AJP - Renal Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 281: F91-F102, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yusufi, A. N. K.
Right arrow Articles by Grande, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yusufi, A. N. K.
Right arrow Articles by Grande, J. P.
Vol. 281, Issue 1, F91-F102, July 2001

cADP-ribose/ryanodine channel/Ca2+-release signal transduction pathway in mesangial cells

Ahad N. K. Yusufi1, Jingfei Cheng1, Michael A. Thompson1, Thomas P. Dousa1, Gina M. Warner2, Henry J. Walker1, and Joseph P. Grande2

1 Renal Pathophysiology Laboratory, Department of Physiology and Biophysics and 2 Division of Nephrology, Department of Medicine, Mayo Clinic, Mayo Medical School, Rochester, Minnesota 55905


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Signaling via release of Ca2+ from intracellular stores is mediated by several systems, including the inositol 1,4,5-trisphosphate (IP3) and cADP-ribose (cADPR) pathway. We recently discovered a high capacity for cADPR synthesis in rat glomeruli and cultured mesangial cells (MC). We sought to determine whether 1) cADPR synthesis in MC is regulated by cytokines and hormones, 2) ryanodine receptors (RyRs) are expressed in MC, and 3) Ca2+ is released through RyRs in response to cADPR. We found that ADP-ribosyl cyclase, a CD38-like enzyme that catalyzes cADPR synthesis, is upregulated in MC by tumor necrosis factor-alpha , interleukin-1beta , and all-trans retinoic acid (atRA). [3H]ryanodine binds to microsomal fractions from MC with high affinity in a Ca2+-dependent manner; binding is enhanced by specific RyR agonists and blocked by ruthenium red and cADPR. Western blot analysis confirmed the presence of RyR in MC. Release of 45Ca2+ from MC microsomes was stimulated by cADPR; release was blocked by ruthenium red and 8-bromo-cADPR. ADPR (non-cyclic) was without effect. In MC, TNF-alpha and atRA amplified the increment of cytoplasmic Ca2+ elicited by vasopressin. We conclude that MC possess elements of a novel ADP-ribosyl cyclaseright-arrowcADPRright-arrowRyRright-arrowCa2+-release signaling pathway subject to regulation by proinflammatory cytokines and steroid superfamily hormones.

cytokines; retinoids; calcium-induced calcium release; adenosine 5'-diphosphate-ribosyl cyclase; crosstalk


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

RELEASE OF CALCIUM FROM INTRACELLULAR stores, endoplasmic/sarcoplasmic reticulum (ER/SR), is one of the key signal transduction mechanisms that play a pivotal role in the regulation of numerous cellular functions (5). There are two major systems for Ca2+ release from intracellular stores (46). Widespread, and probably ubiquitous (45, 26), is a signaling system (6) mediated by the second messenger, inositol 1,4,5-trisphosphate (IP3). In this system, fast-onset, short-acting hormones such as vasoactive peptides bind receptors that are coupled within the plasma membrane to phosphatidylinositol phospholipase C (PI-PLC). This enzyme catalyzes generations of IP3; de novo generated IP3 binds the IP3 receptor channel (IP3Rs) that opens and releases Ca2+ from the ER/SR into the cytoplasm (6).

Another route for Ca2+ release from the ER/SR is through the ryanodine receptor channel (RyRs). This channel is activated by Ca2+ itself (19, 40), and is so named the Ca2+-induced Ca2+ release (CICR) pathway (19). cADP-ribose (cADPR), a novel second messenger, is synthesized from beta -NAD by the enzyme, ADP-ribosyl cyclase (40). cADPR increases sensitivity of RyR to Ca2+ and thereby regulates Ca2+ release through RyRs via the CICR mechanism (19, 40). In our recent studies (11, 17, 3), we discovered that ADP-ribosyl cyclase is upregulated in various tissues and cell types by hormones of the steroid superfamily such as beta -estradiol (11), 3,5,3'-triiodothyronine (17), or all-trans retinoic acid (atRA) (17, 3), which act with a slow onset and have a prolonged effect. Furthermore, RyRs can be activated or blocked by various specific pharmacological agonists and antagonists (70).

In contrast to the ubiquitous IP3Rs (46, 45), RyRs have a more limited tissue distribution (4). Furthermore, the expression of RyRs and IP3Rs is regulated independently, and often in opposing directions. For example, incubation of cells with the cytokine transforming growth factor-beta 1 (TGF-beta 1) enhances expression of RyRs (25, 2) but suppresses expression of IP3Rs (59). Stimulation of muscarinic receptors reduces abundance of IP3Rs without having an effect on expression of RyRs; conversely, incubation in a differentiating medium markedly increases expression of RyRs, but not of IP3Rs (45). In end-stage heart failure, RyRs are downregulated in left ventricular myocardium, whereas IP3Rs are upregulated (27).

Mesangial cells (MC), specialized pericytes in glomeruli, are essential for maintenance and regulation of glomerular functions (8, 58, 60). In addition, MC are prime targets of immunoinflammatory injury in various types of glomerulonephritis (1, 58). Contractility and other MC functions are regulated, in major part, by Ca2+ released from ER/SR (1, 8, 58, 60). Numerous vasoactive peptides, bioactive lipids, and biogenic amines modulate MC functions by binding to requisite receptors in the plasma membrane and act via the IP3-Ca2+-release pathway (1). A recent immunohistochemical study documented the presence of IP3Rs in MC (52).

Although the IP3-Ca2+-release signaling system has been well characterized in MC (1, 8, 58, 60), much less is known about the cADPRright-arrowRyRright-arrowCa2+ signaling system. In particular, it is not known whether RyRs are expressed or play a functionally significant role in cADPR-elicited Ca2+ release in MC. In our recent study examining cADPR metabolism in the rat kidney (13), we found a strikingly high capacity for cADPR synthesis in isolated glomeruli, 50 times higher than in the rest of the examined renal parenchyma (13). We also identified ADP-ribosyl cyclase activity in cultured MC. As mentioned, in studies of nonrenal tissues we determined that ADP-ribosyl cyclase is regulated by long-acting hormones (11, 17, 3).

In view of all these considerations, we now set out to determine whether 1) ADP-ribosyl cyclase in MC is modulated by proinflammatory cytokines and by hormonal agents that act with slow onset and have prolonged action; 2) RyRs are expressed in MC and to what extent; and 3) Ca2+ is released through RyRs in response to a natural second messenger, cADPR (19, 40), and to typical pharmacological agonists of RyRs (70).


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

[3H]ryanodine and 45Ca2+ were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). cADPR, 8-bromo-cADPR (8-Br-cADPR), ADPR, bastadin (bastadin mixture no. 196710), ruthenium red, and lipopolysaccharide (LPS, Pseudomonas aeruginosa; F-D type 1) were purchased from Calbiochem (La Jolla, CA). 4-Cloromethyl-m-cresol (4-CmC), 4-chloro-3-ethyl phenol (4-CEP), and caffeine were from Aldrich (Milwaukee, WI). Monoclonal antibodies (MAb) directed against ryanodine receptors, MA3-925 MAb (34C) and MA3-916 MAb (C3-33), were purchased from Affinity Bioreagents (Golden, CO). Recombinant human tumor necrosis factor-alpha (TNF-alpha ), interleukin-1beta (IL-1beta ), and atRA were from Biomol Research Laboratories (Plymouth Meeting, PA). Nicotinamide guanine dinucleotide (NGD), cGDP-ribose (cGDPR), 3,5,3'-triiodothyronine (T3), and all other chemicals and biochemicals, all of highest purity grades, were from Sigma (St. Louis, MO) or other standard suppliers.

MC. Glomeruli were isolated from 200-g male Sprague-Dawley rats by differential sieving, as previously described (10, 13, 49). Cell outgrowths were characterized as MC by positive immunohistochemical staining for vimentin, smooth muscle-specific actin, and desmin; stains for high- and low-molecular-weight cytokeratins, factor VIII-related antigen, and leukocyte-common antigens were negative. For all experiments described herein, MC were used before passage 20. There was no apparent effect of passage number on ADP-ribosyl cyclase activity, RyRs expression, or cADPR-mediated microsomal Ca2+ release activity. To evaluate the effect of hormones and cytokines on ADP-ribosyl cyclase, MC were grown in complete Waymouth's medium with 20% FCS in 100-mm culture dishes to confluence, rendered quiescent for 48 h in Waymouth's medium with 0.5% FCS, and then incubated with cytokines or hormones for 24 h. At the end of this incubation period, MC were rinsed, harvested, and subjected to sonication (3 cycles of 10 s each, 8-µm amplitude) in a "homogenizing buffer" containing (final concentrations) 0.25 M sucrose and 20 mM Tris · HCl (pH = 7.2). The homogenate was centrifuged first at 2,000 g for 10 min, and the resulting supernatant was then centrifuged at 40,000 g for 30 min. The pellet resuspended in homogenizing medium, designated as "membrane fraction" (11, 70), was assayed for ADP-ribosyl cyclase activity. In pilot experiments, we determined that all ADP-ribosyl cyclase activity in homogenates of MC is associated with membranes, and none was detected in supernatants from 100,000 g for 90 min (43). Homogenization and subsequent procedures were conducted at 0-4°C.

