AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 280: F675-F682, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (94)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Loffing, J.
Right arrow Articles by Verrey, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Loffing, J.
Right arrow Articles by Verrey, F.
Vol. 280, Issue 4, F675-F682, April 2001

Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK

Johannes Loffing2,*, Marija Zecevic1,*, Eric Féraille3, Brigitte Kaissling2, Carol Asher4, Bernard C. Rossier5, Gary L. Firestone6, David Pearce7, and François Verrey1

1 Institute of Physiology and 2 Institute of Anatomy, University of Zürich, CH-8057 Zürich; 3 Division de Néphrologie, Hôpital Cantonal Universitaire, CH-1211 Geneva; 4 Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot, Israel; 5 Institut de Pharmacologie et de Toxicologie, Université de Lausanne, CH-1005 Lausanne, Switzerland; 6 Department of Molecular and Cell Biology and The Cancer Research Laboratory, University of Califonia, Berkeley 94720; and 7 Division of Nephrology, Department of Medicine and Cellular and Molecular Pharmacology, University of California San Francisco, San Francisco, California 94143


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Aldosterone controls sodium reabsorption and potassium secretion in the aldosterone-sensitive distal nephron (ASDN). Although clearance measurements have shown that aldosterone induces these transports within 30-60 min, no early effects have been demonstrated in vivo at the level of the apical epithelial sodium channel (ENaC), the main effector of this regulation. Here we show by real-time RT-PCR and immunofluorescence that an aldosterone injection in adrenalectomized rats induces alpha -ENaC subunit expression along the entire ASDN within 2 h, whereas beta - and gamma -ENaC are constitutively expressed. In the proximal ASDN portions only, ENaC is shifted toward the apical cellular pole and the apical plasma membrane within 2 and 4 h, respectively. To address the question of whether the early aldosterone-induced serum and glucocorticoid-regulated kinase (SGK) might mediate this apical shift of ENaC, we analyzed SGK induction in vivo. Two hours after aldosterone, SGK was highly induced in all segment-specific cells of the ASDN, and its level decreased thereafter. In Xenopus laevis oocytes, SGK induced ENaC activation and surface expression by a kinase activity-dependent mechanism. In conclusion, the rapid in vivo accumulation of SGK and alpha -ENaC after aldosterone injection takes place along the entire ASDN, whereas the translocation of alpha ,beta ,gamma -ENaC to the apical plasma membrane is restricted to its proximal portions. Results from oocyte experiments suggest the hypothesis that a localized activation of SGK may play a role in the mediation of ENaC translocation.

Xenopus laevis oocytes; sodium transport; kidney; collecting duct; epithelial sodium channel; serum and glucocorticoid-regulated kinase


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

ALDOSTERONE STIMULATES Na+ reabsorption across its target epithelia, which are located in the distal part of excretory organs, such as kidney, colon, and salivary and sweat glands. The aldosterone target cells of the kidney are the segment-specific cells, which in the case of the collecting duct are also called principal cells, that form the epithelium of the aldosterone-sensitive distal nephron (ASDN) together with intercalated cells (which have no segment-specific characteristics). The ASDN includes the second half of the distal convoluted tubule (DCT2), the connecting tubule (CNT), the cortical collecting duct (CCD), and the medullary collecting duct (MCD). Na+ is reabsorbed across segment-specific cells of the ASDN by a two-step process consisting of apical influx via the epithelial Na+ channel (ENaC) and basolateral extrusion by the Na+ pump (Na-K-ATPase) (8, 17, 25, 40-42). These cells are also characterized by a high abundance of mineralocorticoid receptor and 11beta -hydroxysteroid dehydrogenase type 2 (3, 11).

The action of aldosterone has been shown to depend on transcription and translation. On the basis of studies made in model epithelia, its effect has been operationally divided into three major phases: a lag period of 20-60 min, followed by an early phase of Na+ transport increase mediated by aldosterone-induced regulatory proteins acting on the preexisting transport machinery (39), and a late/very late phase starting ~3 h after hormone addition, during which a further increase in transport activity correlates with an increase in channels, pumps, and other elements of the transport machinery (34, 42). Early effects of aldosterone, as early as in in vitro models, have been observed in vivo on renal Na+ and K+ excretion in adrenalectomized (Adx) animals and on the activity/number of Na-K-ATPase in isolated CCDs (4, 9, 16, 19).

No early aldosterone effects have been documented in vivo at the level of ENaC as yet, although Na+ influx through this channel represents the major limiting step in Na+ reabsorption (17). Functionally, the number of active ENaCs was shown to be extremely low in the apical plasma membrane of isolated CCDs from animals on a standard laboratory diet. This number was drastically increased by a long-term, low-salt diet, which also induced an increase in circulating aldosterone (31). A similar treatment was recently shown to induce a shift of the three ENaC subunits from an intracellular localization toward the apical surface of segment-specific cells of the distal nephron (25, 27).

As yet, two gene products, K-Ras2 and serum and glucocorticoid-regulated kinase (SGK), which are potential mediators of the early stimulatory action of aldosterone on ENaC function in vivo, have been isolated (6, 17, 28, 30, 36 ). Both are rapidly regulated by aldosterone and have been shown to activate coexpressed ENaC in the Xenopus laevis oocyte expression system and, in the case of K-Ras2, in A6 cell epithelia (6, 28, 30, 38). The effect of SGK on ENaC-mediated Na+ transport in X. laevis oocytes was recently shown to depend on an intact SGK kinase site (21) and to be caused by an increase in channel surface expression (1).

SGK is a serine/threonine kinase known to be expressed in several tissues (43, 45). Its physiological target(s) likely includes ENaC; other targets are not yet known. The activity of SGK has been shown to depend on its own phosphorylation, for instance, by PDK1, a phosphatidylinositol-3-phosphate-dependent kinase (20, 32).

