|
|
||||||||
Department of Pharmacology, Tulane University School of Medicine, New Orleans, Louisiana 70112-2699
| |
ABSTRACT |
|---|
|
|
|---|
First published July 12, 2001;
10.1152/ajprenal.0083.2001.
We have examined the effects of adenosine
receptors and protein kinases A and C in the regulation of
erythropoietin (Epo) production using hepatocellular carcinoma (Hep3B)
cells in culture and in vivo in normal mice under normoxic and hypoxic
conditions. CGS-21680, a selective adenosine A2A agonist,
significantly increased levels of Epo in normoxic Hep3B cell cultures
and in serum of normal mice under both normoxic and hypoxic conditions.
CGS-21680 also produced a significant increase in Epo mRNA levels in
Hep3B cell cultures. SCH-58261, a selective adenosine A2A
receptor antagonist, significantly inhibited the increase in medium
levels of Epo in Hep3B cell cultures exposed to hypoxia (1%
O2). Enprofylline, a selective adenosine A2B
receptor antagonist, significantly inhibited the increase in plasma
levels of Epo in normal mice exposed to hypoxia. Chelerythrine
chloride, an antagonist of protein kinase C activation, significantly
inhibited hypoxia-induced increases in serum levels of Epo in normal
mice. A model is presented for adenosine in hypoxic regulation of Epo
production that involves kinases A and C and phospholipase
A2 pathways.
enprofylline; chelerythrine; CGS-21680; SCH-58261; hypoxia; normoxia
| |
INTRODUCTION |
|---|
|
|
|---|
ADENOSINE IS AN ENDOGENOUS nucleoside that has been demonstrated to modulate several physiological processes through specific G protein-coupled adenosine receptors. There are essentially four subtypes of adenosine receptors that have been cloned: A1, A2A, A2B, and A3 (8, 12, 23, 24, 30, 31). Generally, A1 and A3 adenosine receptors inhibit adenylate cyclase, whereas A2 receptor activation stimulates adenylate cyclase. Adenosine A2A receptor messenger RNA and protein have been demonstrated to be increased in PC12 cells in response to hypoxia (10). We have postulated previously that adenosine acts through adenosine receptors to regulate erythropoietin (Epo) production; however, the specific type of adenosine receptor involved in Epo production has not been elucidated (19, 21, 27). Theophylline, a nonselective adenosine A1 and A2 receptor antagonist, was shown to inhibit the effects of hypoxia on Epo production (27). Hypoxia has been reported to increase ectonucleotidase activity (18) and adenosine production (16) in vascular endothelial cells. We have previously reported that adenosine analogs (19, 21) increase cAMP and Epo production in hepatocellular carcinoma (Hep3B) cell cultures. We have also reported that theophylline, a nonselective adenosine A1 and A2 receptor antagonist, inhibits the enhanced Epo production seen in patients with post-kidney transplantation erythrocytosis (1). A link between protein kinase C (PKC) activation and hypoxia-induced Epo production has been reported (29), but the precise mechanism of this action was not clear. The purpose of the present study was to clarify the relationship of specific types of adenosine receptors and protein kinases that are involved in hypoxic regulation of Epo production.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals
Enprofylline and CGS-21680 were obtained from Sigma Chemical (St. Louis, MO). Penicillin G, streptomycin, L-glutamine, sodium pyruvate, nonessential amino acids, trypsin, Eagle's minimum essential medium (EMEM), and Dulbecco's phosphate-buffered saline were obtained from GIBCO-BRL (Life Technologies). Chelerythrine chloride was obtained from Alexis (San Diego, CA). SCH-58261 was provided by Schering-Plough Research Institute (Milan, Italy). All other chemicals were purchased from Sigma Chemical, with the exception of those specifically described.In Vivo Epo Studies in Mice
Briefly, CD1 strain female mice were used in these studies. Enprofylline, a selective adenosine A2B receptor antagonist in saline, was administered intravenously in a single dose in a volume of 0.2 ml. Chelerythrine and 2-p-[2-carboxyethyl] phenethylamino-5'-N-ethylcarboxamidoadenosine (CGS-21680) were administered subcutaneously in 0.2 ml of saline. After the injection of one of the above compounds, or saline as the control, the mice were exposed to 2 or 4 h of hypoxia (0.42 atm) in a hypobaric chamber. After hypobaric stimulation, the mice were immediately anesthetized with ether and exsanguinated via cardiac puncture. Blood samples were collected via cardiac puncture in heparinized tubes, and the plasma was separated by centrifugation. Epo levels in the plasma were determined by a sensitive Epo RIA. The details of the RIA used in our laboratory have been published previously (14). The mean basal level of Epo in our Hep3B cell culture medium in cells incubated for 24 h under normoxic control conditions for the five CGS-21680 experiments was 18.53 ± 5.0 mu/ml. The minimal detectable level of Epo in this assay was 1.56 mu/ml. Epo levels are expressed as milliunits per milliliter.Hep3B Cell Cultures
Human Hep3B cells, obtained from the American Type Culture Collection (ATCC), were transferred to 75-cm2 canted neck tissue culture flasks (Corning, Corning, NY). The cells were placed in a water-jacketed incubator (model no. 31580; Forma Scientific) and incubated in monolayer cell cultures in EMEM supplemented with 10% fetal bovine serum, 0.1 mmol/l nonessential amino acids, 1 mmol/l sodium pyruvate, penicillin G (100 U/ml), and streptomycin (100 µg/ml) in a humidified atmosphere of 5% CO2-95% air at 37°C. For the CGS-21680 experiments, 7.6 × 106 cells were transferred to each 75-cm2 tissue flask, and, for the mRNA experiments, 15.0 × 106 cells were transferred to each 75-cm2 flask (Sarstedt). The cells were then incubated for 24 h in a normoxic (20% O2-5% CO2-75% N2) atmosphere, after which several experiments were performed. For the SCH-58261 experiments, cells were transferred to each 75-cm2 flask. Cytotoxicity testing of each of the Hep3B cell culture experiments was carried out utilizing the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) technique (4).Isolation of RNA
Hep3B cells were incubated for 6 h under normoxic conditions in the presence or absence of the test substance. Total cellular RNA was isolated by use of the RNAzol B method (TEL-TEST, Friendswood, TX). The isolated RNA was further purified by use of RQ1 RNase-free DNase (Promega, Madison, WI). The integrity of each RNA sample was verified by agarose-formaldehyde gel electrophoresis and quantified spectrophotometrically.Quantitation of RNA
Quantitative RT-PCR was performed using the technique of Fandrey and Bunn (6), as previously described, but with some modifications. Total RNA (250 ng) in each sample was reverse transcribed by incubation with 1 unit of rTth DNA polymerase (PerkinElmer) per 10 µl of the reaction mixture, containing 100 µM deoxynucleotide triphosphate (dNTP; PerkinElmer), 25 pmol of Epo or
-actin downstream primer, 5 mM manganese acetate
[Mn(OAc)2], and 1× EZ buffer (PerkinElmer) for
30 min at 60°C. The reverse transcription was terminated by placing
the tube on ice. The resultant cDNA was used for PCR. Each sample was
measured for Epo cDNA and
-actin cDNA in separate tubes with the use
of specific primers. The sequence of Epo primers was kindly provided by
Dr. Joaquin Fandrey (Univ. of Bonn, Bonn, Germany). These primers
yielded a 253-base pair fragment (6). The upstream and
downstream primers for
-actin were ATCTGGCACCACACCTTCTACAATG and
GGGGTGTTCAAGGTCTCAAAC, respectively, which yielded a 137-base pair
cDNA fragment. PCR was performed by incubation of 250-ng/µl samples
of cDNA with 5 mM Mn(OAc)2, 200 µM dNTP, 1 unit/10 µl of reaction mixture rTth DNA polymerase, 1× EZ buffer, 1 µCi
[32P]dCTP (ICN), and 25 pM of
-actin primers and
carried out for 35 cycles (30 s at 95°C, 30 s at 60°C, and
40 s at 72°C) with the use of the Strategene Robocycler-40
system. PCR using the Epo primers was carried out for 40 cycles
under identical conditions. Epo and
-actin primers were never
combined in the same tube. A quantity of 30 µl of the final PCR
reaction was electrophoresed using 2% agarose (Promega) in 1×
Tris-boric acid-EDTA (TBE) buffer containing 0.36 µg/ml of
ethidium bromide. The bands corresponding to the cDNA product were
excised and mixed with scintillation cocktail, and counts per minute
were determined on a Beckman beta counter. Epo and
-actin cDNA
obtained from PCR of the reverse transcribed RNA was used to generate
standard curves. The cDNA was amplified by PCR, and the resultant
amplified product was divided into small fractions that were
reamplified. The purity of the final product was confirmed by
electrophoresis. If a single band of the appropriate size was obtained,
the final product was cleaned using a Wizard PCR purification system
(Promega) to remove primers. The cleaned product was again
electrophoresed to confirm that it contained only the desired DNA. The
cDNA was quantified spectrophotometrically after purification. Standard
curves for Epo mRNA or
-actin mRNA (10
1 to
10
7 µg/tube) were prepared by simultaneously amplifying
the appropriate samples of cDNA in separate tubes. Every PCR amplified
included a standard curve. All results are expressed as nanograms Epo
cDNA per nanograms
-actin cDNA to standardize the amount of RNA
initially reverse transcribed. All experiments were performed three
times for each assay.
The statistical analyses for all data were carried out using Newman-Keuls post hoc procedure (28) or one-tailed Student's t-test, and the results are expressed as means ± SE.
Experimental Groups Studied
Experiment 1.
Normal female CD1 mice were injected subcutaneously with 0.25 ml
saline, 10 mg/kg chelerythrine, 250 µM/kg enprofylline, or 0.1 µM/kg CGS-21680 (iv). One hour after injection, the mice were placed
in a hypobaric (0.42 atm) chamber for 2 and 4 h, respectively. Immediately after being removed from the hypobaric chamber, the mice
were exsanguinated and the plasma was separated from the heparinized
blood and stored at
70°C before Epo RIA. The effects of CGS-21680
(0.1 µM/kg iv) on plasma levels of Epo in normal mice under normoxic
conditions and after exposure to 4-h hypoxia are shown (see Fig. 5).
The effects of 250 µM/kg enprofylline on plasma levels of Epo in
normal mice after 2- and 4-h exposure to hypoxia are also shown (see
Fig. 6). The effects of chelerythrine at 10 mg/kg (ip) on plasma levels
of Epo in normal mice after exposure to 2- and 4-h hypoxia are shown
(see Fig. 7).
Experiment 2.
The effects of CGS-21680 on Epo and Epo mRNA production by Hep3B cells
were studied. Hep3B cells were incubated in 75-cm2 flasks
under normoxic conditions until 100% confluency of the cells was
reached. Five flasks were used as controls (only EMEM added) and five
flasks for each of five concentrations (1 × 10
9 to
1 × 10
5 M) of CGS-21680 under normoxic (10%
O2) conditions. Fifteen flasks were set up for the
SCH-58261 experiments under hypoxic (1% O2 for 24 h)
conditions (5 flasks for controls, 5 flasks with 1 × 10
6 M SCH-58261, and 5 flasks with 1 × 10
5 M SCH-58261). Thereafter, the medium and cells were
harvested from the 20 flasks and used for quantitative determination of Epo (RIA) and of Epo mRNA by RT-PCR. Figure
1 shows the effects of SCH-58261 (1 × 10
6 and 1 × 10
5 M) on Hep3B cell
medium levels of Epo after exposure to hypoxia (1% O2).
|
|
|
|
| |
RESULTS |
|---|
|
|
|---|
As seen in Fig. 1, SCH-58261 (1 × 10
6 and
1 × 10
5 M), a selective adenosine A2A
receptor antagonist, significantly (P < 0.05) inhibited the increase in medium levels of Epo in Hep3B cell cultures exposed to hypoxia (1% O2) for 24 h.
As noted in Fig. 2, when Hep3B cells were incubated with CGS-21680
(1 × 10
9 to 1 × 10
5M) for
24 h under normoxic conditions, a significant (P < 0.05) increase in Epo levels was seen in the culture medium.
CGS-21680 produced a significant (P < 0.05) increase
in Epo mRNA levels in Hep3B cell cultures under normoxic conditions
(Fig. 3).
The electrophoretic gels illustrating the effects of CGS-21680 and hypoxia on Epo mRNA are shown in Fig. 4. As noted in Fig. 4, exposure of Hep3B cells to CGS-21680 for 6 h under normoxic conditions resulted in a significant increase in Epo mRNA levels in Hep3B cells compared with normoxic controls. Also note the marked increase in Epo mRNA seen after exposure to hypoxia.
As noted in Fig. 5, CGS-21680 at
0.1 µmol/kg (when injected intravenously 4 h before)
and at 0.1 µmol/kg (at the time the mice were exposed to
hypoxia) significantly (P < 0.01) enhanced the effects of hypoxia on plasma levels of Epo compared with hypoxia controls. In addition, CGS-21680 significantly increased plasma levels
of Epo in normoxic mice compared with normoxic controls (Fig. 5). These
data indicate that adenosine A2A receptor activation plays
a significant role in Epo regulation.
|
As seen in Fig. 6, enprofylline, a
selective adenosine A2B receptor antagonist, at a dosage of
250 µmol/kg, significantly (P < 0.01) inhibited the
rise in plasma levels of Epo in normal mice exposed to either 2 or
4 h of hypoxia. These data indicate that adenosine A2B
receptor activation after exposure to hypoxia is an important mechanism
in the regulation of Epo production.
|
As noted in Fig. 7, chelerythrine (10 mg/kg), a selective PKC inhibitor, significantly (P < 0.01) inhibited the increase in plasma levels of Epo in normal mice
exposed to either 2 or 4 h of hypoxia.
|
| |
DISCUSSION |
|---|
|
|
|---|
Hypoxia is known to enhance the production of adenosine in endothelial cells (18). This increase in adenosine activates adenosine A2A (10, 27) and A2B (8, 23) receptors to initiate a cascade of events leading to several physiological responses. We have demonstrated previously that adenosine receptor activation enhances the effects of hypoxia-induced Epo production (19, 21, 27). In the present studies, we report that adenosine regulation of Epo occurs through the activation of both adenosine A2A and A2B receptors. We have also found that SCH-58261, a selective adenosine A2A receptor antagonist, produces a significant inhibition of the rise in Epo levels in culture medium in Hep3B cells after exposure to hypoxia. CGS-21680, a selective adenosine A2A receptor agonist, was also found to produce a significant increase in culture medium levels of Epo and Epo mRNA in Hep3B cells under normoxic conditions and a significant increase in plasma levels of Epo in normal and hypoxic mice. Adenosine A2A receptor activation leads to the stimulation of adenylate cyclase, a rise in cAMP levels in cells, and an increase in A2A receptor mRNA (10). It is well known that A2A and A2B adenosine receptors are coupled to increasing G stimulatory (Gs) proteins, and both have been demonstrated to activate adenylate cyclase in almost every cell that has been studied (8, 10, 22). We know that the activation of adenylate cyclase is an important signaling mechanism for A2A receptors, but adenylate cyclase may not be completely responsible for the important signaling mechanisms after A2A receptor activation (8).
We have also found in these studies that enprofylline, a selective
adenosine A2B receptor antagonist, produced a significant inhibition of the rise in plasma levels of Epo in mice exposed to
hypoxia. It has been proposed that after A2B receptor
activation, a significant stimulation of phospholipase C occurred in
bone marrow-derived mast cells (13). In addition, the
Gp family of regulatory proteins (G proteins that activate
phospholipase A2) has been postulated to play a
significant role in the activation of A2B receptors, which
are coupled to
-phospholipase C in human mast cells
(7). In contrast, A2A receptors have not been
found to stimulate phospholipase C (7). Adenosine
A2B receptor activation has also been found to activate
adenylate cyclase to increase cAMP. We have found in the present
studies that chelerythrine, a selective PKC inhibitor, produced a
significant inhibition of the increase in Epo levels in culture medium
of Hep3B cells and plasma levels of Epo in normal mice after exposure
to hypoxia. Inhibition of Epo production by phorbol esters has been
reported to be associated with downregulation of PKC
isoenzyme in
hepatoma cell cultures (9). It is possible that adenosine
activation of A2A and A2B receptors is
additive, in that it would appear from our previous studies (19,
21) that 5'-(N-ethylcarboxamideadenosine) (NECA), a
nonselective A2A and A2B receptor agonist, was
much more potent in stimulating Epo production than CGS-21680. However, until a more selective A2B agonist is available, it will
not be possible to test this hypothesis. It has been reported that
A2A receptor-stimulated gene expression is regulated by the
activation of adenosine A2A receptors through the
stimulation of adenylate cyclase and an increase in the second
messenger cAMP (25). It is also of interest that hypoxia
has been reported to stimulate the expression of the adenosine
A2A receptor gene in PC12 cells (10). In
addition, studies in HeLa cell cultures treated with either a cAMP
analog or a phorbol ester suggest that protein kinase A, but not PKC,
is involved in oxygen sensing through the transcriptional factor
hypoxia-inducible factor (HIF)-1 (11). Thus we postulate that both A2A and A2B adenosine receptors
increase Epo mRNA through an increase in cAMP and HIF-1
. A
receptor-mediated activation of phospholipase A2 has been
proposed (3). Agonists that provoke hydrolysis of inositol
phospholipids liberate free fatty acids and lysophospholipids as well
as arachidonic acid (5). Adenosine has been demonstrated
in previous studies to be involved in phospholipase A2
activation in biological responses (2, 17). We have
reported previously that a cis-unsaturated free fatty acid,
oleic acid, significantly enhanced
1-oleoyl-2-acetyl-rac-glycerol (OAG)-induced increases in medium levels of Epo in normoxic Hep3B cells, whereas a
phospholipase A2 inhibitor, mepacrine, significantly
decreased hypoxia-induced increases in Epo production in Hep3B cells
(29). We reported several years ago that eicosanoids
significantly increased Epo production in vivo in mice
(20). Cis-unsaturated fatty acids, including
oleic, linoleic, and arachidonic acids, all of which are produced from
phospholipids by the action of phospholipase A2, are known
to enhance the effects of diacylglycerol (DAG) in the presence of
calcium on PKC (26). We propose that an additional transcriptional factor(s), heretofore unidentified, may be important in
the phospholipase C, phospholipase A2, and kinase C signal transduction pathways leading to an increase in Epo mRNA.
Our model for hypoxic regulation of Epo production is shown in Fig.
8. Hypoxia results in the depletion of
ATP in cells. Hypoxia also increases ectonucleotidase activity
in extracellular fluid (18), which breaks down ATP to
adenosine. We propose that adenosine activates A2A and
A2B receptors to stimulate adenylate cyclase, increased
cAMP, kinase A activation, increased phosphorylation of HIF-1
, and
increased Epo mRNA. It has been reported that activating transcription
factor-1 and cAMP-responsive element binding (CREB)-1 are the major
constitutive nuclear factors binding to the HIF-1 DNA recognition site
(11). A2B receptor activation also results in
the stimulation of phospholipase C, which increases levels of inositol
trisphosphate (IP3) and DAG (8).
IP3 increases intracellular calcium, which acts in concert
with DAG to stimulate PKC. Kinase C activation causes phosphorylation
of another transcriptional protein, which binds to a DNA domain on the
Epo gene to increase Epo mRNA, and increased Epo production. We also
propose that adenosine activation of a receptor linked to phospholipase
A2 leads to the production of cis-unsaturated
fatty acids, which act in concert with DAG and calcium to stimulate
PKC, leading to an increase in transcriptional proteins involved with
Epo mRNA production. Our previous studies have indicated that adenosine
activation of Epo production through the A2A receptor is
probably through the cAMP pathway (19), which results in
an increase in the effects of the transcriptional protein HIF-1
and
perhaps an Epo mRNA binding protein (ERBP) (15). Further
work is necessary to clarify the role of cAMP in this
posttranscriptional regulation of Epo mRNA stability by ERBP. We have
reported previously that with antisense oligonucleotide experiments,
PKC
is involved in Epo production (15). The mechanism
of Epo production is multifactorial and involves several signal
transduction pathways.
|
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by funds from the Regents Professor in Pharmacology Fund.
| |
FOOTNOTES |
|---|
First published July 12, 2001; 10.1152/ajprenal.0083.2001
Address for reprint requests and other correspondence: J. W. Fisher, Dept. of Pharmacology, SL83, Tulane Univ. School of Medicine, 1430 Tulane Ave., New Orleans, LA 70112-2699 (E-mail: jfisher{at}tulane.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 15 March 2001; accepted in final form 27 June 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bakris, GR,
Sauter ER,
Hussey JL,
Fisher JW,
Gaber AO,
and
Winsett R.
Effects of theophylline on erythropoietin production in normal subjects and in patients with erythrocytosis after renal transplantation.
N Engl J Med
323:
86-90,
1990[Abstract].
2.
Bouritius, H,
Bojvoth RB,
and
Groot JA.
Microelectrode measurements of the effects of basolateral adenosine in polarized human intestinal epithelial cells in culture.
Pflügers Arch
437:
589-595,
1999[ISI][Medline].
3.
Burch, RM,
Luini A,
and
Axelrod J.
Phospholipase A2 and phospholipase C are activated by distinct GTP-binding proteins in response to alpha 1-adrenergic stimulation in FRTL5 thyroid cells.
Proc Natl Acad Sci USA
83:
7201-7205,
1986
4.
Carmichael, J,
DeGraff WG,
Gazadas AF,
Mims JD,
and
Mitchell JB.
Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing.
Cancer Res
47:
936-942,
1987
5.
Dennis, EA,
Rhee SG,
Billoh MM,
and
Hommun YA.
Role of phospholipase in generating lipid second messengers in signal transduction.
FASEB J
5:
2068-2077,
1991[Abstract].
6.
Fandrey, J,
and
Bunn HF.
In vivo and in vitro regulation of erythropoietin mRNA: measurement by competitive polymerase chain reaction.
Blood
81:
617-623,
1995
7.
Feoktistov, I,
and
Biaggioni I.
Adenosine A2B receptors evoke interleukin-8 secretion in human mast cells. An enprofylline-sensitive mechanism with implications for asthma.
J Clin Invest
96:
1979-1986,
1995.
8.
Feoktistov, I,
and
Biaggioni I.
Adenosine A2B receptors.
Pharmacol Rev
49:
381-402,
1997
9.
Jelkmann, W,
Huwiler A,
Fanderey J,
and
Pfeilshifter J.
Inhibition of erythropoietin production by phorbol ester is associated with down-regulation of protein kinase C-
isoenzyme in hepatoma cells.
Biochem Biophys Res Commun
179:
1441-1448,
1991[ISI][Medline].
10.
Kobayashi, S,
and
Millhorn DE.
Stimulation of expression for the adenosine A2A receptor gene by hypoxia in PC12 cells. A potential role in cell protection.
J Biol Chem
274:
20358-20365,
1999
11.
Kvietikova, I,
Wenger RH,
Marti HH,
and
Gassman M.
The transcription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site.
Nucleic Acids Res
23:
4542-4550,
1995
12.
Libert, F,
Schifmann SN,
Lefort A,
Parmentier M,
Gerard C,
Dumont JE,
Vanderhaeghen JJ,
and
Vassart G.
The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor.
EMBO J
10:
1677-1682,
1991[ISI][Medline].
13.
Marquardt, DL,
Walker LL,
and
Heinemann S.
Cloning of two adenosine receptor subtypes from mouse bone marrow-derived mast cells.
J Immunol
152:
4508-4515,
1994[Abstract].
14.
Mason-Garcia, M,
Beckmann BS,
Brookins J,
Powell JS,
Lanham W,
Blaisdell S,
Keay L,
Li S,
and
Fisher JW.
Development of a new radioimmunoassay for erythropoietin using recombinant erythropoietin.
Kidney Int
38:
969-975,
1990[ISI][Medline].
15.
McGary, EC,
Rondon IJ,
and
Beckman BS.
Post-transcriptional regulation of erythropoietin mRNA stability by erythropoietin mRNA-binding protein.
Proc Natl Acad Sci USA
88:
5149-5153,
1997
16.
Mentzer, RM, Jr,
Rubio R,
and
Berne RM.
Release of adenosine by hypoxic canine lung tissue and its possible role in pulmonary circulation.
Am J Physiol
229:
1625-1631,
1975.
17.
Michoud, MC,
Tao FC,
Pradham AA,
and
Martin JG.
Mechanisms of the potentiation by adenosine of adenosine triphosphate-induced calcium release in tracheal smooth muscle cells.
Am J Respir Cell Mol Biol
21:
30-36,
1999
18.
Minamino, T,
Kitakazc M,
Komamura K,
Node H,
Takeda H,
Inouse M,
Hori M,
and
Kamada T.
Activation of protein kinase C increases adenosine production in the hypoxic canine coronary artery through the extracellular pathway.
Arterioscler Thromb Vasc Biol
15:
2298-2304,
1995
19.
Nakashima, J,
Ohigashi T,
Brookins JW,
Beckman BS,
Agrawal KC,
and
Fisher JW.
Effects of 5-N-ethylcarboxamideadenosine (NECA) on erythropoietin production.
Kidney Int
44:
734-740,
1993[ISI][Medline].
20.
Nelson, K,
Brookins J,
and
Fisher JW.
Erythropoietic effects of prostacyclin (PGI2) and its metabolite 6-keto-prostaglandin (PG)E1.
J Pharmacol Exp Ther
226:
493-499,
1983
21.
Ohigashi, T,
Nakashima J,
Aggarwal S,
Brookins J,
Agrawal K,
and
Fisher JW.
Enhancement of erythropoietin production by selective adenosine A2 receptor agonists in response to hypoxia.
J Lab Clin Med
126:
299-306,
1995[ISI][Medline].
22.
Ongini, E,
and
Fredholm BB.
Pharmacology of adenosine A2A receptors.
Trends Pharmacol Sci
17:
364-372,
1996[Medline].
23.
Pierce, KD,
Furlong TJ,
Selbie LA,
and
Shine J.
Molecular cloning and expression of an adenosine A2B receptor from human brain.
Biochem Biophys Res Commun
187:
86-93,
1992[ISI][Medline].
24.
Rivkees, SA,
and
Reppert SM.
RFL9 encodes an A2B-adenosine receptor.
Mol Endocrinol
6:
1598-1604,
1992[Abstract].
25.
Saitoh, O,
Saitoh Y,
and
Nakata H.
Regulation of A2A adenosine receptor mRNA expression by agonists and forskolin in PC12 cells.
Neuroreport
5:
1317-1320,
1994[ISI][Medline].
26.
Shinomura, T,
Asaoka Y,
Oka M,
Yoshida K,
and
Nishizuka Y.
Synergistic action of diacylglycerol and unsaturated fatty acid for protein kinase C activation: its possible implications.
Proc Natl Acad Sci USA
88:
5149-5153,
1991.
27.
Ueno, M,
Brookins J,
Beckman B,
and
Fisher JW.
A1 and A2 adenosine receptor regulation of erythropoietin production.
Life Sci
43:
229-237,
1988[ISI][Medline].
28.
Winer, BJ,
Brown DR,
and
Michels KM.
Statistical Principles in Experimental Design (3rd ed.). New York: McGraw-Hill, 1990.
29.
Yoshioka, K,
Clejan S,
Brookins J,
and
Fisher JW.
Activation of protein kinase C in human hepatocellular carcinoma (Hep3B) cells increases erythropoietin production.
Life Sci
63:
523-535,
1998[ISI][Medline].
30.
Zhou, QY,
Li C,
Olah ME,
Johnson RA,
Stiles GL,
and
Civelli O.
Molecular cloning and characterization of an adenosine receptor: the A3 adenosine receptor.
Proc Natl Acad Sci USA
89:
7432-7436,
1992
31.
Zocchi, C,
Ongini E,
Conti A,
Monopoli A,
Negretti A,
Baraldi PG,
and
Dionisotti S.
The non-xanthine heterocyclic compound SCH 58261 is a new potent and selective A2A adenosine receptor antagonist.
J Pharmacol Exp Ther
276:
398-404,
1996
This article has been cited by other articles:
![]() |
A. Grenz, H. Zhang, J. Weingart, S. von Wietersheim, T. Eckle, J. Schnermann, C. Kohle, D. Kloor, C. H. Gleiter, V. Vallon, et al. Lack of effect of extracellular adenosine generation and signaling on renal erythropoietin secretion during hypoxia Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1501 - F1511. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Fisher Erythropoietin: Physiology and Pharmacology Update Experimental Biology and Medicine, January 1, 2003; 228(1): 1 - 14. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |