AJP - Renal Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 281: F658-F664, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Ferreri, N. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Ferreri, N. R.
Vol. 281, Issue 4, F658-F664, October 2001

CaR-mediated COX-2 expression in primary cultured mTAL cells

Dairong Wang, Shao-Jian An, Wen-Hui Wang, John C. McGiff, and Nicholas R. Ferreri

Department of Pharmacology, New York Medical College, Valhalla, New York 10595


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Primary cultures of medullary thick ascending limb (mTAL) cells retain the capacity to express calcium-sensing receptor (CaR) mRNA and protein. Increases in cyclooxygenase-2 (COX-2) mRNA accumulation, protein expression, and PGE2 synthesis were observed in a dose- and time-dependent manner after exposure of these cells to extracellular calcium (Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>). Moreover, transfection of mTAL cells with a CaR overexpression vector significantly enhanced COX-2 expression and PGE2 production in response to calcium compared with cells transfected with an empty vector. Challenge with the CaR-selective agonist poly-L-arginine (PLA) also increased COX-2 mRNA accumulation, protein expression, and PGE2 synthesis. Furthermore, Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>- and PLA-mediated PGE2 production was abolished in the presence of NS-398 or nimesulide, two different COX-2-selective inhibitors. These data suggest that intracellular signaling mechanisms initiated via activation of CaR contribute to COX-2-dependent PGE2 synthesis in the mTAL. Because Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> concentration varies along Henle's loop, calcium may contribute to salt and water balance via a COX-2- and CaR-dependent mechanism. Thus novel calcimimetics might be useful in conditions such as hypertension in which manipulation of extracellular fluid volume provides beneficial effects.

cyclooxygense-2; calcium-sensing receptor; medullary thick ascending limb


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

EXPRESSION OF CYCLOOXYGENSE-2 (COX-2) APPEARS to be differentially regulated in the kidney. For instance, low salt increases COX-2 expression in the cortex, whereas high salt increases expression in the medulla (36). These differences are consistent with the ability of renal prostaglandins to affect vascular or tubular events in the cortex and medulla, respectively. The medullary thick ascending limb (mTAL), which is impermeable to water but actively reabsorbs salt from tubular fluid, helps to establish the osmolarity gradient along the loop of Henle. The Na+ pump located on the basolateral membrane of the mTAL provides the energy for this process. Na+, K+, and Cl- are reabsorbed from the tubular fluid via the Na+-K+-2Cl- cotransporter on the apical membrane, and K+ is recycled via apical K+ channels back to the tubular fluid. PGE2, the major prostaglandin produced in the kidney, has been reported to inhibit the Na+-K+-2Cl- cotransporter and apical K+ channel (6, 15, 16). Thus PGE2 derived from COX-2 in the mTAL may be part of a mechanism that contributes to the regulation of renal function because tumor necrosis factor-alpha mediated decreases in rubidium uptake (an in vitro correlate of natriuresis) were COX-2 dependent (10).

Disturbances in renal concentrating ability, water excretion, and loop of Henle function have been associated with hypercalcemia in humans and experimental animals (5, 18, 22). Moreover, increased prostaglandin levels in the kidney have been linked to inhibition of NaCl reabsorption by the TAL in hypercalcemia (22). The locus and mechanisms of these effects are not fully understood. However, immunohistochemical data indicated an increase in COX-2 expression in the outer medulla (18), suggesting that COX-2 expression in the mTAL may increase after challenge with extracellular calcium (Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>).

Calcium-sensing receptor (CaR), originally cloned from the bovine parathyroid gland (2), has also been found in several nephron segments including the rat mTAL (25, 26). CaR are G protein-coupled receptors that transduce Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> binding into several intracellular signals including stimulation of inositol 1,4,5-trisphosphate (IP3) production and diacylglycerol (DAG) levels. IP3 facilitates calcium release from intracellular stores, and DAG can increase protein kinase C (PKC) activity (4, 5). Phorbol myristate acetate (PMA), a known PKC activator, has been shown to increase COX-2 protein expression and PGE2 production in mTAL cells (10). Micropuncture data revealed that an Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> gradient exists along Henle's loop, because the mean calcium concentration in tubular fluid vs. glomerular fluid was 2.8 at the papillary tip, whereas in the early distal tubule it was below 1 (30). Thus signaling pathways initiated via activation of the CaR may contribute to the regulation of mTAL function. The present study was designed to determine whether Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> enhances COX-2 protein expression and PGE2 production in rat primary cultured mTAL and to assess the role of CaR in this response.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. Male Sprague-Dawley rats (Charles River Lab, Wilmington, MA), weighing 100-110 g, were maintained on standard rat chow (Ralston-Purina, Chicago, IL) and given tap water ad libitum.

Reagents. Tissue culture media, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and COX-2 primers (sense: TACAAGCAGTGGCAAAGGC, antisense: CAGTATTGAGGAGAACAGATGGG) were obtained from Life Technologies (Grand Island, NY). Reagent-grade chemicals and collagenase (type 1A) were from Sigma (St. Louis, MO). COX-2 antisera were from Cayman (Ann Arbor, MI). NS-398 and nimesulide were from Biomol (Ann Arbor, MI). Polyvinylidene difluoride (PVDF) membranes were obtained from Amersham (Arlington Heights, IL).

Isolation of mTAL cells. mTAL cells (~95% purity) were isolated and characterized as previously described (9, 17). Briefly, male Sprague-Dawley rats were anesthetized with an intraperitoneal injection of pentobarbital sodium (0.65 mg/100 g body wt). The kidneys were perfused with sterile 0.9% saline, via retrograde perfusion of the aorta and cut along the corticopapillary axis. The inner stripe of the outer medulla was excised, minced with a sterile blade, and incubated for 10 min at 37°C in a 0.1% collagenase solution gassed with 95% O2. The suspension was sedimented on ice, mixed with Hanks' balanced salt solution (HBSS) containing 2% BSA, and the supernatant containing the crude suspension of tubules was collected. The collagenase digestion was repeated three times with the remaining undigested tissue. The combined tubule suspensions were spun, resuspended in HBSS, and filtered through 52-µm nylon mesh (Fisher Scientific, Springfield, NJ). The filtrated solution was discarded, and the tubules retained on the mesh were resuspended in HBSS. Then, the solution was centrifuged at 500 rpm for 5 min, the supernatant was aspirated away, and the cells were cultured in DMEM-Ham's F-12 medium (1:1), 10% fetal bovine serum (FBS), epidermal growth factor (20 ng/ml), 1% glutamine, streptomycin-penicillin (100 U/ml), and Fungizone (1 µg/ml; Gemini, Woodland, CA). After 3 days, monolayers of cells were 80-90% confluent. The cells were kept quiescent in RPMI containing 0.42 mM Ca2+ and 0.5% FBS for 18-24 h before use.

Isolation of total RNA/RT-PCR analysis. Total RNA was isolated by lysing cells or outer medullary tissue in TriZol reagent (GIBCO BRL, Life Technologies, Grand Island, NY) and precipitated with isopropyl alcohol. A 3-µg aliquot of total RNA isolated from unstimulated or stimulated mTAL cells was used for cDNA synthesis using the Superscript Preamplification system (GIBCO BRL, Life Technologies) in a 20-µl reaction mixture containing Superscript II RT (200 U) and random hexamers (50 ng). The reaction was performed at room temperature for 10 min to allow extension of the primers by RT, then at 42°C for 50 min, 70°C for 15 min, and 4°C for 5 min. An aliquot of the cDNA was then amplified using Taq DNA polymerase (2.5 U) in the presence of sense and antisense primers (1 µM) for murine COX-2, CaR, or GAPDH. For COX-2 and GAPDH, the samples were first denatured for 4 min at 94°C, and the amplification (30 cycles) was then initiated by 0.5 min of denaturation at 94°C, 1 min of annealing at 53°C, and polymerization for 0.5 min at 72°C followed by autoextension at 72°C for 8 min. For CaR, the samples were first denatured for 3 min at 94°C, and the amplification (35 cycles) was then initiated by 0.5 min of denaturation at 94°C, 0.5 min of annealing at 47°C, and polymerization for 1 min at 72°C followed by autoextension at 72°C for 10 min. PCR products were quantified by normalizing mRNA accumulation for COX-2 with GAPDH.

Western blot analysis. The media were removed, and cells were washed three times with PBS (1×). Cells were lysed using 10 mM Tris · HCl, pH 7.5, 1 mM EDTA, and 1% SDS for 5 min on ice. Outer medulla and heart were lysed in the same buffer after homogenization on ice. Protein concentrations were determined using a detergent-compatible Bio-Rad protein assay kit. Thirty micrograms of cell lysate were mixed with an equal volume of 2× SDS-PAGE loading buffer (100 mM Tris · Cl, pH 6.8, 200 mM mercaptoethanol, 4% SDS, 0.2% bromophenol blue, and 20% glycerol) and boiled for 3 min. The proteins in the cell lysate were separated on a 10% SDS-PAGE gel and transferred to PVDF membranes. The membranes were blocked with a solution containing 5% nonfat dry milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) at room temperature for 30 min. Membranes were immunoblotted with a rabbit anti-mouse COX-2 polyclonal antibody or anti-CaR primary antibody (a kind gift from Dr. Steven Hebert, Yale University) for 1 h at room temperature. Membranes were washed 3 times with TBST and incubated with alkaline phosphatase-conjugated secondary antibody (Santa Cruz, CA) for 30 min at RT. Membranes were washed, and enhanced chemifluorescence and phosphorimaging were used for analysis of COX-2 or CaR protein expression.

PGE2 ELISA. Quiescent mTAL cells were incubated with calcium chloride (1-2 mM) or poly-L-arginine (PLA; 10-100 nM) in media containing 0.5% serum for varying times, after which the cell-free supernatants were assayed for PGE2 by ELISA (Neogen, Lexington, KY). Briefly, 50 µl of the sample and 50 µl of horseradish peroxidase (HRP)-conjugated PGE2 were added to wells of a 96-well plate that had previously been coated with anti-PGE2 antibody for 1 h. After incubation, substrate for HRP was added to each well for 30 min, and the reaction was terminated by the addition of 50 µl/well 1 N HCl. Quantitation was achieved by measuring absorbance at 450 nm.

Gene transfection. mTAL cells were cultured to 70-80% confluence. The medium was removed, and cells were placed in 1 ml of serum-free OPTI-MEM medium containing 3 µg/ml of either the plasmid DNA expressing CaR (a generous gift from Dr. Karin Rodland, University of Oregon) or an empty plasmid vector (pcDNA3.1) and 10 µl lipofectamine reagent (Life Technologies) for 4 h at 37°C/5% CO2. After the transfection period, 1 ml of DMEM-F-12 containing 20% FBS was added, and the cells were incubated overnight at 37°C/5% CO2. The medium was then removed, and cells were cultured for an additional 12 h in DMEM-F-12 containing 10% FBS. Then cells were kept quiescent overnight in RPMI medium containing 0.5% FBS. Cells were treated with the appropriate reagents, then washed three times with PBS; supernatants were collected for determination of PGE2 levels, and cellular protein was determined to normalize the ELISA data.

Statistical analysis. The responses were compared by unpaired Student's t-test or by one-way ANOVA when multiple comparisons were made. Data are presented as means ± SE; P <=  0.05 was considered statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Expression of CaR in cultured mTAL cells. Expression of CaR has been reported for TAL tissues. However, the ability of primary cultures of mTAL cells to express CaR has not been studied. Thus CaR mRNA accumulation was assessed in mTAL cells after 3 days of culture. The inner stripe of the outer medulla (OM) was used as a positive control because this region was used to prepare tubule suspensions from which primary cultures of mTAL cells were then established. RT-PCR analysis of an equal amount of total RNA isolated from OM and primary cultures of mTAL cells revealed a 400-bp fragment predicted by primers designed to detect the presence of CaR mRNA (Fig. 1). The identity of the 400-bp fragment was confirmed by DNA sequencing analysis, which demonstrated that the sequence was identical to that reported for rat CaR (data not shown). CaR protein was detected by Western blot analysis of equal amounts of protein samples indicating that cultured mTAL cells retained the ability to express this receptor (Fig. 1).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Calcium-sensing receptor (CaR) expression in the medullary thick ascending limb (mTAL). The presence of mRNA (A) and protein (B) for CaR was determined using either total RNA or tissue lysates, respectively, from mTAL cells cultured for 3 days (mTAL), outer medullary tissue (OM), or heart. +, with RT-PCR; -, PCR without RT; Control, RT-PCR of a 500-bp RNA (a positive control for RT-PCR). The primers used, sense 5-CCTTTACCTGTCCCCTGAAG- and antisense 5-GGCAACAAAACTCAAGGTGGC-, were designed to span intron-exon boundaries to eliminate the possibility that PCR amplification of genomic DNA would lead to false positives.

Ca<UP><SUB>o</SUB><SUP>2<UP>+</UP></SUP></UP> and PLA increase COX-2 protein expression. The effects of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> or PLA (a CaR-selective agonist) on COX-2 protein expression in cultured mTAL cells were determined. Exposure of mTAL cells to increasing concentrations of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> or PLA increased expression of COX-2 protein in a dose-dependent manner (Figs. 2 and 3). Significant increases in COX-2 protein expression were observed after a challenge for 9 h with 1.5, 1.7, and 2.0 mM CaCl2; a fourfold enhancement of COX-2 protein levels was observed after a challenge with 2 mM CaCl2 (Fig. 2). The enhanced COX-2 protein expression levels were maintained after a challenge with CaCl2 for up to 22 h (data not shown). Previous studies have demonstrated that the EC50 for activation of CaR by PLA is ~40 nM (3). Our data indicate that at this dose, PLA increased COX-2 protein expression by twofold; additional increases were observed when cells were exposed to 100 nM PLA for 9 h (Fig. 3).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   Extracellular calcium (Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>) increased mTAL cyclooxygenase-2 (COX-2) protein expression. Primary cultures of mTAL were quiesced in RPMI-1640 containing 0.42 mM Ca2+ and 0.5% FCS for 18 h then exposed for 9 h to CaCl2. Control indicates that cells were incubated in media containing 0.42 mM Ca2+; this amount should be added to the amounts used to challenge the cells to obtain the total Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> concentration present. Top: cell lysates (30 µg) were separated on a 10% SDS-PAGE gel, and COX-2 protein expression was assessed by Western blot analysis. Molecular mass of COX-2 (72/74 kDa) is indicated. Bottom: phosphorimaging and analysis with Imagequant software were used to determine relative intensities of bands. COX-2 level in control is assigned a value of 1. *P < 0.05 (n = 4).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Poly-L-arginine (PLA) increased mTAL COX-2 protein expression. Primary cultures of mTAL were exposed for 9 h to PLA. Top: cell lysates were separated on a 10% SDS-PAGE gel, and COX-2 protein expression was assessed by Western blot analysis. Molecular mass of COX-2 (72/74 kDa) is indicated. Bottom: phosphorimaging and analysis with Imagequant software were used to determine relative intensities of bands. COX-2 level in control is assigned a value of 1. *P < 0.05 (n = 4).

Ca<UP><SUB>o</SUB><SUP>2<UP>+</UP></SUP></UP> and PLA increase COX-2 mRNA accumulation. RT-PCR data revealed that both Ca2+ (1 mM) and PLA (40 nM) increased COX-2 mRNA levels in mTAL by about 40% (Figs. 4 and 5). The kinetics of the response to Ca2+ and PLA were similar as significant increases in mRNA accumulation were observed after exposure of cells for 3 or 6 h. These data suggest that the increase in COX-2 protein expression in response to either CaCl2 or PLA may be related to an increase in the transcription of the mRNA for COX-2. Moreover, the relatively smaller increases in COX-2 mRNA levels compared with COX-2 protein expression and PGE2 production (see below) suggests that a posttranscriptional regulatory mechanism(s) and/or modification of COX-2 enzyme activity may be involved.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4.   Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> increased COX-2 mRNA levels in mTAL. Cells were treated with 1 mM CaCl2 for different times, then total RNA was isolated, and RT-PCR was performed to amplify COX-2 cDNA in each sample. DNA gel electrophoresis was performed, and densitometry was used to analyze the cDNA amount. COX-2 cDNA levels were normalized by the corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level and expressed as % control. COX-2 levels in controls were assigned as 100% (n = 3).



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   PLA increased COX-2 mRNA levels in mTAL. Cells were treated with 40 nM PLA for different times, total RNA was then isolated, and RT-PCR was performed to amplify COX-2 cDNA in each sample. DNA gel electrophoresis was performed, and densitometry was used to analyze the cDNA amount. COX-2 cDNA levels were normalized by the value for corresponding GAPDH levels and expressed as % control. The values for controls were assigned as 100% (n = 4).

Ca<UP><SUB>o</SUB><SUP>2<UP>+</UP></SUP></UP> increases PGE2 production by mTAL cells. To confirm that Ca2+, and not the Cl- ion, stimulates PGE2 synthesis in mTAL cells, PGE2 levels in supernatants were measured by ELISA after treatment with 1.7 mM CaCl2 or 3.4 mM NaCl for 1, 6, and 22 h (Fig. 6). We found that CaCl2 strongly enhanced PGE2 production in primary cultured mTAL cells. In contrast, PGE2 levels were similar to those observed for unstimulated cells after exposure to NaCl (with the same Cl- concentration as the CaCl2 treatment) (Fig. 6). These data demonstrate that the enhanced PGE2 production by CaCl2 is caused by the Ca2+ ion but not by Cl-.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> on PGE2 formation by mTAL cells. Primary cultures of mTAL cells were quiesced for 18 h and then exposed for various times to Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> or NaCl. PGE2 levels were determined by ELISA and normalized by total protein amount in corresponding samples. *P < 0.01 (n = 3).

Effects of COX-2-selective inhibitors on Ca<UP><SUB>o</SUB><SUP>2<UP>+</UP></SUP></UP>- and PLA-mediated PGE2 production. NS-398 and nimesulide are selective inhibitors of COX-2. The IC50 of NS-398 is 1 µM for COX-2, and COX-1 enzyme activity is not affected at concentrations up to 100 µM (11). The IC50 of nimesulide is 9.2 µM for COX-1, and 0.52 µM for COX-2 (31). Thus these inhibitors were used to determine if the PGE2 produced by mTAL cells in response to Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> was derived from COX-2. Primary cultured mTAL cells were preincubated in the absence or presence of 1 µM NS-398 or nimesulide for 15 min then challenged with 1 mM Ca2+ for 9 h. Both NS-398 and nimesulide inhibited PGE2 production after a challenge with 1 mM Ca2+, suggesting that COX-2 contributed significantly to PGE2 production in response to Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> (Fig. 7A). Cells were treated with or without COX-2 inhibitors for 15 min, and then challenged with PLA (10~100 nM) for 9 h. PGE2 production increased in a dose-dependent manner after exposure to PLA. Both COX-2 inhibitors blocked the increase in PGE2 production after a challenge with PLA (Fig. 7B). These data indicate that the CaR-selective agonist PLA exerts effects on PGE2 production that are similar to those observed with Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7.   COX-2 inhibitors block Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>- or PLA-dependent PGE2 production. mTAL cells were pretreated with 1 µM NS-398 or nimesulide for 15 min and then treated with 1 mM CaCl2 (A) or 10-100 nM PLA (B) for 9 h. P < 0.05.

Overexpression of CaR in mTAL cells. We recently showed that addition of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> increased intracellular calcium (Ca<UP><SUB>i</SUB><SUP>2+</SUP></UP>) in cultured mTAL cells (34). Because this response is a feature of CaR activation, and because cultured mTAL cells express this receptor, gene transfection studies were performed to determine if the effects of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> could be enhanced by overexpression of CaR. Cells were transfected with plasmids expressing CaR (3 µg/ml) or the corresponding empty plasmid vector without the CaR gene. Expression of CaR protein was increased in cells transfected with CaR overexpression vector compared with mTAL cells transfected with an empty vector (Fig. 8, left). Transfected cells were quiesced, treated with 1.2 mM CaCl2 for 9 h, and COX-2 expression and PGE2 synthesis were determined. Cells transfected with empty vector or the CaR expressing vector produced similar amounts of PGE2 in the absence of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> (Fig. 8). Moreover, the levels of PGE2 in these cells were similar to those observed in untransfected cells (data not shown). However, COX-2 expression and PGE2 synthesis were significantly greater in cells transfected with CaR overexpression vector compared with cells transfected with empty vector after being challenged with Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> (Fig. 8). These data suggest that the enhanced COX-2-derived PGE2 production in response to calcium may be mediated via activation of CaR expressed on mTAL cells.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8.   Effects of CaR overexpression in mTAL. Cells were transfected with 3 µg/ml of either pcDNA3 control or pcDNA3-CaR plasmid vector and then incubated for 9 h in the absence or presence of 1.2 mM CaCl2. Expression of CaR and COX-2 were determined by Western blot analysis; PGE2 levels were determined by ELISA (n = 3).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We demonstrated that mTAL cells in primary culture express CaR. COX-2 mRNA accumulation and protein expression were enhanced after being challenged with Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> or the CaR-agonist, PLA. Production of PGE2 increased in response to either Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> or PLA and was dependent on activation of COX-2, as the COX-2-selective inhibitors NS-398 or nimesulide completely blocked the response. Overexpression of CaR in mTAL cells resulted in greater COX-2 expression and PGE2 production in response to Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>, compared with cells transfected with empty vector.

The COX-1 and COX-2 proteins are encoded by separate genes located on different chromosomes. Multiple signaling pathways have been linked to stimulation of COX-2 gene expression including the protein kinase A pathway, the PKC pathway, viral transformation, and tyrosine kinase (28). We previously demonstrated that PMA and tumor necrosis factor, direct and indirect activators of PKC activity, respectively, enhance COX-2 protein expression and PGE2 production in cultured mTAL cells (10), suggesting that PKC activation may be a signaling pathway for upregulating the COX-2 gene and enhancing local PGE2 production in the mTAL.

The extracellular domain of CaR has several regions rich in negatively charged amino acids, which may bind calcium and other cationic ligands (4, 5). Thus polyvalent cations such as PLA can act as CaR agonists and mimic effects of calcium initiated by CaR activation. (3). Expression of a functional CaR has been demonstrated on the basolateral side of the TAL (24, 25). Some cell types may not retain this receptor when cultured (20). We recently showed that exposure of cultured mTAL cells to increasing concentrations of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> caused a dose-dependent increase in Ca<UP><SUB>i</SUB><SUP>2+</SUP></UP> (34). In the present study, RT-PCR and Western blot analysis were used to detect CaR mRNA accumulation and protein expression, respectively. Collectively, these data suggest that cultured mTAL cells express a functional CaR. We have previously shown that PMA enhanced COX-2 protein expression and PGE2 production in mTAL cells (10). These findings are consistent with the notion that Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> can increase COX-2 gene expression in the mTAL via CaR activation, which involves activation of PKC in some cell types.

The free calcium concentration ranges from 1.0 to 1.2 mM in serum and is tightly regulated by several mechanisms including the CaR (1, 14). Mutations in this receptor have been shown to cause disorders of calcium homeostasis such as familial hypocalciuric hypercalcemia. Heterozygous and homozygous CaR knockout mice exhibit mild and severe alterations in Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> homeostasis, respectively, confirming the importance of CaR in Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> homeostasis (14). COX-2 mRNA accumulation, protein expression, and PGE2 production in mTAL cells were stimulated after increasing the Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> concentration from 0.45 to 1.45 mM. NS-398 and nimesulide, at concentrations that do not inhibit COX-1 enzyme activity, abolished the increased PGE2 production, suggesting that PGE2 was derived from COX-2. The CaR agonist, PLA (40-100 nM), was similarly affected by NS-398 and nimesulide. Moreover, mTAL cells transfected with a CaR overexpression vector expressed higher levels of COX-2 and produced significantly more PGE2 in response to 1.2 mM CaCl2 compared with cells transfected with a plasmid vector without CaR. These data suggest that small changes in the concentration of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> increase COX-2-derived PGE2 production via CaR activation.

Ca2+ has been reported to inhibit K+ recycling in TAL (35) and to disrupt both NaCl and divalent cation reabsorption by the TAL (27). Thus modulation of TAL NaCl and divalent cation reabsorption by CaR activation provides a mechanism to regulate both monovalent and divalent mineral ion homeostasis (1). For instance, raising the serum ionized Ca2+ level by 25% increased the urinary excretion of Na+ by 150% (8, 23). CaR modulation of TAL function also may be linked to alterations in the urinary concentrating capacity of the kidney via alterations in medullary tonicity. Thus hypercalcemia patients have diminished urinary concentrating ability. Hypercalcemia stimulated the expression of intrarenal phospholipase A2 and COX-2 in rats (18), and endogenous PGE2 mediated the inhibition of rat TAL Cl- reabsorption in chronic hypercalcemia (22). Thus the extracellular calcium concentration gradient along the loop of Henle (30) may provide the necessary concentration range to alter local COX-2 protein expression and PGE2 production in the mTAL.

Renal cortical COX-2 mRNA levels decreased 2.9-fold in rats on a high-salt diet and increased 3.3-fold in rats on a low-salt diet (13). In contrast, medullary COX-2 level was increased in rats on a high-salt diet (36). Divergent regulation of COX-2 in cortex and medulla by dietary salt suggests that prostaglandins in different kidney regions serve different functions, with medullary production playing a role in promoting the excretion of salt and water in volume overload, whereas cortical prostaglandins may protect glomerular circulation in volume depletion (13, 36). Recent studies have shown that adrenalectomy (ADX) caused higher COX-2 protein expression in rat TAL segments (32, 37). Previous studies showed that ADX caused inhibition of sodium reabsorption by 33% in the loop of Henle, an effect mediated by PGE2 in the mTAL and reversed by aldosterone (6, 15, 29, 37). Thus aldosterone and other steroid hormones produced by the adrenal gland may be one group of physiological factors that inhibit COX-2 protein expression in the mTAL in vivo to promote salt reabsorption. Immunohistochemical data showed that the mTAL appears to express COX-2 protein constitutively in a subpopulaton of cells (33). Given the effects of PGE2 on mTAL ion transport (15, 16), Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> may contribute to salt and water regulation in the kidney via regulation of COX-2 protein expression and PGE2 production in the mTAL. However, in vivo COX-2 protein expression may be low in mTAL due to the inhibitory effects of adrenal steroid hormones. Under conditions of experimentally induced hypercalcemia, COX-2 protein expression was high in OM tissue (18), perhaps reflecting the ability of Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP> along the TAL to overcome the inhibitory effects of adrenal hormones and other factors.

Ca<UP><SUB>o</SUB><SUP>2+</SUP></UP>-dependent COX-2-derived PGE2 production could contribute to the polyuria observed in hypercalcemia patients. Also, recent meta-analysis of randomized controlled trials revealed that consumption of more calcium caused a small but consistent drop in blood pressure (12, 19). The effect of calcium has been suggested to reside in promoting sodium excretion. Thus calcimimetics may offer a novel means of modulating salt and water reabsorption in conditions associated with volume expansion via enhancing local PGE2 production in mTAL by CaR activation. The use of COX-2-selective inhibitors may be associated with salt and water retention, and severe renal problems are observed in COX-2 knockout mice (7, 21). Establishing a link between CaR and COX-2 gene expression may help clarify the mechanism(s) that regulate local COX-2 gene expression and PGE2 production in the mTAL.


    ACKNOWLEDGEMENTS

This work was supported by National Heart, Lung, and Blood Institute Grants HL-56423 and PPG HL-34300 and American Heart Association Grant 9740001N.


    FOOTNOTES

N. R. Ferreri is an Established Investigator of the American Heart Association.

Address for reprint requests and other correspondence: N. R. Ferreri, Dept. of Pharmacology, New York Medical College, Valhalla, NY 10595 (E-mail: nick_ferreri{at}nymc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 29 March 2001; accepted in final form 15 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Baum, MA, and Harris HW. Recent insights into the coordinate regulation of body water and divalent mineral ion metabolism. Am J Med Sci 316: 321-328, 1998[Web of Science][Medline].

2.   Brown, EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, and Hebert SC. Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid. Nature 366: 575-580, 1993[Medline].

3.   Brown, EM, Katz C, Butters R, and Kifor O. Polyarginine, polylysine, and protamine mimic the effects of high extracellular calcium concentrations on dispersed bovine parathyroid cells. J Bone Miner Res 6: 1217-1225, 1991[Web of Science][Medline].

4.   Brown, EM, Pollak M, and Hebert SC. The extracellular calcium-sensing receptor: its role in health and disease. Annu Rev Med 49: 15-29, 1998[Web of Science][Medline].

5.   Brown, EM, Vassilev PM, Quinn S, and Hebert SC. G-protein-coupled, extracellular Ca(2+)-sensing receptor: a versatile regulator of diverse cellular functions. Vitam Horm 55: 1-71, 1999[Web of Science][Medline].

6.   Culpepper, RM, and Andreoli TE. Interactions among prostaglandin E2, antidiuretic hormone, and cyclic adenosine monophosphate in modulating Cl- absorption in single mouse medullary thick ascending limbs of Henle. J Clin Invest 71: 1588-1601, 1983.

7.   Dinchuk, JE, Car BD, Focht RJ, Johnston JJ, Jaffee BD, Covington MB, Contel NR, Eng VM, Collins RJ, and Czerniak PM. Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II. Nature 378: 406-409, 1995[Medline].

8.   el Hajj, FG, Seifter J, Scott J, and Brown EM. Calcium-regulated renal calcium handling in healthy men: relationship to sodium handling. J Clin Endocrinol Metab 83: 2366-2372, 1998[Abstract/Free Full Text].

9.   Escalante, BA, Ferreri NR, Dunn CE, and McGiff JC. Cytokines affect ion transport in primary cultured thick ascending limb of Henle's loop cells. Am J Physiol Cell Physiol 266: C1568-C1576, 1994[Abstract/Free Full Text].

10.   Ferreri, NR, An SJ, and McGiff JC. Cyclooxygenase-2 expression and function in the medullary thick ascending limb. Am J Physiol Renal Physiol 277: F360-F368, 1999[Abstract/Free Full Text].

11.   Futaki, N, Takahashi S, Yokoyama M, Arai I, Higuchi S, and Otomo S. NS-398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H synthase/cyclooxygenase (COX-2) activity in vitro. Prostaglandins 47: 55-59, 1994[Web of Science][Medline].

12.   Griffith, LE, Guyatt GH, Cook RJ, Bucher HC, and Cook DJ. The influence of dietary and nondietary calcium supplementation on blood pressure: an updated metaanalysis of randomized controlled trials. Am J Hypertens 12: 84-92, 1999[Web of Science][Medline].

13.   Harris, RC, McKanna JA, Akai Y, Jacobson HR, Dubois RN, and Breyer MD. Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction. J Clin Invest 94: 2504-2510, 1994.

14.   Hebert, SC, Brown EM, and Harris HW. Role of the Ca(2+)-sensing receptor in divalent mineral ion homeostasis. J Exp Biol 200: 295-302, 1997[Abstract].

15.   Kaji, DM, Chase HS, Eng JP, and Diaz J. Prostaglandin E2 inhibits Na-K-2Cl cotransport in medullary thick ascending limb cells. Am J Physiol Cell Physiol 271: C354-C361, 1996[Abstract/Free Full Text].

16.   Liu, HJ, Wei Y, Fererri NR, Nasjletti A, and Wang WH. Vasopressin and PGE(2) regulate activity of apical 70-pS K+ channel in thick ascending limb of rat kidney. Am J Physiol Cell Physiol 278: C905-C913, 2000[Abstract/Free Full Text].

17.   Macica, CM, Escalante BA, Conners MS, and Ferreri NR. TNF production by the medullary thick ascending limb of Henle's loop. Kidney Int 46: 113-121, 1994[Web of Science][Medline].

18.   Mangat, H, Peterson LN, and Burns KD. Hypercalcemia stimulates expression of intrarenal phospholipase A2 and prostaglandin H synthase-2 in rats. Role of angiotensin II AT1 receptors. J Clin Invest 100: 1941-1950, 1997[Web of Science][Medline].

19.   McCarron, DA. Diet and blood pressure---the paradigm shift. Science 281: 933-934, 1998[Free Full Text].

20.   Mithal, A, Kifor O, Kifor I, Vassilev P, Butters R, Krapcho K, Simin R, Fuller F, Hebert SC, and Brown EM. The reduced responsiveness of cultured bovine parathyroid cells to extracellular Ca2+ is associated with marked reduction in the expression of extracellular Ca(2+)-sensing receptor messenger ribonucleic acid and protein. Endocrinology 136: 3087-3092, 1995[Abstract].

21.   Morham, SG, Langenbach R, Loftin CD, Tiano HF, Vouloumanos N, Jennette JC, Mahler JF, Kluckman KD, Ledford A, and Lee CA. Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse. Cell 83: 473-482, 1995[Web of Science][Medline].

22.   Peterson, LN, McKay AJ, and Borzecki JS. Endogenous prostaglandin E2 mediates inhibition of rat thick ascending limb Cl reabsorption in chronic hypercalcemia. J Clin Invest 91: 2399-2407, 1993.

23.   Pratt, JH, Ambrosius WT, Wagner MA, and Maharry K. Molecular variations in the calcium-sensing receptor in relation to sodium balance and presence of hypertension in blacks and whites. Am J Hypertens 13: 654-658, 2000[Web of Science][Medline].

24.   Riccardi, D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, and Hebert SC. Localization of the extracellular Ca2+/polyvalent cation-sensing protein in rat kidney. Am J Physiol Renal Physiol 274: F611-F622, 1998[Abstract/Free Full Text].

25.   Riccardi, D, Lee WS, Lee K, Segre GV, Brown EM, and Hebert SC. Localization of the extracellular Ca2+-sensing receptor and PTH/PTHrP receptor in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 271: F951-F956, 1996[Abstract/Free Full Text].

26.   Riccardi, D, Park J, Lee WS, Gamba G, Brown EM, and Hebert SC. Cloning and functional expression of a rat kidney extracellular calcium/polyvalent cation-sensing receptor. Proc Natl Acad Sci USA 92: 131-135, 1995[Abstract/Free Full Text].

27.   Simon, DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, and Lifton RP. Genetic heterogeneity of Bartter's syndrome revealed by mutations in the K+ channel, ROMK. Nat Genet 14: 152-156, 1996[Web of Science][Medline].

28.   Smith, WL, and DeWitt DL. Prostaglandin endoperoxide H synthases-1 and -2. Adv Immunol 62: 167-215, 1996[Web of Science][Medline].

29.   Stokes, JB. Effect of prostaglandin E2 on chloride transport across the rabbit thick ascending limb of Henle. Selective inhibitions of the medullary portion. J Clin Invest 64: 495-502, 1979.

30.   Sutton, RA, and Dirks JH. The renal excretion of calcium: a review of micropuncture data. Can J Physiol Pharmacol 53: 979-988, 1975[Web of Science][Medline].

31.   Vane, JR, Bakhle YS, and Botting RM. Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 38: 97-120, 1998[Web of Science][Medline].

32.   Vio, CP, An SJ, Cespedes C, McGiff JC, and Ferreri NR. Induction of cyclooxygenase-2 in thick ascending limb cells by adrenalectomy. J Am Soc Nephrol 12: 649-658, 2001[Abstract/Free Full Text].

33.   Vio, CP, Cespedes C, Gallardo P, and Masferrer JL. Renal identification of cyclooxygenase-2 in a subset of thick ascending limb cells. Hypertension 30: 687-692, 1997[Abstract/Free Full Text].

34.   Wang, D, McGiff JC, and Ferreri NR. Regulation of cyclooxygenase isoforms in the renal thick ascending limb: effects of extracellular calcium. J Physiol Pharmacol 51: 587-595, 2000[Web of Science][Medline].

35.   Wang, WH, Lu M, and Hebert SC. Cytochrome P-450 metabolites mediate extracellular Ca2+-induced inhibition of apical K+ channels in the TAL. Am J Physiol Cell Physiol 271: C103-C111, 1996[Abstract/Free Full Text].

36.   Yang, T, Singh I, Pham H, Sun D, Smart A, Schnermann JB, and Briggs JP. Regulation of cyclooxygenase expression in the kidney by dietary salt intake. Am J Physiol Renal Physiol 274: F481-F489, 1998[Abstract/Free Full Text].

37.   Zhang, MZ, Harris RC, and McKanna JA. Regulation of cyclooxygenase-2 (COX-2) in rat renal cortex by adrenal glucocorticoids and mineralocorticoids. Proc Natl Acad Sci USA 96: 15280-15285, 1999[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 281(4):F658-F664
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Hao, H. Zhao, Z. Darzynkiewicz, S. Battula, and N. R. Ferreri
Expression and function of NFAT5 in medullary thick ascending limb (mTAL) cells
Am J Physiol Renal Physiol, June 1, 2009; 296(6): F1494 - F1503.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. I. Abdullah, P. L. Pedraza, J. C. McGiff, and N. R. Ferreri
Calcium-sensing receptor signaling pathways in medullary thick ascending limb cells mediate COX-2-derived PGE2 production: functional significance
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1082 - F1089.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. I. Abdullah, P. L. Pedraza, J. C. McGiff, and N. R. Ferreri
CaR activation increases TNF production by mTAL cells via a Gi-dependent mechanism
Am J Physiol Renal Physiol, February 1, 2008; 294(2): F345 - F354.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. Eng, S. Mukhopadhyay, C. P. Vio, P. L. Pedraza, S. Hao, S. Battula, P. B. Sehgal, J. C. McGiff, and N. R. Ferreri
Characterization of a long-term rat mTAL cell line
Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1413 - F1422.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Herrera and J. L. Garvin
Novel role of AQP-1 in NO-dependent vasorelaxation
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1443 - F1451.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. I. Abdullah, P. L. Pedraza, S. Hao, K. D. Rodland, J. C. McGiff, and N. R. Ferreri
NFAT regulates calcium-sensing receptor-mediated TNF production
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1110 - F1117.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. A. Rodriguez, P. De la Cerda, E. Collyer, V. Decap, C. P. Vio, and V. Velarde
Cyclooxygenase-2 induction by bradykinin in aortic vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H30 - H36.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Wang, P. L. Pedraza, H. I. Abdullah, J. C. McGiff, and N. R. Ferreri
Calcium-sensing receptor-mediated TNF production in medullary thick ascending limb cells
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F963 - F970.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Ferreri, N. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Ferreri, N. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online