ADP-ribosyl cyclase activity. Cyclase activity was determined by the fluorometric method of Lee et al. (25, 26), which is based on the conversion of NGD, a structural analog of NAD, to its fluorescent product, cGDPR (28), which we employed in our previous studies (11, 17). Membrane fractions from MC (see above) (~ 0.1 mg protein/ml) were incubated in the homogenizing buffer (see above) in a thermostated cuvette at 37°C with 0.4 mM NGD substrate, and generation of fluorescent product cGDPR was continually monitored at 300-nm excitation wavelength and 410-nm emission wavelength, using a Hitachi model F-2000 spectrofluorometer (11, 17). The enzymatic activity was calculated from the initial linear slope; change in fluorescence (Delta ) was calibrated from standard curves construed with known concentrations of cGDPR (3, 17, 28, 43). All measurements were conducted in duplicate and are from four independent experiments (17). The assay for ADP-ribosyl cyclase with use of NGD substrate accurately determines ADP-ribosyl cyclase activity, because the product cGDPR is, unlike cADPR, resistant to degradation by cADPR hydrolase (28); in our preceding studies we affirmed concordance of results of ADP-ribosyl cyclase measured with NGD and NAD substrates, respectively (11, 17).

cADPR hydrolase activity. Hydrolase activity was determined by thin-layer chromatography (TLC) using 20 × 20-cm ion-exchange, polyethylenimine cellulose TLC plates with ultraviolet (UV) indicator. Membranes isolated from control and cytokine-treated MC (0.5 mg protein/ml) were incubated, in duplicate, for 30 min at 37°C in medium containing (final concentrations) 50 µM cADPR, 20 mM Tris · HCl (pH 7.4), and 0.2 µCi/ml [3H]cADPR. The reaction was terminated by mixing a 20-µl aliquot of the reaction mixture with a 20-µl stop solution containing (final concentration) 1 mM cADPR, 1 mM ADPR, and 10% glacial acetic acid, and storing on ice. The 40-µl aliquot was placed on the TLC plates, and the mixture was separated in a TLC chamber containing 0.2 M NaCl and 30% ethanol at room temperature for a period of 2.5 h. The plates were dried, and the fractions were identified by a 254-nm UV light. The cADPR fraction was removed from the plate, placed in liquid scintillation vials, radioactivity was determined by a Beckman LS6000 liquid scintillation counter, and cADPR hydrolase activity was calculated by comparing initial [3H]cADPR levels with those measured after 30 min of incubation.

Isolation of microsomes. Microsomal fractions were isolated (at 0-4°C) from cultured rat MC or from rat myocardium. MC or myocardium, finely minced with a razor blade, were suspended in a buffer containing 300 mM sucrose, 10 mM HEPES, 0.1 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride (PMSF) (pH = 7.4), and homogenized by Polytron (3 × 30 s at setting 10). The homogenate was centrifuged for 10 min at 1,600 g, and the pellet was discarded. The supernatant was further centrifuged at 11,000 g for 20 min, and the supernatant thus obtained was ultracentrifuged at 100,000 g for 1 h. The pellet was resuspended in a small volume of homogenizing buffer by Dounce homogenizer. The microsomes were either used fresh for measurement of 45Ca2+ release or were divided into aliquots, quickly frozen, and stored at -80°C for measurement of [3H]ryanodine binding. Storage at -80°C preserved the [3H]ryanodine binding capacity of microsomes. The protein content of fractions was determined by the method of Lowry et al. (44).

[3H]ryanodine binding. Microsomes (100-200 µg protein) were incubated for 2 h at 37°C in a medium containing (final concentration) 600 mM KCl, 100 µM EGTA, 150 µM Ca2+, 0.2 mM PMSF, 25 mM HEPES (pH 7.2), and 30 nM [3H]ryanodine (54.7 Ci/mmol). Free [3H]ryanodine was separated from [3H]ryanodine, bound to microsomes by a rapid filtration technique using Whatman GF/B filters, followed by three subsequent washes with 3 ml of ice-cold water. The [3H]ryanodine radioactivity that remained on the filters was measured by liquid scintillation counting (18, 57). The high-affinity specific [3H]ryanodine binding was calculated as the difference of total binding and nonspecific binding, determined in the presence of >3,000-fold higher concentration of unlabeled ryanodine (0.1 mM).

45Ca2+ release from microsomes (32). Freshly prepared microsomes (~100 µg protein) were passively loaded by incubating for 3 h at room temperature (21°C) in a medium containing 100 mM NaCl, 25 mM HEPES (pH 7.2), 1 mM CaCl2, and 1 µCi of 45Ca2+. Release of 45Ca2+ from loaded microsomes was initiated by 10-fold dilution of microsomal suspension with a buffer containing 100 mM NaCl, 1 mM EGTA, 1 mM MgCl2, and 25 mM HEPES, pH 7.2 (32). After 10 s, the suspension was further diluted in a medium of identical composition that contained tested agonists with or without 10 µM ruthenium red (final dilution 50-fold). 45Ca2+ efflux was stopped at 90 s after the second dilution with added test agents, and the 45Ca2+ retained in microsomes was separated from free 45Ca2+ by a rapid filtration technique using Whatman GF/B filters. The filters were rinsed three times with a solution containing 100 mM NaCl, 1 mM EGTA, 4 mM MgCl2, 10 µM ruthenium red, and 25 mM HEPES, pH 7.2. The 45Ca2+ retained in microsomes was determined by liquid scintillation counting.

Measurement of cytoplasmic Ca2+ concentration. Cytoplasmic Ca2+ concentration ([Ca2+]i) in intact MC was measured in monolayers grown to confluence on 9 × 22-mm coverslips (69). MC were treated with cytokines for 24 h, as described above. Coverslips with MC were rinsed two times in PBS and then incubated with 1 µM of the acetoxymethyl ester of fura 2 (fura 2-AM) for 1 h at room temperature in a solution of (final concentrations) 135 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 5.5 mM D-glucose, and 10 mM HEPES, pH 7.4. After fura 2-AM loading, coverslips were washed and placed into thermostated (37°C) cuvettes of the Hitachi model F-2000 fluorescence spectrophotometer. Vasopressin was added to cells, and emitted fluorescence was measured using dual wavelength ratios of 340/380 nm for excitation and 510 nm for emissions, and [Ca2+]i values were determined from the standard curve using Cation Measurement software.

PCR analysis. Total RNA was isolated from rat MC using the RNeasy Total RNA Isolation Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Reverse transcription and PCR amplification were performed using the GeneAmp System (Perkin-Elmer, Branchburg, NJ).

CD38. PCR analysis of CD38 was performed using primers homologous to the rat ADP-ribosyl cyclase/cADPR hydrolase (CD38; GenBank accession no. D29646) (37). The sense primer, 5'-CCTTGGTAGTGGTCGTGGTCATAG-3', and antisense primer, 5'-TCACATTCCAGAACACAGCAACAG-3', were designed to produce a 480-bp product. The PCR conditions were 95°C for 5 min, and then 40 cycles at 95°C for 1 min, 42°C for 1 min, and 72°C for 1 min, followed by a final extension at 72°C for 7 min, and storage at 4°C. The PCR product was subcloned into the pCRII vector (Invitrogen, Carlsbad, CA) and sequenced in both orientations. The cDNA product was used in subsequent Northern blot analyses (see below).

RyRs. PCR analysis of RyR-1, RyR-2, and RyR-3 was performed essentially as previously described (16), with the addition of a DNase I treatment (RNase-free DNase I; Roche Molecular Chemicals, Indianapolis, IN) to eliminate residual genomic DNA. Design of PCR primers was based on GenBank accession nos. X83932 (RyR-1), X83933 (RyR-2), and X83934 (RyR-3) (16). The nucleotide sequence and length of expected PCR products for each primer pair are RyR-1 (sense), GAAGGTTCTGGACAAACACGGG; RyR-1 (antisense), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RyR-2 (sense), GAATCAGTGAGTTACTGGGCATGG; RyR-2 (antisense), CTGGTCTCTGAGTTCTCCAAAAGC (635 bp); RyR-3 (sense), AGAAGAGGCCAAAGCAGAGG; and RyR-3 (antisense), GGAGGCCAACGGTCAGA (269 bp). All PCR products were sequenced in both orientations.

Northern blot analysis. Quiescent rat MC were treated with atRA (1 µM), TNF-alpha (20 ng/ml), or both atRA (1 µM) and TNF-alpha (10 ng/ml) for 18 h before isolation of total cellular RNA. RNA (10 µg/lane) was electrophoresed through a 1% agarose, 2.2 M formaldehyde denaturing gel, then transferred to nylon membranes (Schleicher and Schuell, Keene NH), as previously described (30, 29). Ethidium bromide was added to each lane to allow visualization of the RNA with UV light. The complete transfer of the RNA from the gel to the membrane was documented by examining the membrane under UV light. The CD38 PCR product was excised from the pCRII vector and labeled with [alpha -32P]dCTP by the random primer method (20). Membranes were hybridized at 65°C in a 0.5 M sodium phosphate buffer, pH 7.0, containing 1 mM EDTA, 7% SDS, and 1% BSA, as described by Church and Gilbert (14). Gels were reprobed with a cDNA-encoding housekeeping gene, GAPDH. Autoradiograms were quantitated by computer-assisted video densitometry. Data for 18S ribosomal RNA were obtained from a negative image of the ethidium bromide-stained nylon membrane, according to the method of Correa-Rotter et al. (15). The CD38 signal in each lane was normalized to the corresponding GAPDH band, as previously described (29).

Western blot analysis. SDS-PAGE was performed using 7.5% gels cast in the PROTEAN II minigel system (Bio-Rad). Microsomes (~100 µg protein) were denatured for 3 min at 95°C in loading buffer according to Laemmli (38). Electrophoresis was performed at a constant current (20 mA/gel) and transferred to nitrocellulose membranes, and the blots were incubated with mouse anti-RyR monoclonal antibodies using either MAb MA3-925 (34C) that reacts with both RyR-1 and RyR-2 or MAb MA3-916 (C3-33) that reacts strongly with RyR-2 type, and only faintly with RyR-1. Blots were incubated with anti-mouse secondary antibody for 1 h and visualized by exposure to X-ray film using an enhanced chemiluminescence technique (Amersham Pharmacia Biotech). Western blots prepared from membranes isolated from control, TNF-alpha -treated, and TNF-alpha +atRA-treated renal MC were incubated with an anti-CD38 antibody [goat polyclonal anti-CD38 (M-19), Santa Cruz] and visualized, as described above.

All results were evaluated statistically with use of the Student's t-test for group or paired comparison; values P < 0.05 were considered statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ADP-ribosyl cyclase activity in MC membranes was upregulated by incubation with cytokines and with steroid superfamily hormones (Fig. 1). The proinflammatory cytokines TNF-alpha and IL-1 significantly induced ADP-ribosyl cyclase activity in membranes isolated from MC (TNFalpha Delta +46%, P < 0.05; and IL-1 Delta +38%, P < 0.05). Similarly, the steroid superfamily hormone atRA (1 µM) increased ADP-ribosyl cyclase activity (Delta +76%, P < 0.05) (Fig. 1). Combined treatment of MC with TNF-alpha and atRA, which signal through different pathways, produced at least an additive upregulation of ADP-ribosyl cyclase activity (Delta +145%, P < 0.05) compared with the effects of atRA or TNF-alpha alone. T3, another steroid superfamily hormone, did not significantly augment ADP-ribosyl cyclase activity (Delta +19%, P > 0.05, Fig. 1). Under these experimental conditions, bacterial LPS did not significantly increase ADP-ribosyl cyclase activity in MC (Delta +12%, P > .05).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Upregulation of ADP-ribosyl cyclase activity in mesangial cells (MC) by proinflammatory cytokines and hormones. The basal-specific activity of ADP-ribosyl cyclase [22.8 ± 4.1 nmol cGDP-ribose (cGDPR) · min-1 · mg protein-1; means ± SE, n = 4 experiments, each performed in duplicate] is taken as 100%, and the effects of tested agents are expressed as Delta  + %. Each bar denotes means ± SE. MC were treated with 20 ng/ml tumor necrosis factor-alpha (TNF-alpha ), 30 ng/ml lipopolysaccharide (LPS), 10 ng/ml interleukin-1 (IL-1); 1 µM all-trans retinoic acid (atRA), 0.1 µM 3,5,3'-triiodothyronine (T3), or 10 ng/ml TNF-alpha  + 1 µM atRA. #Value significantly higher (P < 0.05, t-test) than TNF-alpha alone or atRA alone. *Significantly (P < 0.05, t-test, n = 4 experiments) higher than untreated controls.

In other cell systems, CD38 and related enzymes are recognized as multifunctional enzymes (39). Whereas CD38 promotes cADPR formation from beta -NAD through cyclase activity, CD38 also has hydrolase activity, which promotes the catabolism of cADPR to ADPR (39). To determine whether TNF-alpha , atRA, or LPS induces ADP-ribosyl cyclase activity to a greater extent than cADPR hydrolase activity, we assayed ADP-ribosyl cyclase activity and cADPR hydrolase activity in membranes isolated from parallel cultures of MC treated with TNF-alpha , atRA, and atRA plus TNF-alpha . TNF-alpha and atRA increased ADP-ribosyl cyclase activity to a much greater extent than cADPR hydrolase activity (Fig. 2). Although the combined treatment of MC with TNF-alpha plus atRA significantly augmented ADP-ribosyl cyclase activity, these combined treatments did not significantly alter cADPR hydrolase activity (Fig. 2). Similarly, combined treatment of MC with LPS and TNF-alpha did not significantly alter cADPR hydrolase activity, compared with treatment with LPS or TNF-alpha alone (data not shown).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of ADP-ribosyl cyclase activity and cADPR hydrolase activity. The basal specific activity of ADP ribosyl cyclase (36.3 ± 4.3 nM cGDPR · min-1 · mg protein-1; means ± SE, n = 3) is taken as 100%, and the effect of TNF-alpha (20 ng/ml), atRA (1 µM), or the combination of TNF-alpha +atRA (10 ng/ml and 1 µM, respectively) is expressed as Delta +%. cADPR hydrolase activity was quantitated from the amount of [3H]cADPR hydrolyzed after 30 min of incubation. Open bars, ADP-ribosyl cyclase activity; solid bars, cADPR hydrolase activity. Each bar denotes means ± SE. *Significantly (P < 0.05, t-test) higher than untreated controls.

Several approaches were employed to define the nature of MC ADP-ribosyl cyclase activity. By using appropriate primers, a 480-bp cDNA was amplified from reverse-transcribed MC RNA with 100% sequence identity to the rat CD38-like ADP-ribosyl cyclase/cADP ribose hydrolase isolated from rat pancreatic islets (GenBank accession no. D29646, data not shown) (37). By Northern blot analysis, a distinct 2.2-kb band was identified in MC, corresponding to CD38 mRNA. Relatively low levels of CD38 expression were detected in untreated control rat MC (Fig. 3). atRA (1 µM) and TNF-alpha induced steady-state CD38 mRNA levels by 2.2-fold (P < 0.001) and 1.4-fold (P < 0.05), respectively (Fig. 3). Increased CD38 mRNA levels were observed after 2-h treatment with atRA and reached maximal levels after 12-18 h (data not shown). The combined treatment of rat MC for 18 h with atRA (1 µM) and TNF-alpha induced CD38 mRNA levels by 2.8-fold (P < 0.001) (Fig. 3). These studies indicate that TNF-alpha - and atRA-mediated increases in ADP-ribosyl cyclase activity are associated with a concomitant induction of steady-state CD38 mRNA levels.


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 3.   Induction of CD38 mRNA by TNF-alpha and atRA. Northern blots prepared from rat MC treated with atRA (1 µM), TNF-alpha (20 ng/ml), or both TNF-alpha (10 ng/ml) and atRA (1 µM) were probed with a rat CD38 cDNA, as described in MATERIALS AND METHODS. Data are representative of 3 independent experiments.