SGK was shown to be induced very rapidly and strongly at the mRNA and protein levels by dexamethasone or aldosterone in A6 epithelia (6). In the kidney of Adx rats, in situ hybridizations indicated that SGK mRNA is induced within 4 h by aldosterone in structures that probably correspond to the collecting system (6). This in vivo induction has been corroborated by in vitro studies on rabbit CCD primary cell cultures showing a rapid SGK mRNA induction by both mineralocorticoid receptor- and glucocorticoid receptor-specific agonists (30).

In the present study we perfomed in vivo (rat kidney) and in vitro (X. laevis oocytes) studies to localize alpha -ENaC and SGK induction by aldosterone in kidney tubules and address the question of how their induction might relate to ENaC surface expression.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals for tubule dissection and kidney morphology. Adult male Adx Wistar rats, with a body weight of 180-200 g, were purchased from Iffa Credo (l'Arbresle, France) and kept on a normal diet and water supplemented with 9 g/l NaCl. Aldosterone was injected subcutaneously (50 µg/100 g) 1 wk after adrenalectomy. The animals were anesthetized with thiopental (10 mg/100 g body wt ip) or pentobarbital sodium (5 mg/100 g body wt ip).

Preparation of rat tubule RNA. Single proximal convoluted tubules (PT) and CCDs (1-2 mm each) were isolated by microdissection as described previously (12) and frozen in groups of two or three at -80°C. Yeast tRNA (10 µg; Fluka, Buchs, Switzerland) was added to the tubules with 500 µl TRIzol Reagent (GIBCO-BRL), and RNA was extracted according to the manufacturer's protocol. RNA was resuspended in H2O at a concentration of 0.1 µg/µl and 1/100 of the input RNA (corresponding to 9-24 cells) was reverse transcribed for each real-time PCR reaction.

Real-time RT-PCR. RNA was first reverse transcribed with MultiScribe reverse transcriptase (PE Applied Biosystems, Foster City, CA) according to the manufacturer's instructions by using 2.5 µM random hexamers (with tissue RNA) or oligo (dT)16 (with tubule RNA) for priming and a total RNA concentration of 10 ng/µl. Fluorescence changes during real- time quantitative PCR were measured with an ABI Prism 7700 sequence detector (PE Biosystems). All reactions were performed by using the TaqMan PCR kit according the manufacturer's recommendation (PE Biosystems). The PCR primers used were the following: 5'-GCCAGGATAGAGCCACCAATC (actin); 3'-ACTGCCCTGGCTCCTAGCA (actin); 5'-GAGGGAGCGCTGCTTCCT (SGK); 3'-ACCCAAGGCACTGGCTATTTC (SGK); 5'-CAGGGTGATGGTGCATGGT (alpha -ENaC); 3'-CCACGCCAGGCCTCAAG (alpha -ENaC); 5'-CATAATCCTAGCCTGTCTGTTTGGA (beta -ENaC); 3'-CAGTTGCCATAATCAGGGTAGAAGA (beta -ENaC); 5'-TGCAAGCAATCCTGTAGCTTTAAG (gamma -ENaC); and 3'-GAAGCCTCAGACGGCCATT (gamma -ENaC). The fluorescent oligonucleotide probes that hybridize to the template between the PCR primers were covalently labeled at their 5' ends with the reporter dye 6-carboxyfluorescin (FAM) and at their 3' ends via a linker arm with the quencher 6-carboxytetramethylrhodamine (TAMRA; PE Biosystems). These probes were for actin (CCATGAAGATCAAGATCATTGCTCCTCCT); SGK (CCCCGTGCTCGCTTCTACGCA); alpha -ENaC (TGAAGCCACCATCATCCATAAAGGCAG); beta -ENaC (CCCTGCAGTCATCGGAACTTCACACCT); and gamma -ENaC (AATGGACACTGACCACCAGCTTGGC). Standard curves were generated by using rat colon total RNA as template. The detection limit for actin, SGK, alpha -ENaC, and beta -ENaC was <80 pg of the RNA. The ratio of the different signals to that of actin was calculated for every sample. The results obtained for the different test conditions are given normalized to the control values (fractional change in mRNA × expression, relative to actin). The validity of the method was verified by comparing the results obtained by real-time RT-PCR with those obtained by Northern blotting on the same tissue RNA samples (r = 0.904, data not shown).

Immunohistochemistry on kidney sections. Two and four hours after injection of vehicle (2 Adx rats/time point) or aldosterone (3 Adx rats/time point), kidneys were fixed by vascular perfusion and processed for immunohistochemistry as previously described (23). Serial cryosections (4-8 µm) were incubated overnight at 4°C with either a polyclonal, affinity-purified anti-SGK antiserum (dilution 1:500) or polyclonal rabbit antisera against alpha -ENaC (dilution 1:1,000), beta -ENaC (dilution 1:1,000), or gamma -ENaC (dilution 1:20,000). In some experiments, sections were coincubated with a mouse monoclonal antibody (Ab) against the vacuolar H+-ATPase (dilution 1:4). All antibodies have been characterized previously (5, 8, 18). The binding sites of the primary antibodies were revealed with a Cy3-conjugated donkey anti-rabbit IgG (Jackson Immuno Research Labs, West Grove, PA) diluted 1:1,000 and a FITC-conjugated goat anti-mouse IgG (Jackson Immuno Research Laboratories) diluted 1:40, respectively. Subsequently, the sections were processed according to routine procedures. Digitized images were acquired with a Visicam charge-coupled device camera (Visitron, Puchheim, Germany) and processed by Image-Pro Plus v3.0 software (Media Cybernetics, Silver Spring, MD). In control experiments, the primary antibodies were omitted or replaced by a non-immune rabbit serum. All control experiments yielded no immunofluorescent staining.

