|
|
||||||||
Divisions of 1 Nephrology and 2 Pharmacology, University of Heidelberg, D-69115, Germany
| |
ABSTRACT |
|---|
|
|
|---|
We previously demonstrated that all-trans retinoic acid (RA) preserves glomerular structure and function in anti-Thy1.1 nephritis (Wagner J, Dechow C, Morath C, Lehrke I, Amann K, Floege J, and Ritz E. J Am Soc Nephrol 11: 1479-1489, 2000). Because the renin-angiotensin system (RAS) contributes to renal damage, we 1) studied retinoid-specific effects on its components and 2) compared the effects of all-trans-RA with those of the AT1-receptor blocker candesartan. Rats were pretreated for 3 days before injection of the OX-7 antibody and continued with treatment with either vehicle or daily injections of 10 mg/kg all-trans-RA only (study 1) or 10 mg/kg body wt all-trans-RA, 1 mg/kg candesartan, or both (study 2) for an additional 7 days. The blood pressure increase observed in anti-Thy1.1 nephritic rats was equally normalized by all-trans-RA and candesartan (P < 0.05). In nephritic rats, mRNAs of angiotensinogen and angiotensin-converting enzyme (ACE) in the kidney were unchanged, but renin mRNA was lower (P < 0.01). Renal and glomerular AT1-receptor gene and protein expression levels were higher in anti-Thy1.1 nephritic rats (P < 0.05). In the renal cortex of nephritic rats, pretreatment with all-trans-RA significantly reduced mRNAs of all the examined RAS components, but in the glomeruli it increased ACE gene and protein expression (P < 0.01). In nephritic rats, candesartan reduced the number of glomerular cells and mitoses (P < 0.05) less efficiently than all-trans-RA (P < 0.01). Both substances reduced cellular proliferation (proliferating cell nuclear antigen) significantly (P < 0.05). No additive effects were noted when both compounds were combined. In conclusion, all-trans-RA influences the renal RAS in anti-Thy1.1 nephritis by decreasing ANG II synthesis and receptor expression. The beneficial effect of retinoids may be explained, at least in part, by reduction of RAS activity.
anti-Thy1.1 nephritis; mesangioproliferative glomerulonephritis; candesartan; polymerase chain reaction; immunohistochemistry
| |
INTRODUCTION |
|---|
|
|
|---|
WE PREVIOUSLY DEMONSTRATED that retinoids effectively limit renal damage and mesangial cell proliferation in the rat anti-Thy1.1 model of mesangioproliferative glomerulonephritis. This was documented by a lower capillary occlusion score, lower glomerular cell counts, less inflammatory cell immigration, and less extracellular matrix deposition. These effects led to preservation of renal function and reduction of albuminuria (48).
The rat anti-Thy1.1 model is a well-established model of mesangioproliferative glomerulonephritis (32). A singular injection of an antibody directed toward the Thy antigen located on the surface of mesangial cells induces initial mesangiolysis. That period is followed by a phase of overcompensatory proliferation of mesangial cells, which is cleared and restored to normal within a period of 3 wk. Species-specific differences having been taken into account, anti-Thy1.1 nephritis resembles in many aspects human IgA nephritis or Henoch-Schonlein purpura (37). Therefore, in the past this model has been used to test potentially therapeutic approaches (2, 20).
The mechanisms through which the beneficial retinoid effects are
mediated have not been clarified. We documented an effect of retinoids
on the expression of several cytokines and growth factors (11,
14, 29, 42), but this does not exclude the possibility that
additional mechanisms play a role. In this context, the
renin-angiotensin system (RAS) is of particular importance. ANG II is a
key factor in the genesis of renal damage. ANG II promotes
proliferation of mesangial cells, glomerular hypertrophy, and
extracellular matrix expansion (21, 23, 38) and exerts these effects either via direct actions or indirectly via stimulation of growth factors, cytokines such as interleukin (IL)-6
(24), and vasoactive substances. Some effects of ANG II
are mediated via modulation of protooncogenes and transcription factors
such as activator protein-1 (AP-1) and nuclear factor-
B (NF-
B)
(1, 27, 34).
