223 MCN, Vanderbilt Univ. School of Medicine, Nashville, TN 37232 (E-mail: Ray.Harris{at}mcmail.vanderbilt.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 13 July 2000; accepted in final form 1 November 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Campbell, DJ, Lawrence AC, Towrie A, Kladis A, and Valentijn AJ. Differential regulation of angiotensin peptide levels in plasma and kidney of the rat. Hypertension 18: 763-773, 1991[Abstract/Free Full Text].

2.   Cheng, HF, Wang JL, Wang SW, McKanna JL, and Harris RC. Angiotensin converting enzyme inhibitor-mediated increases in renal renin expression are not seen in cyclooxygenase-2 knockout mice. J Am Soc Nephrol 10: 343A, 1999.

3.   Cheng, HF, Wang JL, Zhang MZ, Miyazaki Y, Ichikawa I, McKanna JA, and Harris RC. Angiotensin II attenuates renal cortical cyclooxygenase-2 expression. J Clin Invest 103: 953-961, 1999[ISI][Medline].

4.   Dinchuk, JE, Car BD, Focht RJ, Johnston JJ, Jaffee BD, Covington MB, Contel NR, Eng VM, Collins RJ, Czerniak PM, Gorry SA, and Trzaskos JM. Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II. Nature 378: 406-409, 1995[Medline].

5.   Francisco, LJ, Osborn JL, and DiBona GF. Prostaglandins in renin release during sodium deprivation. Am J Physiol Renal Fluid Electrolyte Physiol 243: F537-F542, 1982[Abstract/Free Full Text].

6.   Gomez, RA, Chevalier RL, Everett AD, Elwood JP, Peach MJ, Lynch KR, and Carey RM. Recruitment of renin gene-expressing cells in adult rat kidneys. Am J Physiol Renal Fluid Electrolyte Physiol 259: F660-F665, 1990[Abstract/Free Full Text].

7.   Gomez, RA, Lynch KR, Chevalier RL, Everett AD, Johns DW, Wilfong N, Peach MJ, and Carey RM. Renin and angiotensinogen gene expression and intrarenal renin distribution during ACE inhibition. Am J Physiol Renal Fluid Electrolyte Physiol 254: F900-F906, 1988[Abstract/Free Full Text].

8.   Gomez, RA, Lynch KR, Chevalier RL, Wilfong N, Everett A, Carey RM, and Peach MJ. Renin and angiotensinogen gene expression in maturing rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 254: F582-F587, 1988[Abstract/Free Full Text].

9.   Greenberg, SG, Lorenz JN, He XR, Schnermann JB, and Briggs JP. Effect of prostaglandin synthesis inhibition on macula densa-stimulated renin secretion. Am J Physiol Renal Fluid Electrolyte Physiol 265: F578-F583, 1993[Abstract/Free Full Text].

10.   Hackenthal, E, Paul M, Ganten D, and Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 70: 1067-1116, 1990[Free Full Text].

11.   Harding, P, Sigmon DH, Alfie ME, Huang PL, Fishman MC, Beierwaltes WH, and Carretero OA. Cyclooxygenase-2 mediates increased renal renin content induced by low-sodium diet. Hypertension 29: 297-302, 1997[Abstract/Free Full Text].

12.   Harris, RC, McKanna JA, Akai Y, Jacobson HR, Dubois RN, and Breyer MD. Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction. J Clin Invest 94: 2504-2510, 1994.

13.   Hartner, A, Goppelt-Struebe M, and Hilgers KF. Coordinate expression of cyclooxygenase-2 and renin in the rat kidney in renovascular hypertension. Hypertension 31: 201-205, 1998[Abstract/Free Full Text].

14.   Ito, S, Carretero OA, Abe K, Beierwaltes WH, and Yoshinaga K. Effect of prostanoids on renin release from rabbit afferent arterioles with and without macula densa. Kidney Int 35: 1138-1144, 1989[ISI][Medline].

15.   Jensen, BL, and Kurtz A. Differential regulation of renal cyclooxygenase mRNA by dietary salt intake. Kidney Int 52: 1242-1249, 1997[ISI][Medline].

16.   Jensen, BL, Schmid C, and Kurtz A. Prostaglandins stimulate renin secretion and renin mRNA in mouse renal juxtaglomerular cells. Am J Physiol Renal Fluid Electrolyte Physiol 271: F659-F669, 1996[Abstract/Free Full Text].

17.   Komhoff, M, Wang JL, Cheng HF, Langenbach R, McKanna JA, Harris RC, and Breyer MD. Cyclooxygenase-2-selective inhibitors impair glomerulogenesis and renal cortical development. Kidney Int 57: 414-422, 2000[ISI][Medline].