Criteria for cortical distal segment identification on kidney sections. The initial segments of the ASDN, DCT2, and CNT are situated in the cortical labyrinth. The "landmark" for the CNT is its close vicinity to the cortical radial vessels. The CCDs are identified in the medullary rays.

Expression in oocytes and two-electrode, voltage-clamp measurements. X. laevis ENaC cDNAs in pSDeasy with a FLAG epitope sequence (alpha - and beta -ENaCF for binding and immunofluorescence) or without (electrophysiology) were used (13, 28, 33). The vector pSDeasy/SGK has been described (6). The K130A mutation (with an alanine replacing lysine in the putative ATP binding pocket) was introduced by PCR together with a silent AflII restriction site (CTTAAG replacing CTCAAA) located 18 nucleotides downstream of the lysine-alanine mutation (nucleotide sequence GCA replacing AAA). Amplicons containing the mutations were digested with AflII and flanking enzymes (BamHI for the upstream and XbaI for the downstream fragment) and ligated into pSDeasy. PCR-amplified sequences were verified by DNA sequencing and SGK protein expression by Western blot (not shown). cDNA encoding the human ribosomal protein L28 was used as control (14). After plasmids were linearized with BglII (beta -XENaC, XSGK), AflIII (alpha - and gamma -XENaC), or XhoI (L28), capped cRNA was synthetized by using SP6 or T3 (L28) RNA polymerase, as previously described (28). XENaC subunits (0.05 ng each wt cRNA for electrophysiology or 5 ng cRNA with FLAG sequence for binding and immunofluorescence) were coinjected either alone or together with 5 ng cRNA (10 ng for binding and immunofluorescence) of SGK, SGK-K130A, or L28. Incubation of the oocytes and two-electrode voltage clamp were as previously described (28).

Iodination of M2Ab and binding assay. The iodination and binding procedures were as previously shown (28) and corresponded essentially to those described by Firsov et al. (13). The specific activity of the labeled M2 anti-FLAG monoclonal Ab (Kodak, Rochester, NY) ranged between 0.3 and 0.7 × 1018 cpm/mol, where cpm is counts/min. Background binding measured on H2O-injected oocytes amounted to 33% of the total binding on oocytes injected with ENaC cRNAs alone and was subtracted.

Immunohistochemical detection of ENaC in X. laevis oocytes. Fixation (24 h after injection with cRNA), embedding, and cryosectioning were as described previously (28). A tyramide signal amplification (TSA-Direct) kit (NEN, Boston, MA) was used for immunofluorescence according to the manufacturer's instructions, and XENaCF was detected with the M2 anti-FLAG IgG Ab as described (28). No staining was observed in experiments where the primary Ab was omitted. Sections were studied by epifluorescence.

Statistics. Data are expressed as means ± SE. The difference between control and test values was evaluated by using Student's t-test (2 tailed, unpaired, or 1 sample).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Rapid induction of alpha -ENaC by aldosterone in ASDN. To quantitate the effect of aldosterone on tubular ENaC subunit mRNAs, PTs and CCDs were microdissected from Adx rats and Adx rats that had received a single subcutaneous injection of aldosterone (50 µg/100 g) 2 h before. As shown in Fig. 1, the mRNA of alpha -ENaC was induced in CCDs by a factor of 1.92 ± 0.25 (n = 12, from 4 rats/condition), whereas those for beta - and gamma -ENaC subunits were not significantly altered. ENaC mRNA was not detected in PTs.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Real-time RT-PCR of the 3 epithelial sodium channel (ENaC) subunits on RNA extracted from microdissected cortical collecting ducts (CCDs) of adrenalectomized (ADX) rats 2 h after injection of vehicle (open bars) or aldosterone (aldo; solid bars). Values are means ± SE (n = 12, pooled from 4 animals). P < 0.005 ADX+ aldo vs. ADX.

To determine the effect of aldosterone on ENaC protein abundance and subcellular localization, ENaC subunits were disclosed by immunohistochemistry in the kidneys of Adx rats and of Adx rats 2 and 4 h after a single subcutaneous aldosterone injection (Fig. 2). In control rats, alpha -ENaC was undetectable in CCDs, whereas beta - and gamma -ENaC were readily visible in the cytoplasm of the segment-specific CCD cells. Two and four hours after aldosterone injection, the presence of alpha -ENaC was indisputable in the cytoplasm of CCD cells, indicating that aldosterone rapidly increased its abundance. The amount of immunohistochemically revealed gamma -ENaC and the subcellular localization of ENaC subunits in the CCD cells were not affected by the single aldosterone injection. The beta -ENaC signal slightly decreased after 4 h. Changes similar to those in CCD occurred in MCD (see Fig. 5B).


View larger version (93K):
[in this window]
[in a new window]
 
Fig. 2.   CCD profiles of kidneys from ADX rats and from ADX rats 2 and 4 h after aldosterone injection. Immunofluorescence with rabbit antisera against alpha -, beta -, and gamma -ENaC subunits on cryostat sections is shown. Unstained cells in the CCD epithelium are intercalated cells. Note the virtual lack for alpha -ENaC staining and the strong cytoplasmic staining for beta - and gamma -ENaC in the CCD cells of ADX rats, the strong cytoplasmic staining for alpha -ENaC 2 and 4 h after aldosterone, whereas beta -ENaC staining appear to be less strong after 4 h. Bar, ~20 µm.

Aldosterone shifts ENaC toward the apical plasma membrane in initial portions of the ASDN. Immunohistochemistry disclosed that, in the initial portions of the ASDN, aldosterone not only increased the abundance of alpha -ENaC but also profoundly affected the subcellular localization of all three ENaC subunits (Fig. 3). In Adx rats without aldosterone administration, beta - and gamma -subunits of ENaC were found in a fine granular staining pattern exclusively throughout the cytoplasm of all segment-specific cells, and alpha -ENaC was undetectable (Fig. 3). Two hours after aldosterone injection, alpha -ENaC was visible in the cytoplasm of the segment-specific cells of the CNT. At that time point, the intracellular staining for all three ENaC subunits was more condensed in the upper third of most CNT cells. At 4 h, ENaC subunits were shifted from the diffuse intracellular localization toward the apical plasma membrane. The aldosterone-induced translocation of ENaC was most obvious for alpha -ENaC and was seen predominantly in the initial ASDN (DCT2 and the early CNT). Apical labeling decreased progressively along the CNT and was absent in the CCD (Fig. 2).


View larger version (106K):
[in this window]
[in a new window]
 
Fig. 3.   Connecting tubule (CNT) profiles in kidneys from ADX rats and from ADX rats 2 and 4 h after aldosterone injection. Immunofluorescence with rabbit antisera against alpha -, beta -, and gamma -ENaC on cryostat sections is shown. Unstained cells in the CNT epithelium are intercalated cells. Note the absence of staining for alpha -ENaC and the cytoplasmic fine-granular staining for beta - and gamma -ENaC in ADX rats, the condensation of beta - and gamma -ENaC in para- and supranuclear CNT cell compartments 2 h after aldosterone, and the virtual absence of staining for any subunit in the cytoplasm, but their strong appearance in the apical plasma membrane of CNT cells after 4 h. Bar, ~15 µm.

SGK is rapidly induced by aldosterone in the ASDN. Our previous in situ hybridization data suggested that, in Adx rats, aldosterone induces SGK selectively in the distal nephron (6). Now, we quantified the induction of SGK mRNA in microdissected PTs and CCDs from Adx rats by using real-time RT-PCR. Two hours after aldosterone administration, SGK was increased by a factor of 3.6 ± 0.5 in CCDs, whereas it remained unchanged in PTs (Fig. 4). These results confirm that SGK mRNA is rapidly induced by aldosterone on the mRNA level in rat CCDs.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4.   Real-time RT-PCR of serum and glucocorticoid-regulated kinase (SGK) on RNA extracted from microdissected proximal convoluted tubules (PT) and CCDs of kidneys from ADX rats 2 h after injection of vehicle (open bars) or aldosterone (solid bars). Values are means ± SE (n = 12, pooled from 4 animals). P < 0.0001 for ADX+aldo vs. ADX.

To test whether aldosterone in vivo rapidly induces SGK on the protein level as well, we performed immunohistochemistry on kidney sections from Adx rats treated as above. Consecutive cryosections from renal cortex (Fig. 5A) and medulla (Fig. 5B) were incubated with anti-SGK and anti-beta -ENaC antibodies, respectively. In untreated Adx animals, SGK was not detectable in ENaC-positive tubular profiles of kidney cortex (Fig. 5A) and medulla (Fig. 5B). In contrast, 2 h after aldosterone injection, SGK was highly abundant in all ENaC-expressing, segment-specific cells of the ASDN. Four hours after aldosterone injection, SGK protein was still visible in the ASDN, but the staining intensity had already declined. Along the entire ASDN, induced SGK was homogenously distributed throughout the cytoplasm and always extranuclearly, compatible with a cytosolic localization. SGK was not seen in intercalated cells that were identified by their strong binding to H-ATPase antibodies (Fig. 6).


View larger version (125K):
[in this window]
[in a new window]
 
Fig. 5.   Profiles of CNT (CN) in cortex (A) and of collecting duct (CD; C) in the upper third of the inner medulla (B) in kidneys from ADX rats and from ADX rats 2 and 4 h after aldosterone injection. Immunofluorescence with rabbit antisera against SGK and beta -ENaC on pairs of consecutive cryostat sections is shown. In A, note the absence of SGK staining but the strong cytoplasmic beta -ENaC-staining in CNT cells of ADX rats, the prominent cytoplasmic SGK staining, and the shift of beta -ENaC toward the apical cell pole 2 h after aldosterone, and the weak SGK staining contrasting with a prominent beta -ENaC-staining in the apical cell pole and plasma membrane of the same cells (arrows) after 4 h. Arrowheads: intercalated cells. In B, note the absence of SGK staining but the strong cytoplasmic beta -ENaC staining in CD cells of collecting duct profiles from ADX rats (C), the presence of strong cytoplasmic staining for SGK and beta -ENaC 2 h after aldosterone, and the weak staining for both SGK and beta -ENaC after 4 h. Bars, ~ 20 µm.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 6.   CNT profile in kidney of ADX rat 2 h after aldosterone injection. Double immunofluorescence on the same cryostat section with rabbit polyclonal antibody against SGK and mouse monoclonal antibody against vacuolar H+-ATPase is shown. SGK is seen only in the segment-specific CNT cells (arrows) but not in the H+-ATPase-positive intercalated cells (arrowheads). Bar, ~ 20 µm.