Retinoids are derivates of vitamin A. In contrast to ANG II, they have
antiproliferative and anti-inflammatory effects (9, 17,
30). These compounds exert their actions via different receptor
subtypes, i.e., retinoid A receptors, which interact with the
retinoid-prototype all-trans retinoic acid (RA), and retinoid X receptors, which interact with 9-cis-RA (4,
5, 13, 15). Retinoid receptors are expressed in the kidney,
where they alter the expression of target genes via modulation of gene transcription (5, 16, 42, 43). Retinoids reduce the
expression of platelet-derived growth factor, inducible NO synthase,
IL-6, and endothelin (9, 11, 29) and thus oppose the
action of ANG II. Their effects on expression and function of
transforming growth factor-
1 (TGF-
1) as well as on extracellular
matrix proteins are cell and context specific (14, 19). In
anti-Thy1.1 glomerulonephritis, renal TGF-
1 expression was reduced
by retinoids (31). Retinoids counteract AP-1 activity and
NF-
B, which are involved in ANG II action (6, 9, 30, 42, 43,
51). Haxsen et al. (17) demonstrated that retinoids
inhibit ANG II-induced proliferation in vascular smooth muscle cells
and downregulate AT1-receptor expression, possibly via
effects on AP-1 (17, 46).
The present study was designed to examine the possibility that retinoids act, at least in part, by interfering with the expression and action of ANG II in the anti-Thy1.1 nephritis model. To this end, we 1) investigated the effects of all-trans-RA on the expression of the components of the RAS in the kidneys and plasma of rats with anti-Thy1.1 glomerulonephritis and 2) compared the effect of retinoids on glomerular cell counts and glomerular cell proliferation with that of the AT1-receptor blocker candesartan.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Experimental Protocol
Anti-Thy1.1 nephritis was induced by a single intravenous injection of 1 mg/kg body wt OX-7 (courtesy of Dr. J. Floege, Univ. of Aachen), a monoclonal antibody against the Thy1.1-like antigen on the surface of rat mesangial cells. Male Wistar rats, weighing 180-200 g, were used in two experiments (n = 9/group).Study 1.
Anti-Thy1.1 nephritic rats were injected daily with either 10 mg/kg
body wt all-trans-RA or vehicle (oleum arachis, 5% DMSO) and compared with similarly treated control animals. Rats were pretreated with all-trans-RA for 3 days before application
of the antibody. Thus treatment lasted from day
3 to
day +7. In a separate
experiment, we had excluded that pretreatment interferes with the
binding of the OX-7 antibody and the subsequent acute injury
(48). Anti-Thy1.1 nephritis was induced on day
0, and the experiment was terminated 8 days after antibody
injection by injection of xylazine (5 mg/kg body wt im, WDT, Garbsen,
Germany) and ketamine (100 mg/kg body wt im, BayerVital, Leverkusen,
Germany). Rats were perfused with saline containing 1 mg/l procaine
hydrochloride by retrograde insertion of a cannula into the abdominal
aorta. Blood was drained through an incision of the inferior vena cava. The perfusion pressure was adapted to the individual systemic blood
pressure measured before termination of the experiment. Glomeruli were
isolated by a fractional sieving technique as described earlier
(45). The yield and the purity of isolated glomeruli at
each time point were comparable (purity >95%).
Study 2.
To compare the effects of retinoids to those of an
AT1-receptor blocker, rats were treated with
all-trans-RA or vehicle similarly to study 1 and
additionally received 1 mg/kg body wt candesartan cilexitil (Takeda
Pharma, Aachen, Germany) or vehicle administered in the drinking water
from day 0 to day +7. Blood
pressure was determined on days
3 and
+7 by tail-cuff plethysmography under light ether anesthesia.
