|
|
||||||||
1 Renal Pathophysiology Laboratory, Department of Physiology and Biophysics and 2 Division of Nephrology, Department of Medicine, Mayo Clinic, Mayo Medical School, Rochester, Minnesota 55905
| |
ABSTRACT |
|---|
|
|
|---|
Signaling via release
of Ca2+ from intracellular stores is mediated by several
systems, including the inositol 1,4,5-trisphosphate (IP3)
and cADP-ribose (cADPR) pathway. We recently discovered a high capacity
for cADPR synthesis in rat glomeruli and cultured mesangial cells (MC).
We sought to determine whether 1) cADPR synthesis in MC is
regulated by cytokines and hormones, 2) ryanodine receptors
(RyRs) are expressed in MC, and 3) Ca2+ is
released through RyRs in response to cADPR. We found that ADP-ribosyl
cyclase, a CD38-like enzyme that catalyzes cADPR synthesis, is
upregulated in MC by tumor necrosis factor-
, interleukin-1
, and
all-trans retinoic acid (atRA). [3H]ryanodine
binds to microsomal fractions from MC with high affinity in a
Ca2+-dependent manner; binding is enhanced by specific RyR
agonists and blocked by ruthenium red and cADPR. Western blot analysis confirmed the presence of RyR in MC. Release of
45Ca2+ from MC microsomes was stimulated by
cADPR; release was blocked by ruthenium red and 8-bromo-cADPR. ADPR
(non-cyclic) was without effect. In MC, TNF-
and atRA amplified the
increment of cytoplasmic Ca2+ elicited by vasopressin. We
conclude that MC possess elements of a novel ADP-ribosyl
cyclase
cADPR
RyR
Ca2+-release signaling pathway
subject to regulation by proinflammatory cytokines and steroid
superfamily hormones.
cytokines; retinoids; calcium-induced calcium release; adenosine 5'-diphosphate-ribosyl cyclase; crosstalk
| |
INTRODUCTION |
|---|
|
|
|---|
RELEASE OF CALCIUM FROM INTRACELLULAR stores, endoplasmic/sarcoplasmic reticulum (ER/SR), is one of the key signal transduction mechanisms that play a pivotal role in the regulation of numerous cellular functions (5). There are two major systems for Ca2+ release from intracellular stores (46). Widespread, and probably ubiquitous (45, 26), is a signaling system (6) mediated by the second messenger, inositol 1,4,5-trisphosphate (IP3). In this system, fast-onset, short-acting hormones such as vasoactive peptides bind receptors that are coupled within the plasma membrane to phosphatidylinositol phospholipase C (PI-PLC). This enzyme catalyzes generations of IP3; de novo generated IP3 binds the IP3 receptor channel (IP3Rs) that opens and releases Ca2+ from the ER/SR into the cytoplasm (6).
Another route for Ca2+ release from the ER/SR is through
the ryanodine receptor channel (RyRs). This channel is activated by Ca2+ itself (19, 40), and is so named the
Ca2+-induced Ca2+ release (CICR) pathway
(19). cADP-ribose (cADPR), a novel second messenger, is
synthesized from
-NAD by the enzyme, ADP-ribosyl cyclase
(40). cADPR increases sensitivity of RyR to
Ca2+ and thereby regulates Ca2+ release through
RyRs via the CICR mechanism (19, 40). In our recent
studies (11, 17, 3), we discovered that ADP-ribosyl cyclase is upregulated in various tissues and cell types by hormones of
the steroid superfamily such as
-estradiol (11),
3,5,3'-triiodothyronine (17), or all-trans
retinoic acid (atRA) (17, 3), which act with a slow onset
and have a prolonged effect. Furthermore, RyRs can be activated or
blocked by various specific pharmacological agonists and antagonists
(70).
In contrast to the ubiquitous IP3Rs (46, 45),
RyRs have a more limited tissue distribution (4).
Furthermore, the expression of RyRs and IP3Rs is regulated
independently, and often in opposing directions. For example,
incubation of cells with the cytokine transforming growth factor-
1
(TGF-
1) enhances expression of RyRs (25, 2) but
suppresses expression of IP3Rs (59).
Stimulation of muscarinic receptors reduces abundance of
IP3Rs without having an effect on expression of RyRs;
conversely, incubation in a differentiating medium markedly increases
expression of RyRs, but not of IP3Rs (45). In
end-stage heart failure, RyRs are downregulated in left ventricular
myocardium, whereas IP3Rs are upregulated
(27).
Mesangial cells (MC), specialized pericytes in glomeruli, are essential for maintenance and regulation of glomerular functions (8, 58, 60). In addition, MC are prime targets of immunoinflammatory injury in various types of glomerulonephritis (1, 58). Contractility and other MC functions are regulated, in major part, by Ca2+ released from ER/SR (1, 8, 58, 60). Numerous vasoactive peptides, bioactive lipids, and biogenic amines modulate MC functions by binding to requisite receptors in the plasma membrane and act via the IP3-Ca2+-release pathway (1). A recent immunohistochemical study documented the presence of IP3Rs in MC (52).
Although the IP3-Ca2+-release signaling system
has been well characterized in MC (1, 8, 58, 60), much
less is known about the cADPR
RyR
Ca2+ signaling
system. In particular, it is not known whether RyRs are expressed or
play a functionally significant role in cADPR-elicited Ca2+
release in MC. In our recent study examining cADPR metabolism in the
rat kidney (13), we found a strikingly high capacity for
cADPR synthesis in isolated glomeruli, 50 times higher than in the rest
of the examined renal parenchyma (13). We also identified ADP-ribosyl cyclase activity in cultured MC. As mentioned, in studies
of nonrenal tissues we determined that ADP-ribosyl cyclase is regulated
by long-acting hormones (11, 17, 3).
In view of all these considerations, we now set out to determine whether 1) ADP-ribosyl cyclase in MC is modulated by proinflammatory cytokines and by hormonal agents that act with slow onset and have prolonged action; 2) RyRs are expressed in MC and to what extent; and 3) Ca2+ is released through RyRs in response to a natural second messenger, cADPR (19, 40), and to typical pharmacological agonists of RyRs (70).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
[3H]ryanodine and 45Ca2+
were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). cADPR,
8-bromo-cADPR (8-Br-cADPR), ADPR, bastadin (bastadin mixture no.