By Western blot analysis, a 42-kDa CD38-like protein was identified in membranes isolated from rat MC (Fig. 4). In parallel with ADP-ribosyl cyclase activity (Fig. 1), atRA and TNFalpha +atRA increased expression of the CD38-like protein [Delta +% 24 ± 5 vs. untreated control (P < 0.05) and Delta +% 42 ± 6 vs. untreated control (P < 0.05), respectively; n = 6 experiments, each performed in duplicate] (Fig. 4). These studies indicate that cytokine-mediated ADP-ribosyl cyclase activity may at least in part be mediated through increased production of a CD38-like protein. Furthermore, cytokine-mediated induction of CD38 mRNA and protein leads to preferential activation of ADP-ribosyl cyclase activity relative to cADPR hydrolase activity.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   Upregulation of CD38-like ADP-ribosyl cyclase by TNF-alpha and atRA. Western blots were prepared from membranes of rat MC treated with atRA alone (1 µM) or both TNF-alpha (10 ng/ml) and atRA (1 µM), as described in MATERIALS AND METHODS. Data are representative of 6 experiments.

In other cell systems, intracellular Ca2+ release by cADPR is mediated by the RyR channel. However, the presence of such an RyR channel in MC has not been previously documented. We found that [3H]ryanodine specifically binds to microsomal fractions isolated from MC in a Ca2+-dependent fashion (Fig. 5A). The [3H]ryanodine binding was suppressed by the addition of molar excess (greater than ×3,000) of unlabeled ryanodine and was also blocked by 10 µM ruthenium red (Fig. 5A), an established inhibitor of RyRs (19, 40). Specific binding of [3H]ryanodine to microsomes prepared from MC (91 ± 22 fmol · mg protein-1 · 120 min-1) was about threefold less (P < 0.01) than [3H]ryanodine binding to microsomes prepared from rat myocardium (324 ± 20 fmol · mg protein-1 · 120 min-1) (data not shown).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   [3H]ryanodine binding to microsomal fractions of MC. A: [3H]ryanodine binding is shown. The microsomes were incubated with 30 nM [3H]ryanodine (see MATERIALS AND METHODS) without added Ca2+ (control), with 50 µM Ca2+ alone, with 50 µM Ca2+ + 100 µM ryanodine, or with 50 µM Ca2+ + 10 µM ruthenium red. Each bar denotes means ± SE; n = 4. *Statistically different from controls (P < 0.05 by t-test). B: the effect of ryanodine receptor (RyR) agonists on specific Ca2+-dependent [3H]ryanodine binding to MC microsomal fraction. Microsomal fractions were treated with no addition (control),= 0.5 mM 4-chloromethyl-m-cresol (4-CmC), 0.5 mM 4-chloro-3-ethyl phenol (4-CEP), 10 µM bastadin, or 20 mM caffeine. Each bar denotes means ± SE; n = 3. *Statistically different (P < 0.05, t-test) from controls. C: effect of 10 µM cADPR on 3[H]ryanodine binding to microsomes from MC. Microsomes were treated with no addition (control), 10 µM cADPR, 10 µM cADPR + 40 µM 8-bromo-cADPR (8-Br-cADPR), or 10 µM ADPR. Each bar denotes means ± SE; n = 3.

To further document the specificity of [3H]ryanodine binding to MC microsomes, we measured [3H]ryanodine binding in the presence of caffeine, a well-known and established RyR agonist (19, 36, 40), and in the presence of several recently described pharmacological agonists that interact specifically with RyRs (18, 32, 36, 55, 57). We found that 4-CmC, 4-CEP, and the alkaloids bastadin and caffeine all significantly enhanced [3H]ryanodine binding to microsomes of MC (Fig. 5B). Moreover, [3H]ryanodine binding to MC microsomes was inhibited by 10 µM cADPR. This effect was blocked by 8-Br-cADPR, a selective antagonist of cADPR. ADPR (non-cyclic) had no effect on [3H]ryanodine binding to MC microsomes (Fig. 5C ). The presence of RyR-1, -2, and -3 was identified in MC by RT-PCR (Fig. 6A).


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 6.   RyR expression by MC. A: PCR amplification of RyR-1, RyR-2, and RyR-3 in MC. cDNA fragments of RyR-1 (lanes 1 and 2), RyR-2 (lanes 3 and 4), and RyR-3 (lanes 5 and 6) were amplified from MC cDNA, as described in MATERIALS AND METHODS. MC express RyR-1 (480 bp, lane 1), RyR-2 (635 bp, lane 3), and RyR-3 (269 bp, lane 5). Lanes 2, 4, and 6: negative controls, in which RT is omitted. B: analysis of MC microsomal fractions by Western blot. MC preparations were probed with 2 different RyR mAb (see MATERIALS AND METHODS) and compared with microsome preparations from rat myocardium. Lanes 1 and 3: rat myocardial microsomes. Lanes 2 and 4: MC microsomes. Lanes 1 and 2 were probed with MA3-925 MAb, which reacts strongly with RyR-1 and RyR-2. Lanes 3 and 4 were probed with MA3-916, which reacts strongly with RyR-2 and weakly with RyR-1. Note the strong signal in rat myocardium (lane 3) and the absence of signal in MC (lane 4), despite prolonged exposure time. Two major bands of Mr~560 kDa are identified in both rat myocardium and MC.

Immunoblot analysis, using RyR isoform-specific antibodies, confirmed the presence of RyR-1 in MC microsomes (Fig. 6B). When a Western blot was probed with MAb MA3-925 (that recognizes RyR-1 and RyR-2 isoforms equally), two major bands were detected at Mr sime  560 kDa (Fig. 6B, lanes 1 and 2). When probed with MAb MA3-916, which strongly reacts with RyR-2 but weakly with RyR-1, strong bands were detected in microsomal preparations from rat myocardium, but no bands were detected in microsomes from MC even after prolonged exposure (Fig. 6B, lanes 3 and 4), indicating that MC expression of RyR-2 is extremely low. Taken together, these data indicate that MC possess RyR-1 and possibly RyR-3, with low levels of RyR-2 expression.

To determine the functional significance of RyRs in MC, we measured Ca2+ release from MC microsomes that were preloaded with 45Ca2+. cADPR elicited 45Ca2+ release from rat MC microsomes in a dose-dependent fashion (Fig. 7). The release of 45Ca2+ was significantly (P < 0.01) increased by cADPR, a natural RyR agonist (19, 40), by caffeine (19, 36, 40), and by 4-CmC (57, 69) (Fig. 8A). The stimulatory effects of cADPR and pharmacological agonists on 45Ca2+ release from MC microsomes were all blocked by ruthenium red (Fig. 8, A and B). The cADPR-stimulated 45Ca2+ release (Delta % + 62 ± 9; means ± SE, P < 0.025, t-test; n = 3) was blocked by the selective cADPR antagonist 8-Br-cADPR (64); furthermore, ADPR (non-cyclic), a hydrolytic metabolite of cADPR (19, 40), showed no effect on 45Ca2+ release (Fig. 8B). Release of 45Ca2+ mediated by cADPR was 60-70% of 45Ca2+ release induced by ionomycin or IP3 (Fig. 8, B and C). IP3-mediated 45Ca2+ release was blocked by heparin and not by ruthenium red, as expected (Fig. 8C).


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 7.   cADPR elicits 45Ca2+ release from rat MC microsomes in a dose-dependent fashion. Microsomes isolated from rat MC were loaded with 45Ca2+ in the presence of doses of cADPR ranging from 0 to 10 µM. 45Ca2+ release was assessed as described in MATERIALS AND METHODS.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8.   45Ca2+ release from MC microsomes. A: effect of cADPR and pharmacological RyR agonists on 45Ca2+ release from preloaded microsomal fraction of MC. Microsomal fractions were treated with no additions (control), 10 µM cADPR, 20 mM caffeine alone or with 10 µM ruthenium red (+RR), or 500 µM 4-CmC alone or with 10 µM RR. B: microsomal fractions were treated with no additions (control), 10 µM cADPR, 10 µM cADPR + 40 µM 8-Br-cADPR, 10 µM cADPR + 10 µM RR, or 10 µM ADPR. C: effect of ionomycin and IP3 on calcium release by microsomes isolated from MC. Microsomes were treated with no addition (control), 10 µM ionomycin, 8 µM IP3, 8 µM IP3 + 1 mg/ml heparin, or 8 µM IP3 + 10 µM RR. *Significantly higher (P < 0.01; t-test) than controls; each bar denotes means ± SE; n = 3-4.

