|
|
||||||||
George M. O'Brien Kidney and Urologic Diseases Center and Division of Nephrology, 1 Department of Medicine and 2 Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232
| |
ABSTRACT |
|---|
|
|
|---|
Cyclooxygenase-2 (COX-2) is
expressed in macula densa (MD) and surrounding cortical thick ascending
limb of the loop of Henle (cTALH) and is involved in regulation of
renin production. We and others have previously found that selective
COX-2 inhibitors can inhibit renal renin production (Cheng HF, Wang JL,
Zhang MZ, Miyazaki Y, Ichikawa I, McKanna JA, and Harris RC. J
Clin Invest 103: 953-961, 1999; Harding P, Sigmon DH, Alfie
ME, Huang PL, Fishman MC, Beierwaltes WH, and Carretero OA.
Hypertension 29: 297-302, 1997; Traynor TR, Smart A,
Briggs JP, and Schnermann J. Am J Physiol Renal Physiol 277:
F706-F710, 1999; Wang JL, Cheng HF, and Harris RC.
Hypertension 34: 96-101, 1999). In the present studies, we utilized mice with genetic deletions of the COX-2 gene in
order to investigate further the potential role of COX-2 in mediation
of the renin-angiotensin system (RAS). Age-matched wild-type (+/+),
heterozygotes (+/
), and homozygous null mice (
/
) were
administered the angiotensin-converting enzyme inhibitor (ACEI),
captopril, for 7 days. ACEI failed to significantly increase plasma
renin activity, renal renin mRNA expression, and renal renin activity
in (
/
) mice. ACEI increased the number of cells expressing
immunoreactive renin in the (+/+) mice both by inducing more
juxtaglomerular cells to express immunoreactive renin and by recruiting
additional renin-expressing cells in the more proximal afferent
arteriole. In contrast, there was minimal recruitment of
renin-expressing cells in the more proximal afferent arteriole of the
/
mice. In summary, these results indicate that ACEI-mediated increases in renal renin production were defective in COX-2 knockout (K/O) mice and provide further indication that MD COX-2 is an important
mediator of the renin-angiotensin system.
macula densa; juxtaglomerular; angiotensin-converting enzyme; cyclooxygenase-2
| |
INTRODUCTION |
|---|
|
|
|---|
THE MACULA DENSA IS A PLAQUE of morphologically unique tubular epithelial cells localized at the distal end of the thick ascending limb of Henle (TALH) that participates in regulation of renin secretion and tubuloglomerular feedback (TGF) (10). At low flow rates (functional volume depletion), sodium concentrations of ascending loop of Henle tubular fluid fall as low as 20 meq/l. A decrease in luminal NaCl is sensed by the macula densa, which then signals the juxtaglomerular cells to increase production and secretion of renin. (21, 22). Administration of nonselective cyclooxygenase inhibitors can elicit a hyporeninemic state, and studies using an isolated perfused juxtaglomerular preparation indicated that nonsteroidal anti-inflammatory drugs' administration prevented the increases in renin release mediated by macula densa sensing of decreases in luminal NaCl (9).
There are two separate gene products with cyclooxygenase activity, cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2). The gene for COX-1, the "constitutive" cyclooxygenase, encodes a 2.7- to 2.9-kb transcript, whereas the gene for COX-2, the "inducible" cyclooxygenase, encodes a 4.5-kb transcript, which increases in response to inflammatory or mitogenic stimuli. In the kidney, COX-1 has been localized to mesangial cells, arteriolar endothelial cells, parietal epithelial cells of Bowman's capsule, and cortical and medullary collecting ducts (12, 24). There is also localized expression of COX-2 in the developing and adult kidney. In situ hybridization and immunohistochemical localization have documented that COX-2 expression is localized to two cell types in normal adult rat kidney: 1) occasional macula densa cells and surrounding cTALH cells; and 2) a subset of medullary interstitial cells near the papillary tip. No COX-2 immunoreactivity was detected in arterioles, glomeruli, cortical, or medullary collecting ducts. Immunoreactive COX-1 cannot be detected in cortical thick limb or macula densa (12, 24).
The role of COX-2 in mediating macula densa-mediated renin release has been suggested by studies demonstrating that high-renin states such as dietary salt depletion, administration of angiotensin-converting enzyme (ACE) inhibitors, administration of loop diuretics, and experimental renovascular hypertension all increased macula densa/cTALH COX-2 expression (3, 12, 15, 29, 32), and selective COX-2 inhibitors prevented increases in renin production and release in response to dietary salt restriction, ACE inhibition, and an experimental model of renovascular hypertension (3, 11, 29). Furthermore, in an isolated perfused juxtaglomerular preparation, Traynor et al. (27) demonstrated that renin release, in response to lowering the perfusate NaCl concentration, was blocked by a COX-2 selective inhibitor but not by a COX-1-selective inhibitor (27). To elucidate further the possible role of macula densa COX-2 expression in regulation of renin expression, the present studies were performed in mice with genetic deletion of functional COX-2 (4).
| |
METHODS |
|---|
|
|
|---|
Animals and genotyping.
Mice with genetic deletion of the COX-2 gene maintained on a mixed
B6/129 background were originally generated by Dinchuk et al.
(4), and heterozygous breeding pairs were obtained from Jackson Laboratories (Bar Harbor, ME). Mice were genotyped by PCR, and
the genotype of all mice used in these studies was confirmed by
Southern hybridization with a specific internal probe. For PCR, the
employed primer pairs were IMR013 (CTTGGGTGGAGAGGCTATTC) and IMR014
(AGGTGAGATGACA GGAGATC) and 0IMR546 (ATCTCAGCACTGCATCCTGC) and IMR547
(CACCATAG AATCCAGTCCGG). PCR was performed for 30 cycles at 95°C for
45 s, 55°C for 60 s, and 72°C for 120 s, followed by
a 10-min extension at 72°C. Because the 1.6-kb phosphoglycerate kinase neocassette replaced a genomic fragment encompassing exon 1 and
surrounding introns, the neoprimers-0IMR013 and 0IMR014 amplified
a 280-bp product in homozygous or heterozygous mice; while the COX-2
primers 0IMR546 and 0IMR547 generated a 922-bp product from the
wild-type and heterozygous mice (Fig.
1A). For Southern analysis,
DNA samples were digested with Afl II, then electrophoresed
in agarose gels and transferred to nylon transfer membranes. The blots
were hybridized as described (17) with an internal probe.
Wild-type (+/+), heterozygous (+/
), and homozygous (
/
) knockout
offspring are indicated as Fig. 1B. Age-matched male adult
(6wk) COX-2 +/+, +/
, and
/
mice were maintained with or without
captopril in the drinking water (400 mg/l) for 7 days.
|
RNA extraction and Northern blotting. Renal cortex RNA was extracted by the acid guanidium thiocyanate-phenol chloroform method, as described previously (3). RNA samples were electrophoresed in a denatured agarose gel and transferred to nitrocellulose membranes and hybridized with a 1.4-kb 32P-labeled cDNA fragment of rat renin (29). The membranes were then stripped and rehybridized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Immunohistochemistry. Kidneys were perfused in situ with saline containing 0.02% sodium nitrite and heparin (10 U/ml) and fixed by perfusion for renin immunohistochemistry with FLPA (3.7% formaldehyde, 1.4% lysine, 0.01 M sodium metaperiodate, 0.04 M sodium phosphate, and 1% acetic acid) and for COX-2 immunohistochemistry with GPAS (2.5% glutaraldehyde, 0.011 M sodium metaperiodate, 0.04 M sodium phosphate, 1% acetic acid, and 0.1 M NaCl) as previously described (33). The kidneys were then dehydrated with a graded series of ethanols and embedded in paraffin. Sections (4-µm thick) were mounted on glass slides and immunostained with polyclonal rabbit anti-renin antiserum (1-6,000 dilution), which is a generous gift from Prof. T. Inagami, Vanderbilt University, or with polyclonal rabbit anti-murine COX-2 anti-serum (Cayman, Ann Arbor, MI) diluted to 2.5 ng/ml. Vectastain ABC-Elite was used to localize the primary antibodies with a chromogen of oxidized diaminobenzidine, followed by a light toluidine blue counterstain.