196710), ruthenium red, and lipopolysaccharide (LPS, Pseudomonas
aeruginosa; F-D type 1) were purchased from Calbiochem (La Jolla,
CA). 4-Cloromethyl-m-cresol (4-CmC), 4-chloro-3-ethyl phenol
(4-CEP), and caffeine were from Aldrich (Milwaukee, WI). Monoclonal
antibodies (MAb) directed against ryanodine receptors, MA3-925 MAb
(34C) and MA3-916 MAb (C3-33), were purchased from Affinity
Bioreagents (Golden, CO). Recombinant human tumor necrosis factor-
(TNF-
), interleukin-1
(IL-1
), and atRA were from Biomol Research Laboratories (Plymouth Meeting, PA). Nicotinamide guanine dinucleotide (NGD), cGDP-ribose (cGDPR), 3,5,3'-triiodothyronine (T3), and all other chemicals and biochemicals, all of
highest purity grades, were from Sigma (St. Louis, MO) or other
standard suppliers.
MC. Glomeruli were isolated from 200-g male Sprague-Dawley rats by differential sieving, as previously described (10, 13, 49). Cell outgrowths were characterized as MC by positive immunohistochemical staining for vimentin, smooth muscle-specific actin, and desmin; stains for high- and low-molecular-weight cytokeratins, factor VIII-related antigen, and leukocyte-common antigens were negative. For all experiments described herein, MC were used before passage 20. There was no apparent effect of passage number on ADP-ribosyl cyclase activity, RyRs expression, or cADPR-mediated microsomal Ca2+ release activity. To evaluate the effect of hormones and cytokines on ADP-ribosyl cyclase, MC were grown in complete Waymouth's medium with 20% FCS in 100-mm culture dishes to confluence, rendered quiescent for 48 h in Waymouth's medium with 0.5% FCS, and then incubated with cytokines or hormones for 24 h. At the end of this incubation period, MC were rinsed, harvested, and subjected to sonication (3 cycles of 10 s each, 8-µm amplitude) in a "homogenizing buffer" containing (final concentrations) 0.25 M sucrose and 20 mM Tris · HCl (pH = 7.2). The homogenate was centrifuged first at 2,000 g for 10 min, and the resulting supernatant was then centrifuged at 40,000 g for 30 min. The pellet resuspended in homogenizing medium, designated as "membrane fraction" (11, 70), was assayed for ADP-ribosyl cyclase activity. In pilot experiments, we determined that all ADP-ribosyl cyclase activity in homogenates of MC is associated with membranes, and none was detected in supernatants from 100,000 g for 90 min (43). Homogenization and subsequent procedures were conducted at 0-4°C.
ADP-ribosyl cyclase activity.
Cyclase activity was determined by the fluorometric method of Lee et
al. (25, 26), which is based on the conversion of NGD, a
structural analog of NAD, to its fluorescent product, cGDPR (28), which we employed in our previous studies (11,
17). Membrane fractions from MC (see above) (~ 0.1 mg
protein/ml) were incubated in the homogenizing buffer (see above) in a
thermostated cuvette at 37°C with 0.4 mM NGD substrate, and
generation of fluorescent product cGDPR was continually monitored at
300-nm excitation wavelength and 410-nm emission wavelength, using a
Hitachi model F-2000 spectrofluorometer (11, 17). The
enzymatic activity was calculated from the initial linear slope; change
in fluorescence (
) was calibrated from standard curves construed
with known concentrations of cGDPR (3, 17, 28, 43). All
measurements were conducted in duplicate and are from four independent
experiments (17). The assay for ADP-ribosyl cyclase with
use of NGD substrate accurately determines ADP-ribosyl cyclase
activity, because the product cGDPR is, unlike cADPR, resistant to
degradation by cADPR hydrolase (28); in our preceding studies we affirmed concordance of results of ADP-ribosyl cyclase measured with NGD and NAD substrates, respectively (11,
17).
cADPR hydrolase activity. Hydrolase activity was determined by thin-layer chromatography (TLC) using 20 × 20-cm ion-exchange, polyethylenimine cellulose TLC plates with ultraviolet (UV) indicator. Membranes isolated from control and cytokine-treated MC (0.5 mg protein/ml) were incubated, in duplicate, for 30 min at 37°C in medium containing (final concentrations) 50 µM cADPR, 20 mM Tris · HCl (pH 7.4), and 0.2 µCi/ml [3H]cADPR. The reaction was terminated by mixing a 20-µl aliquot of the reaction mixture with a 20-µl stop solution containing (final concentration) 1 mM cADPR, 1 mM ADPR, and 10% glacial acetic acid, and storing on ice. The 40-µl aliquot was placed on the TLC plates, and the mixture was separated in a TLC chamber containing 0.2 M NaCl and 30% ethanol at room temperature for a period of 2.5 h. The plates were dried, and the fractions were identified by a 254-nm UV light. The cADPR fraction was removed from the plate, placed in liquid scintillation vials, radioactivity was determined by a Beckman LS6000 liquid scintillation counter, and cADPR hydrolase activity was calculated by comparing initial [3H]cADPR levels with those measured after 30 min of incubation.
Isolation of microsomes.
Microsomal fractions were isolated (at 0-4°C) from cultured rat
MC or from rat myocardium. MC or myocardium, finely minced with a razor
blade, were suspended in a buffer containing 300 mM sucrose, 10 mM
HEPES, 0.1 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride (PMSF)
(pH = 7.4), and homogenized by Polytron (3 × 30 s at
setting 10). The homogenate was centrifuged for 10 min at 1,600 g, and the pellet was discarded. The supernatant was
further centrifuged at 11,000 g for 20 min, and the
supernatant thus obtained was ultracentrifuged at 100,000 g
for 1 h. The pellet was resuspended in a small volume of
homogenizing buffer by Dounce homogenizer. The microsomes were either
used fresh for measurement of 45Ca2+ release or
were divided into aliquots, quickly frozen, and stored at
80°C for
measurement of [3H]ryanodine binding. Storage at
80°C
preserved the [3H]ryanodine binding capacity of
microsomes. The protein content of fractions was determined by the
method of Lowry et al. (44).