Finally, we determined whether the RyR agonist caffeine can enhance the increment of cytoplasmic Ca2+ level evoked by vasopressin in intact MC (Fig. 9A). The extent of Ca2+ increase in intact MC elicited by vasopressin (Delta % +137 ± 17; n = 5) was enhanced twofold (P < 0.01) in the presence of 10 mM caffeine (Delta % +281 ± 33, means ± SE; n = 5). The vasopressin-elicited Ca2+ release was also significantly increased by TNF-alpha and atRA combined (Fig. 9B).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 9.   Intracellular Ca2+ ([Ca2+]i) release triggered by 1 µM vasopressin in MC. A: effect of caffeine. Basal [Ca2+]i level in MC was 140 ± 11 nM. Bars (means ± SE, n = 5) denote increment (Delta %) of [Ca2+]i in response to 1 µM vasopressin without (control) or in the presence of 10 mM caffeine. *Significantly higher than controls (P < 0.01, t-test, n = 5 experiments). B: effects of retinoids and TNF-alpha . Bars (means ± SE, n = 3 experiments) denote increment (Delta %) of [Ca2+]i in response to 1 µM vasopressin alone (control), with 1 µM atRA, with 1 µM atRA + 10 ng/ml TNF-alpha , and with 10 µM atRA + 10 ng/ml TNF-alpha .


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Release of Ca2+ from intracellular stores governs major functions of MC, such as contractility (58, 60), and plays a key role in signal transduction pathways by which many hormonal agents regulate MC functions in physiological and pathobiological states (1, 8, 58, 60).

In general, signaling pathways that transduce effects of fast-onset, short-acting hormonal agents in MC, such as vasoactive peptides (e.g., endothelin, vasopressin), often employ the well-established IP3-IP3R-Ca2+-release system (1, 5, 6, 58). This signaling pathway includes binding of a hormone to its receptor, coupled in the plasma membrane via Gq to PI-PLC, that increases generation of IP3; the de novo generated IP3 binds onto IP3Rs within SR/ER membranes and triggers release of Ca2+ as a signal into the cytoplasm (Fig. 10).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 10.   Schematic depiction of cADPRright-arrowRyRright-arrow Ca2+ and IP3right-arrowIP3Rright-arrowCa2+ signaling pathways in MC and their crosstalk via Ca2+-induced Ca2+ release (CICR). Slow-onset, long-acting hormone, e.g., atRA (via nuclear receptors RAR/RXR), or cytokine TNF-alpha , by binding to its receptor, upregulates ADP-ribosyl cyclase (AC) activity and increases synthesis of cADPR from beta -NAD. Elevated cADPR, by interacting with RyRs, elicits Ca2+ release via CICR. Fast-onset, short-acting hormones, by binding to receptor, activate phosphatidylinositol-phospholipase C (PI-PLC) and increase generation of IP3, which triggers Ca2+ release through IP3 receptor channel (IP3Rs). Ca2+ released from RyRs sensitizes IP3Rs to action of IP3; conversely, Ca2+ released through IP3Rs can accentuate the cADPR-elicited Ca2+ release through RyRs.

Herein we report that MC possess elements of a "cADPRright-arrowRyRright-arrowCa2+-release" signaling pathway and that this pathway differs substantially in design and function from the classic IP3-Ca2+-release pathway (6, 14, 19, 40). First, Ca2+ release from MC is elicited by a novel second messenger, cADPR, that sensitizes RyRs to Ca2+ and activates and/or facilitates CICR (14, 19, 40). Second, MC are capable of synthesizing cADPR from beta -NAD, a reaction catalyzed by ADP-ribosyl cyclase. Finally, Ca2+ is released from MC through a distinct RyR channel that differs in properties, namely regulation, from IP3Rs (19, 40, 46).

Several distinct molecules with ADP-ribosyl cyclase activity have been identified, including a soluble ADP-ribosyl cyclase isolated from Aplysia californica ovotestis, a cytosolic enzyme capable of metabolizing cADPR isolated from sea urchin egg extracts (15, 19, 37, 39, 41), and the membrane-bound ADP-ribosyl cyclases CD38 and BST-1/CD157 (33). We found that virtually all of the MC Ca2+ release activity attributable to cADPR was membrane bound; no significant cytosolic Ca2+ release activity was detected. In several other mammalian cells and tissues, including rat liver homogenates, uterine smooth muscle cells, and vascular smooth muscle cells, we found that almost all of the cADPR-mediated Ca2+ release activity is membrane associated (11, 17, 43). Furthermore, we failed to demonstrate BST-1 expression in membrane extracts from MC (Walker HJ, Yusufi ANK, and Dousa TP, unpublished observations). Based on these considerations, we sought to determine whether Ca2+ release activity elicited by cADPR may be mediated by a CD38-like ADP-ribosyl cyclase.

By RT-PCR, we found that MC possess a CD38-like molecule with 100% sequence homology to the rat CD38-like ADP-ribosyl cyclase/cADPR hydrolase isolated from rat pancreatic islets. The presence of a CD38-like protein in rat MC was confirmed by Western blot analysis (Fig. 3). CD38 has recently been identified in a variety of mammalian cells including liver (43), brain (50), vascular and uterine smooth muscle (11, 17), T cells (31), and pancreatic islets (54, 62). In rat pancreas, the CD38right-arrowcADPRright-arrowRyRright-arrowCa2+ signaling pathway is regulated by glucose and is involved in regulation of insulin secretion (54, 62). In diabetic patients, autoantibodies directed against CD38 (35) and missense mutations in the CD38 gene (67) have been identified.

In concert with increased ADP-ribosyl cyclase activity, we found that atRA and TNF-alpha induce CD38 mRNA expression and production of a CD38-like protein, as assessed by Western blot analysis. Because we did not identify soluble ADP-ribosyl cyclase activity or BST-1 in MC, we postulate that basal and cytokine-induced ADP-ribosyl cyclase activity in MC is directed by a CD38-like protein. However, further studies such as CD38 antibody neutralization studies, CD38 antisense studies, or Ca2+ release experiments using cells derived from CD38 knockout animals are needed to determine whether atRA or TNFalpha -mediated induction of CD38 is causally related to increases in ADP-ribosyl cyclase activity in MC.

CD38 and other ADP-ribosyl cyclases are multifunctional enzymes that are capable of catalyzing the hydrolysis of cADPR to ADPR as well as the production of cADPR from beta -NAD (34). Under our experimental conditions, ADP-ribosyl cyclase activity in MC is preferentially induced by atRA and TNF-alpha , without significant effects on cADPR hydrolase activity. We observed that the extent of Ca2+ increase in intact MC elicited by vasopressin was augmented by pretreatment with TNF-alpha and atRA or pretreatment with the RyR agonist caffeine. These studies provide indirect evidence that atRA- and TN-alpha -mediated induction of ADP-ribosyl cyclase produces functionally significant increases in intracellular Ca2+ fluxes.

Several lines of evidence document that functionally competent RyRs are expressed in MC. The high-affinity, [3H]ryanodine Ca2+-dependent binding is now a well-established method for detection and quantitation of RyRs (18, 45, 57). [3H]ryanodine binding to MC microsomes requires relatively high KCl concentrations. This requirement for high KCl concentrations to demonstrate specific ryanodine binding in a variety of mammalian cells and tissues, including smooth muscle cells, LLC-PK1 cells, and extracts from renal cortex, has been reported by other investigators (4, 18, 63). The observation that [3H]ryanodine binding to microsomes from MC is significantly enhanced by specific pharmacological agonists of RyRs is diagnostic (Fig. 5B): caffeine (32, 36, 57), 4-CmC (18, 32, 36, 57), 4-CEP (18, 36), and the alkaloid bastadin (18, 55) all acted in a similar manner. All of these agonists enhance binding of [3H]ryanodine to microsomes from skeletal muscle, myocardium, and other tissues (18, 32, 36, 55, 57). The presence of RyR in MC microsomes was confirmed by Western blot analysis (Fig. 6).

We found that cADPR inhibits [3H]ryanodine binding to MC microsomes. This observation would suggest that cADPR and ryanodine compete for binding to a similar site on the ryanodine receptor channel (19). In other systems, variable effects of cADPR on [3H]ryanodine binding have been described. In cardiac SR vessels and in lymphocytes, cADPR enhances [3H]-ryanodine binding (9, 31, 51). In parotid cells and, as described here in MC, cADPR competes with [3H]ryanodine for binding to the ryanodine receptor channel (68). Recent data suggest that cADPR indirectly interacts with the ryanodine receptor channel, through interactions with one or more accessory proteins (46, 65), such as the FK506 binding protein 12.6 (53).

By RT-PCR, we have identified RyR-1, -2, and -3 in MC. By Western blot analysis, MC express relatively high levels of RyR-1, with minimal expression of RyR-2. High levels of RyR-1 expression have been described in skeletal muscle and smooth muscle, RyR-2 expression in cardiac muscle (5) and pancreatic acinar cells (42), and RyR-3 expression in brain, smooth muscle cells, and other tissues (21, 47, 48, 61, 68). Future studies, using RyR-3-specific antibodies, are needed to define the level of RyR-3 expression in MC.

The functional competence of RyRs for Ca2+ release from MC is evidenced by measurements of in vitro release of 45Ca2+ from preloaded MC microsomes (Fig. 8). The natural second messenger cADPR (19, 40), as well as the pharmacological RyR agonists caffeine (36, 57) and 4-CmC (18, 32, 57), all elicited 45Ca2+ release from MC microsomes to the same extent (Fig. 8A). The 45Ca2+-releasing effects of all these agents were prevented by the RyR blocker ruthenium red (Fig. 8, A and B), and the 45Ca2+-releasing effect of cADPR was blocked by a selective inhibitor, 8-Br-cADPR (64). ADPR, an inactive hydrolytic metabolite of cADPR (14, 19, 40), was without effect on 45Ca2+ release (Fig. 8B). All these observations evince that 45Ca2+ release through RyRs in MC is sensitive to stimulation by cADPR, a novel second messenger.

In experiments on intact monolayers of MC, we observed that the RyR agonist caffeine enhanced the increment in cytoplasmic Ca2+ level that was elicited by vasopressin. Conceivably, by activating RyRs and CICR, caffeine sensitized the IP3Rs to the Ca2+-releasing action of IP3 generated in response to vasopressin and produced an enhanced rise of Ca2+ (Fig. 9A). atRA+TNF-alpha also enhanced vasopressin-mediated increases in cytoplasmic Ca2+ (Fig. 9B). These findings are consistent with the notion that RyRs can be activated in the intact MC and that there may be crosstalk between the functionally distinct cADPR and IP3 signaling pathways. However, the exact mechanism by which this occurs remains to be clarified in future studies.

Because the cADPRright-arrowRyRright-arrowCa2+-release signaling system and the IP3right-arrowIP3Rright-arrowCa2+-release signaling system do coexist in MC, it should be considered whether these two pathways interact with each other and regulate MC functions in a coordinated, integrated manner. A major point of mutual interaction is the fact that both RyRs (19, 14) and IP3Rs (12, 22) can behave as CICR and thereby may influence release of Ca2+ via each other. We thus propose, as a working hypothesis (Fig. 10), that slow-onset, long-acting "adaptive" cytokines and hormones, which act via upregulating the ADP-ribosyl cyclaseright-arrowcADPRright-arrowRyRright-arrowCICR pathway, regulate and control primarily the ambient, steady-state Ca2+ levels in cytoplasm. The level of cytoplasmic Ca2+ determines sensitivity of IP3Rs to the Ca2+-releasing effect of IP3 that is generated in response to fast-acting hormones, such as vasoactive peptides. In short, via this mechanism, long-acting adaptive hormones would modulate the responsiveness of MC to fast-acting hormones and autacoids. Conversely, Ca2+ released in response to IP3 may contribute to enhance activity of RyRs as positive feedback to CICR (Fig. 10).

Conceivably, hormones that act via the cADPRright-arrow RyRright-arrowCa2+-release signaling pathway can regulate other cellular functions of MC in addition to contractility. As recently reported, RyRs and IP3Rs can be differentially distributed within one cell (68): IP3Rs were detected close to plasma membranes, whereas RyRs were located in the perinuclear region (68). cADPR has been shown to elicit release of Ca2+ through RyRs into the nucleus (23, 56), and as a result, nuclear Ca2+ levels elevated in response to cADPR can modulate expression of various genes via Ca2+-dependent phosphorylation-dephosphorylation of transcription factors (e.g., CREB, CREM, SRF) (24). The cADPRright-arrowRyRright-arrowCa2+-release signaling pathway might also play a role in initiation of apoptosis. This possibility is suggested by observations that release of Ca2+ from intracellular stores by thapsigargin (66) or cyclopiazonic acid (7, 66) can cause apoptosis (9, 51, 63). Apoptosis initiated by thapsigargin or by other maneuvers was prevented or attenuated by dantrolene (51) and ruthenium red (51, 68), both blockers of RyRs.

In conclusion, we provide evidence that MC are endowed with a novel cADPRright-arrowRyRright-arrowCa2+-release signaling pathway and that biosynthesis of the initial step, second messenger cADPR, is upregulated by proinflammatory cytokines and steroid superfamily hormones. We surmise that the cADPRright-arrowRyRright-arrowCa2+-release regulatory pathway in MC is an essential, hitherto unrecognized, signaling system operant in the regulation of contractility and other functions of MC. It represents another layer of signaling machinery that governs normal glomerular MC functions and interacts, via crosstalk, with other signaling pathways. Finally, it can also play a pathogenic role in glomerular inflammation and may be a potential target for signal transduction pharmacotherapy.


    ACKNOWLEDGEMENTS

We acknowledge James Haugen for providing excellent technical assistance and Cherish Grabau and Carol Davidson for providing excellent secretarial assistance.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-16105 and DK-55603 and by the Mayo Foundation. J. Cheng, is a postdoctoral research fellow supported by the Mayo Foundation.

Address for reprint requests and other correspondence: J. P. Grande, Mayo Clinic, 200 First St., SW, Guggenheim Bldg. 501, Rochester, MN 55905 (E-mail: grande.joseph{at}mayo.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 15 June 2000; accepted in final form 23 March 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ardaillou, R, Ronco P, and Rondeau E. Biology of renal cells in culture. In: The Kidney, edited by Brenner B.. Philadelphia, PA: Saunders, 1996, p. 99-192.

2.   Awad, S, Lamb H, Morgan J, Dunlop W, and Gillespie J. Differential expression of ryanodine receptor RyR2 mRNA in the nonpregnant and pregnant human myometrium. Biochem J 322: 777-783, 1997.

3.   Beers, K, Chini E, and Dousa T. All-trans-retinoic acid stimulates synthesis of cADP-ribose in renal LLC-PK1 cells. J Clin Invest 95: 2385-2390, 1995.

4.   Bennett, D, Cheek T, Berridge M, De Smedt H, Parys J, Missiaen L, and Bootman MD. Expression and function of ryanodine receptors in nonexcitable cells. J Biol Chem 271: 6356-6362, 1996[Abstract/Free Full Text].

5.   Berridge, M. Elementary and global aspects of calcium signaling. J Physiol (Lond) 499: 291-306, 1997[Free Full Text].

6.   Berridge, M. Inositol triphosphate and calcium signaling. Ann NY Acad Sci 766: 31-43, 1995[Web of Science][Medline].

7.   Bian, X, Hughes F, Huang Y, Cidlowski J, and Putney J. Roles of cytoplasmic Ca2+ and intracellular Ca2+ stores in induction and suppression of apoptosis in S49 cells. Am J Physiol Cell Physiol 272: C1241-C1249, 1997[Abstract/Free Full Text].

8.   Bonventre, J. Calcium and calcium-related signaling pathways in glomerular mesangial cells. Clin Exp Pharmacol Physiol 23: 65-70, 1996[Web of Science][Medline].

9.   Bourguignon, LY, Chu A, Jin H, and Brandt NR. Ryanodine receptor-ankyrin interaction regulates internal Ca2+ release in mouse T-lymphoma cells. J Biol Chem 270: 17917-22, 1995[Abstract/Free Full Text].

10.   Chini, E, Chini C, Bollinger C, Jougasaki M, Grande J, Burnett J, and Dousa TP. Cytoprotective effects of adrenomedullin in glomerular cell injury: central role of cAMP signaling pathway. Kidney Int 52: 917-925, 1997[Web of Science][Medline].

11.   Chini, E, de Toledo F, Thompson M, and Dousa T. Effect of estrogen upon cADP ribose metabolism: b-estradiol stimulates ADP ribosyl cyclase in rat uterus. Proc Natl Acad Sci USA 94: 5872-5876, 1997[Abstract/Free Full Text].

12.   Chini, E, and Dousa T. Nicotinate-adenine dinucleotide phosphate-induced Ca2+ release does not behave as a Ca2+-induced Ca2+-release system. Biochem J 316: 709-711, 1996.

13.   Chini, E, Klener P, Beers K, Chini C, Grande J, and Dousa T. cADP-ribose metabolism in rat kidney: high capacity for synthesis in glomeruli. Kidney Int 51: 1500-1506, 1997[Web of Science][Medline].

14.   Church, GM, and Gilbert W. Genomic sequencing. Proc Natl Acad Sci USA 81: 1991-1995, 1984[Abstract/Free Full Text].

15.   Correa-Rotter, R, Mariash CN, and Rosenberg ME. Loading and transfer control for Northern hybridization. Biotechniques 12: 154-158, 1992[Web of Science][Medline].

16.   Coussin, F, Macrez N, Morel JL, and Mironneau J. Requirement of ryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ release in vascular myocytes. J Biol Chem 275: 9596-9603, 2000[Abstract/Free Full Text].

17.   de Toledo, F, Cheng J, and Dousa T. Retinoic acid and triiodothyronine stimulate ADP-ribosyl cyclase activity in rat vascular smooth muscle cells. Biochem Biophys Res Commun 238: 847-850, 1995.

18.   DiJulio, D, Watson E, Pessah I, Jacobson K, Ott S, Buck E, and Singh JC. Ryanodine receptor type III (Ry3R) identification in mouse parotid acini. J Biol Chem 272: 15687-15696, 1997[Abstract/Free Full Text].

19.   Dousa, T, Chini E, and Beers K. Adenine nucleotide diphosphates: emerging second messengers acting via intracellular Ca release. Am J Physiol Cell Physiol 271: C1007-C1024, 1996[Abstract/Free Full Text].

20.   Feinberg, AP, and Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132: 6-13, 1983[Web of Science][Medline].

21.  Galione A and Churchill G. cADP ribose as a calcium-mobilizing messenger. [Online]. Science's Signal Transduction Knowledge Environment. http://www.stke.org/cgi/content/full/OC_sigtrans; 2000/41/pe1 [2000, Jul.].

22.   Galione, A. Ca2+-induced Ca2+ release and its modulation by cyclic ADP-ribose. Trends Pharmacol Sci 13: 304-306, 1992[Medline].

23.   Gerasimenko, O, Gerasimenko J, Tepikin A, and Petersen O. ATP-dependent accumulation and inositol triphosphate- or cADP-ribose-mediated release of Ca2+ from the nuclear envelope. Cell 80: 439-444, 1995[Web of Science][Medline].

24.   Ghosh, A, Ginty D, Bading H, and Greenberg M. Calcium regulation of gene expression in neuronal cells. J Neurobiol 25: 294-303, 1994[Web of Science][Medline].

25.   Giannini, G, Clementi E, Ceci R, Marziali G, and Sorrentino V. Expression of a ryanodine receptor-Ca2+ channel that is regulated by TGF-beta . Science 257: 91-94, 1992[Abstract/Free Full Text].

26.   Giannini, G, Conti A, Mammarella S, Scrobogna M, and Sorrentino V. The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues. J Cell Biol 128: 893-904, 1995[Abstract/Free Full Text].

27.   Go, L, Moschella M, Watras J, Handa K, Fyfe B, and Marks A. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. J Clin Invest 95: 888-894, 1995.

28.   Graeff, R, Walseth T, Fryxell K, Branton W, and Lee H. Enzymatic synthesis and characterizations of cGDP-ribose. J Biol Chem 269: 30260-30267, 1994[Abstract/Free Full Text].

29.   Grande, J, Melder D, Zinsmeister A, and Killen P. TGF-beta 1 induces collagen IV gene expression in NIH-3T3 cells. Lab Invest 69: 387-395, 1993[Web of Science][Medline].

30.   Grande, JP, Melder DC, and Zinsmeister AR. Modulation of collagen gene expression by cytokines: stimulatory effect of transforming growth factor-beta 1, with divergent effects of epidermal growth factor and tumor necrosis factor-a on collagen type I and collagen type IV. J Lab Clin Med 130: 476-486, 1997[Web of Science][Medline].

31.   Guse, AH, da Silva CP, Berg I, Skapenko AL, Weber K, Heyer P, Hohenegger M, Ashamu GA, Schulye-Koops H, Potter BV, and Mayr GW. Regulation of calcium signaling in T lymphocytes by the second messenger cADP-ribose. Nature 398: 70-73, 1999[Medline].

32.   Herrmann-Frank, A, Richter M, Sarkozi S, Mohr U, and Lehmann-Horn F. 4-Chloro-m-cresol, a potent and specific activator of the skeletal muscle ryanodine receptor. Biochim Biophys Acta 1289: 31-40, 1996[Medline].

33.   Hirata, Y, Kimura N, Sato K, Ohsugi Y, Takasawa S, Okamoto H, Ishikawa J, Kaisho T, Ishihara K, and Hirano T. ADP ribosyl cyclase activity of a novel bone marrow stromal cell surface molecule, BST-1. FEBS Lett 356: 244-248, 1994[Web of Science][Medline].

34.   Howard, M, Grimaldi JC, Bazan JF, Lund FE, Santos-Argumedo L, Parkhouse RME, Walseth TF, and Lee HC. Formation and hydrolysis of cADP-ribose catalyzed by lymphocyte antigen CD38. Science 262: 1056-1059, 1993[Abstract/Free Full Text].

35.   Ikehata, F, Satoh J, Nata K, Tohgo A, Nakazawa T, Kato I, Kobayashi S, Akiyama T, Takasawa S, Toyota T, and Okamoto H. Autoantibodies against CD38 (ADP-ribosyl cyclase/cADP-ribose hydrolase) that impair glucose-induced insulin secretion in noninsulin-dependent diabetes patients. J Clin Invest 102: 395-401, 1998[Web of Science][Medline].

36.   Islam, M, Leibiger I, Leibiger B, Rossi D, Sorrentino V, Ekstrom T, Westerblad H, Andrade FH, and Berggren PO. In situ activation of the type 2 ryanodine receptor in pancreatic beta cells requires cAMP-dependent phosphorylation. Proc Natl Acad Sci USA 95: 6145-6150, 1998[Abstract/Free Full Text].

37.   Koguma, T, Takasawa S, Tohgo A, Karasawa T, Furuya Y, Yonekura H, and Okamoto H. Cloning and characterization of cDNA encoding rat ADP-ribosyl cyclase/cADP-ribose hydrolase (homologue to human CD38) from islets of Langerhans. Biochim Biophys Acta 1223: 160-162, 1994[Medline].

38.   Laemmli, U. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227: 680-685, 1970[Medline].

39.   Lee, H. Calcium signaling by cADP-ribose and NAADP. Cell Biochem Biophys 28: 1-17, 1998[Medline].

40.   Lee, H. Mechanisms of calcium signaling by cADP-ribose and NAADP. Physiol Rev 77: 1133-1164, 1997[Abstract/Free Full Text].

41.   Lee, H. Modulator and messenger functions of cADP-ribose in calcium signaling. Recent Prog Horm Res 51: 355-389, 1996.

42.   Leite, M, Dranoff J, Gao L, and Nathanson M. Expression and subcellular localization of the ryanodine receptor in rat pancreatic acinar cells. Biochem J 337: 305-309, 1999.

43.   Liang, M, Chini E, Cheng J, and Dousa T. Synthesis of NAADP and cADPR in mitochondria. Arch Biochem Biophys 371: 317-325, 1999[Web of Science][Medline].

44.   Lowry, O, Rosebrough A, Farr A, and Randall R. Protein measurement with Folin phenol reagent. J Biol Chem 193: 265-275, 1951[Free Full Text].

45.   Mackrill, J, Challiss R, O'Connell D, Lai F, and Nahorski S. Differential expression and regulation of ryanodine receptor and myo-inositol 1,4,5-triphosphate receptor Ca2+ release channels in mammalian tissues and cell lines. Biochem J 327: 251-258, 1997.

46.   Mackrill, J. Protein-protein interactions in intracellular Ca2+-release channel function. Biochem J 337: 345-361, 1999.

47.   Martin, C, Chapman K, Thornton S, and Ashley R. Changes in the expression of myometrial ryanodine receptor mRNAs during human pregnancy. Biochim Biophys Acta 1451: 343-352, 1999[Medline].

48.   Martin, C, Hyvelin J, Chapman K, Marthan R, Ashley R, and Savineau J. Pregnant rat myometrial cells show heterogeneous ryanodine- and caffeine-sensitive calcium stores. Am J Physiol Cell Physiol 277: C243-C252, 1999[Abstract/Free Full Text].

49.   Matousovic, K, Grande JP, Chini CCS, Chini EN, and Dousa TP. Inhibitors of cyclic nucleotide phosphodiesterase isozymes type-III and type-IV suppress mitogenesis of rat mesangial cells. J Clin Invest 96: 401-410, 1995.

50.   Matsumura, N, and Tanuma S. Involvement of cytosolic NAD+ glycohydrolase in cADP-ribose metabolism. Biochem Biophys Res Commun 253: 246-52, 1998[Web of Science][Medline].

51.   Meszaros, LG, Bak J, and Chu A. cADP-ribose as an endogenous regulator of the nonskeletal type ryanodine receptor Ca2+ channel. Nature 364: 76-79, 1993[Medline].

52.   Monkawa, T, Hayashi M, Miyawaki A, Sukiyama T, Yamamoto-Hino M, Hasegawa M, Furuichi T, Mikoshiba K, and Saruta T. Localization of inositol 1,4,5-triphosphate receptors in the rat kidney. Kidney Int 53: 296-301, 1998[Web of Science][Medline].

53.   Noguchi, N, Takasawa S, Nata K, Tohgo A, Kato I, Ikehata F, Yonekura H, and Okamoto H. cADP-ribose binds to FK506-binding protein 12.6 to release Ca2+ from islet microsomes. J Biol Chem 272: 3133-3136, 1997[Abstract/Free Full Text].

54.   Okamoto, H, Takasawa S, and Nata K. The CD38-cADP-ribose signaling system in insulin secretion: molecular basis and clinical implications. Diabetologia 40: 1485-1491, 1997[Web of Science][Medline].

55.   Pessah, I, Molinski T, Meloy T, Wong P, Buck E, Allen P, Mohr FC, and Mack MM. Bastadins relate ryanodine-sensitive and -insensitive Ca2+ efflux pathways in skeletal SR and BC3H1 cells. Am J Physiol Cell Physiol 272: C601-C614, 1997[Abstract/Free Full Text].

56.   Petersen, O, Gerasimenko O, Gerasimenko J, Mogami H, and Tepikin A. The calcium store in the nuclear envelope. Cell Calcium 23: 87-90, 1998[Web of Science][Medline].

57.   Richter, M, Schleithoff L, Deufel T, Lehmann-Horn F, and Herrmann-Frank A. Functional characterization of a distinct ryanodine receptor mutation in human malignant hyperthermia-susceptible muscle. J Biol Chem 272: 5256-5260, 1997[Abstract/Free Full Text].

58.   Schlondorff, D. Roles of the mesangium in glomerular function. Kidney Int 49: 1583-1585, 1996[Web of Science][Medline].

59.   Sharma, K, Wang L, Zhu Y, Bokkala S, and Joseph S. Transforming growth factor-beta 1 inhibits type I inositol 1,4,5-trisphosphate receptor expression and enhances its phosphorylation in mesangial cells. J Biol Chem 272: 14617-14623, 1997[Abstract/Free Full Text].

60.   Stockand, J, and Sansom S. Glomerular mesangial cells: electrophysiology and regulation of contraction. Physiol Rev 78: 723-744, 1998[Abstract/Free Full Text].

61.   Sundaresan, S, Weiss J, Bauer-Dantoin A, and Jameson J. Expression of ryanodine receptors in the pituitary gland: evidence for a role in gonadotropin-releasing hormone signaling. Endocrinology 138: 2056-2065, 1997[Abstract/Free Full Text].

62.   Takasawa, S, Nata S, Yonekura H, and Okamoto H. cADP-ribose in insulin secretion from pancreatic beta  cells. Science 259: 370-373, 1993[Abstract/Free Full Text].

63.   Tunwell, R, and Lai F. Ryanodine receptor expression in the kidney and a non-excitable kidney epithelial cell. J Biol Chem 271: 29583-29588, 1996[Abstract/Free Full Text].

64.   Walseth, T, and Lee H. Synthesis and characterization of antagonists of cADP-ribose-induced Ca2+ release. Biochim Biophys Acta 1178: 235-242, 1993[Medline].

65.   Walseth, TF, Aarhus R, Kerr JA, and Lee HC. Identification of cADP-ribose-binding proteins by photoaffinity labeling. J Biol Chem 268: 26686-26691, 1993[Abstract/Free Full Text].

66.  Wie H, Wei W, Bredesen D, and Perry D. Bcl-2 protects against apoptosis in neuronal cell line caused by thapsigargin-induced depletion of intracellular calcium stores. J Neurochem 70: 2305-2314.

67.   Yagui, K, Shimada F, Mimura M, Hashimoto N, Suzuki Y, Tokuyama Y, Nata K, Tohgo A, Ikehata F, Takasawa S, Okamoto H, Makino H, Saito Y, and Kanatsuka A. A missense mutation in the CD38 gene, a novel factor for insulin secretion: association with Type II diabetes mellitus in Japanese subjects and evidence of abnormal function when expressed in vitro. Diabetologia 41: 1024-1028, 1998[Web of Science][Medline].

68.   Zhang, X, Wen J, Bidasee K, Besch H, Wojcikiewicz J, Lee B, and Rubin RP. Ryanodine and inositol trisphosphate receptors are differentially distributed and expressed in rat parotid gland. Biochem J 340: 519-527, 1999.

69.   Zhu, Z, Neusser M, Tepel M, Spieker C, Golinski P, and Zidek W. Effect of Na-K-ATPase inhibition on cytosolic free calcium ions in vascular smooth muscle cells of spontaneously hypertensive and normotensive rats. J Hypertens 12: 1007-1012, 1994[Web of Science][Medline].

70.   Zucchi, R, and Ronca-Testoni S. The sarcoplasmic reticulum Ca2+ channel/ryanodine receptor: modulation by endogenous effectors, drugs and disease states. Pharmacol Rev 49: 1-51, 1997[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 281(1):F91-F102
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Satriano, R. Cunard, O. W. Peterson, T. Dousa, F. B. Gabbai, and R. C. Blantz
Effects on kidney filtration rate by agmatine requires activation of ryanodine channels for nitric oxide generation
Am J Physiol Renal Physiol, April 1, 2008; 294(4): F795 - F800.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. K. Fellner and W. J. Arendshorst
Voltage-gated Ca2+ entry and ryanodine receptor Ca2+-induced Ca2+ release in preglomerular arterioles
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1568 - F1572.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
I. Rivera, S. Zhang, B. S. Fuller, B. Edwards, T. Seki, M.-H. Wang, M. B. Marrero, and E. W. Inscho
P2 receptor regulation of [Ca2+]i in cultured mouse mesangial cells
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1380 - F1389.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. C. Rogers, M. J. Van Meter, and G. E. Hermann
Tumor Necrosis Factor Potentiates Central Vagal Afferent Signaling by Modulating Ryanodine Channels
J. Neurosci., December 6, 2006; 26(49): 12642 - 12646.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. D. Johnson, E. L. Ford, E. Bernal-Mizrachi, K. L. Kusser, D. S. Luciani, Z. Han, H. Tran, T. D. Randall, F. E. Lund, and K. S. Polonsky
Suppressed insulin signaling and increased apoptosis in CD38-null islets.
Diabetes, October 1, 2006; 55(10): 2737 - 2746.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. K. Fellner and W. J. Arendshorst
Angiotensin II Ca2+ signaling in rat afferent arterioles: stimulation of cyclic ADP ribose and IP3 pathways
Am J Physiol Renal Physiol, April 1, 2005; 288(4): F785 - F791.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Thompson, H. Barata da Silva, W. Zielinska, T. A. White, J. P. Bailey, F. E. Lund, G. C. Sieck, and E. N. Chini
Role of CD38 in myometrial Ca2+ transients: modulation by progesterone
Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1142 - E1148.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yusufi, A. N. K.
Right arrow Articles by Grande, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yusufi, A. N. K.
Right arrow Articles by Grande, J. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online