18.   Linas, SL. Role of prostaglandins in renin secretion in the isolated kidney. Am J Physiol Renal Fluid Electrolyte Physiol 246: F811-F818, 1984[Abstract/Free Full Text].

19.   Matsusaka, T, Nishimura H, Utsunomiya H, Kakuchi J, Niimura F, Inagami T, Fogo A, and Ichikawa I. Chimeric mice carrying "regional" targeted deletion of the angiotensin type 1A receptor gene. Evidence against the role for local angiotensin in the in vivo feedback regulation of renin synthesis in juxtaglomerular cells. J Clin Invest 98: 1867-1877, 1996[ISI][Medline].

20.   Morham, SG, Langenbach R, Loftin CD, Tiano HF, Vouloumanos N, Jennette JC, Mahler JF, Kluckman KD, Ledford A, Lee CA, and Smithies O. Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse. Cell 83: 473-482, 1995[ISI][Medline].

21.   Persson, AEG, Salomonsson M, Westerlund P, Greger R, Schlatter E, and Gonzalez E. Macula densa function. Kidney Int 32: S39-S44, 1991.

22.   Schlatter, E, Salomonsson M, Persson AEG, and Greger R. Macula densa cells sense luminal NaCl concentration via furosemide-sensitive Na+2C1-K+ cotransport. Pflügers Arch 414: 286-290, 1989[ISI][Medline].

23.   Shricker, K, Holmer S, Kramer BK, Riegger GA, and Kurtz A. The role of angiotensin II in the feedback control of renin gene expression. Pflügers Arch 434: 166-172, 1997[ISI][Medline].

24.   Smith, WL, and Bell TG. Immunohistochemical localization of the prostaglandin-forming cyclooxygenase in renal cortex. Am J Physiol Renal Fluid Electrolyte Physiol 235: F451-F457, 1978[Abstract/Free Full Text].

25.   Taugner, R, Hackenthal E, Helmchen U, Ganten D, Kugler P, Marin-Grez M, Nobiling R, Unger T, Lockwald I, and Keilbach R. The intrarenal renin-angiotensin-system. An immunocytochemical study on the localization of renin, angiotensinogen, converting enzyme and the angiotensins in the kidney of mouse and rat. Klin Wochenschr 60: 1218-1222, 1982[ISI][Medline].

26.   Taugner, R, Marin-Grez M, Keilbach R, Hackenthal E, and Nobiling R. Immunoreactive renin and angiotensin II in the afferent glomerular arterioles of rats with hypertension due to unilateral renal artery constriction. Histochemistry 76: 61-69, 1982[ISI][Medline].

27.   Traynor, TR, Smart A, Briggs JP, and Schnermann J. Inhibition of macula densa-stimulated renin secretion by pharmacological blockade of cyclooxygenase-2. Am J Physiol Renal Physiol 277: F706-F710, 1999[Abstract/Free Full Text].

28.  Wang JL, Cheng HF, Sheppel S, and Harris RC. The cyclooxygenase-2 inhibitor, SC58326, decreases proteinuria and retards progression of glomerulosclerosis in the rat remnant kidney. Kidney Int In Press, 2000.

29.   Wang, JL, Cheng HF, and Harris RC. Cyclooxygenase-2 inhibition decreases renin content and lowers blood pressure in a model of renovascular hypertension. Hypertension 34: 96-101, 1999[Abstract/Free Full Text].

30.   Whorton, A, Misono K, Hollifield J, Frolich JC, Inagami T, and Oates JA. Prostaglandins and renin release. I. Stimulation of renin release from rabbit renal cortical slices by PGI2. Prostaglandins 14: 1095-1104, 1977[ISI][Medline].

31.   Yang, T, Endo Y, Huang YG, Smart A, Briggs JP, and Schnermann J. Renin expression in COX-2 knockout mice on normal- or low-salt diets. Am J Physiol Renal Physiol 279: F819-F825, 2000[Abstract/Free Full Text].

32.   Yang, T, Singh I, Pham H, Sun D, Smart A, Schnermann JB, and Briggs JP. Regulation of cyclooxygenase expression in the kidney by dietary salt intake. Am J Physiol Renal Physiol 274: F481-F489, 1998[Abstract/Free Full Text].

33.   Zhang, MZ, Harris RC, and McKanna JA. Regulation of cyclooxygenase-2 (COX-2) in rat renal cortex by adrenal glucocorticoids and mineralocorticoids. Proc Natl Acad Sci USA 96: 15280-15285, 1999[Abstract/Free Full Text].