Renal Morphology
Tissue for standard light microscopy was fixed in 10% buffered formalin and embedded in paraffin. Sections (4 µm) were stained with periodic acid-Schiff reagent and counterstained with hematoxylin. Total glomerular cell count was determined in at least 30 cortical glomeruli/kidney with a diameter of at least 100 µm. Visible glomerular mitoses (anaphases, metaphases) were counted in 100 glomeruli/kidney section. The extent of capillary occlusion was determined by a semiquantitative score system as follows: 0, little or no occlusion; 1+, <25% of total capillary tuft area occluded; and 2+, 3+, and 4+: <50, <75, and 75-100% occluded capillary tuft area of at least 30 cortical glomeruli, respectively.Immunohistochemical Analyses of Proliferating Cell Nuclear Antigen and RAS Parameters
Cryostat sections of freshly frozen renal tissue were air-dried and fixed in aceton. The samples were prepared with a commercial peroxidase immunostaining kit (Zymed Laboratories, San Francisco, CA) according to the manufacturer's protocol. Sections were incubated at 4°C overnight with the following primary antibodies: 19A2, a monoclonal mouse IgM antibody against the proliferating cell nuclear antigen (PCNA; BioGenex, San Ramon, CA); CD143, a monoclonal mouse IgG antibody against the angiotensin-converting enzyme (ACE; Chemicon, Temecula, CA); AT1 (306), a polyclonal rabbit IgG antibody against the AT1-receptor (Santa Cruz Biotechnology, Santa Cruz, CA); and 1A4, a murine monoclonal IgG antibody against
-smooth muscle actin (DAKO, Via Real, CA).
For light microscopy, all samples were counterstained with hematoxylin. Positive cells for PCNA were counted in at least 30 glomeruli. Immunostaining for ACE and AT1 receptor was assessed with a semiquantitative score as follows: 0, little or no positive staining; 1+, <25% of total glomerular area stained; and 2+, 3+, and 4+: <50, <75, and 75-100% positive staining of glomerular area of at least 30 cortical glomeruli, respectively. Each histological study was performed in a blinded fashion and verified by a second investigator.
Double-staining for ACE and
-smooth muscle actin was performed in
two steps: first, the sections were incubated with the CD143 antibody
and stained with a peroxidase immunostaining kit (BioGenex) using
diaminobenzidine peroxidase (containing 0.5% NiCl2) as a
substrate. Sections were then incubated with the 1A4 antibody and
stained using a alkaline phosphatase kit and fast red as a substrate (DAKO).
Measurements of Gene Expression of Components of the RAS
Isolation of RNA. RNA of shock-frozen renal tissue and glomeruli was isolated by TRIzol (GIBCO), according to the manufacturer's protocol. The concentrations were determined by photometry at A = 260 nm and adjusted to a final concentration of 0.2 µg/µl.
Reverse transcription of RNA was essentially performed as described before (49).Quantitation by PCR. Measurements of cDNA products were performed using a deletion mutant as described previously (25, 49, 50). Primer sequences used as follows: CTGCAAGGATCTTATGACCTGC (sense) and TACACAGCAAACAGGAATGGGC (antisense) for angiotensinogen; TTGGAGAGGTCACCGAGCT (sense) and CTTGGCTACAGTTCACAACG (antisense) for renin; TGAAGCCAAGGCTAACAGGT (sense) and TCCACACCCAAAGCAATTCT (antisense) for ACE; and ATTTCCTGACAGCAGAAGCC (sense) and GTGTTGTGTCAGGAACAATGG (antisense) for the AT1a receptor. For the rat aldosterone receptor, TGGATGTGTCTATCATCGTT served as the sense and GGTCCTTCGTAGGCATAGA as the antisense primer, and for c-fos mRNA TGGATGTGTCTATCATCGTT was the sense and GGTCCTTCGTAGGCATAGA the antisense primer. All measurements were performed in triplicate.