SGK increases ENaC activity in X. laevis oocytes by a mechanism involving its kinase activity. We and others have previously shown that SGK expression in X. laevis oocytes increases the transport activity of coexpressed ENaC (6, 30). We have now tested whether the kinase activity of X. laevis SGK might be required to mediate this effect by selectively mutating a single amino acid (K130A) known to be required for the function of its consensus kinase site (32). Although expression of wild-type SGK increased the amiloride-sensitive current fourfold, expression of the kinase-dead mutant SGK decreased it (Fig. 7A). The lack of ENaC activity upregulation by the kinase-dead SGK indicates that its kinase activity is required for this action. The twofold lower current observed in the presence of kinase-dead SGK further suggests a competition of this overexpressed mutant protein with an endogenous one (dominant negative effect). The fact that coexpression of an unrelated protein (ribosomal protein L28) did not interfere with the ENaC-mediated sodium current (data not shown) excludes the possibility that the effect of kinase-dead SGK was due to competition at the translational level.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of wild-type (wt) and kinase-dead (mut) SGK on ENaC-mediated current and ENaC surface localization in Xenopus laevis (X) oocytes. A: opposite effects of wt and mut SGK on ENaC-mediated current. Bars, means ± SE of fractional values (test/control) of 6 independent experiments, each with 3-10 oocytes/point. For wt SGK and mut SGK vs. control, P = 0.016 and <0.0001, respectively. B: binding of radioiodinated anti-Flag antibody (M2Ab) to surface-expressed epitope-tagged alpha ,beta ,gamma -ENaC. Bars, means ± SE of fractional values (test/control) of 4 independent experiments each with 12 oocytes. wt SGK vs. control, P = 0.05; mut SGK is statistically not significantly different from control. C: immunostaining with M2 anti-FLAG antibody against epitope-tagged XENaC in cryosections of oocytes. Note the weak staining in the plasma membrane of oocytes expressing XENaC alone (left) but the drastic increase in plasma membrane staining of oocytes coexpressing XENaC and wild-type SGK (middle), whereas XENaC surface staining is absent in kinase-dead mutant-expressing oocytes (right).

SGK acts on ENaC activity by increasing its surface expression in X. laevis oocytes. To test whether the functional change induced by SGK coexpression might be explained by changes in XENaC surface expression, we measured the binding of monoclonal antibodies (M2Ab) to epitope tags introduced in the extracellular loop of the alpha - and beta -ENaC subunits (Fig. 7B) (13, 28). The results of this binding experiment correlate with the functional results shown in Fig. 7A. Coexpressed SGK increased the surface binding by a factor of 3.26 ± 0.72, and kinase-dead SGK decreased it by a factor of 0.76 ± 0.12.

These observations were confirmed by immunofluorescence using the same M2Ab. Weak plasma membrane labeling was observed at the cell surface of oocytes expressing ENaC only, and ENaC was undetectable on the surface of oocytes coexpressing kinase-dead SGK with ENaC. In contrast, coexpression of wild-type SGK drastically increased the ENaC-related plasma membrane labeling (Fig. 7C).

The results of these binding and morphological experiments suggest that the opposite effects of SGK and kinase-dead SGK on the activity of coexpressed ENaC in X. laevis oocytes might be entirely mediated by a change in ENaC cell-surface expression.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Aldosterone induces alpha -ENaC accumulation and alpha ,beta ,gamma -ENaC surface expression in ASDN. Previous in vivo studies have shown that chronic elevations of plamsa aldosterone levels induce in kidney aldosterone-target epithelia an increase in alpha -ENaC subunit expression at the mRNA and protein levels. In contrast, beta - and gamma -ENaC appear to be expressed constitutively in ASDN (2, 7, 10, 22, 26, 27). The present study shows that, in kidney of Adx rats, accumulation of alpha -ENaC protein is recognizable as early as 2 h after a single aldosterone injection and remains at approximately the same level during the following 2 h. This upregulation of alpha -ENaC occurs in all segment-specific cells of the ASDN. The about twofold rise in the level of alpha -ENaC mRNA (2 h after aldosterone injection) appears small compared with the striking increase in immunofluorescence from zero in Adx rats to bright immunostaining in Adx+aldosterone rats. This suggests that, in the mammalian distal nephron, the regulation of alpha -ENaC protein abundance might also involve posttranscriptional mechanisms in addition to alpha -ENaC transcription. A previous in vitro study on A6 epithelia suggested this possibility (29).

Patch-clamp analysis has revealed that, in isolated CCDs from rats on control diet, the number of active ENaCs was very low but that it was dramatically increased in CCDs from rats on chronic dietary Na+ restriction (31). These functional data correlate with recent immunofluorescence studies in kidneys of rats and mice on prolonged low-salt diet that demonstrated a shift of ENaC from intracellular compartments toward the apical plasma membrane (25, 27). Yet, these studies were unable to disclose whether the translocation of ENaC to the apical membrane depends on the low-salt intake itself or on the diet-associated rise in plasma aldosterone. We now show that, in Adx rats on a salt-supplemented diet, aldosterone indeed causes a rapid shift of ENaC subunits to the apical plasma membrane. This translocation displays a pronounced axial heterogeneity along the ASDN. In the present conditions, it is apparent in the initial upstream portions of the ASDN and progressively disappears farther downstream in the CCD. A similar axial heterogeneity in the apical abundance of ENaC along the ASDN has been observed in rabbits (24) and mice on a control diet (25). However, the tubular portion with apical ENaC localization was longer after chronic dietary salt restriction than after an acute aldosterone treatment because it also included the CCDs (25). The observation of a differential translocation of ENaC along the ASDN suggests that systemic changes in aldosterone levels cannot be the sole factor for regulating aldosterone-dependent Na+ reabsorption via ENaC. It is conceivable that local factors that vary along the tubule axis must cooperate with aldosterone to promote the translocation of ENaC from an intracellular pool to the apical membrane.

Is SGK a mediator of ENaC surface expression? A recently published study (1) as well as the present study show that coexpression of SGK with ENaC increases the number of active channels at the cell surface in the X. laevis oocyte expression system. To investigate whether SGK, as a mediator of aldosterone, might promote ENaC surface expression in vivo, we visualized the localization of its expression in kidney. Aldosterone injection induced an important SGK accumulation within 2 h in all ENaC-positive segments, the level of which was already reduced after 4 h. This shows that SGK has a short half-life and suggests that it might be regulated as rapidly in mammals in vivo as previously shown in amphibian A6 cell epithelia (6). The onset of SGK accumulation apparently precedes the visible apical translocation of ENaC and also likely precedes or coincides with the physiological response observed at the level of the Na+ and K+ clearance (i.e., between 30 and 60 min after the beginning of an aldosterone treatment) (9, 19). However, the fact that the aldosterone-induced accumulation of SGK is localized to the entire ASDN stands in contrast to the limitation of ENaC translocation to a proximal part of the ASDN. The present study shows that the kinase catalytic site of SGK needs to be intact for promoting ENaC surface expression in X. laevis oocytes. This complements the notion that SGK needs to be phosphorylated to be an active kinase and that 3-phosphoinositide-dependent protein kinase 1 (PDK1) functions as an upstream kinase of SGK (32). Furthermore, recent experiments showed that inhibition of phosphoinositol 3-kinase (PI3-kinase) activity markedly reduces SGK stimulation of ENaC activity in the oocyte system. PI3-kinase inhibition also prevented both phophorylation of SGK and mineralocorticoid-induced Na+ transport in A6 cells (44). Together with these results, our study shows that SGK expression per se is not sufficient to promote ENaC surface expression in X. laevis oocytes as well as in epithelial cells. In the oocyte system, this effect of SGK is shown to depend on its own catalytic activity, and thus, phosphorylation.

Role of SGK and alpha -ENaC induction in ENaC surface expression: a hypothesis. Together, the present in vivo and in vitro data suggest the following hypothesis for the regulation of ENaC cell surface expression by aldosterone in ASDN: SGK is rapidly induced by aldosterone and, if activated, promotes the translocation of available alpha ,beta ,gamma -ENaC toward the surface. Activation of SGK requires its phosphorylation by a PDK1(-like) kinase. This phosphorylation could be controlled by an axially heterogenous mechanism that thereby restricts ENaC translocation to more or less long upstream portions of the ASDN. In the absence of aldosterone, the availability of preassembled ENaC is limited by a low level of alpha -ENaC. Hence, by inducing an upregulation of alpha ENaC, aldosterone also leads to a progressive increase in the pool of assembled alpha ,beta ,gamma -ENaC available for translocation to the surface.

Whether the translocation of the three ENaC subunits observed by immunofluorescence corresponds to a transfer of ENaC toward a subapical pool or directly to the luminal surface membrane cannot be discerned at the present resolution. Furthermore, the precise role of SGK in the context of the complex regulatory network that controls ENaC surface expression and includes protein kinase A and Nedd4 (15, 35, 37), however, remains to be elucidated. In conclusion, we show that aldosterone rapidly induces the accumulation of SGK and alpha -ENaC along the entire ENaC-expressing ASDN. We hypothesize that SGK might play an important role in the translocation of ENaC to the apical cell surface by integrating the transcriptional aldosterone action with signals that might be differentially available along the ASDN.


    ACKNOWLEDGEMENTS

The authors thank Ian Forster for assistance with the electrophysiological experiments, Christian Gasser for artwork, Lea Kläusli for technical assistance, Steven Gluck (St. Louis, MO) for providing the monoclonal anti-vacuolar H+-ATPase antibody, and Annette Audigé (Bern, Switzerland) for providing unpublished primer and probe sequences for real-time PCR measurements of the rat ENaC subunits. The laboratory of F. Verrey was supported by Swiss NSF Grants 31-49727.96 and 31-59141.99, that of B. Kaissling by Swiss NSF Grant 31-47742.96.


    FOOTNOTES

* J. Loffing and M. Zecevic contributed equally to this work.

Address for reprint requests and other correspondence: F. Verrey, Institute of Physiology, Univ. of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland (E-mail: verrey{at}physiol.unizh.ch).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 25 August 2000; accepted in final form 7 November 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alvarez de la Rosa, D, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, and Canessa CM. The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834-37839, 1999[Abstract/Free Full Text].

2.   Asher, C, Wald H, Rossier BC, and Garty H. Aldosterone-induced increase in the abundance of Na+ channel subunits. Am J Physiol Cell Physiol 271: C605-C611, 1996[Abstract/Free Full Text].

3.   Bachmann, S, Bostanjoglo M, Schmitt R, and Ellison DH. Sodium transport-related proteins in the mammalian distal nephron---distribution, ontogeny and functional aspects. Anat Embryol 200: 447-468, 1999[Medline].

4.   Barlet-Bas, C, Khadoury C, Marsy S, and Doucet A. Sodium-independent in vitro induction of Na+,K+-ATPase by aldosterone in renal target cells: permissive effect of triiodothyronine. Proc Natl Acad Sci USA 85: 1707-1711, 1988[Abstract/Free Full Text].

5.   Buse, P, Tran SH, Luther E, Phu PT, Aponte GW, and Firestone GL. Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, SGK, in mammary tumor cells---a novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274: 7253-7263, 1999[Abstract/Free Full Text].

6.   Chen, S, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514-2519, 1999[Abstract/Free Full Text].

7.   Dijkink, L, Hartog A, Deen PMT, van Os CH, and Bindels RJM Time-dependent regulation by aldosterone of the amiloride-sensitive Na+ channel in rabbit kidney. Pflügers Arch 438: 354-360, 1999[ISI][Medline].

8.   Duc, C, Farman N, Canessa CM, Bonvalet JP, and Rossier BC. Cell-specific expression of epithelial sodium channel alpha, beta, and gamma subunits in aldosterone-responsive epithelia from the rat: localization by in situ hybridization and immunocytochemistry. J Cell Biol 127: 1907-1921, 1994[Abstract/Free Full Text].

9.   El Mernissi, G, and Doucet A. Short-term effect of aldosterone on renal sodium transport and tubular Na-K-ATPase in the rat. Pflügers Arch 339: 139-146, 1983.

10.   Escoubet, B, Coureau C, Bonvalet JP, and Farman N. Noncoordinate regulation of epithelial Na channel and Na pump subunit mRNAs in kidney and colon by aldosterone. Am J Physiol Cell Physiol 272: C1482-C1491, 1997[Abstract/Free Full Text].

11.   Farman, N. Steroid receptors: distribution along the nephron. Semin Nephrol 12: 12-17, 1992[ISI][Medline].

12.   Feraille, E, Carranza ML, Buffin-Meyer B, Rousselot M, Doucet A, and Favre H. Protein kinase C-dependent stimulation of Na+-K+-ATPase in rat proximal convoluted tubules. Am J Physiol Cell Physiol 268: C1277-C1283, 1995[Abstract/Free Full Text].

13.   Firsov, D, Schild L, Gautschi I, Merillat AM, Schneeberger E, and Rossier BC. Cell surface expression of the epithelial Na channel and a mutant causing Liddle syndrome---a quantitative approach. Proc Natl Acad Sci USA 93: 15370-15375, 1996[Abstract/Free Full Text].

14.   Frigerio, JM, Dagorn JC, and Iovanna JL. Cloning, sequencing and expression of the L5, L21, L27a, L28, S5, S9, S10 and S29 human ribosomal protein mRNAs. Biochim Biophys Acta 1262: 64-68, 1995[Medline].

15.   Frindt, G, Silver RB, Windhager EE, and Palmer LG. Feedback regulation of Na channels in rat CCT. III. Response to cAMP. Am J Physiol Renal Fluid Electrolyte Physiol 268: F480-F489, 1995[Abstract/Free Full Text].

16.   Fujii, Y, Takemoto F, and Katz AI. Early effects of aldosterone on Na-K pump in rat cortical collecting tubules. Am J Physiol Renal Fluid Electrolyte Physiol 259: F40-F45, 1990[Abstract/Free Full Text].

17.   Garty, H, and Palmer LG. Epithelial sodium channels---function, structure, and regulation. Physiol Rev 77: 359-396, 1997[Abstract/Free Full Text].

18.   Hemken, P, Guo XL, Wang ZQ, Zhang K, and Gluck S. Immunologic evidence that vacuolar H+ ATPases with heterogeneous forms of Mr = 31,000 subunit have different membrane distributions in mammalian kidney. J Biol Chem 267: 9948-9957, 1992[Abstract/Free Full Text].

19.   Horisberger, JD, and Diezi J. Effects of mineralocorticoids on Na+ and K+ excretion in the adrenalectomized rat. Am J Physiol Renal Fluid Electrolyte Physiol 245: F89-F99, 1983[Abstract/Free Full Text].

20.   Kobayashi, T, and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 PDK1 and PDK2. Biochem J 339: 319-328, 1999.

21.   Lang, F, Klingel K, Wagner CA, Stegen C, Warntges S, Friedrich B, Lanzendorfer M, Melzig J, Moschen I, Steuer S, Waldegger S, Sauter M, Paulmichl M, Gerke V, Risler T, Gamba G, Capasso G, Kandolf R, Hebert SC, Massry SG, and Broer S. Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci USA 97: 8157-8162, 2000[Abstract/Free Full Text].

22.   Lingueglia, E, Renard S, Waldmann R, Voilley N, Champigny G, Plass H, Lazdunski M, and Barbry P. Different homologous subunits of the amiloride-sensitive Na+ channel are differently regulated by aldosterone. J Biol Chem 269: 13736-13739, 1994[Abstract/Free Full Text].

23.   Loffing, J, Loffing-Cueni D, Hegyi I, Kaplan MR, Hebert SC, Le Hir M, and Kaissling B. Thiazide treatment of rats provokes apoptosis in distal tubule cells. Kidney Int 50: 1180-1190, 1996[ISI][Medline].

24.   Loffing, J, Loffing-Cueni D, Macher A, Hebert SC, Olson B, Knepper MA, Rossier BC, and Kaissling B. Localization of epithelial sodium channel and aquaporin-2 in rabbit kidney cortex. Am J Physiol Renal Physiol 278: F530-F539, 2000[Abstract/Free Full Text].

25.   Loffing, J, Pietri L, Aregger F, Bloch-Faure M, Meneton P, Rossier BC, and Kaissling B. Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets. Am J Physiol Renal Physiol 279: F252-F258, 2000[Abstract/Free Full Text].

26.   MacDonald, P, MacKenzie S, Ramage LE, Seckl JR, and Brown RW. Corticosteroid regulation of amiloride-sensitive sodium-channel subunit mRNA expression in mouse kidney. J Endocrinol 165: 25-37, 2000[Abstract].

27.   Masilamani, S, Kim GH, Mitchell C, Wade JB, and Knepper MA. Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104: R19-R23, 1999[Medline].

28.   Mastroberardino, L, Spindler B, Forster I, Loffing J, Assandri R, May A, and Verrey F. Ras pathway activates epithelial Na+ channel and decreases its surface expression in Xenopus oocytes. Mol Biol Cell 9: 3417-3427, 1998[Abstract/Free Full Text].

29.   May, A, Puoti A, Gaeggeler HP, Horisberger JD, and Rossier BC. Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells. J Am Soc Nephrol 8: 1813-1822, 1997[Abstract].

30.   Naray-Fejes-Toth, A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. Sgk is an aldosterone-induced kinase in the renal collecting duct---effects on epithelial Na+ channels. J Biol Chem 274: 16973-16978, 1999[Abstract/Free Full Text].

31.   Pacha, J, Frindt G, Antonian L, Silver RB, and Palmer LG. Regulation of Na channels of the rat cortical collecting tubule by aldosterone. J Gen Physiol 102: 25-42, 1993[Abstract/Free Full Text].

32.   Park, J, Leong ML, Buse P, Maiyar AC, Firestone GL, and Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024-3033, 1999[ISI][Medline].

33.   Puoti, A, May A, Canessa CM, Horisberger JD, Schild L, and Rossier BC. The highly selective low-conductance epithelial Na channel of Xenopus laevis A6 kidney cells. Am J Physiol Cell Physiol 269: C188-C197, 1995[Abstract/Free Full Text].

34.   Rachamim, N, Latter H, Malinin N, Asher C, Wald H, and Garty H. Dexamethasone enhances expression of mitochondrial oxidative phosphorylation genes in rat distal colon. Am J Physiol Cell Physiol 269: C1305-C1310, 1995[Abstract/Free Full Text].

35.   Schafer, JA, and Hawk CT. Regulation of Na+ channels in the cortical collecting duct by AVP and mineralocorticoids. Kidney Int 41: 255-268, 1992[ISI][Medline].

36.   Spindler, B, Mastroberardino L, Custer M, and Verrey F. Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434: 323-331, 1997[ISI][Medline].

37.   Staub, O, Abriel H, Plant P, Ishikawa T, Kanelis V, Saleki R, Horisberger JD, Schild L, and Rotin D. Regulation of the epithelial Na+ channel by Nedd4 and ubiquitination. Kidney Int 57: 809-815, 2000[ISI][Medline].

38.   Stockand, JD, Spier BJ, Worrell RT, Yue G, Al-Baldawi N, and Eaton DC. Regulation of Na+ reabsorption by the aldosterone-induced small G protein K-Ras2A. J Biol Chem 274: 35449-35454, 1999[Abstract/Free Full Text].

39.   Verrey, F. Early aldosterone action: toward filling the gap between transcription and transport. Am J Physiol Renal Physiol 277: F319-F327, 1999[Abstract/Free Full Text].

40.   Verrey, F. Transcriptional control of sodium transport in tight epithelia by adrenal steroids. J Membr Biol 144: 93-110, 1995[ISI][Medline].

41.   Verrey, F, Beron J, and Spindler B. Corticosteroid regulation of renal Na,K-ATPase. Miner Electrolyte Metab 22: 279-292, 1996[ISI][Medline].

42.   Verrey, F, Hummler E, Schild L, and Rossier BC. Control of Na+ transport by aldosterone. In: The Kidney: Physiology and Pathophysiology (3rd ed.), edited by Seldin DW, and Giebiesch G.. New York: Lippincott, Williams & Wilkins, 2000.

43.   Waldegger, S, Barth P, Raber G, and Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440-4445, 1997[Abstract/Free Full Text].

44.   Wang, J, Barbry P, Maiyar AC, Rozansky DJ, Bhargava A, Leong M, Firestone GL, and Pearce D. SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. Am J Physiol Renal Physiol 280: F303-F313, 2001[Abstract/Free Full Text].

45.   Webster, MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031-2040, 1993[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 280(4):F675-F682
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Estilo, W. Liu, N. Pastor-Soler, P. Mitchell, M. D. Carattino, T. R. Kleyman, and L. M. Satlin
Effect of aldosterone on BK channel expression in mammalian cortical collecting duct
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F780 - F788.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Fejes-Toth, G. Frindt, A. Naray-Fejes-Toth, and L. G. Palmer
Epithelial Na+ channel activation and processing in mice lacking SGK1
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1298 - F1305.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Physiol.Home page
G. Frindt, Z. Ergonul, and L. G. Palmer
Surface Expression of Epithelial Na Channel Protein in Rat Kidney
J. Gen. Physiol., May 26, 2008; 131(6): 617 - 627.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. S. Raikwar and C. P. Thomas
Nedd4-2 isoforms ubiquitinate individual epithelial sodium channel subunits and reduce surface expression and function of the epithelial sodium channel
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1157 - F1165.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Taruno, N. Niisato, and Y. Marunaka
Intracellular calcium plays a role as the second messenger of hypotonic stress in gene regulation of SGK1 and ENaC in renal epithelial A6 cells
Am J Physiol Renal Physiol, January 1, 2008; 294(1): F177 - F186.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Li, C. S. Wingo, and S.-L. Xia
Downregulation of SGK1 by nucleotides in renal tubular epithelial cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1751 - F1757.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. P. Hughey and T. R. Kleyman
Functional cross talk between ENaC and pendrin
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1439 - F1440.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. A. Martel, D. Michael, G. Fejes-Toth, and A. Naray-Fejes-Toth
Melanophilin, a novel aldosterone-induced gene in mouse cortical collecting duct cells
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F904 - F913.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Li, W. Wang, R. Norregaard, M. A. Knepper, S. Nielsen, and J. Frokiaer
Altered expression of epithelial sodium channel in rats with bilateral or unilateral ureteral obstruction
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F333 - F341.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. Cordas, A. Naray-Fejes-Toth, and G. Fejes-Toth
Subcellular location of serum- and glucocorticoid-induced kinase-1 in renal and mammary epithelial cells
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1971 - C1981.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. Fakitsas, G. Adam, D. Daidie, M. X. van Bemmelen, F. Fouladkou, A. Patrignani, U. Wagner, R. Warth, S. M.R. Camargo, O. Staub, et al.
Early Aldosterone-Induced Gene Product Regulates the Epithelial Sodium Channel by Deubiquitylation
J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1084 - 1092.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C.-T. Chang, M.-S. Wu, Y.-C. Tian, K.-H. Chen, C.-C. Yu, C.-H. Liao, C.-C. Hung, and C.-W. Yang
Enhancement of epithelial sodium channel expression in renal cortical collecting ducts cells by advanced glycation end products
Nephrol. Dial. Transplant., March 1, 2007; 22(3): 722 - 731.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. G. Fuster, I. A.