34.   Zhang, MZ, Wang JL, Cheng HF, Harris RC, and McKanna JA. Cyclooxygenase-2 in rat nephron development. Am J Physiol Renal Physiol 273: F994-F1002, 1997[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 280(3):F449-F456
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Wagner, C. de Wit, M. Gerl, A. Kurtz, and K. Hocherl
Increased expression of cyclooxygenase 2 contributes to aberrant renin production in connexin 40-deficient kidneys
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R1781 - R1786.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Matzdorf, A. Kurtz, and K. Hocherl
COX-2 activity determines the level of renin expression but is dispensable for acute upregulation of renin expression in rat kidneys
Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1782 - F1790.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Chen, S. M. Kim, M. Oppermann, R. Faulhaber-Walter, Y. Huang, D. Mizel, M. Chen, M. L. S. Lopez, L. S. Weinstein, R. A. Gomez, et al.
Regulation of renin in mice with Cre recombinase-mediated deletion of G protein Gs{alpha} in juxtaglomerular cells
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F27 - F37.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. M. Kim, L. Chen, D. Mizel, Y. G. Huang, J. P. Briggs, and J. Schnermann
Low plasma renin and reduced renin secretory responses to acute stimuli in conscious COX-2-deficient mice
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F415 - F422.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H.-F. Cheng, M.-Z. Zhang, and R. C. Harris
Nitric oxide stimulates cyclooxygenase-2 in cultured cTAL cells through a p38-dependent pathway
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1391 - F1397.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
L. J. Mullins, M. A. Bailey, and J. J. Mullins
Hypertension, Kidney, and Transgenics: A Fresh Perspective
Physiol Rev, April 1, 2006; 86(2): 709 - 746.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
R. C. Harris and M. D. Breyer
Update on Cyclooxygenase-2 Inhibitors
Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 236 - 245.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. M. Nusing, A. Treude, C. Weissenberger, B. Jensen, M. Bek, C. Wagner, S. Narumiya, and H. W. Seyberth
Dominant Role of Prostaglandin E2 EP4 Receptor in Furosemide-Induced Salt-Losing Tubulopathy: A Model for Hyperprostaglandin E Syndrome/Antenatal Bartter Syndrome
J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2354 - 2362.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T. Yang, Y. G. Huang, W. Ye, P. Hansen, J. B. Schnermann, and J. P. Briggs
Influence of genetic background and gender on hypertension and renal failure in COX-2-deficient mice
Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1125 - F1132.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
S. Fries and T. Grosser
The Cardiovascular Pharmacology of COX-2 Inhibition
Hematology, January 1, 2005; 2005(1): 445 - 451.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Kohlstedt, R. Busse, and I. Fleming
Signaling via the Angiotensin-Converting Enzyme Enhances the Expression of Cyclooxygenase-2 in Endothelial Cells
Hypertension, January 1, 2005; 45(1): 126 - 132.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Schweda, J. Klar, S. Narumiya, R. M. Nusing, and A. Kurtz
Stimulation of renin release by prostaglandin E2 is mediated by EP2 and EP4 receptors in mouse kidneys
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F427 - F433.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Paliege, D. Mizel, C. Medina, A. Pasumarthy, Y. G. Huang, S. Bachmann, J. P. Briggs, J. B. Schnermann, and T. Yang
Inhibition of nNOS expression in the macula densa by COX-2-derived prostaglandin E2
Am J Physiol Renal Physiol, July 1, 2004; 287(1): F152 - F159.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H.-F. Cheng and R. C. Harris
Cyclooxygenases, the Kidney, and Hypertension
Hypertension, March 1, 2004; 43(3): 525 - 530.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Castrop, J. Klar, C. Wagner, K. Hocherl, and A. Kurtz
General inhibition of renocortical cyclooxygenase-2 expression by the renin-angiotensin system
Am J Physiol Renal Physiol, March 1, 2003; 284(3): F518 - F524.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Hocherl, F. Dreher, H. Vitzthum, J. Kohler, and A. Kurtz
Cyclosporine A Suppresses Cyclooxygenase-2 Expression in the Rat Kidney
J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2427 - 2436.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H.-F. Cheng, S.-W. Wang, M.-Z. Zhang, J. A. McKanna, R. Breyer, and R. C. Harris
Prostaglandins that increase renin production in response to ACE inhibition are not derived from cyclooxygenase-1
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2002; 283(3): R638 - R646.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. C. Kammerl, W. Richthammer, A. Kurtz, and B. K. Kramer
Angiotensin II feedback is a regulator of renocortical renin, COX-2, and nNOS expression
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1613 - R1617.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. C. Harris and M. D. Breyer
Physiological regulation of cyclooxygenase-2 in the kidney
Am J Physiol Renal Physiol, July 1, 2001; 281(1): F1 - F11.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow