AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 281: F909-F919, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dechow, C.
Right arrow Articles by Wagner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dechow, C.
Right arrow Articles by Wagner, J.
Vol. 281, Issue 5, F909-F919, November 2001

Effects of all-trans retinoic acid on renin-angiotensin system in rats with experimental nephritis

Claudius Dechow1, Christian Morath1, Jörg Peters2, Ingo Lehrke1, Rüdiger Waldherr1, Volker Haxsen1, Eberhard Ritz1, and Jürgen Wagner1

Divisions of 1 Nephrology and 2 Pharmacology, University of Heidelberg, D-69115, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We previously demonstrated that all-trans retinoic acid (RA) preserves glomerular structure and function in anti-Thy1.1 nephritis (Wagner J, Dechow C, Morath C, Lehrke I, Amann K, Floege J, and Ritz E. J Am Soc Nephrol 11: 1479-1489, 2000). Because the renin-angiotensin system (RAS) contributes to renal damage, we 1) studied retinoid-specific effects on its components and 2) compared the effects of all-trans-RA with those of the AT1-receptor blocker candesartan. Rats were pretreated for 3 days before injection of the OX-7 antibody and continued with treatment with either vehicle or daily injections of 10 mg/kg all-trans-RA only (study 1) or 10 mg/kg body wt all-trans-RA, 1 mg/kg candesartan, or both (study 2) for an additional 7 days. The blood pressure increase observed in anti-Thy1.1 nephritic rats was equally normalized by all-trans-RA and candesartan (P < 0.05). In nephritic rats, mRNAs of angiotensinogen and angiotensin-converting enzyme (ACE) in the kidney were unchanged, but renin mRNA was lower (P < 0.01). Renal and glomerular AT1-receptor gene and protein expression levels were higher in anti-Thy1.1 nephritic rats (P < 0.05). In the renal cortex of nephritic rats, pretreatment with all-trans-RA significantly reduced mRNAs of all the examined RAS components, but in the glomeruli it increased ACE gene and protein expression (P < 0.01). In nephritic rats, candesartan reduced the number of glomerular cells and mitoses (P < 0.05) less efficiently than all-trans-RA (P < 0.01). Both substances reduced cellular proliferation (proliferating cell nuclear antigen) significantly (P < 0.05). No additive effects were noted when both compounds were combined. In conclusion, all-trans-RA influences the renal RAS in anti-Thy1.1 nephritis by decreasing ANG II synthesis and receptor expression. The beneficial effect of retinoids may be explained, at least in part, by reduction of RAS activity.

anti-Thy1.1 nephritis; mesangioproliferative glomerulonephritis; candesartan; polymerase chain reaction; immunohistochemistry


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

WE PREVIOUSLY DEMONSTRATED that retinoids effectively limit renal damage and mesangial cell proliferation in the rat anti-Thy1.1 model of mesangioproliferative glomerulonephritis. This was documented by a lower capillary occlusion score, lower glomerular cell counts, less inflammatory cell immigration, and less extracellular matrix deposition. These effects led to preservation of renal function and reduction of albuminuria (48).

The rat anti-Thy1.1 model is a well-established model of mesangioproliferative glomerulonephritis (32). A singular injection of an antibody directed toward the Thy antigen located on the surface of mesangial cells induces initial mesangiolysis. That period is followed by a phase of overcompensatory proliferation of mesangial cells, which is cleared and restored to normal within a period of 3 wk. Species-specific differences having been taken into account, anti-Thy1.1 nephritis resembles in many aspects human IgA nephritis or Henoch-Schonlein purpura (37). Therefore, in the past this model has been used to test potentially therapeutic approaches (2, 20).

The mechanisms through which the beneficial retinoid effects are mediated have not been clarified. We documented an effect of retinoids on the expression of several cytokines and growth factors (11, 14, 29, 42), but this does not exclude the possibility that additional mechanisms play a role. In this context, the renin-angiotensin system (RAS) is of particular importance. ANG II is a key factor in the genesis of renal damage. ANG II promotes proliferation of mesangial cells, glomerular hypertrophy, and extracellular matrix expansion (21, 23, 38) and exerts these effects either via direct actions or indirectly via stimulation of growth factors, cytokines such as interleukin (IL)-6 (24), and vasoactive substances. Some effects of ANG II are mediated via modulation of protooncogenes and transcription factors such as activator protein-1 (AP-1) and nuclear factor-kappa B (NF-kappa B) (1, 27, 34).

Retinoids are derivates of vitamin A. In contrast to ANG II, they have antiproliferative and anti-inflammatory effects (9, 17, 30). These compounds exert their actions via different receptor subtypes, i.e., retinoid A receptors, which interact with the retinoid-prototype all-trans retinoic acid (RA), and retinoid X receptors, which interact with 9-cis-RA (4, 5, 13, 15). Retinoid receptors are expressed in the kidney, where they alter the expression of target genes via modulation of gene transcription (5, 16, 42, 43). Retinoids reduce the expression of platelet-derived growth factor, inducible NO synthase, IL-6, and endothelin (9, 11, 29) and thus oppose the action of ANG II. Their effects on expression and function of transforming growth factor-beta 1 (TGF-beta 1) as well as on extracellular matrix proteins are cell and context specific (14, 19). In anti-Thy1.1 glomerulonephritis, renal TGF-beta 1 expression was reduced by retinoids (31). Retinoids counteract AP-1 activity and NF-kappa B, which are involved in ANG II action (6, 9, 30, 42, 43, 51). Haxsen et al. (17) demonstrated that retinoids inhibit ANG II-induced proliferation in vascular smooth muscle cells and downregulate AT1-receptor expression, possibly via effects on AP-1 (17, 46).

The present study was designed to examine the possibility that retinoids act, at least in part, by interfering with the expression and action of ANG II in the anti-Thy1.1 nephritis model. To this end, we 1) investigated the effects of all-trans-RA on the expression of the components of the RAS in the kidneys and plasma of rats with anti-Thy1.1 glomerulonephritis and 2) compared the effect of retinoids on glomerular cell counts and glomerular cell proliferation with that of the AT1-receptor blocker candesartan.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Experimental Protocol

Anti-Thy1.1 nephritis was induced by a single intravenous injection of 1 mg/kg body wt OX-7 (courtesy of Dr. J. Floege, Univ. of Aachen), a monoclonal antibody against the Thy1.1-like antigen on the surface of rat mesangial cells. Male Wistar rats, weighing 180-200 g, were used in two experiments (n = 9/group).

Study 1. Anti-Thy1.1 nephritic rats were injected daily with either 10 mg/kg body wt all-trans-RA or vehicle (oleum arachis, 5% DMSO) and compared with similarly treated control animals. Rats were pretreated with all-trans-RA for 3 days before application of the antibody. Thus treatment lasted from day -3 to day +7. In a separate experiment, we had excluded that pretreatment interferes with the binding of the OX-7 antibody and the subsequent acute injury (48). Anti-Thy1.1 nephritis was induced on day 0, and the experiment was terminated 8 days after antibody injection by injection of xylazine (5 mg/kg body wt im, WDT, Garbsen, Germany) and ketamine (100 mg/kg body wt im, BayerVital, Leverkusen, Germany). Rats were perfused with saline containing 1 mg/l procaine hydrochloride by retrograde insertion of a cannula into the abdominal aorta. Blood was drained through an incision of the inferior vena cava. The perfusion pressure was adapted to the individual systemic blood pressure measured before termination of the experiment. Glomeruli were isolated by a fractional sieving technique as described earlier (45). The yield and the purity of isolated glomeruli at each time point were comparable (purity >95%).

Study 2. To compare the effects of retinoids to those of an AT1-receptor blocker, rats were treated with all-trans-RA or vehicle similarly to study 1 and additionally received 1 mg/kg body wt candesartan cilexitil (Takeda Pharma, Aachen, Germany) or vehicle administered in the drinking water from day 0 to day +7. Blood pressure was determined on days -3 and +7 by tail-cuff plethysmography under light ether anesthesia.

Renal Morphology

Tissue for standard light microscopy was fixed in 10% buffered formalin and embedded in paraffin. Sections (4 µm) were stained with periodic acid-Schiff reagent and counterstained with hematoxylin. Total glomerular cell count was determined in at least 30 cortical glomeruli/kidney with a diameter of at least 100 µm. Visible glomerular mitoses (anaphases, metaphases) were counted in 100 glomeruli/kidney section. The extent of capillary occlusion was determined by a semiquantitative score system as follows: 0, little or no occlusion; 1+, <25% of total capillary tuft area occluded; and 2+, 3+, and 4+: <50, <75, and 75-100% occluded capillary tuft area of at least 30 cortical glomeruli, respectively.

Immunohistochemical Analyses of Proliferating Cell Nuclear Antigen and RAS Parameters

Cryostat sections of freshly frozen renal tissue were air-dried and fixed in aceton. The samples were prepared with a commercial peroxidase immunostaining kit (Zymed Laboratories, San Francisco, CA) according to the manufacturer's protocol. Sections were incubated at 4°C overnight with the following primary antibodies: 19A2, a monoclonal mouse IgM antibody against the proliferating cell nuclear antigen (PCNA; BioGenex, San Ramon, CA); CD143, a monoclonal mouse IgG antibody against the angiotensin-converting enzyme (ACE; Chemicon, Temecula, CA); AT1 (306), a polyclonal rabbit IgG antibody against the AT1-receptor (Santa Cruz Biotechnology, Santa Cruz, CA); and 1A4, a murine monoclonal IgG antibody against alpha -smooth muscle actin (DAKO, Via Real, CA).

For light microscopy, all samples were counterstained with hematoxylin. Positive cells for PCNA were counted in at least 30 glomeruli. Immunostaining for ACE and AT1 receptor was assessed with a semiquantitative score as follows: 0, little or no positive staining; 1+, <25% of total glomerular area stained; and 2+, 3+, and 4+: <50, <75, and 75-100% positive staining of glomerular area of at least 30 cortical glomeruli, respectively. Each histological study was performed in a blinded fashion and verified by a second investigator.

Double-staining for ACE and alpha -smooth muscle actin was performed in two steps: first, the sections were incubated with the CD143 antibody and stained with a peroxidase immunostaining kit (BioGenex) using diaminobenzidine peroxidase (containing 0.5% NiCl2) as a substrate. Sections were then incubated with the 1A4 antibody and stained using a alkaline phosphatase kit and fast red as a substrate (DAKO).

Measurements of Gene Expression of Components of the RAS

Isolation of RNA. RNA of shock-frozen renal tissue and glomeruli was isolated by TRIzol (GIBCO), according to the manufacturer's protocol. The concentrations were determined by photometry at A = 260 nm and adjusted to a final concentration of 0.2 µg/µl.

Reverse transcription of RNA was essentially performed as described before (49).

Quantitation by PCR. Measurements of cDNA products were performed using a deletion mutant as described previously (25, 49, 50). Primer sequences used as follows: CTGCAAGGATCTTATGACCTGC (sense) and TACACAGCAAACAGGAATGGGC (antisense) for angiotensinogen; TTGGAGAGGTCACCGAGCT (sense) and CTTGGCTACAGTTCACAACG (antisense) for renin; TGAAGCCAAGGCTAACAGGT (sense) and TCCACACCCAAAGCAATTCT (antisense) for ACE; and ATTTCCTGACAGCAGAAGCC (sense) and GTGTTGTGTCAGGAACAATGG (antisense) for the AT1a receptor. For the rat aldosterone receptor, TGGATGTGTCTATCATCGTT served as the sense and GGTCCTTCGTAGGCATAGA as the antisense primer, and for c-fos mRNA TGGATGTGTCTATCATCGTT was the sense and GGTCCTTCGTAGGCATAGA the antisense primer. All measurements were performed in triplicate.

Renal and Systemic RAS Parameters

EDTA-plasma was taken retroorbitally under light ether anesthesia, and blood levels of angiotensinogen, renin, and ACE were determined as described (18, 39, 40).

Cell Culture Experiments

Rat mesangial cells were obtained and grown essentially as described (38). After morphological and immunohistochemical confirmation of at least 98% of mesangial cells in culture, cells between the third and sixth subculture were used for experiments. Mesangial cells were pretreated with 10-6 M all all-trans-RA or vehicle for 1 h and then stimulated by ANG II in different doses (10-6, 10-7, and 10-9 M) as described before (17). Cells were harvested after stimulation by ANG II for 1 h. Isolation of RNA and quantitative RT-PCR were performed as described above.

Statistical Analysis

All values are expressed as means ± SE unless stated otherwise. Statistical significance (defined as P < 0.05) was evaluated by the nonparametric Mann-Whitney test where appropriate. Multiple testing was performed with ANOVA and Bonferroni's posttest.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Effects of All-Trans-RA on Blood Pressure in Anti-Thy1.1 Nephritis

Figure 1 shows a significant rise in blood pressure of vehicle-treated rats with anti-Thy1.1 nephritis compared with control rats. This increase was completely abrogated by treatment with all-trans-RA or candesartan whereas no effect of these compounds was observed in nonnephritic control rats. Combined treatment with all-trans-RA and candesartan had no additive effect on blood pressure in rats with anti-Thy1.1 nephritis compared with the respective monotherapies.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   All-trans retinoic acid (RA) and candesartan abrogate blood pressure in rat anti-Thy1.1 nephritis. Systemic blood pressure (BP) is markedly elevated in anti-Thy1.1 nephritis but significantly lowered by pretreatment with all-trans-RA as well as by candesartan. No effects were noted in the nonnephritic control groups. Values are means ± SE; n = 9 rats/group (data of study 2 are shown; study 1 showed comparable results). n.s., Not significant.

Effects of Retinoids on the Components of the RAS

Angiotensinogen. Figure 2A indicates that in nonnephritic control rats plasma angiotensinogen levels were not altered after pretreatment with all-trans-RA. There was also no change in the plasma angiotensinogen level in rats with anti-Thy1.1 nephritis. Similarly, liver angiotensinogen mRNA expression was not changed in nonnephritic control rats treated with all-trans-RA or in rats with anti-Thy1.1 nephritis (Fig. 2B). In the kidneys of control rats, renal angiotensinogen gene expression was not affected by all-trans-RA (Fig. 2C). In anti-Thy1.1 nephritic rats, however, angiotensinogen mRNA levels were lower in rats treated with all-trans-RA compared with vehicle-treated nephritic rats (P < 0.01; Fig. 2C).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   All-trans-RA does not alter systemic but does alter renal angiotensinogen mRNA levels in anti-Thy1.1 nephritis. Plasma angiotensinogen (A) and hepatic angiotensinogen gene expression levels (B) are not influenced by anti-Thy1.1 nephritis or all-trans-RA pretreatment. Although basal angiotensinogen mRNA is not altered in rats with anti-Thy1.1 nephritis, angiotensinogen is significantly lowered by pretreatment with all-trans-RA (C). Values are means ± SE; n = 9 rats/group. OD, optical density.

Renin. Plasma renin concentrations were not significantly lower in nonnephritic control rats treated with all-trans-RA compared with the vehicle-treated group in both studies 1 (data not shown) and 2 (see Fig. 3A). Plasma renin concentrations were decreased in vehicle-treated rats with anti-Thy1.1 nephritis compared with nonnephritic controls (P < 0.01). After pretreatment with all-trans-RA, no change in plasma renin concentration was noted in anti-Thy1.1 nephritic rats.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of all-trans-RA on renin in anti-Thy1.1 nephritis. Plasma renin concentration (PRC; A) and cortical renin gene expression in the kidney (B) are markedly depressed in vehicle-treated anti-Thy1.1 nephritic rats. In nonnephritic control rats, they are also lower after pretreatment with all-trans-RA. All-trans-RA pretreatment also reduces cortical mRNA in anti-Thy1.1 nephritic animals. Values are means ± SE; n = 9 rats/group.

Figure 3A also shows the effects of all-trans-RA in rats treated with candesartan. Candesartan treatment increased the plasma renin concentration in nonnephritic controls. The candesartan-induced increase was less in rats that were additionally treated with all-trans-RA. In rats with anti-Thy1.1 nephritis, candesartan treatment increased plasma renin concentration as well. The increase was attenuated when the treatments with candesartan and all-trans-RA were combined.

Renin gene expression in the kidney was lower in nonnephritic control rats treated with all-trans-RA compared with vehicle-treated rats (P < 0.01) and was even less in vehicle-treated rats with anti-Thy1.1 nephritis (P < 0.001 vs. vehicle-treated control rats). After pretreatment with all-trans-RA, renal renin mRNA was reduced in anti-Thy1.1 nephritic animals (P < 0.01; see Fig. 3B).

AT1 receptor. In nonnephritic control rats treated with all-trans-RA, the cortical expression of the AT1a receptor tended to be higher compared with vehicle-treated rats, but this difference was not statistically significant (Fig. 4A). In rats with anti-Thy1.1 nephritis, AT1a-receptor gene expression was significantly higher compared with vehicle-treated nonnephritic control rats but was less after pretreatment with all-trans-RA (P < 0.001; Fig. 4A). In the anti-Thy1.1 nephritic rats treated with all-trans-RA, AT1a-receptor expression was even lower than in vehicle-treated nonnephritic controls rats (P < 0.001; Fig. 4A).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   All-trans-RA abrogates the induction of AT1a-receptor gene expression in anti-Thy1.1 nephritis. Both cortical (A) and glomerular (B) AT1a-receptor gene expression are elevated in anti-Thy1.1 nephritis compared with nonnephritic control rats. This increase is significantly reduced in presence of all-trans-RA. The immunohistological analysis reveals similar findings (C). The increase in retinoid-treated control animals is not significant. Values are means ± SE; n = 9 rats/group.

A similar result was obtained for glomerular AT1a-receptor gene expression: no significant change was observed in nonnephritic control rats treated with all-trans-RA (P < 0.06). Glomerular AT1a-receptor gene expression was increased in vehicle-treated anti-Thy1.1 nephritic rats compared with nonnephritic controls. After pretreatment with all-trans-RA, AT1a-receptor expression was reduced (Fig. 4B). Immunohistochemical staining showed less glomerular AT1-receptor expression in all-trans-RA-treated anti-Thy1.1 nephritic rats (Fig. 4C). Typical examples of immunohistochemical staining are presented in Fig. 5, A-C.


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 5.   Immunostaining of the AT1-receptor. Compared with controls (A), anti-Thy1.1-nephritic rats (B) exhibit more marked glomerular immunostaining of the AT1 receptor. It is markedly reduced after pretreatment with all-trans-RA (C).

ACE. There was no effect of all-trans-RA on serum ACE activity in nonnephritic control rats (Fig. 6A). In vehicle-treated rats with anti-Thy1.1 nephritis, serum ACE activity was higher compared with nonnephritic controls. This increase was completely abrogated by all-trans-RA in anti-Thy1.1 nephritic rats (Fig. 6A). There was no significant effect of all-trans-RA on cortical ACE mRNA in nonnephritic controls. ACE gene expression was not increased in anti-Thy1.1 nephritic rats either but was significantly less after pretreatment of nephritic rats with all-trans-RA (Fig. 6B).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6.   All-trans-RA has complex effects on systemic and renal angiotensin-converting enzyme (ACE) parameters. Serum ACE activity (A), glomerular ACE gene expression (C), and glomerular ACE immunostaining (D) are increased in vehicle-treated anti-Thy1.1 nephritic rats. In nephritic rats, all-trans-RA pretreatment reduces serum ACE activity (A) and cortical ACE mRNA (B), but glomerular gene expression (C) and immunostaining are enhanced (D). Values are means ± SE; n = 9 rats/group.

Glomerular expression of the ACE gene was very low in controls. All-trans-RA had no effect on basal glomerular ACE mRNA. In anti-Thy1.1 nephritic rats, glomerular ACE gene expression was increased compared with controls and was further increased in all-trans-RA-treated nephritic rats (P < 0.01; Fig. 6C). Immunohistochemical staining scores of glomerular ACE changed in parallel (Fig. 6D). Only weak staining was found in nonnephritic control animals, but there was a strong increase in anti-Thy1.1 nephritic rats and a further increase after pretreatment with all-trans-RA (Fig. 7, A-C). Double-staining of ACE and alpha -smooth muscle actin demonstrated that glomerular ACE is mainly localized in cells negative for alpha -smooth muscle actin (Fig. 7D).


View larger version (130K):
[in this window]
[in a new window]
 
Fig. 7.   Immunohistochemistry of renal ACE. Glomerular staining for ACE is only faint in nonnephritic rats (A) but marked in vehicle-treated anti-Thy1.1 nephritic rats (B). Glomerular ACE is markedly increased by all-trans-RA pretreatment in anti-Thy1.1-nephritis (C). D: double-staining for alpha -SM-actin (brown) as a marker for activated mesangial cells and ACE (red) demonstrates that glomerular ACE is mainly localized within differentiated cells.

Aldosterone receptor. Cortical expression of this receptor was increased by anti-Thy1.1 nephritis compared with nonnephritic controls (P < 0.001; Fig. 8A) and was significantly lower in the presence of all-trans-RA in nephritic rats (P < 0.01). No difference was observed in nonnephritic controls. Similar changes as in cortex were observed for aldosterone receptor expression in isolated glomeruli (Fig. 8B). Here, receptor expression was lower in all-trans-RA-pretreated groups compared with vehicle in both nephritic and nonnephritic glomeruli (P < 0.005 and P < 0.02, respectively).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 8.   All-trans-RA lowers aldosterone receptor gene expression in the renal cortex (A) and in isolated glomeruli (B) of nephritic rats. Compared with nonnephritic controls, cortical expression of the aldosterone receptor (A) is not altered by all-trans-RA but is enhanced in vehicle-treated nephritic rats. Pretreatment with all-trans-RA markedly lowers cortical aldosterone receptor expression in anti-Thy1.1 nephritis. Comparable changes are found at a lower signal strength in the glomeruli, where all-trans-RA also reduces glomerular gene expression in nonnephritic controls (B).

Inhibition of ANG II-Induced c-fos Induction by All-Trans-RA

Stimulation of mesangial cells with 10-7 or 10-6 M ANG II showed a significant rise in c-fos mRNA levels (P < 0.001) (Fig. 9). Pretreatment (1 h) with 10-6 M all-trans-RA completely blocked ANG II-induced increase in c-fos (P < 0.001) but had no effect on vehicle-stimulated control cells.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 9.   All-trans-RA inhibitis ANG II-stimulated c-fos induction in mesangial cells. Although pretreatment of mesangial cells with 10-6 M all-trans-RA does not alter c-fos gene expression in unstimulated controls, it significantly blocks the ANG II-dependent increase in c-fos expression. ANG II in a concentration of 10-9 M has no effect on c-fos gene expression compared with controls.

Comparison of the Effects of All-Trans-RA and Candesartan on Glomerular Morphology

The capillary occlusion score was markedly elevated in vehicle-treated anti-Thy1.1 nephritic rats (study 2; see Table 1). Treatment with candesartan alone did not significantly alter the capillary occlusion score in contrast to pretreatment with all-trans-RA (P < 0.001). The score was not reduced further when candesartan and all-trans-RA were combined (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Comparison of the effects of all-trans-RA or candesartan or both compounds on glomerular morphology and cell proliferation

The number of glomerular nuclei as an indicator of glomerular cell count was elevated in anti-Thy1.1 nephritic rats compared with nonnephritic controls (Table 1). Candesartan slightly lowered the glomerular cell count compared with vehicle-treated anti-Thy1.1 nephritic rats (P < 0.05), whereas all-trans-RA reduced glomerular cell numbers markedly (P < 0.001). There was no further reduction in glomerular cell count when both treatments were combined (Table 1).

The number of glomerular mitoses was increased in vehicle-treated anti-Thy1.1 nephritic rats. It was significantly less in rats treated with candesartan. The number of glomerular mitoses was also reduced by pretreatment with all-trans-RA alone, but no further decrease was noted when both treatments were combined (Table 1). Similarly, both candesartan and all-trans-RA reduced the increased numbers of PCNA-positive glomerular cells in anti-Thy1.1 nephritic rats, but an additional effect of combination treatment was not observed.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The results of the present study address the repair phase of anti-Thy1.1 nephritis in the rat and support our working hypothesis that the beneficial effect of the retinoid all-trans-RA is mediated to a large extent via interference with the action of the RAS. The renal, but not the hepatic, expression of both angiotensinogen and renin and the AT1a receptor in the kidney was reduced by all-trans-RA in anti-Thy1.1 nephritic rats. An effect of all-trans-RA on the RAS is further suggested by the reduction of renin mRNA expression even in nonnephritic control rats. These findings were complemented by the observation that AT1-receptor expression on the protein level was also reduced by all-trans-RA as shown by immunohistochemical staining. In contrast, glomerular ACE mRNA expression and immunohistochemical staining increased, but this may well reflect the known increase in ACE during glomerular repair. Taken together, our findings suggest, but do not prove, reduced availability of, and response to, ANG II. In line with this hypothesis, all-trans-RA pretreatment reduced systolic blood pressure to an even greater extent than did the chosen dose of candesartan, further suggesting attenuation of the RAS by all-trans-RA in this renal damage model. The dose of 10 mg/kg body wt all-trans-RA/day was selected according to previous experiments that showed an efficient reduction of renal damage in this model (48) and is in accordance with the work other researchers (10).

The effect of anti-Thy1.1 nephritis and of pretreatment with all-trans-RA on the individual components of the RAS deserves further comment. Surprisingly, plasma renin concentration was decreased in animals in the repair phase of anti-Thy1.1 glomerulonephritis, but this model is presumably associated with extensive damage to the juxtaglomerular apparatus. From studies in several experimental models (8, 41), as well as in human glomerular disease (50), it is known that systemic and intrarenal RAS activities do not necessarily go in parallel. Although we did not perform immunohistochemical staining, it has even been shown that in renal damage models ANG is synthesized in structures other than the juxtaglomerular apparatus. It is of note that even in nonnephritic control rats, all-trans-RA decreased cortical renin mRNA in the kidney. The mechanism by which retinoids affect renin is unclear, but we draw attention to the fact that the renin promotor contains AP-1 binding sites (12, 47). Because retinoids inhibit AP-1 (43, 44, 51), we propose the hypothesis that retinoids reduce renin gene expression by interfering with this pathway.

The idea of a dissociation between the activities of the systemic and renal RAS is further supported by our observation that all-trans-RA selectively reduced angiotensinogen expression in the kidney but not in the liver of anti-Thy1.1 nephritic rats. This effect of retinoids contrasts with that of other members of the steroid-receptor superfamily, such as glucocorticoids and estrogens, which increase plasma angiotensinogen concentration secondarily to increased hepatic synthesis (7, 28). Angiotensinogen expression in the kidney of control rats was not affected.

Anti-Thy1.1 nephritis significantly increased the expression of the AT1-receptor mRNA in the renal cortex and in glomeruli. This was paralleled by increased staining for the AT1-receptor protein. No significant effects were seen in control rats. Pretreatment with all-trans-RA impressively reduced the expression of the AT1 receptor on both the mRNA and the protein level.

Although all of these findings argue that retinoids attenuate RAS activity, both cortical and glomerular ACE mRNA and ACE protein expression were markedly elevated in anti-Thy1.1 nephritic rats compared with controls. Increased expression of ACE has been shown in other models of renal damage (22) and may reflect glomerular remodeling or a response to albuminuria, as suggested by others (26). All-trans-RA significantly increased glomerular ACE mRNA and ACE protein staining in anti-Thy1.1 nephritis. Double-staining for ACE and alpha -smooth muscle actin, a marker of mesangial cell activation, indicates that glomerular ACE expression is mainly confined to nonproliferating mesangial cells. The findings in the cortex may be less reliable due to potential confounding effects resulting from infiltration by nonresident cells and protein loading of tubular cells, which account for the majority of renal ACE expression. An increase in ACE expression might indicate an activation rather than inhibition of RAS components by retinoids. Complementary experiments, however, testing the effect of all-trans-RA treatment on the ability of ANG II to stimulate c-fos in mesangial cells revealed that retinoids completely blocked the ANG II-dependent c-fos stimulation (Fig. 9). These data suggest, but do not finally prove, that the inhibition of ANG II action by retinoids cannot be overrun even at high doses of ANG II.

Although no direct interaction of aldosterone (class I) and retinoid (class II) receptors has been reported, we also examined glomerular and cortical expression of the aldosterone receptor in this model (Fig. 8, A and B). The increase in glomerular and cortical expression of this receptor is presumably the consequence of the activation of the RAS in nephritic rats. In contrast, in the presence of retinoids a lower expression level of both the glomerular and cortical aldosterone receptor was found, further supporting an inhibitory action of retinoids on the RAS. From these experiments, we cannot conclude whether all-trans-RA has an indirect or direct effect on the aldosterone receptor expression.

Because we had suspected that the beneficial effect of all-trans-RA on the evolution of anti-Thy1.1 nephritis is mediated, at least in part, via interference with the RAS, we compared the effect of all-trans-RA with that of the AT1-receptor blocker candesartan. Both agents, i.e., all-trans-RA and candesartan, lowered systolic blood pressure in anti-Thy1.1 nephritis, but there was no further reduction with combination treatment. Predictably, plasma renin concentration increased after candesartan as a result of the interruption of the short-loop feedback mechanism in the juxtaglomerular cells. The combination of candesartan and all-trans-RA reduced the stimulation of plasma renin concentration, further arguing for a direct effect of all-trans-RA on renin activity as discussed above. Several indexes of renal damage, i.e., capillary occlusion score, and of compensatory repair by resident cell proliferation, i.e., nuclei counts, number of mitoses and number of PCNA(+) cells per glomerulus, were improved by all-trans-RA but to a lesser extent or not at all by the chosen dose of candesartan. This dose of candesartan of 1 mg · kg body wt-1 · day-1 had been shown to effectively block the AT1 receptor in previous studies (3, 33, 35, 36). The combination of all-trans-RA and candesartan did not further attenuate renal injury. These findings are in agreement with our hypothesis that most (but presumably not all) effects of all-trans-RA are mediated via the RAS.

In summary, this study provides strong arguments that, in a model of inflammatory renal damage, part of the beneficial effect of all-trans-RA, as a prototypical substance of the retinoid family, is mediated via attenuation of the RAS. The molecular mechanisms involved require further study. Their elucidation is of definite interest, because the beneficial effect of retinoids on inflammatory glomerular injury makes these substances interesting candidates in the treatment of glomerulonephritis.


    ACKNOWLEDGEMENTS

The authors thank Dr. Jürgen Floege, University of Aachen, Germany, for kindly providing the OX-7 antibody.


    FOOTNOTES

Address for reprint requests and other correspondence: J. Wagner, Div. of Nephrology, Dept. of Internal Medicine, Univ. of Heidelberg, Bergheimer Strasse 56a, D-69115 Heidelberg, Germany (E-mail: juergen_wagner{at}med.uni-heidelberg.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 23 August 2000; accepted in final form 20 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Blume, A, Herdegen T, and Unger T. Angiotensin peptides and inducible transcription factors. J Mol Med 77: 339-357, 1999[Web of Science][Medline].

2.   Burg, M, Ostendorf T, Mooney A, Koch KM, and Floege J. Treatment of experimental mesangioproliferative glomerulonephritis with non-anticoagulant heparin: therapeutic efficacy and safety. Lab Invest 76: 505-516, 1997[Web of Science][Medline].

3.   Cervenka, L, and Navar LG. Renal responses of the nonclipped kidney of two-kidney/one-clip Goldblatt hypertensive rats to type 1 angiotensin II receptor blockade with candesartan. J Am Soc Nephrol 10, Suppl11: S197-S201, 1999.

4.   Chambon, P. The retinoid signaling pathway: molecular and genetic analyses. Semin Cell Biol 5: 115-125, 1994[Medline].

5.   Chambon, P. A decade of molecular biology of retinoic acid receptors. FASEB J 10: 940-954, 1996[Abstract].

6.   Chen, JY, Penco S, Ostrowski J, Balaguer P, Pons M, Starrett JE, Reczek P, Chambon P, and Gronemeyer H. RAR-specific agonist/antagonists which dissociate transactivation and AP1 transrepression inhibit anchorage-independent cell proliferation. Embo J 14: 1187-1197, 1995[Web of Science][Medline].

7.   Clauser, E, Gaillard I, Wei L, and Corvol P. Regulation of angiotensinogen gene. Am J Hypertens 2: 403-410, 1989[Web of Science][Medline].

8.   Correa-Rotter, R, Hostetter TH, and Rosenberg ME. Renin and angiotensinogen gene expression in experimental diabetes mellitus. Kidney Int 41: 796-804, 1992[Web of Science][Medline].

9.   Datta, PK, and Lianos EA. Retinoic acids inhibit inducible nitric oxide synthase expression in mesangial cells. Kidney Int 56: 486-493, 1999[Web of Science][Medline].

10.   DeRose, JJ, Madigan J, Umana JP, Prystowsky JH, Nowygrod R, and Todd GJ. Retinoic acid suppresses intimal hyperplasia and prevents vessel remodeling following arterial injury. Cardiovasc Surg 7: 633-639, 1999[Web of Science][Medline].

11.   Dorfman, DM, Wilson DB, Bruns GA, and Orkin SH. Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells. J Biol Chem 267: 1279-1285, 1992[Abstract/Free Full Text].

12.   Germain, S, Bonnet F, Philippe J, Fuchs S, Corvol P, and Pinet F. A novel distal enhancer confers chorionic expression on the human renin gene. J Biol Chem 273: 25292-25300, 1998[Abstract/Free Full Text].

13.   Giguère, V. Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signalling. Endocrine Rev 15: 61-79, 1994[Abstract/Free Full Text].

14.   Glick, AB, McCune BK, Abdulkarem N, Flanders KC, Lumadue A, Smith JM, and Sporn MB. Complex regulation of TGF-beta expression by retinoic acid in the vitamin A-deficient rat. Development 111: 1081-1086, 1991[Abstract/Free Full Text].

15.   Gudas, LJ, Sporn MB, and Roberts AB. Cellular biology and biochemistry of the retinoids. In: The Retinoids: Biology, Chemistry, and Medicine, edited by Sporn MB, Roberts AB, and Goodman DS.. New York: Raven, 1994, p. 443-520.

16.   Harada, H, Miki R, Masushige S, and Kato S. Gene expression of retinoic acid receptors, retinoid-X receptors, and cellular retinol-binding protein I in bone and its regulation by vitamin A. Endocrinology 136: 5329-5335, 1995[Abstract].

17.   Haxsen, V, Adam-Stitah S, Ritz E, and Wagner J. Retinoids inhibit the actions of angiotensin II on vascular smooth muscle cells. Circ Res 88: 637-644, 2001[Abstract/Free Full Text].

18.   Hilbers, U, Peters J, Bornstein R, Correa FMA, Jöhren O, Saavedra JM, and Ehrhart-Bornstein M. Local renin-angiotensin system is involved in K+-induced aldosterone secretion from human adrenocortical NCI-H295 cells. Hypertension 33: 1025-1030, 1999[Abstract/Free Full Text].

19.   Jakowlew, SB, Cubert J, Danielpour D, Sporn MB, and Roberts AB. Differential regulation of the expression of transforming growth factor-beta mRNAs by growth factors and retinoic acid in chicken embryo chondrocytes, myocytes, and fibroblasts. J Cell Physiol 150: 377-385, 1992[Web of Science][Medline].

20.   Johnson, RJ, Lombardi D, Eng E, Gordon K, Alpers CE, Pritzl P, Floege J, Young B, Pippin J, Couser WG, and Gabbiani G. Modulation of experimental mesangial proliferative nephritis by interferon-gamma. Kidney Int 47: 62-69, 1995[Web of Science][Medline].

21.  Kagami S, Border WA, Miller DE, and Noble NA. Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor-beta expression in rat glomerular mesangial cells. J Clin Invest 93: 2431-2437.

22.   Kashiwagi, M, Shinozaki M, Hirakata H, Tamaki K, Hirano T, Tokumoto M, Goto H, Okuda S, and Fujishima M. Locally activated renin-angiotensin system associated with TGF-beta1 as a major factor for renal injury induced by chronic inhibition of nitric oxide synthase in rats. J Am Soc Nephrol 11: 616-624, 2000[Abstract/Free Full Text].

23.   Ketteler, M, Noble NA, and Border WA. Transforming growth factor-beta and angiotensin II: the missing link from glomerular hyperfiltration to glomerulosclerosis? Annu Rev Physiol 57: 279-295, 1995[Web of Science][Medline].

24.   Kranzhofer, R, Schmidt J, Pfeiffer CA, Hagl S, Libby P, and Kubler W. Angiotensin induces inflammatory activation of human vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 19: 1623-1629, 1999[Abstract/Free Full Text].

25.   Krukoff, TL, Gehlen F, Ganten D, and Wagner J. Gene expression of brain nitric oxide synthase and soluble guanylyl cyclase in hypothalamus and medulla of two-kidney, one clip hypertensive rats. Hypertension 26: 171-176, 1995[Abstract/Free Full Text].

26.   Largo, R, Gómez-Garre D, Soto K, Marrón B, Blanco J, Gazapo RM, Plaza JJ, and Egido J. Angiotensin-converting enzyme is upregulated in the proximal tubules of rats with intense proteinuria. Hypertension 33: 732-739, 1999[Abstract/Free Full Text].

27.   Luft, FC, Mervaala E, Muller DN, Gross V, Schmidt F, Park JK, Schmitz C, Lippoldt A, Breu V, Dechend R, Dragun D, Schneider W, Ganten D, and Haller H. Hypertension-induced end-organ damage: a new transgenic approach to an old problem. Hypertension 33: 212-218, 1999[Abstract/Free Full Text].

28.   Menard, J, Bouhnik J, Clauser E, Richoux JP, and Corvol P. Biochemistry and regulation of angiotensinogen. Clin Exp Hypertens A 5: 1005-1019, 1983[Web of Science][Medline].

29.   Mercola, M, Wang CY, Kelly J, Brownlee C, Jackson-Grusby L, Stiles C, and Bowen-Pope D. Selective expression of PDGF A and its receptor during early mouse embryogenesis. Dev Biol 138: 114-122, 1990[Web of Science][Medline].

30.   Miano, JM, Topouzis S, Majesky MW, and Olson EN. Retinoid receptor expression and all trans-retinoic acid-mediated growth inhibition in vascular smooth muscle cells. Circulation 93: 1886-1895, 1996[Abstract/Free Full Text].

31.  Morath C, Dechow C, Lehrke I, Ihling C, Floege J, Ritz E, and Wagner J. Retinoic acid suppresses TGF-beta overexpression in a rat model of glomerular damage. J Am Soc Nephrol. In press.

32.  Morita T, Yamamoto T, and Churg J. Mesangiolysis: an update. Am J Kidney Dis 31: p. 559-573, 1998.

33.   Morsing, P. Candesartan: a new-generation angiotensin II AT1 receptor blocker: pharmacology, antihypertensive efficacy, renal function, and renoprotection. J Am Soc Nephrol 10, Suppl11: S248-S254, 1999.

34.   Muller, DN, Dechend R, Mervaala EM, Park JK, Schmidt F, Fiebeler A, Theuer J, Breu V, Ganten D, Haller H, and Luft FC. NF-kappaB inhibition ameliorates angiotensin II-induced inflammatory damage in rats. Hypertension 35: 193-201, 2000[Abstract/Free Full Text].

35.   Nakamura, T, Obata J, Kimura H, Ohno S, Yoshida Y, Kawachi H, and Shimizu F. Blocking angiotensin II ameliorates proteinuria and glomerular lesions in progressive mesangioproliferative glomerulonephritis. Kidney Int 55: 877-889, 1999[Web of Science][Medline].

36.   Nakamura, T, Obata J, Onizuka M, Kimura H, Ohno S, Yoshida Y, Kawachi H, and Shimizu F. Candesartan prevents the progression of mesangioproliferative nephritis in rats. Kidney Int 63, Suppl: S226-S228, 1997.

37.   O'Donoghue, DJ, Darvill A, and Ballardie FW. Mesangial cell autoantigens in immunoglobulin A nephropathy and Henoch- Schonlein purpura. J Clin Invest 88: 1522-1530, 1991.

38.   Orth, SR, Weinreich T, Bonisch S, Weih M, and Ritz E. Angiotensin II induces hypertrophy and hyperplasia in adult human mesangial cells. Exp Nephrol 3: 23-33, 1995[Web of Science][Medline].

39.   Peters, J, Münter K, Bader M, Hackenthal E, Mullins JJ, and Ganten D. Increased adrenal renin in transgenic hypertensive rats, TGR(mREN2)27, and its regulation by cAMP, angiotensin II, and calcium. J Clin Invest 91: 742-747, 1993.

40.   Peters, J, Obermüller N, Woyth A, Peters B, Maser-Gluth C, Kränzlin B, and Gretz N. Losartan and angiotensin II inhibit aldosterone production in anephric rats via different actions on the intraadrenal renin-angiotensin system. Endocrinology 140: 675-682, 1999[Abstract/Free Full Text].

41.   Rosenberg, ME, Smith LJ, Correa-Rotter R, and Hostetter TH. The paradox of the renin-angiotensin system in chronic renal disease. Kidney Int 45: 403-410, 1994[Web of Science][Medline].

42.   Salbert, G, Fanjul A, Piedrafita FJ, Lu XP, Kim SJ, Tran P, and Pfahl M. Retinoic acid receptors and retinoid X receptor-alpha down-regulate the transforming growth factor-beta 1 promoter by antagonizing AP-1 activity. Mol Endocrinol 7: 1347-1356, 1993[Abstract/Free Full Text].

43.   Schule, R, Rangarajan P, Yang N, Kliewer S, Ransone LJ, Bolado J, Verma IM, and Evans RM. Retinoic acid is a negative regulator of AP-1-responsive genes. Proc Natl Acad Sci USA 88: 6092-6096, 1991[Abstract/Free Full Text].

44.   Simonson, MS. Anti-AP-1 activity of all-trans retinoic acid in glomerular mesangial cells. Am J Physiol Renal Fluid Electrolyte Physiol 267: F805-F815, 1994[Abstract/Free Full Text].

45.   Stahl, RA, Helmchen U, Paravicini M, Ritter LJ, and Schollmeyer P. Glomerular prostaglandin formation in two-kidney, one-clip hypertensive rats. Am J Physiol Renal Fluid Electrolyte Physiol 247: F975-F981, 1984[Abstract/Free Full Text].

46.   Takeda, K, Ichiki T, Funakoshi Y, Ito K, and Takeshita A. Downregulation of angiotensin II type 1 receptor by all-trans retinoic acid in vascular smooth muscle cells. Hypertension 35: 297-302, 2000[Abstract/Free Full Text].

47.   Tamura, K, Umemura S, Nyui N, Yabana M, Toya Y, Fukamizu A, Murakami K, and Ishii M. Possible role of c-Jun in transcription of the mouse renin gene. Kidney Int 54: 382-393, 1998[Web of Science][Medline].

48.   Wagner, J, Dechow C, Morath C, Lehrke I, Amann K, Floege J, and Ritz E. Retinoic acid reduces glomerular injury in a rat model of glomerular damage. J Am Soc Nephrol 11: 1469-1475, 2000[Abstract/Free Full Text].

49.   Wagner, J, Gehlen F, Ciechanowicz A, and Ritz E. Angiotensin II receptor type 1 gene expression in human glomerulonephritis and diabetes mellitus. J Am Soc Nephrol 10: 545-551, 1999[Abstract/Free Full Text].

50.   Wagner, J, Volk S, Haufe CC, Ciechanowicz A, Paul M, and Ritz E. Renin gene expression in human kidney biopsies from patients with glomerulonephritis or graft rejection. J Am Soc Nephrol 5: 1469-1475, 1995[Abstract].

51.   Zhou, XF, Shen XQ, and Shemshedini L. Ligand-activated retinoic acid receptor inhibits AP-1 transactivation by disrupting c-Jun/c-Fos dimerization. Mol Endocrinol 13: 276-285, 1999[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 281(5):F909-F919
0363-6127/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J CARDIOVASC PHARMACOL THERHome page
A. Baraka, M. Mikhail, A. Guemei, and S. El Ghotny
Effect of Targeting Mitogen-Activated Protein Kinase on Cardiac Remodeling in Rats
Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2009; 14(4): 339 - 346.
[Abstract] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Kastner, M. Pohl, M. Sendeski, G. Stange, C. A. Wagner, B. Jensen, A. Patzak, S. Bachmann, and F. Theilig
Effects of receptor-mediated endocytosis and tubular protein composition on volume retention in experimental glomerulonephritis
Am J Physiol Renal Physiol, April 1, 2009; 296(4): F902 - F911.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
A. Zulli, S. Rai, B. F. Buxton, L. M. Burrell, and D. L. Hare
Co-localization of angiotensin-converting enzyme 2-, octomer-4- and CD34-positive cells in rabbit atherosclerotic plaques
Exp Physiol, May 1, 2008; 93(5): 564 - 569.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Choudhary, A. Palm-Leis, R. C. Scott III, R. S. Guleria, E. Rachut, K. M. Baker, and J. Pan
All-trans retinoic acid prevents development of cardiac remodeling in aortic banded rats by inhibiting the renin-angiotensin system
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H633 - H644.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Zhang, H. Meng, Z.-H. Li, Z. Shu, X. Ma, and B.-X. Zhang
Regulation of STIM1, store-operated Ca2+ influx, and nitric oxide generation by retinoic acid in rat mesangial cells
Am J Physiol Renal Physiol, March 1, 2007; 292(3): F1054 - F1064.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J.-C. Zhong, D.-Y. Huang, G.-F. Liu, H.-Y. Jin, Y.-M. Yang, Y.-F. Li, X.-H. Song, and K. Du
Effects of all-trans retinoic acid on orphan receptor APJ signaling in spontaneously hypertensive rats
Cardiovasc Res, February 15, 2005; 65(3): 743 - 750.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J.-C. Zhong, D.-Y. Huang, Y.-M. Yang, Y.-F. Li, G.-F. Liu, X.-H. Song, and K. Du
Upregulation of Angiotensin-Converting Enzyme 2 by All-trans Retinoic Acid in Spontaneously Hypertensive Rats
Hypertension, December 1, 2004; 44(6): 907 - 912.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Ma, T. Matsusaka, H. Yang, H. Kawachi, F. Shimizu, Y. Isaka, E. Imai, V. Kon, and I. Ichikawa
Local Actions of Endogenous Angiotensin II in Injured Glomeruli
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1268 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Liebler, B. Uberschar, H. Kubert, S. Brems, A. Schnitger, M. Tsukada, C. C. Zouboulis, E. Ritz, and J. Wagner
The renal retinoid system: time-dependent activation in experimental glomerulonephritis
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F458 - F465.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dechow, C.
Right arrow Articles by Wagner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dechow, C.
Right arrow Articles by Wagner, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online