AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 281: F826-F832, 2001. First published July 12, 2001; doi:10.1152/ajprenal.0083.2001
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
281/5/F826    most recent
0083.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fisher, J. W.
Right arrow Articles by Brookins, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fisher, J. W.
Right arrow Articles by Brookins, J.
Vol. 281, Issue 5, F826-F832, November 2001

Adenosine A2A and A2B receptor activation of erythropoietin production

James W. Fisher and Jesse Brookins

Department of Pharmacology, Tulane University School of Medicine, New Orleans, Louisiana 70112-2699


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

First published July 12, 2001; 10.1152/ajprenal.0083.2001.---We have examined the effects of adenosine receptors and protein kinases A and C in the regulation of erythropoietin (Epo) production using hepatocellular carcinoma (Hep3B) cells in culture and in vivo in normal mice under normoxic and hypoxic conditions. CGS-21680, a selective adenosine A2A agonist, significantly increased levels of Epo in normoxic Hep3B cell cultures and in serum of normal mice under both normoxic and hypoxic conditions. CGS-21680 also produced a significant increase in Epo mRNA levels in Hep3B cell cultures. SCH-58261, a selective adenosine A2A receptor antagonist, significantly inhibited the increase in medium levels of Epo in Hep3B cell cultures exposed to hypoxia (1% O2). Enprofylline, a selective adenosine A2B receptor antagonist, significantly inhibited the increase in plasma levels of Epo in normal mice exposed to hypoxia. Chelerythrine chloride, an antagonist of protein kinase C activation, significantly inhibited hypoxia-induced increases in serum levels of Epo in normal mice. A model is presented for adenosine in hypoxic regulation of Epo production that involves kinases A and C and phospholipase A2 pathways.

enprofylline; chelerythrine; CGS-21680; SCH-58261; hypoxia; normoxia


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ADENOSINE IS AN ENDOGENOUS nucleoside that has been demonstrated to modulate several physiological processes through specific G protein-coupled adenosine receptors. There are essentially four subtypes of adenosine receptors that have been cloned: A1, A2A, A2B, and A3 (8, 12, 23, 24, 30, 31). Generally, A1 and A3 adenosine receptors inhibit adenylate cyclase, whereas A2 receptor activation stimulates adenylate cyclase. Adenosine A2A receptor messenger RNA and protein have been demonstrated to be increased in PC12 cells in response to hypoxia (10). We have postulated previously that adenosine acts through adenosine receptors to regulate erythropoietin (Epo) production; however, the specific type of adenosine receptor involved in Epo production has not been elucidated (19, 21, 27). Theophylline, a nonselective adenosine A1 and A2 receptor antagonist, was shown to inhibit the effects of hypoxia on Epo production (27). Hypoxia has been reported to increase ectonucleotidase activity (18) and adenosine production (16) in vascular endothelial cells. We have previously reported that adenosine analogs (19, 21) increase cAMP and Epo production in hepatocellular carcinoma (Hep3B) cell cultures. We have also reported that theophylline, a nonselective adenosine A1 and A2 receptor antagonist, inhibits the enhanced Epo production seen in patients with post-kidney transplantation erythrocytosis (1). A link between protein kinase C (PKC) activation and hypoxia-induced Epo production has been reported (29), but the precise mechanism of this action was not clear. The purpose of the present study was to clarify the relationship of specific types of adenosine receptors and protein kinases that are involved in hypoxic regulation of Epo production.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chemicals

Enprofylline and CGS-21680 were obtained from Sigma Chemical (St. Louis, MO). Penicillin G, streptomycin, L-glutamine, sodium pyruvate, nonessential amino acids, trypsin, Eagle's minimum essential medium (EMEM), and Dulbecco's phosphate-buffered saline were obtained from GIBCO-BRL (Life Technologies). Chelerythrine chloride was obtained from Alexis (San Diego, CA). SCH-58261 was provided by Schering-Plough Research Institute (Milan, Italy). All other chemicals were purchased from Sigma Chemical, with the exception of those specifically described.

In Vivo Epo Studies in Mice

Briefly, CD1 strain female mice were used in these studies. Enprofylline, a selective adenosine A2B receptor antagonist in saline, was administered intravenously in a single dose in a volume of 0.2 ml. Chelerythrine and 2-p-[2-carboxyethyl] phenethylamino-5'-N-ethylcarboxamidoadenosine (CGS-21680) were administered subcutaneously in 0.2 ml of saline. After the injection of one of the above compounds, or saline as the control, the mice were exposed to 2 or 4 h of hypoxia (0.42 atm) in a hypobaric chamber. After hypobaric stimulation, the mice were immediately anesthetized with ether and exsanguinated via cardiac puncture. Blood samples were collected via cardiac puncture in heparinized tubes, and the plasma was separated by centrifugation. Epo levels in the plasma were determined by a sensitive Epo RIA. The details of the RIA used in our laboratory have been published previously (14). The mean basal level of Epo in our Hep3B cell culture medium in cells incubated for 24 h under normoxic control conditions for the five CGS-21680 experiments was 18.53 ± 5.0 mu/ml. The minimal detectable level of Epo in this assay was 1.56 mu/ml. Epo levels are expressed as milliunits per milliliter.

Hep3B Cell Cultures

Human Hep3B cells, obtained from the American Type Culture Collection (ATCC), were transferred to 75-cm2 canted neck tissue culture flasks (Corning, Corning, NY). The cells were placed in a water-jacketed incubator (model no. 31580; Forma Scientific) and incubated in monolayer cell cultures in EMEM supplemented with 10% fetal bovine serum, 0.1 mmol/l nonessential amino acids, 1 mmol/l sodium pyruvate, penicillin G (100 U/ml), and streptomycin (100 µg/ml) in a humidified atmosphere of 5% CO2-95% air at 37°C. For the CGS-21680 experiments, 7.6 × 106 cells were transferred to each 75-cm2 tissue flask, and, for the mRNA experiments, 15.0 × 106 cells were transferred to each 75-cm2 flask (Sarstedt). The cells were then incubated for 24 h in a normoxic (20% O2-5% CO2-75% N2) atmosphere, after which several experiments were performed. For the SCH-58261 experiments, cells were transferred to each 75-cm2 flask. Cytotoxicity testing of each of the Hep3B cell culture experiments was carried out utilizing the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) technique (4).

Isolation of RNA

Hep3B cells were incubated for 6 h under normoxic conditions in the presence or absence of the test substance. Total cellular RNA was isolated by use of the RNAzol B method (TEL-TEST, Friendswood, TX). The isolated RNA was further purified by use of RQ1 RNase-free DNase (Promega, Madison, WI). The integrity of each RNA sample was verified by agarose-formaldehyde gel electrophoresis and quantified spectrophotometrically.

Quantitation of RNA

Quantitative RT-PCR was performed using the technique of Fandrey and Bunn (6), as previously described, but with some modifications. Total RNA (250 ng) in each sample was reverse transcribed by incubation with 1 unit of rTth DNA polymerase (PerkinElmer) per 10 µl of the reaction mixture, containing 100 µM deoxynucleotide triphosphate (dNTP; PerkinElmer), 25 pmol of Epo or beta -actin downstream primer, 5 mM manganese acetate [Mn(OAc)2], and 1× EZ buffer (PerkinElmer) for 30 min at 60°C. The reverse transcription was terminated by placing the tube on ice. The resultant cDNA was used for PCR. Each sample was measured for Epo cDNA and beta -actin cDNA in separate tubes with the use of specific primers. The sequence of Epo primers was kindly provided by Dr. Joaquin Fandrey (Univ. of Bonn, Bonn, Germany). These primers yielded a 253-base pair fragment (6). The upstream and downstream primers for beta -actin were ATCTGGCACCACACCTTCTACAATG and GGGGTGTTCAAGGTCTCAAAC, respectively, which yielded a 137-base pair cDNA fragment. PCR was performed by incubation of 250-ng/µl samples of cDNA with 5 mM Mn(OAc)2, 200 µM dNTP, 1 unit/10 µl of reaction mixture rTth DNA polymerase, 1× EZ buffer, 1 µCi [32P]dCTP (ICN), and 25 pM of beta -actin primers and carried out for 35 cycles (30 s at 95°C, 30 s at 60°C, and 40 s at 72°C) with the use of the Strategene Robocycler-40 system. PCR using the Epo primers was carried out for 40 cycles under identical conditions. Epo and beta -actin primers were never combined in the same tube. A quantity of 30 µl of the final PCR reaction was electrophoresed using 2% agarose (Promega) in 1× Tris-boric acid-EDTA (TBE) buffer containing 0.36 µg/ml of ethidium bromide. The bands corresponding to the cDNA product were excised and mixed with scintillation cocktail, and counts per minute were determined on a Beckman beta counter. Epo and beta -actin cDNA obtained from PCR of the reverse transcribed RNA was used to generate standard curves. The cDNA was amplified by PCR, and the resultant amplified product was divided into small fractions that were reamplified. The purity of the final product was confirmed by electrophoresis. If a single band of the appropriate size was obtained, the final product was cleaned using a Wizard PCR purification system (Promega) to remove primers. The cleaned product was again electrophoresed to confirm that it contained only the desired DNA. The cDNA was quantified spectrophotometrically after purification. Standard curves for Epo mRNA or beta -actin mRNA (10-1 to 10-7 µg/tube) were prepared by simultaneously amplifying the appropriate samples of cDNA in separate tubes. Every PCR amplified included a standard curve. All results are expressed as nanograms Epo cDNA per nanograms beta -actin cDNA to standardize the amount of RNA initially reverse transcribed. All experiments were performed three times for each assay.

The statistical analyses for all data were carried out using Newman-Keuls post hoc procedure (28) or one-tailed Student's t-test, and the results are expressed as means ± SE.

Experimental Groups Studied

Experiment 1. Normal female CD1 mice were injected subcutaneously with 0.25 ml saline, 10 mg/kg chelerythrine, 250 µM/kg enprofylline, or 0.1 µM/kg CGS-21680 (iv). One hour after injection, the mice were placed in a hypobaric (0.42 atm) chamber for 2 and 4 h, respectively. Immediately after being removed from the hypobaric chamber, the mice were exsanguinated and the plasma was separated from the heparinized blood and stored at -70°C before Epo RIA. The effects of CGS-21680 (0.1 µM/kg iv) on plasma levels of Epo in normal mice under normoxic conditions and after exposure to 4-h hypoxia are shown (see Fig. 5). The effects of 250 µM/kg enprofylline on plasma levels of Epo in normal mice after 2- and 4-h exposure to hypoxia are also shown (see Fig. 6). The effects of chelerythrine at 10 mg/kg (ip) on plasma levels of Epo in normal mice after exposure to 2- and 4-h hypoxia are shown (see Fig. 7).

Experiment 2. The effects of CGS-21680 on Epo and Epo mRNA production by Hep3B cells were studied. Hep3B cells were incubated in 75-cm2 flasks under normoxic conditions until 100% confluency of the cells was reached. Five flasks were used as controls (only EMEM added) and five flasks for each of five concentrations (1 × 10-9 to 1 × 10-5 M) of CGS-21680 under normoxic (10% O2) conditions. Fifteen flasks were set up for the SCH-58261 experiments under hypoxic (1% O2 for 24 h) conditions (5 flasks for controls, 5 flasks with 1 × 10-6 M SCH-58261, and 5 flasks with 1 × 10-5 M SCH-58261). Thereafter, the medium and cells were harvested from the 20 flasks and used for quantitative determination of Epo (RIA) and of Epo mRNA by RT-PCR. Figure 1 shows the effects of SCH-58261 (1 × 10-6 and 1 × 10-5 M) on Hep3B cell medium levels of Epo after exposure to hypoxia (1% O2).


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of SCH-58261, a selective adenosine A2A receptor antagonist, on erythropoietin (Epo) levels in culture medium of hepatocellular carcinoma (Hep3B) cells after exposure to hypoxia (1% O2, 24 h). * Significantly different from hypoxia controls, P < 0.05.

Figure 2 shows the effects of several concentrations of CGS-21680 on Hep3B cell culture medium levels of Epo under normoxic conditions. Figure 3 shows the effects of CGS-21860 on Epo mRNA in Hep3B cell cultures under normoxic conditions.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of CGS-21680, a selective adenosine A2A receptor agonist, on culture medium levels of Epo in Hep3B cell cultures under normoxic conditions. Mean baseline control Epo level was 18.53 ± 5.0 mu/ml. * Significantly different from normoxic (20% O2, 24 h) controls, P < 0.05.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of CGS-21680 on Epo mRNA levels in Hep3B cell cultures under normoxic conditions. * Significantly different from controls (20% O2), P < 0.05.

Figure 4 shows the electrophoretic gels of Epo mRNA from Hep3B cell cultures after hypoxia (1% O2) and CGS-21680.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4.   Electrophoretic gels of Epo mRNA from Hep3B cell cultures exposed for 6 h to hypoxia (1.0% O2) and CGS-21680 (1 × 10-3 M) under normoxic (20% O2) conditions. Lane A, reagent blank; lane B, hypoxia (1.0% O2); lane C, CGS-21680 (1 × 10-3 M) under normoxic (20% O2) conditions; lane D, beta -actin reagent blank; lane E, beta -actin for hypoxia (1.0% O2); lane F, beta -actin for CGS-21680.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

As seen in Fig. 1, SCH-58261 (1 × 10-6 and 1 × 10-5 M), a selective adenosine A2A receptor antagonist, significantly (P < 0.05) inhibited the increase in medium levels of Epo in Hep3B cell cultures exposed to hypoxia (1% O2) for 24 h.

As noted in Fig. 2, when Hep3B cells were incubated with CGS-21680 (1 × 10-9 to 1 × 10-5M) for 24 h under normoxic conditions, a significant (P < 0.05) increase in Epo levels was seen in the culture medium. CGS-21680 produced a significant (P < 0.05) increase in Epo mRNA levels in Hep3B cell cultures under normoxic conditions (Fig. 3).

The electrophoretic gels illustrating the effects of CGS-21680 and hypoxia on Epo mRNA are shown in Fig. 4. As noted in Fig. 4, exposure of Hep3B cells to CGS-21680 for 6 h under normoxic conditions resulted in a significant increase in Epo mRNA levels in Hep3B cells compared with normoxic controls. Also note the marked increase in Epo mRNA seen after exposure to hypoxia.

As noted in Fig. 5, CGS-21680 at 0.1 µmol/kg (when injected intravenously 4 h before) and at 0.1 µmol/kg (at the time the mice were exposed to hypoxia) significantly (P < 0.01) enhanced the effects of hypoxia on plasma levels of Epo compared with hypoxia controls. In addition, CGS-21680 significantly increased plasma levels of Epo in normoxic mice compared with normoxic controls (Fig. 5). These data indicate that adenosine A2A receptor activation plays a significant role in Epo regulation.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of CGS-21680, a selective adenosine A2A receptor agonist, on plasma levels of Epo in normal mice under normoxic conditions and in mice exposed to hypoxia (0.42 atm) for 4 h. A dosage of CGS-21680 (0.1 µmol/kg iv) was injected 4 h before the mice were placed in the hypobaric chamber and at the time they were placed in the chamber. * Significantly different from respective control, P < 0.01.

As seen in Fig. 6, enprofylline, a selective adenosine A2B receptor antagonist, at a dosage of 250 µmol/kg, significantly (P < 0.01) inhibited the rise in plasma levels of Epo in normal mice exposed to either 2 or 4 h of hypoxia. These data indicate that adenosine A2B receptor activation after exposure to hypoxia is an important mechanism in the regulation of Epo production.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of enprofylline (250 µmol/kg), a selective adenosine A2B receptor antagonist, on plasma levels of Epo in normal mice exposed to hypoxia (0.42 atm) for 2 (A) and 4 h (B). * Significantly different from hypoxia controls, P < 0.01.

As noted in Fig. 7, chelerythrine (10 mg/kg), a selective PKC inhibitor, significantly (P < 0.01) inhibited the increase in plasma levels of Epo in normal mice exposed to either 2 or 4 h of hypoxia.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of chelerythrine (10 mg/kg), a selective protein kinase C inhibitor, on plasma levels of Epo in normal mice exposed to hypoxia (0.42 atm) for 2 (A) and 4 h (B). * Significantly different from hypoxia controls, P < 0.01.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Hypoxia is known to enhance the production of adenosine in endothelial cells (18). This increase in adenosine activates adenosine A2A (10, 27) and A2B (8, 23) receptors to initiate a cascade of events leading to several physiological responses. We have demonstrated previously that adenosine receptor activation enhances the effects of hypoxia-induced Epo production (19, 21, 27). In the present studies, we report that adenosine regulation of Epo occurs through the activation of both adenosine A2A and A2B receptors. We have also found that SCH-58261, a selective adenosine A2A receptor antagonist, produces a significant inhibition of the rise in Epo levels in culture medium in Hep3B cells after exposure to hypoxia. CGS-21680, a selective adenosine A2A receptor agonist, was also found to produce a significant increase in culture medium levels of Epo and Epo mRNA in Hep3B cells under normoxic conditions and a significant increase in plasma levels of Epo in normal and hypoxic mice. Adenosine A2A receptor activation leads to the stimulation of adenylate cyclase, a rise in cAMP levels in cells, and an increase in A2A receptor mRNA (10). It is well known that A2A and A2B adenosine receptors are coupled to increasing G stimulatory (Gs) proteins, and both have been demonstrated to activate adenylate cyclase in almost every cell that has been studied (8, 10, 22). We know that the activation of adenylate cyclase is an important signaling mechanism for A2A receptors, but adenylate cyclase may not be completely responsible for the important signaling mechanisms after A2A receptor activation (8).

We have also found in these studies that enprofylline, a selective adenosine A2B receptor antagonist, produced a significant inhibition of the rise in plasma levels of Epo in mice exposed to hypoxia. It has been proposed that after A2B receptor activation, a significant stimulation of phospholipase C occurred in bone marrow-derived mast cells (13). In addition, the Gp family of regulatory proteins (G proteins that activate phospholipase A2) has been postulated to play a significant role in the activation of A2B receptors, which are coupled to beta -phospholipase C in human mast cells (7). In contrast, A2A receptors have not been found to stimulate phospholipase C (7). Adenosine A2B receptor activation has also been found to activate adenylate cyclase to increase cAMP. We have found in the present studies that chelerythrine, a selective PKC inhibitor, produced a significant inhibition of the increase in Epo levels in culture medium of Hep3B cells and plasma levels of Epo in normal mice after exposure to hypoxia. Inhibition of Epo production by phorbol esters has been reported to be associated with downregulation of PKCalpha isoenzyme in hepatoma cell cultures (9). It is possible that adenosine activation of A2A and A2B receptors is additive, in that it would appear from our previous studies (19, 21) that 5'-(N-ethylcarboxamideadenosine) (NECA), a nonselective A2A and A2B receptor agonist, was much more potent in stimulating Epo production than CGS-21680. However, until a more selective A2B agonist is available, it will not be possible to test this hypothesis. It has been reported that A2A receptor-stimulated gene expression is regulated by the activation of adenosine A2A receptors through the stimulation of adenylate cyclase and an increase in the second messenger cAMP (25). It is also of interest that hypoxia has been reported to stimulate the expression of the adenosine A2A receptor gene in PC12 cells (10). In addition, studies in HeLa cell cultures treated with either a cAMP analog or a phorbol ester suggest that protein kinase A, but not PKC, is involved in oxygen sensing through the transcriptional factor hypoxia-inducible factor (HIF)-1 (11). Thus we postulate that both A2A and A2B adenosine receptors increase Epo mRNA through an increase in cAMP and HIF-1alpha . A receptor-mediated activation of phospholipase A2 has been proposed (3). Agonists that provoke hydrolysis of inositol phospholipids liberate free fatty acids and lysophospholipids as well as arachidonic acid (5). Adenosine has been demonstrated in previous studies to be involved in phospholipase A2 activation in biological responses (2, 17). We have reported previously that a cis-unsaturated free fatty acid, oleic acid, significantly enhanced 1-oleoyl-2-acetyl-rac-glycerol (OAG)-induced increases in medium levels of Epo in normoxic Hep3B cells, whereas a phospholipase A2 inhibitor, mepacrine, significantly decreased hypoxia-induced increases in Epo production in Hep3B cells (29). We reported several years ago that eicosanoids significantly increased Epo production in vivo in mice (20). Cis-unsaturated fatty acids, including oleic, linoleic, and arachidonic acids, all of which are produced from phospholipids by the action of phospholipase A2, are known to enhance the effects of diacylglycerol (DAG) in the presence of calcium on PKC (26). We propose that an additional transcriptional factor(s), heretofore unidentified, may be important in the phospholipase C, phospholipase A2, and kinase C signal transduction pathways leading to an increase in Epo mRNA.

Our model for hypoxic regulation of Epo production is shown in Fig. 8. Hypoxia results in the depletion of ATP in cells. Hypoxia also increases ectonucleotidase activity in extracellular fluid (18), which breaks down ATP to adenosine. We propose that adenosine activates A2A and A2B receptors to stimulate adenylate cyclase, increased cAMP, kinase A activation, increased phosphorylation of HIF-1alpha , and increased Epo mRNA. It has been reported that activating transcription factor-1 and cAMP-responsive element binding (CREB)-1 are the major constitutive nuclear factors binding to the HIF-1 DNA recognition site (11). A2B receptor activation also results in the stimulation of phospholipase C, which increases levels of inositol trisphosphate (IP3) and DAG (8). IP3 increases intracellular calcium, which acts in concert with DAG to stimulate PKC. Kinase C activation causes phosphorylation of another transcriptional protein, which binds to a DNA domain on the Epo gene to increase Epo mRNA, and increased Epo production. We also propose that adenosine activation of a receptor linked to phospholipase A2 leads to the production of cis-unsaturated fatty acids, which act in concert with DAG and calcium to stimulate PKC, leading to an increase in transcriptional proteins involved with Epo mRNA production. Our previous studies have indicated that adenosine activation of Epo production through the A2A receptor is probably through the cAMP pathway (19), which results in an increase in the effects of the transcriptional protein HIF-1alpha and perhaps an Epo mRNA binding protein (ERBP) (15). Further work is necessary to clarify the role of cAMP in this posttranscriptional regulation of Epo mRNA stability by ERBP. We have reported previously that with antisense oligonucleotide experiments, PKCalpha is involved in Epo production (15). The mechanism of Epo production is multifactorial and involves several signal transduction pathways.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Model for adenosine, protein kinases A and C, and phospholipase A2 in hypoxic regulation of Epo production. CC, chelerythrine; HIF-1alpha , hypoxia-inducible factor-1alpha ; PLC, phospholipase C; PLA2, phospholipase A2; AC, adenylate cyclase; R, receptor; DAG, diacylglycerol; IP3, inositol trisphophate; PIP2, phosphatidylinositol 4,5-bisphosphate; TP, transcriptional proteins; Gq, G protein that activates phosphoinositide-specific PLC; Gs = G stimulatory proteins; Gp = G protein that activates PLA2; NECA, 5'-(N-ethylcarboxamideadenosine); MP, mepacrine; FFA, free fatty acids; PC, phosphatidylcholine.


    ACKNOWLEDGEMENTS

This work was supported by funds from the Regents Professor in Pharmacology Fund.


    FOOTNOTES

First published July 12, 2001; 10.1152/ajprenal.0083.2001

Address for reprint requests and other correspondence: J. W. Fisher, Dept. of Pharmacology, SL83, Tulane Univ. School of Medicine, 1430 Tulane Ave., New Orleans, LA 70112-2699 (E-mail: jfisher{at}tulane.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 15 March 2001; accepted in final form 27 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bakris, GR, Sauter ER, Hussey JL, Fisher JW, Gaber AO, and Winsett R. Effects of theophylline on erythropoietin production in normal subjects and in patients with erythrocytosis after renal transplantation. N Engl J Med 323: 86-90, 1990[Abstract].

2.   Bouritius, H, Bojvoth RB, and Groot JA. Microelectrode measurements of the effects of basolateral adenosine in polarized human intestinal epithelial cells in culture. Pflügers Arch 437: 589-595, 1999[ISI][Medline].

3.   Burch, RM, Luini A, and Axelrod J. Phospholipase A2 and phospholipase C are activated by distinct GTP-binding proteins in response to alpha 1-adrenergic stimulation in FRTL5 thyroid cells. Proc Natl Acad Sci USA 83: 7201-7205, 1986[Abstract/Free Full Text].

4.   Carmichael, J, DeGraff WG, Gazadas AF, Mims JD, and Mitchell JB. Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res 47: 936-942, 1987[Abstract/Free Full Text].

5.   Dennis, EA, Rhee SG, Billoh MM, and Hommun YA. Role of phospholipase in generating lipid second messengers in signal transduction. FASEB J 5: 2068-2077, 1991[Abstract].

6.   Fandrey, J, and Bunn HF. In vivo and in vitro regulation of erythropoietin mRNA: measurement by competitive polymerase chain reaction. Blood 81: 617-623, 1995[Abstract/Free Full Text].

7.   Feoktistov, I, and Biaggioni I. Adenosine A2B receptors evoke interleukin-8 secretion in human mast cells. An enprofylline-sensitive mechanism with implications for asthma. J Clin Invest 96: 1979-1986, 1995.

8.   Feoktistov, I, and Biaggioni I. Adenosine A2B receptors. Pharmacol Rev 49: 381-402, 1997[Abstract/Free Full Text].

9.   Jelkmann, W, Huwiler A, Fanderey J, and Pfeilshifter J. Inhibition of erythropoietin production by phorbol ester is associated with down-regulation of protein kinase C-alpha isoenzyme in hepatoma cells. Biochem Biophys Res Commun 179: 1441-1448, 1991[ISI][Medline].

10.   Kobayashi, S, and Millhorn DE. Stimulation of expression for the adenosine A2A receptor gene by hypoxia in PC12 cells. A potential role in cell protection. J Biol Chem 274: 20358-20365, 1999[Abstract/Free Full Text].

11.   Kvietikova, I, Wenger RH, Marti HH, and Gassman M. The transcription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site. Nucleic Acids Res 23: 4542-4550, 1995[Abstract/Free Full Text].

12.   Libert, F, Schifmann SN, Lefort A, Parmentier M, Gerard C, Dumont JE, Vanderhaeghen JJ, and Vassart G. The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor. EMBO J 10: 1677-1682, 1991[ISI][Medline].

13.   Marquardt, DL, Walker LL, and Heinemann S. Cloning of two adenosine receptor subtypes from mouse bone marrow-derived mast cells. J Immunol 152: 4508-4515, 1994[Abstract].

14.   Mason-Garcia, M, Beckmann BS, Brookins J, Powell JS, Lanham W, Blaisdell S, Keay L, Li S, and Fisher JW. Development of a new radioimmunoassay for erythropoietin using recombinant erythropoietin. Kidney Int 38: 969-975, 1990[ISI][Medline].

15.   McGary, EC, Rondon IJ, and Beckman BS. Post-transcriptional regulation of erythropoietin mRNA stability by erythropoietin mRNA-binding protein. Proc Natl Acad Sci USA 88: 5149-5153, 1997[Abstract/Free Full Text].

16.   Mentzer, RM, Jr, Rubio R, and Berne RM. Release of adenosine by hypoxic canine lung tissue and its possible role in pulmonary circulation. Am J Physiol 229: 1625-1631, 1975.

17.   Michoud, MC, Tao FC, Pradham AA, and Martin JG. Mechanisms of the potentiation by adenosine of adenosine triphosphate-induced calcium release in tracheal smooth muscle cells. Am J Respir Cell Mol Biol 21: 30-36, 1999[Abstract/Free Full Text].

18.   Minamino, T, Kitakazc M, Komamura K, Node H, Takeda H, Inouse M, Hori M, and Kamada T. Activation of protein kinase C increases adenosine production in the hypoxic canine coronary artery through the extracellular pathway. Arterioscler Thromb Vasc Biol 15: 2298-2304, 1995[Abstract/Free Full Text].

19.   Nakashima, J, Ohigashi T, Brookins JW, Beckman BS, Agrawal KC, and Fisher JW. Effects of 5-N-ethylcarboxamideadenosine (NECA) on erythropoietin production. Kidney Int 44: 734-740, 1993[ISI][Medline].

20.   Nelson, K, Brookins J, and Fisher JW. Erythropoietic effects of prostacyclin (PGI2) and its metabolite 6-keto-prostaglandin (PG)E1. J Pharmacol Exp Ther 226: 493-499, 1983[Free Full Text].

21.   Ohigashi, T, Nakashima J, Aggarwal S, Brookins J, Agrawal K, and Fisher JW. Enhancement of erythropoietin production by selective adenosine A2 receptor agonists in response to hypoxia. J Lab Clin Med 126: 299-306, 1995[ISI][Medline].

22.   Ongini, E, and Fredholm BB. Pharmacology of adenosine A2A receptors. Trends Pharmacol Sci 17: 364-372, 1996[Medline].

23.   Pierce, KD, Furlong TJ, Selbie LA, and Shine J. Molecular cloning and expression of an adenosine A2B receptor from human brain. Biochem Biophys Res Commun 187: 86-93, 1992[ISI][Medline].

24.   Rivkees, SA, and Reppert SM. RFL9 encodes an A2B-adenosine receptor. Mol Endocrinol 6: 1598-1604, 1992[Abstract].

25.   Saitoh, O, Saitoh Y, and Nakata H. Regulation of A2A adenosine receptor mRNA expression by agonists and forskolin in PC12 cells. Neuroreport 5: 1317-1320, 1994[ISI][Medline].

26.   Shinomura, T, Asaoka Y, Oka M, Yoshida K, and Nishizuka Y. Synergistic action of diacylglycerol and unsaturated fatty acid for protein kinase C activation: its possible implications. Proc Natl Acad Sci USA 88: 5149-5153, 1991.

27.   Ueno, M, Brookins J, Beckman B, and Fisher JW. A1 and A2 adenosine receptor regulation of erythropoietin production. Life Sci 43: 229-237, 1988[ISI][Medline].

28.   Winer, BJ, Brown DR, and Michels KM. Statistical Principles in Experimental Design (3rd ed.). New York: McGraw-Hill, 1990.

29.   Yoshioka, K, Clejan S, Brookins J, and Fisher JW. Activation of protein kinase C in human hepatocellular carcinoma (Hep3B) cells increases erythropoietin production. Life Sci 63: 523-535, 1998[ISI][Medline].

30.   Zhou, QY, Li C, Olah ME, Johnson RA, Stiles GL, and Civelli O. Molecular cloning and characterization of an adenosine receptor: the A3 adenosine receptor. Proc Natl Acad Sci USA 89: 7432-7436, 1992[Abstract/Free Full Text].

31.   Zocchi, C, Ongini E, Conti A, Monopoli A, Negretti A, Baraldi PG, and Dionisotti S. The non-xanthine heterocyclic compound SCH 58261 is a new potent and selective A2A adenosine receptor antagonist. J Pharmacol Exp Ther 276: 398-404, 1996[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 281(5):F826-F832
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Grenz, H. Zhang, J. Weingart, S. von Wietersheim, T. Eckle, J. Schnermann, C. Kohle, D. Kloor, C. H. Gleiter, V. Vallon, et al.
Lack of effect of extracellular adenosine generation and signaling on renal erythropoietin secretion during hypoxia
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1501 - F1511.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. W. Fisher
Erythropoietin: Physiology and Pharmacology Update
Experimental Biology and Medicine, January 1, 2003; 228(1): 1 - 14.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
281/5/F826    most recent
0083.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fisher, J. W.
Right arrow Articles by Brookins, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fisher, J. W.
Right arrow Articles by Brookins, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online