[3H]ryanodine binding. Microsomes (100-200 µg protein) were incubated for 2 h at 37°C in a medium containing (final concentration) 600 mM KCl, 100 µM EGTA, 150 µM Ca2+, 0.2 mM PMSF, 25 mM HEPES (pH 7.2), and 30 nM [3H]ryanodine (54.7 Ci/mmol). Free [3H]ryanodine was separated from [3H]ryanodine, bound to microsomes by a rapid filtration technique using Whatman GF/B filters, followed by three subsequent washes with 3 ml of ice-cold water. The [3H]ryanodine radioactivity that remained on the filters was measured by liquid scintillation counting (18, 57). The high-affinity specific [3H]ryanodine binding was calculated as the difference of total binding and nonspecific binding, determined in the presence of >3,000-fold higher concentration of unlabeled ryanodine (0.1 mM).
45Ca2+ release from microsomes (32). Freshly prepared microsomes (~100 µg protein) were passively loaded by incubating for 3 h at room temperature (21°C) in a medium containing 100 mM NaCl, 25 mM HEPES (pH 7.2), 1 mM CaCl2, and 1 µCi of 45Ca2+. Release of 45Ca2+ from loaded microsomes was initiated by 10-fold dilution of microsomal suspension with a buffer containing 100 mM NaCl, 1 mM EGTA, 1 mM MgCl2, and 25 mM HEPES, pH 7.2 (32). After 10 s, the suspension was further diluted in a medium of identical composition that contained tested agonists with or without 10 µM ruthenium red (final dilution 50-fold). 45Ca2+ efflux was stopped at 90 s after the second dilution with added test agents, and the 45Ca2+ retained in microsomes was separated from free 45Ca2+ by a rapid filtration technique using Whatman GF/B filters. The filters were rinsed three times with a solution containing 100 mM NaCl, 1 mM EGTA, 4 mM MgCl2, 10 µM ruthenium red, and 25 mM HEPES, pH 7.2. The 45Ca2+ retained in microsomes was determined by liquid scintillation counting.
Measurement of cytoplasmic Ca2+ concentration. Cytoplasmic Ca2+ concentration ([Ca2+]i) in intact MC was measured in monolayers grown to confluence on 9 × 22-mm coverslips (69). MC were treated with cytokines for 24 h, as described above. Coverslips with MC were rinsed two times in PBS and then incubated with 1 µM of the acetoxymethyl ester of fura 2 (fura 2-AM) for 1 h at room temperature in a solution of (final concentrations) 135 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 5.5 mM D-glucose, and 10 mM HEPES, pH 7.4. After fura 2-AM loading, coverslips were washed and placed into thermostated (37°C) cuvettes of the Hitachi model F-2000 fluorescence spectrophotometer. Vasopressin was added to cells, and emitted fluorescence was measured using dual wavelength ratios of 340/380 nm for excitation and 510 nm for emissions, and [Ca2+]i values were determined from the standard curve using Cation Measurement software.
PCR analysis. Total RNA was isolated from rat MC using the RNeasy Total RNA Isolation Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Reverse transcription and PCR amplification were performed using the GeneAmp System (Perkin-Elmer, Branchburg, NJ).
CD38. PCR analysis of CD38 was performed using primers homologous to the rat ADP-ribosyl cyclase/cADPR hydrolase (CD38; GenBank accession no. D29646) (37). The sense primer, 5'-CCTTGGTAGTGGTCGTGGTCATAG-3', and antisense primer, 5'-TCACATTCCAGAACACAGCAACAG-3', were designed to produce a 480-bp product. The PCR conditions were 95°C for 5 min, and then 40 cycles at 95°C for 1 min, 42°C for 1 min, and 72°C for 1 min, followed by a final extension at 72°C for 7 min, and storage at 4°C. The PCR product was subcloned into the pCRII vector (Invitrogen, Carlsbad, CA) and sequenced in both orientations. The cDNA product was used in subsequent Northern blot analyses (see below).
RyRs. PCR analysis of RyR-1, RyR-2, and RyR-3 was performed essentially as previously described (16), with the addition of a DNase I treatment (RNase-free DNase I; Roche Molecular Chemicals, Indianapolis, IN) to eliminate residual genomic DNA. Design of PCR primers was based on GenBank accession nos. X83932 (RyR-1), X83933 (RyR-2), and X83934 (RyR-3) (16). The nucleotide sequence and length of expected PCR products for each primer pair are RyR-1 (sense), GAAGGTTCTGGACAAACACGGG; RyR-1 (antisense), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RyR-2 (sense), GAATCAGTGAGTTACTGGGCATGG; RyR-2 (antisense), CTGGTCTCTGAGTTCTCCAAAAGC (635 bp); RyR-3 (sense), AGAAGAGGCCAAAGCAGAGG; and RyR-3 (antisense), GGAGGCCAACGGTCAGA (269 bp). All PCR products were sequenced in both orientations.
Northern blot analysis.
Quiescent rat MC were treated with atRA (1 µM), TNF-
(20 ng/ml),
or both atRA (1 µM) and TNF-
(10 ng/ml) for 18 h before isolation of total cellular RNA. RNA (10 µg/lane) was electrophoresed through a 1% agarose, 2.2 M formaldehyde denaturing gel, then transferred to nylon membranes (Schleicher and Schuell, Keene NH), as
previously described (30, 29). Ethidium bromide was added
to each lane to allow visualization of the RNA with UV light. The
complete transfer of the RNA from the gel to the membrane was
documented by examining the membrane under UV light. The CD38 PCR
product was excised from the pCRII vector and labeled with [
-32P]dCTP by the random primer method
(20). Membranes were hybridized at 65°C in a 0.5 M
sodium phosphate buffer, pH 7.0, containing 1 mM EDTA, 7% SDS, and 1%
BSA, as described by Church and Gilbert (14). Gels were
reprobed with a cDNA-encoding housekeeping gene, GAPDH. Autoradiograms
were quantitated by computer-assisted video densitometry. Data for 18S
ribosomal RNA were obtained from a negative image of the ethidium
bromide-stained nylon membrane, according to the method of
Correa-Rotter et al. (15). The CD38 signal in each lane
was normalized to the corresponding GAPDH band, as previously described
(29).
Western blot analysis.
SDS-PAGE was performed using 7.5% gels cast in the PROTEAN II minigel
system (Bio-Rad). Microsomes (~100 µg protein) were denatured for 3 min at 95°C in loading buffer according to Laemmli (38).
Electrophoresis was performed at a constant current (20 mA/gel) and
transferred to nitrocellulose membranes, and the blots were incubated
with mouse anti-RyR monoclonal antibodies using either MAb MA3-925
(34C) that reacts with both RyR-1 and RyR-2 or MAb MA3-916
(C3-33) that reacts strongly with RyR-2 type, and only faintly
with RyR-1. Blots were incubated with anti-mouse secondary antibody for
1 h and visualized by exposure to X-ray film using an enhanced
chemiluminescence technique (Amersham Pharmacia Biotech). Western blots
prepared from membranes isolated from control, TNF-
-treated, and
TNF-
+atRA-treated renal MC were incubated with an anti-CD38 antibody
[goat polyclonal anti-CD38 (M-19), Santa Cruz] and visualized, as
described above.
| |
RESULTS |
|---|
|
|
|---|
ADP-ribosyl cyclase activity in MC membranes was upregulated by
incubation with cytokines and with steroid superfamily hormones (Fig.
1). The proinflammatory cytokines TNF-
and IL-1 significantly induced ADP-ribosyl cyclase activity in
membranes isolated from MC (TNF
+46%, P < 0.05;
and IL-1
+38%, P < 0.05). Similarly, the steroid
superfamily hormone atRA (1 µM) increased ADP-ribosyl cyclase
activity (
+76%, P < 0.05) (Fig. 1). Combined
treatment of MC with TNF-
and atRA, which signal through different
pathways, produced at least an additive upregulation of ADP-ribosyl
cyclase activity (
+145%, P < 0.05) compared with
the effects of atRA or TNF-
alone. T3, another steroid
superfamily hormone, did not significantly augment ADP-ribosyl cyclase
activity (
+19%, P > 0.05, Fig. 1). Under these
experimental conditions, bacterial LPS did not significantly increase
ADP-ribosyl cyclase activity in MC (
+12%, P > .05).
|
In other cell systems, CD38 and related enzymes are recognized as
multifunctional enzymes (39). Whereas CD38 promotes cADPR formation from
-NAD through cyclase activity, CD38 also has
hydrolase activity, which promotes the catabolism of cADPR to ADPR
(39). To determine whether TNF-
, atRA, or LPS induces
ADP-ribosyl cyclase activity to a greater extent than cADPR hydrolase
activity, we assayed ADP-ribosyl cyclase activity and cADPR hydrolase
activity in membranes isolated from parallel cultures of MC treated
with TNF-
, atRA, and atRA plus TNF-
. TNF-
and atRA increased
ADP-ribosyl cyclase activity to a much greater extent than cADPR
hydrolase activity (Fig. 2). Although the
combined treatment of MC with TNF-
plus atRA significantly augmented
ADP-ribosyl cyclase activity, these combined treatments did not
significantly alter cADPR hydrolase activity (Fig. 2). Similarly,
combined treatment of MC with LPS and TNF-
did not significantly
alter cADPR hydrolase activity, compared with treatment with LPS or
TNF-
alone (data not shown).
|
Several approaches were employed to define the nature of MC ADP-ribosyl
cyclase activity. By using appropriate primers, a 480-bp cDNA was
amplified from reverse-transcribed MC RNA with 100% sequence identity
to the rat CD38-like ADP-ribosyl cyclase/cADP ribose hydrolase isolated
from rat pancreatic islets (GenBank accession no. D29646, data not
shown) (37). By Northern blot analysis, a distinct 2.2-kb
band was identified in MC, corresponding to CD38 mRNA. Relatively low
levels of CD38 expression were detected in untreated control rat MC
(Fig. 3). atRA (1 µM) and TNF-
induced steady-state CD38 mRNA
levels by 2.2-fold (P < 0.001) and 1.4-fold (P < 0.05), respectively (Fig.
3). Increased CD38 mRNA levels were
observed after 2-h treatment with atRA and reached maximal levels after
12-18 h (data not shown). The combined treatment of rat MC for
18 h with atRA (1 µM) and TNF-
induced CD38 mRNA levels by
2.8-fold (P < 0.001) (Fig. 3). These studies indicate that TNF-
- and atRA-mediated increases in ADP-ribosyl cyclase activity are associated with a concomitant induction of steady-state CD38 mRNA levels.
|
By Western blot analysis, a 42-kDa CD38-like protein was identified in
membranes isolated from rat MC (Fig. 4).
In parallel with ADP-ribosyl cyclase activity (Fig. 1), atRA and
TNF
+atRA increased expression of the CD38-like protein [
+%
24 ± 5 vs. untreated control (P < 0.05) and
+% 42 ± 6 vs. untreated control (P < 0.05),
respectively; n = 6 experiments, each performed in duplicate] (Fig. 4). These studies indicate that cytokine-mediated ADP-ribosyl cyclase activity may at least in part be mediated through
increased production of a CD38-like protein. Furthermore, cytokine-mediated induction of CD38 mRNA and protein leads to preferential activation of ADP-ribosyl cyclase activity relative to
cADPR hydrolase activity.
|
In other cell systems, intracellular Ca2+ release by cADPR
is mediated by the RyR channel. However, the presence of such an RyR
channel in MC has not been previously documented. We found that
[3H]ryanodine specifically binds to microsomal fractions
isolated from MC in a Ca2+-dependent fashion (Fig.
5A). The
[3H]ryanodine binding was suppressed by the addition of
molar excess (greater than ×3,000) of unlabeled ryanodine and was also
blocked by 10 µM ruthenium red (Fig. 5A), an established
inhibitor of RyRs (19, 40). Specific binding of
[3H]ryanodine to microsomes prepared from MC (91 ± 22 fmol · mg protein
1 · 120 min
1) was about threefold less (P < 0.01) than [3H]ryanodine binding to microsomes prepared
from rat myocardium (324 ± 20 fmol · mg
protein
1 · 120 min
1) (data not
shown).
|
To further document the specificity of [3H]ryanodine
binding to MC microsomes, we measured [3H]ryanodine
binding in the presence of caffeine, a well-known and established RyR
agonist (19, 36, 40), and in the presence of several
recently described pharmacological agonists that interact specifically
with RyRs (18, 32, 36, 55, 57). We found that 4-CmC,
4-CEP, and the alkaloids bastadin and caffeine all significantly
enhanced [3H]ryanodine binding to microsomes of MC (Fig.
5B). Moreover, [3H]ryanodine binding to MC
microsomes was inhibited by 10 µM cADPR. This effect was blocked by
8-Br-cADPR, a selective antagonist of cADPR. ADPR (non-cyclic) had no
effect on [3H]ryanodine binding to MC microsomes (Fig.
5C ). The presence of RyR-1, -2, and -3 was identified in MC
by RT-PCR (Fig. 6A).
|
Immunoblot analysis, using RyR isoform-specific antibodies, confirmed
the presence of RyR-1 in MC microsomes (Fig. 6B). When a
Western blot was probed with MAb MA3-925 (that recognizes RyR-1 and RyR-2 isoforms equally), two major bands were detected at Mr
560 kDa (Fig. 6B,
lanes 1 and 2). When probed with MAb
MA3-916, which strongly reacts with RyR-2 but weakly with RyR-1,
strong bands were detected in microsomal preparations from rat
myocardium, but no bands were detected in microsomes from MC even after
prolonged exposure (Fig. 6B, lanes 3 and
4), indicating that MC expression of RyR-2 is extremely low.
Taken together, these data indicate that MC possess RyR-1 and possibly
RyR-3, with low levels of RyR-2 expression.
To determine the functional significance of RyRs in MC, we measured
Ca2+ release from MC microsomes that were preloaded with
45Ca2+. cADPR elicited
45Ca2+ release from rat MC microsomes in a
dose-dependent fashion (Fig. 7). The
release of 45Ca2+ was significantly
(P < 0.01) increased by cADPR, a natural RyR agonist
(19, 40), by caffeine (19, 36, 40), and by
4-CmC (57, 69) (Fig.
8A). The stimulatory effects
of cADPR and pharmacological agonists on 45Ca2+
release from MC microsomes were all blocked by ruthenium red (Fig. 8,
A and B). The cADPR-stimulated
45Ca2+ release (
% + 62 ± 9;
means ± SE, P < 0.025, t-test;
n = 3) was blocked by the selective cADPR antagonist
8-Br-cADPR (64); furthermore, ADPR (non-cyclic), a
hydrolytic metabolite of cADPR (19, 40), showed no effect
on 45Ca2+ release (Fig. 8B). Release
of 45Ca2+ mediated by cADPR was 60-70% of
45Ca2+ release induced by ionomycin or
IP3 (Fig. 8, B and C).
IP3-mediated 45Ca2+ release was
blocked by heparin and not by ruthenium red, as expected (Fig.
8C).
|
|
Finally, we determined whether the RyR agonist caffeine can enhance the
increment of cytoplasmic Ca2+ level evoked by vasopressin
in intact MC (Fig. 9A). The
extent of Ca2+ increase in intact MC elicited by
vasopressin (
% +137 ± 17; n = 5) was enhanced
twofold (P < 0.01) in the presence of 10 mM caffeine
(
% +281 ± 33, means ± SE; n = 5). The
vasopressin-elicited Ca2+ release was also significantly
increased by TNF-
and atRA combined (Fig. 9B).
|
| |
DISCUSSION |
|---|
|
|
|---|
Release of Ca2+ from intracellular stores governs major functions of MC, such as contractility (58, 60), and plays a key role in signal transduction pathways by which many hormonal agents regulate MC functions in physiological and pathobiological states (1, 8, 58, 60).
In general, signaling pathways that transduce effects of fast-onset,
short-acting hormonal agents in MC, such as vasoactive peptides (e.g.,
endothelin, vasopressin), often employ the well-established IP3-IP3R-Ca2+-release system
(1, 5, 6, 58). This signaling pathway includes binding of
a hormone to its receptor, coupled in the plasma membrane via
Gq to PI-PLC, that increases generation of IP3;
the de novo generated IP3 binds onto IP3Rs
within SR/ER membranes and triggers release of Ca2+ as a
signal into the cytoplasm (Fig. 10).
|
Herein we report that MC possess elements of a
"cADPR
RyR
Ca2+-release" signaling pathway and that
this pathway differs substantially in design and function from the
classic IP3-Ca2+-release pathway (6, 14,
19, 40). First, Ca2+ release from MC is elicited by
a novel second messenger, cADPR, that sensitizes RyRs to
Ca2+ and activates and/or facilitates CICR (14, 19,
40). Second, MC are capable of synthesizing cADPR from
-NAD,
a reaction catalyzed by ADP-ribosyl cyclase. Finally, Ca2+
is released from MC through a distinct RyR channel that differs in
properties, namely regulation, from IP3Rs (19, 40,
46).
Several distinct molecules with ADP-ribosyl cyclase activity have been identified, including a soluble ADP-ribosyl cyclase isolated from Aplysia californica ovotestis, a cytosolic enzyme capable of metabolizing cADPR isolated from sea urchin egg extracts (15, 19, 37, 39, 41), and the membrane-bound ADP-ribosyl cyclases CD38 and BST-1/CD157 (33). We found that virtually all of the MC Ca2+ release activity attributable to cADPR was membrane bound; no significant cytosolic Ca2+ release activity was detected. In several other mammalian cells and tissues, including rat liver homogenates, uterine smooth muscle cells, and vascular smooth muscle cells, we found that almost all of the cADPR-mediated Ca2+ release activity is membrane associated (11, 17, 43). Furthermore, we failed to demonstrate BST-1 expression in membrane extracts from MC (Walker HJ, Yusufi ANK, and Dousa TP, unpublished observations). Based on these considerations, we sought to determine whether Ca2+ release activity elicited by cADPR may be mediated by a CD38-like ADP-ribosyl cyclase.
By RT-PCR, we found that MC possess a CD38-like molecule with 100%
sequence homology to the rat CD38-like ADP-ribosyl cyclase/cADPR hydrolase isolated from rat pancreatic islets. The presence of a
CD38-like protein in rat MC was confirmed by Western blot analysis (Fig. 3). CD38 has recently been identified in a variety of mammalian cells including liver (43), brain (50),
vascular and uterine smooth muscle (11, 17), T cells
(31), and pancreatic islets (54, 62). In rat
pancreas, the CD38
cADPR
RyR
Ca2+ signaling pathway
is regulated by glucose and is involved in regulation of insulin
secretion (54, 62). In diabetic patients, autoantibodies
directed against CD38 (35) and missense mutations in the
CD38 gene (67) have been identified.
In concert with increased ADP-ribosyl cyclase activity, we found that
atRA and TNF-
induce CD38 mRNA expression and production of a
CD38-like protein, as assessed by Western blot analysis. Because we did
not identify soluble ADP-ribosyl cyclase activity or BST-1 in MC, we
postulate that basal and cytokine-induced ADP-ribosyl cyclase activity
in MC is directed by a CD38-like protein. However, further studies such
as CD38 antibody neutralization studies, CD38 antisense studies, or
Ca2+ release experiments using cells derived from CD38
knockout animals are needed to determine whether atRA or
TNF
-mediated induction of CD38 is causally related to increases in
ADP-ribosyl cyclase activity in MC.
CD38 and other ADP-ribosyl cyclases are multifunctional enzymes that
are capable of catalyzing the hydrolysis of cADPR to ADPR as well as
the production of cADPR from
-NAD (34). Under our
experimental conditions, ADP-ribosyl cyclase activity in MC is
preferentially induced by atRA and TNF-
, without significant effects
on cADPR hydrolase activity. We observed that the extent of
Ca2+ increase in intact MC elicited by vasopressin was
augmented by pretreatment with TNF-
and atRA or pretreatment with
the RyR agonist caffeine. These studies provide indirect evidence that atRA- and TN-
-mediated induction of ADP-ribosyl cyclase produces functionally significant increases in intracellular Ca2+ fluxes.
Several lines of evidence document that functionally competent RyRs are expressed in MC. The high-affinity, [3H]ryanodine Ca2+-dependent binding is now a well-established method for detection and quantitation of RyRs (18, 45, 57). [3H]ryanodine binding to MC microsomes requires relatively high KCl concentrations. This requirement for high KCl concentrations to demonstrate specific ryanodine binding in a variety of mammalian cells and tissues, including smooth muscle cells, LLC-PK1 cells, and extracts from renal cortex, has been reported by other investigators (4, 18, 63). The observation that [3H]ryanodine binding to microsomes from MC is significantly enhanced by specific pharmacological agonists of RyRs is diagnostic (Fig. 5B): caffeine (32, 36, 57), 4-CmC (18, 32, 36, 57), 4-CEP (18, 36), and the alkaloid bastadin (18, 55) all acted in a similar manner. All of these agonists enhance binding of [3H]ryanodine to microsomes from skeletal muscle, myocardium, and other tissues (18, 32, 36, 55, 57). The presence of RyR in MC microsomes was confirmed by Western blot analysis (Fig. 6).
We found that cADPR inhibits [3H]ryanodine binding to MC microsomes. This observation would suggest that cADPR and ryanodine compete for binding to a similar site on the ryanodine receptor channel (19). In other systems, variable effects of cADPR on [3H]ryanodine binding have been described. In cardiac SR vessels and in lymphocytes, cADPR enhances [3H]-ryanodine binding (9, 31, 51). In parotid cells and, as described here in MC, cADPR competes with [3H]ryanodine for binding to the ryanodine receptor channel (68). Recent data suggest that cADPR indirectly interacts with the ryanodine receptor channel, through interactions with one or more accessory proteins (46, 65), such as the FK506 binding protein 12.6 (53).
By RT-PCR, we have identified RyR-1, -2, and -3 in MC. By Western blot analysis, MC express relatively high levels of RyR-1, with minimal expression of RyR-2. High levels of RyR-1 expression have been described in skeletal muscle and smooth muscle, RyR-2 expression in cardiac muscle (5) and pancreatic acinar cells (42), and RyR-3 expression in brain, smooth muscle cells, and other tissues (21, 47, 48, 61, 68). Future studies, using RyR-3-specific antibodies, are needed to define the level of RyR-3 expression in MC.
The functional competence of RyRs for Ca2+ release from MC is evidenced by measurements of in vitro release of 45Ca2+ from preloaded MC microsomes (Fig. 8). The natural second messenger cADPR (19, 40), as well as the pharmacological RyR agonists caffeine (36, 57) and 4-CmC (18, 32, 57), all elicited 45Ca2+ release from MC microsomes to the same extent (Fig. 8A). The 45Ca2+-releasing effects of all these agents were prevented by the RyR blocker ruthenium red (Fig. 8, A and B), and the 45Ca2+-releasing effect of cADPR was blocked by a selective inhibitor, 8-Br-cADPR (64). ADPR, an inactive hydrolytic metabolite of cADPR (14, 19, 40), was without effect on 45Ca2+ release (Fig. 8B). All these observations evince that 45Ca2+ release through RyRs in MC is sensitive to stimulation by cADPR, a novel second messenger.
In experiments on intact monolayers of MC, we observed that the RyR
agonist caffeine enhanced the increment in cytoplasmic Ca2+
level that was elicited by vasopressin. Conceivably, by activating RyRs
and CICR, caffeine sensitized the IP3Rs to the
Ca2+-releasing action of IP3 generated in
response to vasopressin and produced an enhanced rise of
Ca2+ (Fig. 9A). atRA+TNF-
also enhanced
vasopressin-mediated increases in cytoplasmic Ca2+ (Fig.
9B). These findings are consistent with the notion that RyRs
can be activated in the intact MC and that there may be crosstalk between the functionally distinct cADPR and IP3 signaling
pathways. However, the exact mechanism by which this occurs remains to
be clarified in future studies.
Because the cADPR
RyR
Ca2+-release signaling system and
the IP3
IP3R
Ca2+-release
signaling system do coexist in MC, it should be considered whether
these two pathways interact with each other and regulate MC functions
in a coordinated, integrated manner. A major point of mutual
interaction is the fact that both RyRs (19, 14) and
IP3Rs (12, 22) can behave as CICR and thereby
may influence release of Ca2+ via each other. We thus
propose, as a working hypothesis (Fig. 10), that slow-onset,
long-acting "adaptive" cytokines and hormones, which act via
upregulating the ADP-ribosyl cyclase
cADPR
RyR
CICR pathway,
regulate and control primarily the ambient, steady-state Ca2+ levels in cytoplasm. The level of cytoplasmic
Ca2+ determines sensitivity of IP3Rs to the
Ca2+-releasing effect of IP3 that is generated
in response to fast-acting hormones, such as vasoactive peptides. In
short, via this mechanism, long-acting adaptive hormones would modulate
the responsiveness of MC to fast-acting hormones and autacoids.
Conversely, Ca2+ released in response to IP3
may contribute to enhance activity of RyRs as positive feedback to CICR
(Fig. 10).
Conceivably, hormones that act via the
cADPR
RyR
Ca2+-release signaling pathway can
regulate other cellular functions of MC in addition to contractility.
As recently reported, RyRs and IP3Rs can be differentially
distributed within one cell (68): IP3Rs were
detected close to plasma membranes, whereas RyRs were located in the
perinuclear region (68). cADPR has been shown to elicit release of Ca2+ through RyRs into the nucleus (23,
56), and as a result, nuclear Ca2+ levels elevated
in response to cADPR can modulate expression of various genes via
Ca2+-dependent phosphorylation-dephosphorylation of
transcription factors (e.g., CREB, CREM, SRF) (24).
The cADPR
RyR
Ca2+-release signaling pathway might also
play a role in initiation of apoptosis. This possibility
is suggested by observations that release of Ca2+ from
intracellular stores by thapsigargin (66) or cyclopiazonic acid (7, 66) can cause apoptosis (9, 51,
63). Apoptosis initiated by thapsigargin or by other
maneuvers was prevented or attenuated by dantrolene (51)
and ruthenium red (51, 68), both blockers of RyRs.
In conclusion, we provide evidence that MC are endowed with a novel
cADPR
RyR
Ca2+-release signaling pathway and that
biosynthesis of the initial step, second messenger cADPR, is
upregulated by proinflammatory cytokines and steroid superfamily
hormones. We surmise that the cADPR
RyR
Ca2+-release
regulatory pathway in MC is an essential, hitherto unrecognized, signaling system operant in the regulation of contractility and other
functions of MC. It represents another layer of signaling machinery
that governs normal glomerular MC functions and interacts, via
crosstalk, with other signaling pathways. Finally, it can also play a
pathogenic role in glomerular inflammation and may be a potential
target for signal transduction pharmacotherapy.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge James Haugen for providing excellent technical assistance and Cherish Grabau and Carol Davidson for providing excellent secretarial assistance.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-16105 and DK-55603 and by the Mayo Foundation. J. Cheng, is a postdoctoral research fellow supported by the Mayo Foundation.
Address for reprint requests and other correspondence: J. P. Grande, Mayo Clinic, 200 First St., SW, Guggenheim Bldg. 501, Rochester, MN 55905 (E-mail: grande.joseph{at}mayo.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 15 June 2000; accepted in final form 23 March 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ardaillou, R,
Ronco P,
and
Rondeau E.
Biology of renal cells in culture.
In: The Kidney, edited by Brenner B.. Philadelphia, PA: Saunders, 1996, p. 99-192.
2.
Awad, S,
Lamb H,
Morgan J,
Dunlop W,
and
Gillespie J.
Differential expression of ryanodine receptor RyR2 mRNA in the nonpregnant and pregnant human myometrium.
Biochem J
322:
777-783,
1997.
3.
Beers, K,
Chini E,
and
Dousa T.
All-trans-retinoic acid stimulates synthesis of cADP-ribose in renal LLC-PK1 cells.
J Clin Invest
95:
2385-2390,
1995.
4.
Bennett, D,
Cheek T,
Berridge M,
De Smedt H,
Parys J,
Missiaen L,
and
Bootman MD.
Expression and function of ryanodine receptors in nonexcitable cells.
J Biol Chem
271:
6356-6362,
1996
5.
Berridge, M.
Elementary and global aspects of calcium signaling.
J Physiol (Lond)
499:
291-306,
1997[ISI][Medline].
6.
Berridge, M.
Inositol triphosphate and calcium signaling.
Ann NY Acad Sci
766:
31-43,
1995[ISI][Medline].
7.
Bian, X,
Hughes F,
Huang Y,
Cidlowski J,
and
Putney J.
Roles of cytoplasmic Ca2+ and intracellular Ca2+ stores in induction and suppression of apoptosis in S49 cells.
Am J Physiol Cell Physiol
272:
C1241-C1249,
1997
8.
Bonventre, J.
Calcium and calcium-related signaling pathways in glomerular mesangial cells.
Clin Exp Pharmacol Physiol
23:
65-70,
1996[ISI][Medline].
9.
Bourguignon, LY,
Chu A,
Jin H,
and
Brandt NR.
Ryanodine receptor-ankyrin interaction regulates internal Ca2+ release in mouse T-lymphoma cells.
J Biol Chem
270:
17917-22,
1995
10.
Chini, E,
Chini C,
Bollinger C,
Jougasaki M,
Grande J,
Burnett J,
and
Dousa TP.
Cytoprotective effects of adrenomedullin in glomerular cell injury: central role of cAMP signaling pathway.
Kidney Int
52:
917-925,
1997[ISI][Medline].
11.
Chini, E,
de Toledo F,
Thompson M,
and
Dousa T.
Effect of estrogen upon cADP ribose metabolism: b-estradiol stimulates ADP ribosyl cyclase in rat uterus.
Proc Natl Acad Sci USA
94:
5872-5876,
1997
12.
Chini, E,
and
Dousa T.
Nicotinate-adenine dinucleotide phosphate-induced Ca2+ release does not behave as a Ca2+-induced Ca2+-release system.
Biochem J
316:
709-711,
1996.
13.
Chini, E,
Klener P,
Beers K,
Chini C,
Grande J,
and
Dousa T.
cADP-ribose metabolism in rat kidney: high capacity for synthesis in glomeruli.
Kidney Int
51:
1500-1506,
1997[ISI][Medline].
14.
Church, GM,
and
Gilbert W.
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995,
1984
15.
Correa-Rotter, R,
Mariash CN,
and
Rosenberg ME.
Loading and transfer control for Northern hybridization.
Biotechniques
12:
154-158,
1992[ISI][Medline].
16.
Coussin, F,
Macrez N,
Morel JL,
and
Mironneau J.
Requirement of ryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ release in vascular myocytes.
J Biol Chem
275:
9596-9603,
2000
17.
de Toledo, F,
Cheng J,
and
Dousa T.
Retinoic acid and triiodothyronine stimulate ADP-ribosyl cyclase activity in rat vascular smooth muscle cells.
Biochem Biophys Res Commun
238:
847-850,
1995.
18.
DiJulio, D,
Watson E,
Pessah I,
Jacobson K,
Ott S,
Buck E,
and
Singh JC.
Ryanodine receptor type III (Ry3R) identification in mouse parotid acini.
J Biol Chem
272:
15687-15696,
1997
19.
Dousa, T,
Chini E,
and
Beers K.
Adenine nucleotide diphosphates: emerging second messengers acting via intracellular Ca release.
Am J Physiol Cell Physiol
271:
C1007-C1024,
1996
20.
Feinberg, AP,
and
Vogelstein B.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
132:
6-13,
1983[ISI][Medline].
21.
Galione A and Churchill G. cADP ribose as a calcium-mobilizing
messenger. [Online]. Science's Signal Transduction Knowledge
Environment. http://www.stke.org/cgi/content/full/OC_sigtrans;
2000/41/pe1 [2000, Jul.].
22.
Galione, A.
Ca2+-induced Ca2+ release and its modulation by cyclic ADP-ribose.
Trends Pharmacol Sci
13:
304-306,
1992[Medline].
23.
Gerasimenko, O,
Gerasimenko J,
Tepikin A,
and
Petersen O.
ATP-dependent accumulation and inositol triphosphate- or cADP-ribose-mediated release of Ca2+ from the nuclear envelope.
Cell
80:
439-444,
1995[ISI][Medline].
24.
Ghosh, A,
Ginty D,
Bading H,
and
Greenberg M.
Calcium regulation of gene expression in neuronal cells.
J Neurobiol
25:
294-303,
1994[ISI][Medline].
25.
Giannini, G,
Clementi E,
Ceci R,
Marziali G,
and
Sorrentino V.
Expression of a ryanodine receptor-Ca2+ channel that is regulated by TGF-
.
Science
257:
91-94,
1992
26.
Giannini, G,
Conti A,
Mammarella S,
Scrobogna M,
and
Sorrentino V.
The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues.
J Cell Biol
128:
893-904,
1995
27.
Go, L,
Moschella M,
Watras J,
Handa K,
Fyfe B,
and
Marks A.
Differential regulation of two types of intracellular calcium release channels during end-stage heart failure.
J Clin Invest
95:
888-894,
1995.
28.
Graeff, R,
Walseth T,
Fryxell K,
Branton W,
and
Lee H.
Enzymatic synthesis and characterizations of cGDP-ribose.
J Biol Chem
269:
30260-30267,
1994
29.
Grande, J,
Melder D,
Zinsmeister A,
and
Killen P.
TGF-
1 induces collagen IV gene expression in NIH-3T3 cells.
Lab Invest
69:
387-395,
1993[ISI][Medline].
30.
Grande, JP,
Melder DC,
and
Zinsmeister AR.
Modulation of collagen gene expression by cytokines: stimulatory effect of transforming growth factor-
1, with divergent effects of epidermal growth factor and tumor necrosis factor-a on collagen type I and collagen type IV.
J Lab Clin Med
130:
476-486,
1997[ISI][Medline].
31.
Guse, AH,
da Silva CP,
Berg I,
Skapenko AL,
Weber K,
Heyer P,
Hohenegger M,
Ashamu GA,
Schulye-Koops H,
Potter BV,
and
Mayr GW.
Regulation of calcium signaling in T lymphocytes by the second messenger cADP-ribose.
Nature
398:
70-73,
1999[Medline].
32.
Herrmann-Frank, A,
Richter M,
Sarkozi S,
Mohr U,
and
Lehmann-Horn F.
4-Chloro-m-cresol, a potent and specific activator of the skeletal muscle ryanodine receptor.
Biochim Biophys Acta
1289:
31-40,
1996[Medline].
33.
Hirata, Y,
Kimura N,
Sato K,
Ohsugi Y,
Takasawa S,
Okamoto H,
Ishikawa J,
Kaisho T,
Ishihara K,
and
Hirano T.
ADP ribosyl cyclase activity of a novel bone marrow stromal cell surface molecule, BST-1.
FEBS Lett
356:
244-248,
1994[ISI][Medline].
34.
Howard, M,
Grimaldi JC,
Bazan JF,
Lund FE,
Santos-Argumedo L,
Parkhouse RME,
Walseth TF,
and
Lee HC.
Formation and hydrolysis of cADP-ribose catalyzed by lymphocyte antigen CD38.
Science
262:
1056-1059,
1993
35.
Ikehata, F,
Satoh J,
Nata K,
Tohgo A,
Nakazawa T,
Kato I,
Kobayashi S,
Akiyama T,
Takasawa S,
Toyota T,
and
Okamoto H.
Autoantibodies against CD38 (ADP-ribosyl cyclase/cADP-ribose hydrolase) that impair glucose-induced insulin secretion in noninsulin-dependent diabetes patients.
J Clin Invest
102:
395-401,
1998[ISI][Medline].
36.
Islam, M,
Leibiger I,
Leibiger B,
Rossi D,
Sorrentino V,
Ekstrom T,
Westerblad H,
Andrade FH,
and
Berggren PO.
In situ activation of the type 2 ryanodine receptor in pancreatic beta cells requires cAMP-dependent phosphorylation.
Proc Natl Acad Sci USA
95:
6145-6150,
1998
37.
Koguma, T,
Takasawa S,
Tohgo A,
Karasawa T,
Furuya Y,
Yonekura H,
and
Okamoto H.
Cloning and characterization of cDNA encoding rat ADP-ribosyl cyclase/cADP-ribose hydrolase (homologue to human CD38) from islets of Langerhans.
Biochim Biophys Acta
1223:
160-162,
1994[Medline].
38.
Laemmli, U.
Cleavage of structural proteins during assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
39.
Lee, H.
Calcium signaling by cADP-ribose and NAADP.
Cell Biochem Biophys
28:
1-17,
1998[Medline].
40.
Lee, H.
Mechanisms of calcium signaling by cADP-ribose and NAADP.
Physiol Rev
77:
1133-1164,
1997
41.
Lee, H.
Modulator and messenger functions of cADP-ribose in calcium signaling.
Recent Prog Horm Res
51:
355-389,
1996.
42.
Leite, M,
Dranoff J,
Gao L,
and
Nathanson M.
Expression and subcellular localization of the ryanodine receptor in rat pancreatic acinar cells.
Biochem J
337:
305-309,
1999.
43.
Liang, M,
Chini E,
Cheng J,
and
Dousa T.
Synthesis of NAADP and cADPR in mitochondria.
Arch Biochem Biophys
371:
317-325,
1999[ISI][Medline].
44.
Lowry, O,
Rosebrough A,
Farr A,
and
Randall R.
Protein measurement with Folin phenol reagent.
J Biol Chem
193:
265-275,
1951
45.
Mackrill, J,
Challiss R,
O'Connell D,
Lai F,
and
Nahorski S.
Differential expression and regulation of ryanodine receptor and myo-inositol 1,4,5-triphosphate receptor Ca2+ release channels in mammalian tissues and cell lines.
Biochem