For quantitation, renin-positive renal cortical cells were counted. Multiple sections from each kidney were counted; quantitation of renin immunoreactivity was performed by using Bioquant real color image analysis system (R&M Biometrics, Nashville, TN). Digitized color video images were adjusted to discriminate the brown diaminobenzidine reaction product, and areas were calculated as previously described (12).Immunoblotting. Renal cortex was homogenized with radioimmunoprecipitation assay buffer and centrifuged, an aliquot was taken for protein measurement, and the rest was heated to 100°C for 5 min with sample buffer. Renal cortical microsomes were isolated as previously described (12). Equal volumes of protein were separated on 8% SDS-PAGE under reducing conditions and transferred to Immobilon-P transfer membranes (Milipore, Bedford, MA). The blots were blocked overnight with 100 mM Tris · HCl, pH 7.4, containing 5% nonfat dry milk, 3% albumin, and 0.5% Tween 20, followed by incubation for 16 h with the primary antibody. The secondary biotinylated antibody, was detected by using avidin and biotinylated horseradish peroxidase (Pierce) and exposed on film by using enhanced chemiluminescence (Amersham).
Renin activity.
Blood was collected on ice at the time of death in EDTA (1 mg/ml
blood). The plasma was separated and frozen at
20°C until assayed.
For renal tissue renin, the kidneys were homogenized in 0.1 M
Tris · HCl, pH 7.4, containing (in mM) 3.4 8-hydroxyquinolone sulfate, 0.25 EDTA, 0.1 phenylmethysulfonyl fluoride, 1.6 dimercaprol, 5 sodium tetrathionate, and 0.1% Triton X-100. The concentration of
protein was determined with a bicinchoninic acid protein assay kit
(Pierce, Rockford, IL). After centrifugation of the homogenate, the
supernatant was incubated for 1 h with excess exogenous renin substrate (rat plasma obtained from rats nephrectomized 48 h
before collection). Renin was analyzed by radioimmunoassay with an
[125I]ANG I kit (New England Nuclear).
Statistical analysis. All values are presented as means ± SE. ANOVA and Bonferroni t-tests were used for statistical analysis, and differences were considered significant when P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
In control +/+ mice, there was sparse cortical immunoreactive
COX-2 expression in macula densa cells and surrounding cTALH. Treatment
with the ACE inhibitor captopril increased expression of macula densa
COX-2 expression, similar to that seen in rats (Fig. 1C)
(3). In +/+ mice, captopril treatment increased renal cortical COX-2 expression 4.0 ± 0.2-fold (n = 5;
P < 0.01) (Fig. 1D). In control +/
mice,
renal cortical COX-2 expression was 0.66 ± 0.10 of that seen in
+/+ mice, and captopril treatment led to a 2.1 ± 0.3-fold
increase (n = 5; P < 0.05) (Fig.
1D). As expected, no immunoreactive COX-2 was detected in
/
mice under control conditions or in response to captopril
treatment (Fig. 1C).
Renal renin mRNA was normalized with GAPDH and expressed as degree of
difference from control (+/+ mice without captopril treatment). There
was no significant difference in the basal level of renin mRNA among
the three genotypes [1.2 ± 0.2-fold control in +/
and 1.4 ± 0.2 in
/
mice, respectively, n = 4, not
significant (NS)]. In response to treatment with captopril, renin mRNA
expression was significantly increased in +/+ mice (5.2 ± 0.2-fold control, n = 4, P < 0.05) and
was numerically but not significantly increased in the +/
mice
(3.0 ± 0.7-fold control with captopril treatment, n = 4, P = 1.5, NS) but was minimally
altered in
/
mice (1.5 ± 0.2-fold control, n = 4, NS) (Fig. 2).
|
Plasma renin activity (PRA) was measured at the time of death (±7 days
of captopril treatment). Captopril treatment significantly increased
PRA in +/+ mice (10.6 ± 1.7 to 29.9 ± 6.1 ng ANG
I · ml
1 · h
1,
n = 5, P < 0.05) and +/
mice
(5.1 ± 2.1 to 24.9 ± 5.1 ng ANG I · ml
1 · h
1,
n = 5, P < 0.05) but did not lead to
statistically significant increases in
/
mice (5.2 ± 0.9 to
12.6 ± 1.7 ng ANG
I · ml
1 · h
1,
n = 5, NS) (Fig. 3).
Significant increases in renal renin activity were observed in the +/+
mice (9.3 ± 1.4 to 20.9 ± 3.0 ng ANG I · mg
protein
1 · h
1, n = 5, P < 0.05), but there were no significant
alterations in +/
mice (8.7 ± 1.4 to 10.3 ± 1.6 ng ANG
I · mg protein
1 · h
1,
n = 5, NS) or
/
mice (6.9 ± 0.5 to 8.8 ± 1.2 ng ANG I · mg protein
1 · h
1, n = 5, NS) (Fig. 4).
|
|
In the absence of captopril treatment, immunoreactive renin was
localized to the juxtaglomerular (JG) cells in all three groups of mice
(Fig. 5A). The number of
renin-expressing JG cells, as determined by the area of renin
immunoreactivity normalized to the area of renal cortex, was
numerically higher but not statistically significant in +/+ mice
compared with
/
mice (+/+ mice: 0.972 ± 0.131; +/
mice:
1.166 ± 0.12;
/
mice: 0.565 ± 0.083 immunoreactive renin area/cortex area × 10
4; n = 4-6; NS) (Fig. 5B). The ACEI increased immunoreactive
renin expression significantly in +/+ mice (4.426 ± 0.436 ir
renin area/cortex area × 10
4; n = 5; P < 0.01) and +/
mice (4.012 ± 0.274 immunoreactive renin area/cortex area × 10
4 , n = 5, P < 0.01) but not in
/
mice
(0.494 ± 0.078 immunoreactive renin area/cortex area × 10
4; n = 7; NS) (Fig. 5B). The
increases in the number of cells expressing immunoreactive renin in the
+/+ and +/
mice with captopril treatment were the result of more
JG-expressing renin and the recruitment of additional renin-expressing
cells in the more proximal afferent arteriole (Fig. 5A). In
contrast, there was minimal, if any, recruitment of renin-expressing
cells in the more proximal afferent arteriole of the
/
mice.
|
| |
DISCUSSION |
|---|
|
|
|---|
There is increasing evidence for a role of prostanoids derived from COX-2 in regulation of renin expression and secretion. COX-2 is selectively expressed in macula densa and surrounding cTALH, and expression increases significantly in high-renin states (3, 12, 15, 29, 32). PGE2 and PGI2 administration increase renin secretion in in vitro preparations (5, 14, 18, 30) and in primary cultures of juxtaglomerular cells (16). Inhibition of prostaglandin production with selective COX-2 inhibitors inhibits renin production and secretion (3, 11, 27, 29). The present studies determined that mice with genetic deletion of the COX-2 gene failed to increase renin expression in response to inhibition of ANG II production with an ACE inhibitor, further indicating an important role for COX-2 in regulation of renin.
In previous studies, we determined that administration of either an ACE inhibitor or an angiotensin type 1 (AT1)R antagonist to rats led to increases in cortical COX-2 expression in vivo and murine double nullizygotes for the two AT1R subtypes expressed abundant COX-2 immunoreactivity (2). In rats treated with ACE inhibitors, elevations in plasma and kidney renin were significantly inhibited by simultaneous treatment with a selective COX-2 inhibitor.
ANG II is known to inhibit renal renin production and release by a so-called "short loop feedback inhibition" (23). Administration of either ACE inhibitors or AT1 receptor antagonists results in increases in both renin mRNA and immunoreactive protein in the kidney, in the absence of any detectable alteration in intravascular volume or renal hemodynamics (1, 6, 10). Of interest, the increases in expression of renin have been shown to occur not only by an increase in the content of renin in individual juxtaglomerular cells but also by recruitment of both additional juxtaglomerular cells and more proximal afferent arteriolar cells that do not normally produce renin (6, 7). Such a change in the pattern of renin expression is seen in immature kidney (8), as well as in renovascular hypertension (26) and after adrenalectomy (25). It is of note that increased macula densa/cTALH COX-2 expression is also seen in all of these conditions (3, 13, 29, 33, 34).
Studies in chimeric mice carrying "regional" null mutation of the angiotensin type 1A (AT1a) receptor, the AT1 receptor subtype exclusively present in mouse JG cells, indicated that changes in the JG were proportional to the degree of chimerism, but the degree of JG hypertrophy/hyperplasia and the expression of renin mRNA and protein were not different in individual JG cells that did or did not express AT1a receptors. Therefore, the presence or absence of AT1 receptors on JG cells was not the determining factor of whether ANG II could regulate JG renin synthesis. (19). Our previous studies suggested an alternative or additional mechanism by which ANG II might inhibit renal renin production and release, namely, feedback inhibition of macula densa/cTALH COX-2 expression (3). The present studies provide further evidence that the increased renin expression blocking production of ANG II is dependent on COX-2 expression.
A potential limitation of these studies that must be considered is the renal abnormalities present in the COX-2-deficient mice. These mice display a postnatal renal developmental abnormality manifested by a reduction in functioning glomeruli and a significantly reduced size and development of superficial cortical (subcapsular) glomeruli (4, 17, 20). These mice ultimately develop chronic renal insufficiency secondary to progressive glomerular sclerosis, although we have not observed the extensive early mortality originally described (4, 20). For the present studies, we employed young mice (6-8 wk) that did not demonstrate severe glomerular lesions. Furthermore, we have recently determined that rats that had undergone subtotal (5/6) nephrectomy were still able to increase renal renin expression in response to administration of an ACE inhibitor (28). In addition, a recent report has indicated that COX-2-deficient mice displayed an inability to increase renal renin expression in response to dietary salt restriction (31).
In the mouse, regulation of plasma renin is dependent on limiting
concentrations of angiotensinogen rather than renin. In addition,
certain mice strains (e.g., 129Sv) have an additional renin gene (REN2)
expressed in submandibular glands, whereas other strains (e.g., C57Bl6)
do not, and all of the animals used in this study were of a mixed
129Sv/C57Bl6 background. Therefore, differences in plasma renin
activity in these animals may not necessarily reflect differences in
renal renin production. A more complete analysis of whether PRA can
increase in (
/
) mice in response to physiological stimuli must
await successful backcrossing to a REN2 strain. However, for
determination of kidney renin activity, an excess of angiotensinogen
was provided, so differences between wild-type and COX-2-deficient mice
represent differences in the amount of active enzyme produced by REN1.
For the COX-2-deficient mice, in response to exposure to the ACE
inhibitor, there was a consistent lack of increase in renal renin mRNA,
immunoreactive renin, and renal renin activity. The physiological
significance of the relative lack of increase in renin activity in the
heterozygous mice is still uncertain, because renin mRNA and
immunoreactive renin did increase, albeit not to the levels seen in the
wild-type mice. It is of note that both basal and captopril-stimulated
renal cortical COX-2 activity were at intermediate levels in
heterozygous mice compared with wild-type mice (Fig. 1D),
similar to the pattern of renal renin expression.
In summary, the failure of mice with genetic deletions of COX-2 to increase renal renin expression in response to exposure to an ACE inhibitor is consistent with previous studies demonstrating that COX-2-specific inhibitors prevent macula densa-mediated increases in renin production and secretion. The determination of whether prostanoids derived from macula densa COX-2 directly interact with JG cells or act through intermediate signals and the identification of the specific prostanoids involved must await further studies.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by the Vanderbilt George O'Brien Kidney and Urologic Diseases Center (National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-39261) and by funds from the Department of Veterans Affairs.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: R. C. Harris, Div. of Nephrology, S 3223 MCN, Vanderbilt Univ. School of Medicine, Nashville, TN 37232 (E-mail: Ray.Harris{at}mcmail.vanderbilt.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 13 July 2000; accepted in final form 1 November 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Campbell, DJ,
Lawrence AC,
Towrie A,
Kladis A,
and
Valentijn AJ.
Differential regulation of angiotensin peptide levels in plasma and kidney of the rat.
Hypertension
18:
763-773,
1991
2.
Cheng, HF,
Wang JL,
Wang SW,
McKanna JL,
and
Harris RC.
Angiotensin converting enzyme inhibitor-mediated increases in renal renin expression are not seen in cyclooxygenase-2 knockout mice.
J Am Soc Nephrol
10:
343A,
1999.
3.
Cheng, HF,
Wang JL,
Zhang MZ,
Miyazaki Y,
Ichikawa I,
McKanna JA,
and
Harris RC.
Angiotensin II attenuates renal cortical cyclooxygenase-2 expression.
J Clin Invest
103:
953-961,
1999[ISI][Medline].
4.
Dinchuk, JE,
Car BD,
Focht RJ,
Johnston JJ,
Jaffee BD,
Covington MB,
Contel NR,
Eng VM,
Collins RJ,
Czerniak PM,
Gorry SA,
and
Trzaskos JM.
Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II.
Nature
378:
406-409,
1995[Medline].
5.
Francisco, LJ,
Osborn JL,
and
DiBona GF.
Prostaglandins in renin release during sodium deprivation.
Am J Physiol Renal Fluid Electrolyte Physiol
243:
F537-F542,
1982
6.
Gomez, RA,
Chevalier RL,
Everett AD,
Elwood JP,
Peach MJ,
Lynch KR,
and
Carey RM.
Recruitment of renin gene-expressing cells in adult rat kidneys.
Am J Physiol Renal Fluid Electrolyte Physiol
259:
F660-F665,
1990
7.
Gomez, RA,
Lynch KR,
Chevalier RL,
Everett AD,
Johns DW,
Wilfong N,
Peach MJ,
and
Carey RM.
Renin and angiotensinogen gene expression and intrarenal renin distribution during ACE inhibition.
Am J Physiol Renal Fluid Electrolyte Physiol
254:
F900-F906,
1988
8.
Gomez, RA,
Lynch KR,
Chevalier RL,
Wilfong N,
Everett A,
Carey RM,
and
Peach MJ.
Renin and angiotensinogen gene expression in maturing rat kidney.
Am J Physiol Renal Fluid Electrolyte Physiol
254:
F582-F587,
1988
9.
Greenberg, SG,
Lorenz JN,
He XR,
Schnermann JB,
and
Briggs JP.
Effect of prostaglandin synthesis inhibition on macula densa-stimulated renin secretion.
Am J Physiol Renal Fluid Electrolyte Physiol
265:
F578-F583,
1993
10.
Hackenthal, E,
Paul M,
Ganten D,
and
Taugner R.
Morphology, physiology, and molecular biology of renin secretion.
Physiol Rev
70:
1067-1116,
1990
11.
Harding, P,
Sigmon DH,
Alfie ME,
Huang PL,
Fishman MC,
Beierwaltes WH,
and
Carretero OA.
Cyclooxygenase-2 mediates increased renal renin content induced by low-sodium diet.
Hypertension
29:
297-302,
1997
12.
Harris, RC,
McKanna JA,
Akai Y,
Jacobson HR,
Dubois RN,
and
Breyer MD.
Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction.
J Clin Invest
94:
2504-2510,
1994.
13.
Hartner, A,
Goppelt-Struebe M,
and
Hilgers KF.
Coordinate expression of cyclooxygenase-2 and renin in the rat kidney in renovascular hypertension.
Hypertension
31:
201-205,
1998
14.
Ito, S,
Carretero OA,
Abe K,
Beierwaltes WH,
and
Yoshinaga K.
Effect of prostanoids on renin release from rabbit afferent arterioles with and without macula densa.
Kidney Int
35:
1138-1144,
1989[ISI][Medline].
15.
Jensen, BL,
and
Kurtz A.
Differential regulation of renal cyclooxygenase mRNA by dietary salt intake.
Kidney Int
52:
1242-1249,
1997[ISI][Medline].
16.
Jensen, BL,
Schmid C,
and
Kurtz A.
Prostaglandins stimulate renin secretion and renin mRNA in mouse renal juxtaglomerular cells.
Am J Physiol Renal Fluid Electrolyte Physiol
271:
F659-F669,
1996
17.
Komhoff, M,
Wang JL,
Cheng HF,
Langenbach R,
McKanna JA,
Harris RC,
and
Breyer MD.
Cyclooxygenase-2-selective inhibitors impair glomerulogenesis and renal cortical development.
Kidney Int
57:
414-422,
2000[ISI][Medline].
18.
Linas, SL.
Role of prostaglandins in renin secretion in the isolated kidney.
Am J Physiol Renal Fluid Electrolyte Physiol
246:
F811-F818,
1984
19.
Matsusaka, T,
Nishimura H,
Utsunomiya H,
Kakuchi J,
Niimura F,
Inagami T,
Fogo A,
and
Ichikawa I.
Chimeric mice carrying "regional" targeted deletion of the angiotensin type 1A receptor gene. Evidence against the role for local angiotensin in the in vivo feedback regulation of renin synthesis in juxtaglomerular cells.
J Clin Invest
98:
1867-1877,
1996[ISI][Medline].
20.
Morham, SG,
Langenbach R,
Loftin CD,
Tiano HF,
Vouloumanos N,
Jennette JC,
Mahler JF,
Kluckman KD,
Ledford A,
Lee CA,
and
Smithies O.
Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse.
Cell
83:
473-482,
1995[ISI][Medline].
21.
Persson, AEG,
Salomonsson M,
Westerlund P,
Greger R,
Schlatter E,
and
Gonzalez E.
Macula densa function.
Kidney Int
32:
S39-S44,
1991.
22.
Schlatter, E,
Salomonsson M,
Persson AEG,
and
Greger R.
Macula densa cells sense luminal NaCl concentration via furosemide-sensitive Na+2C1
K+ cotransport.
Pflügers Arch
414:
286-290,
1989[ISI][Medline].
23.
Shricker, K,
Holmer S,
Kramer BK,
Riegger GA,
and
Kurtz A.
The role of angiotensin II in the feedback control of renin gene expression.
Pflügers Arch
434:
166-172,
1997[ISI][Medline].
24.
Smith, WL,
and
Bell TG.
Immunohistochemical localization of the prostaglandin-forming cyclooxygenase in renal cortex.
Am J Physiol Renal Fluid Electrolyte Physiol
235:
F451-F457,
1978
25.
Taugner, R,
Hackenthal E,
Helmchen U,
Ganten D,
Kugler P,
Marin-Grez M,
Nobiling R,
Unger T,
Lockwald I,
and
Keilbach R.
The intrarenal renin-angiotensin-system. An immunocytochemical study on the localization of renin, angiotensinogen, converting enzyme and the angiotensins in the kidney of mouse and rat.
Klin Wochenschr
60:
1218-1222,
1982[ISI][Medline].
26.
Taugner, R,
Marin-Grez M,
Keilbach R,
Hackenthal E,
and
Nobiling R.
Immunoreactive renin and angiotensin II in the afferent glomerular arterioles of rats with hypertension due to unilateral renal artery constriction.
Histochemistry
76:
61-69,
1982[ISI][Medline].
27.
Traynor, TR,
Smart A,
Briggs JP,
and
Schnermann J.
Inhibition of macula densa-stimulated renin secretion by pharmacological blockade of cyclooxygenase-2.
Am J Physiol Renal Physiol
277:
F706-F710,
1999
28.
Wang JL, Cheng HF, Sheppel S, and Harris RC. The cyclooxygenase-2
inhibitor, SC58326, decreases proteinuria and retards progression of
glomerulosclerosis in the rat remnant kidney. Kidney Int In
Press, 2000.
29.
Wang, JL,
Cheng HF,
and
Harris RC.
Cyclooxygenase-2 inhibition decreases renin content and lowers blood pressure in a model of renovascular hypertension.
Hypertension
34:
96-101,
1999
30.
Whorton, A,
Misono K,
Hollifield J,
Frolich JC,
Inagami T,
and
Oates JA.
Prostaglandins and renin release. I. Stimulation of renin release from rabbit renal cortical slices by PGI2.
Prostaglandins
14:
1095-1104,
1977[ISI][Medline].
31.
Yang, T,
Endo Y,
Huang YG,
Smart A,
Briggs JP,
and
Schnermann J.
Renin expression in COX-2 knockout mice on normal- or low-salt diets.
Am J Physiol Renal Physiol
279:
F819-F825,
2000
32.
Yang, T,
Singh I,
Pham H,
Sun D,
Smart A,
Schnermann JB,
and
Briggs JP.
Regulation of cyclooxygenase expression in the kidney by dietary salt intake.
Am J Physiol Renal Physiol
274:
F481-F489,
1998
33.
Zhang, MZ,
Harris RC,
and
McKanna JA.
Regulation of cyclooxygenase-2 (COX-2) in rat renal cortex by adrenal glucocorticoids and mineralocorticoids.
Proc Natl Acad Sci USA
96:
15280-15285,
1999
34.
Zhang, MZ,
Wang JL,
Cheng HF,
Harris RC,
and
McKanna JA.
Cyclooxygenase-2 in rat nephron development.
Am J Physiol Renal Physiol
273:
F994-F1002,
1997
This article has been cited by other articles:
![]() |
C. Wagner, C. de Wit, M. Gerl, A. Kurtz, and K. Hocherl Increased expression of cyclooxygenase 2 contributes to aberrant renin production in connexin 40-deficient kidneys Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R1781 - R1786. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Matzdorf, A. Kurtz, and K. Hocherl COX-2 activity determines the level of renin expression but is dispensable for acute upregulation of renin expression in rat kidneys Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1782 - F1790. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, S. M. Kim, M. Oppermann, R. Faulhaber-Walter, Y. Huang, D. Mizel, M. Chen, M. L. S. Lopez, L. S. Weinstein, R. A. Gomez, et al. Regulation of renin in mice with Cre recombinase-mediated deletion of G protein Gs{alpha} in juxtaglomerular cells Am J Physiol Renal Physiol, January 1, 2007; 292(1): F27 - F37. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Kim, L. Chen, D. Mizel, Y. G. Huang, J. P. Briggs, and J. Schnermann Low plasma renin and reduced renin secretory responses to acute stimuli in conscious COX-2-deficient mice Am J Physiol Renal Physiol, January 1, 2007; 292(1): F415 - F422. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Cheng, M.-Z. Zhang, and R. C. Harris Nitric oxide stimulates cyclooxygenase-2 in cultured cTAL cells through a p38-dependent pathway Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1391 - F1397. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Mullins, M. A. Bailey, and J. J. Mullins Hypertension, Kidney, and Transgenics: A Fresh Perspective Physiol Rev, April 1, 2006; 86(2): 709 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Harris and M. D. Breyer Update on Cyclooxygenase-2 Inhibitors Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 236 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Nusing, A. Treude, C. Weissenberger, B. Jensen, M. Bek, C. Wagner, S. Narumiya, and H. W. Seyberth Dominant Role of Prostaglandin E2 EP4 Receptor in Furosemide-Induced Salt-Losing Tubulopathy: A Model for Hyperprostaglandin E Syndrome/Antenatal Bartter Syndrome J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2354 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yang, Y. G. Huang, W. Ye, P. Hansen, J. B. Schnermann, and J. P. Briggs Influence of genetic background and gender on hypertension and renal failure in COX-2-deficient mice Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1125 - F1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fries and T. Grosser The Cardiovascular Pharmacology of COX-2 Inhibition Hematology, January 1, 2005; 2005(1): 445 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kohlstedt, R. Busse, and I. Fleming Signaling via the Angiotensin-Converting Enzyme Enhances the Expression of Cyclooxygenase-2 in Endothelial Cells Hypertension, January 1, 2005; 45(1): 126 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Schweda, J. Klar, S. Narumiya, R. M. Nusing, and A. Kurtz Stimulation of renin release by prostaglandin E2 is mediated by EP2 and EP4 receptors in mouse kidneys Am J Physiol Renal Physiol, September 1, 2004; 287(3): F427 - F433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Paliege, D. Mizel, C. Medina, A. Pasumarthy, Y. G. Huang, S. Bachmann, J. P. Briggs, J. B. Schnermann, and T. Yang Inhibition of nNOS expression in the macula densa by COX-2-derived prostaglandin E2 Am J Physiol Renal Physiol, July 1, 2004; 287(1): F152 - F159. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Cheng and R. C. Harris Cyclooxygenases, the Kidney, and Hypertension Hypertension, March 1, 2004; 43(3): 525 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Castrop, J. Klar, C. Wagner, K. Hocherl, and A. Kurtz General inhibition of renocortical cyclooxygenase-2 expression by the renin-angiotensin system Am J Physiol Renal Physiol, March 1, 2003; 284(3): F518 - F524. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hocherl, F. Dreher, H. Vitzthum, J. Kohler, and A. Kurtz Cyclosporine A Suppresses Cyclooxygenase-2 Expression in the Rat Kidney J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2427 - 2436. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Cheng, S.-W. Wang, M.-Z. Zhang, J. A. McKanna, R. Breyer, and R. C. Harris Prostaglandins that increase renin production in response to ACE inhibition are not derived from cyclooxygenase-1 Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2002; 283(3): R638 - R646. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Kammerl, W. Richthammer, A. Kurtz, and B. K. Kramer Angiotensin II feedback is a regulator of renocortical renin, COX-2, and nNOS expression Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1613 - R1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Harris and M. D. Breyer Physiological regulation of cyclooxygenase-2 in the kidney Am J Physiol Renal Physiol, July 1, 2001; 281(1): F1 - F11. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||