Renal and Systemic RAS Parameters
EDTA-plasma was taken retroorbitally under light ether anesthesia, and blood levels of angiotensinogen, renin, and ACE were determined as described (18, 39, 40).Cell Culture Experiments
Rat mesangial cells were obtained and grown essentially as described (38). After morphological and immunohistochemical confirmation of at least 98% of mesangial cells in culture, cells between the third and sixth subculture were used for experiments. Mesangial cells were pretreated with 10
6 M
all all-trans-RA or vehicle for 1 h and then stimulated
by ANG II in different doses (10
6, 10
7, and
10
9 M) as described before (17). Cells were
harvested after stimulation by ANG II for 1 h. Isolation of RNA
and quantitative RT-PCR were performed as described above.
Statistical Analysis
All values are expressed as means ± SE unless stated otherwise. Statistical significance (defined as P < 0.05) was evaluated by the nonparametric Mann-Whitney test where appropriate. Multiple testing was performed with ANOVA and Bonferroni's posttest.| |
RESULTS |
|---|
|
|
|---|
Effects of All-Trans-RA on Blood Pressure in Anti-Thy1.1 Nephritis
Figure 1 shows a significant rise in blood pressure of vehicle-treated rats with anti-Thy1.1 nephritis compared with control rats. This increase was completely abrogated by treatment with all-trans-RA or candesartan whereas no effect of these compounds was observed in nonnephritic control rats. Combined treatment with all-trans-RA and candesartan had no additive effect on blood pressure in rats with anti-Thy1.1 nephritis compared with the respective monotherapies.
|
Effects of Retinoids on the Components of the RAS
Angiotensinogen.
Figure 2A indicates that in
nonnephritic control rats plasma angiotensinogen levels were not
altered after pretreatment with all-trans-RA. There
was also no change in the plasma angiotensinogen level in rats with
anti-Thy1.1 nephritis. Similarly, liver angiotensinogen mRNA expression
was not changed in nonnephritic control rats treated with
all-trans-RA or in rats with anti-Thy1.1 nephritis (Fig. 2B). In the kidneys of control rats, renal angiotensinogen
gene expression was not affected by all-trans-RA (Fig.
2C). In anti-Thy1.1 nephritic rats, however, angiotensinogen
mRNA levels were lower in rats treated with all-trans-RA
compared with vehicle-treated nephritic rats (P < 0.01; Fig. 2C).
|
Renin.
Plasma renin concentrations were not significantly lower in
nonnephritic control rats treated with all-trans-RA compared
with the vehicle-treated group in both studies 1 (data not
shown) and 2 (see Fig.
3A). Plasma renin
concentrations were decreased in vehicle-treated rats with anti-Thy1.1
nephritis compared with nonnephritic controls (P < 0.01). After pretreatment with all-trans-RA, no change in
plasma renin concentration was noted in anti-Thy1.1 nephritic rats.
|
AT1 receptor.
In nonnephritic control rats treated with all-trans-RA, the
cortical expression of the AT1a receptor tended to be
higher compared with vehicle-treated rats, but this difference was not
statistically significant (Fig.
4A). In rats with anti-Thy1.1
nephritis, AT1a-receptor gene expression was significantly
higher compared with vehicle-treated nonnephritic control rats but was
less after pretreatment with all-trans-RA (P < 0.001; Fig. 4A). In the anti-Thy1.1 nephritic rats
treated with all-trans-RA, AT1a-receptor
expression was even lower than in vehicle-treated nonnephritic controls
rats (P < 0.001; Fig. 4A).
|
|
ACE.
There was no effect of all-trans-RA on serum ACE activity in
nonnephritic control rats (Fig.
6A). In vehicle-treated rats with anti-Thy1.1 nephritis, serum ACE activity was higher compared with
nonnephritic controls. This increase was completely abrogated by
all-trans-RA in anti-Thy1.1 nephritic rats (Fig.
6A). There was no significant effect of
all-trans-RA on cortical ACE mRNA in nonnephritic controls.
ACE gene expression was not increased in anti-Thy1.1 nephritic rats
either but was significantly less after pretreatment of nephritic rats
with all-trans-RA (Fig. 6B).
|
-smooth muscle actin demonstrated that
glomerular ACE is mainly localized in cells negative for
-smooth
muscle actin (Fig. 7D).
|
Aldosterone receptor.
Cortical expression of this receptor was increased by anti-Thy1.1
nephritis compared with nonnephritic controls (P < 0.001; Fig. 8A) and was
significantly lower in the presence of all-trans-RA in
nephritic rats (P < 0.01). No difference was observed
in nonnephritic controls. Similar changes as in cortex were observed
for aldosterone receptor expression in isolated glomeruli (Fig.
8B). Here, receptor expression was lower in
all-trans-RA-pretreated groups compared with vehicle in both
nephritic and nonnephritic glomeruli (P < 0.005 and
P < 0.02, respectively).
|
Inhibition of ANG II-Induced c-fos Induction by All-Trans-RA
Stimulation of mesangial cells with 10
7 or
10
6 M ANG II showed a significant rise in c-fos mRNA
levels (P < 0.001) (Fig.
9). Pretreatment (1 h) with
10
6 M all-trans-RA completely blocked ANG
II-induced increase in c-fos (P < 0.001) but had no
effect on vehicle-stimulated control cells.
|
Comparison of the Effects of All-Trans-RA and Candesartan on Glomerular Morphology
The capillary occlusion score was markedly elevated in vehicle-treated anti-Thy1.1 nephritic rats (study 2; see Table 1). Treatment with candesartan alone did not significantly alter the capillary occlusion score in contrast to pretreatment with all-trans-RA (P < 0.001). The score was not reduced further when candesartan and all-trans-RA were combined (Table 1).
|
The number of glomerular nuclei as an indicator of glomerular cell count was elevated in anti-Thy1.1 nephritic rats compared with nonnephritic controls (Table 1). Candesartan slightly lowered the glomerular cell count compared with vehicle-treated anti-Thy1.1 nephritic rats (P < 0.05), whereas all-trans-RA reduced glomerular cell numbers markedly (P < 0.001). There was no further reduction in glomerular cell count when both treatments were combined (Table 1).
The number of glomerular mitoses was increased in vehicle-treated anti-Thy1.1 nephritic rats. It was significantly less in rats treated with candesartan. The number of glomerular mitoses was also reduced by pretreatment with all-trans-RA alone, but no further decrease was noted when both treatments were combined (Table 1). Similarly, both candesartan and all-trans-RA reduced the increased numbers of PCNA-positive glomerular cells in anti-Thy1.1 nephritic rats, but an additional effect of combination treatment was not observed.
| |
DISCUSSION |
|---|
|
|
|---|
The results of the present study address the repair phase of anti-Thy1.1 nephritis in the rat and support our working hypothesis that the beneficial effect of the retinoid all-trans-RA is mediated to a large extent via interference with the action of the RAS. The renal, but not the hepatic, expression of both angiotensinogen and renin and the AT1a receptor in the kidney was reduced by all-trans-RA in anti-Thy1.1 nephritic rats. An effect of all-trans-RA on the RAS is further suggested by the reduction of renin mRNA expression even in nonnephritic control rats. These findings were complemented by the observation that AT1-receptor expression on the protein level was also reduced by all-trans-RA as shown by immunohistochemical staining. In contrast, glomerular ACE mRNA expression and immunohistochemical staining increased, but this may well reflect the known increase in ACE during glomerular repair. Taken together, our findings suggest, but do not prove, reduced availability of, and response to, ANG II. In line with this hypothesis, all-trans-RA pretreatment reduced systolic blood pressure to an even greater extent than did the chosen dose of candesartan, further suggesting attenuation of the RAS by all-trans-RA in this renal damage model. The dose of 10 mg/kg body wt all-trans-RA/day was selected according to previous experiments that showed an efficient reduction of renal damage in this model (48) and is in accordance with the work other researchers (10).
The effect of anti-Thy1.1 nephritis and of pretreatment with all-trans-RA on the individual components of the RAS deserves further comment. Surprisingly, plasma renin concentration was decreased in animals in the repair phase of anti-Thy1.1 glomerulonephritis, but this model is presumably associated with extensive damage to the juxtaglomerular apparatus. From studies in several experimental models (8, 41), as well as in human glomerular disease (50), it is known that systemic and intrarenal RAS activities do not necessarily go in parallel. Although we did not perform immunohistochemical staining, it has even been shown that in renal damage models ANG is synthesized in structures other than the juxtaglomerular apparatus. It is of note that even in nonnephritic control rats, all-trans-RA decreased cortical renin mRNA in the kidney. The mechanism by which retinoids affect renin is unclear, but we draw attention to the fact that the renin promotor contains AP-1 binding sites (12, 47). Because retinoids inhibit AP-1 (43, 44, 51), we propose the hypothesis that retinoids reduce renin gene expression by interfering with this pathway.
The idea of a dissociation between the activities of the systemic and renal RAS is further supported by our observation that all-trans-RA selectively reduced angiotensinogen expression in the kidney but not in the liver of anti-Thy1.1 nephritic rats. This effect of retinoids contrasts with that of other members of the steroid-receptor superfamily, such as glucocorticoids and estrogens, which increase plasma angiotensinogen concentration secondarily to increased hepatic synthesis (7, 28). Angiotensinogen expression in the kidney of control rats was not affected.
Anti-Thy1.1 nephritis significantly increased the expression of the AT1-receptor mRNA in the renal cortex and in glomeruli. This was paralleled by increased staining for the AT1-receptor protein. No significant effects were seen in control rats. Pretreatment with all-trans-RA impressively reduced the expression of the AT1 receptor on both the mRNA and the protein level.
Although all of these findings argue that retinoids attenuate RAS
activity, both cortical and glomerular ACE mRNA and ACE protein
expression were markedly elevated in anti-Thy1.1 nephritic rats
compared with controls. Increased expression of ACE has been shown in
other models of renal damage (22) and may reflect
glomerular remodeling or a response to albuminuria, as suggested by
others (26). All-trans-RA significantly
increased glomerular ACE mRNA and ACE protein staining in anti-Thy1.1
nephritis. Double-staining for ACE and
-smooth muscle actin, a
marker of mesangial cell activation, indicates that glomerular ACE
expression is mainly confined to nonproliferating mesangial cells. The
findings in the cortex may be less reliable due to potential
confounding effects resulting from infiltration by nonresident cells
and protein loading of tubular cells, which account for the majority of
renal ACE expression. An increase in ACE expression might indicate an
activation rather than inhibition of RAS components by retinoids.
Complementary experiments, however, testing the effect of
all-trans-RA treatment on the ability of ANG II to stimulate
c-fos in mesangial cells revealed that retinoids completely blocked the
ANG II-dependent c-fos stimulation (Fig. 9). These data suggest, but do
not finally prove, that the inhibition of ANG II action by retinoids
cannot be overrun even at high doses of ANG II.
Although no direct interaction of aldosterone (class I) and retinoid (class II) receptors has been reported, we also examined glomerular and cortical expression of the aldosterone receptor in this model (Fig. 8, A and B). The increase in glomerular and cortical expression of this receptor is presumably the consequence of the activation of the RAS in nephritic rats. In contrast, in the presence of retinoids a lower expression level of both the glomerular and cortical aldosterone receptor was found, further supporting an inhibitory action of retinoids on the RAS. From these experiments, we cannot conclude whether all-trans-RA has an indirect or direct effect on the aldosterone receptor expression.
Because we had suspected that the beneficial effect of
all-trans-RA on the evolution of anti-Thy1.1 nephritis is
mediated, at least in part, via interference with the RAS, we compared
the effect of all-trans-RA with that of the
AT1-receptor blocker candesartan. Both agents, i.e.,
all-trans-RA and candesartan, lowered systolic blood
pressure in anti-Thy1.1 nephritis, but there was no further reduction
with combination treatment. Predictably, plasma renin concentration
increased after candesartan as a result of the interruption of the
short-loop feedback mechanism in the juxtaglomerular cells. The
combination of candesartan and all-trans-RA reduced the
stimulation of plasma renin concentration, further arguing for a direct
effect of all-trans-RA on renin activity as discussed above.
Several indexes of renal damage, i.e., capillary occlusion score, and of compensatory repair by resident cell proliferation, i.e., nuclei counts, number of mitoses and number of PCNA(+) cells per glomerulus, were improved by all-trans-RA but to a lesser extent or not
at all by the chosen dose of candesartan. This dose of candesartan of 1 mg · kg body wt
1 · day
1 had
been shown to effectively block the AT1 receptor in
previous studies (3, 33, 35, 36). The combination of
all-trans-RA and candesartan did not further attenuate renal
injury. These findings are in agreement with our hypothesis that most
(but presumably not all) effects of all-trans-RA are
mediated via the RAS.
In summary, this study provides strong arguments that, in a model of inflammatory renal damage, part of the beneficial effect of all-trans-RA, as a prototypical substance of the retinoid family, is mediated via attenuation of the RAS. The molecular mechanisms involved require further study. Their elucidation is of definite interest, because the beneficial effect of retinoids on inflammatory glomerular injury makes these substances interesting candidates in the treatment of glomerulonephritis.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Dr. Jürgen Floege, University of Aachen, Germany, for kindly providing the OX-7 antibody.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: J. Wagner, Div. of Nephrology, Dept. of Internal Medicine, Univ. of Heidelberg, Bergheimer Strasse 56a, D-69115 Heidelberg, Germany (E-mail: juergen_wagner{at}med.uni-heidelberg.de).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 23 August 2000; accepted in final form 20 June 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Blume, A,
Herdegen T,
and
Unger T.
Angiotensin peptides and inducible transcription factors.
J Mol Med
77:
339-357,
1999[ISI][Medline].
2.
Burg, M,
Ostendorf T,
Mooney A,
Koch KM,
and
Floege J.
Treatment of experimental mesangioproliferative glomerulonephritis with non-anticoagulant heparin: therapeutic efficacy and safety.
Lab Invest
76:
505-516,
1997[ISI][Medline].
3.
Cervenka, L,
and
Navar LG.
Renal responses of the nonclipped kidney of two-kidney/one-clip Goldblatt hypertensive rats to type 1 angiotensin II receptor blockade with candesartan.
J Am Soc Nephrol
10, Suppl11:
S197-S201,
1999.
4.
Chambon, P.
The retinoid signaling pathway: molecular and genetic analyses.
Semin Cell Biol
5:
115-125,
1994[Medline].
5.
Chambon, P.
A decade of molecular biology of retinoic acid receptors.
FASEB J
10:
940-954,
1996[Abstract].
6.
Chen, JY,
Penco S,
Ostrowski J,
Balaguer P,
Pons M,
Starrett JE,
Reczek P,
Chambon P,
and
Gronemeyer H.
RAR-specific agonist/antagonists which dissociate transactivation and AP1 transrepression inhibit anchorage-independent cell proliferation.
Embo J
14:
1187-1197,
1995[ISI][Medline].
7.
Clauser, E,
Gaillard I,
Wei L,
and
Corvol P.
Regulation of angiotensinogen gene.
Am J Hypertens
2:
403-410,
1989[ISI][Medline].
8.
Correa-Rotter, R,
Hostetter TH,
and
Rosenberg ME.
Renin and angiotensinogen gene expression in experimental diabetes mellitus.
Kidney Int
41:
796-804,
1992[ISI][Medline].
9.
Datta, PK,
and
Lianos EA.
Retinoic acids inhibit inducible nitric oxide synthase expression in mesangial cells.
Kidney Int
56:
486-493,
1999[ISI][Medline].
10.
DeRose, JJ,
Madigan J,
Umana JP,
Prystowsky JH,
Nowygrod R,
and
Todd GJ.
Retinoic acid suppresses intimal hyperplasia and prevents vessel remodeling following arterial injury.
Cardiovasc Surg
7:
633-639,
1999[ISI][Medline].
11.
Dorfman, DM,
Wilson DB,
Bruns GA,
and
Orkin SH.
Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells.
J Biol Chem
267:
1279-1285,
1992
12.
Germain, S,
Bonnet F,
Philippe J,
Fuchs S,
Corvol P,
and
Pinet F.
A novel distal enhancer confers chorionic expression on the human renin gene.
J Biol Chem
273:
25292-25300,
1998
13.
Giguère, V.
Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signalling.
Endocrine Rev
15:
61-79,
1994[ISI][Medline].
14.
Glick, AB,
McCune BK,
Abdulkarem N,
Flanders KC,
Lumadue A,
Smith JM,
and
Sporn MB.
Complex regulation of TGF-
expression by retinoic acid in the vitamin A-deficient rat.
Development
111:
1081-1086,
1991
15.
Gudas, LJ,
Sporn MB,
and
Roberts AB.
Cellular biology and biochemistry of the retinoids.
In: The Retinoids: Biology, Chemistry, and Medicine, edited by Sporn MB,
Roberts AB,
and Goodman DS.. New York: Raven, 1994, p. 443-520.
16.
Harada, H,
Miki R,
Masushige S,
and
Kato S.
Gene expression of retinoic acid receptors, retinoid-X receptors, and cellular retinol-binding protein I in bone and its regulation by vitamin A.
Endocrinology
136:
5329-5335,
1995[Abstract].
17.
Haxsen, V,
Adam-Stitah S,
Ritz E,
and
Wagner J.
Retinoids inhibit the actions of angiotensin II on vascular smooth muscle cells.
Circ Res
88:
637-644,
2001
18.
Hilbers, U,
Peters J,
Bornstein R,
Correa FMA,
Jöhren O,
Saavedra JM,
and
Ehrhart-Bornstein M.
Local renin-angiotensin system is involved in K+-induced aldosterone secretion from human adrenocortical NCI-H295 cells.
Hypertension
33:
1025-1030,
1999
19.
Jakowlew, SB,
Cubert J,
Danielpour D,
Sporn MB,
and
Roberts AB.
Differential regulation of the expression of transforming growth factor-beta mRNAs by growth factors and retinoic acid in chicken embryo chondrocytes, myocytes, and fibroblasts.
J Cell Physiol
150:
377-385,
1992[ISI][Medline].
20.
Johnson, RJ,
Lombardi D,
Eng E,
Gordon K,
Alpers CE,
Pritzl P,
Floege J,
Young B,
Pippin J,
Couser WG,
and
Gabbiani G.
Modulation of experimental mesangial proliferative nephritis by interferon-gamma.
Kidney Int
47:
62-69,
1995[ISI][Medline].
21.
Kagami S, Border WA, Miller DE, and Noble NA. Angiotensin II
stimulates extracellular matrix protein synthesis through induction of
transforming growth factor-beta expression in rat glomerular mesangial
cells. J Clin Invest 93: 2431-2437.
22.
Kashiwagi, M,
Shinozaki M,
Hirakata H,
Tamaki K,
Hirano T,
Tokumoto M,
Goto H,
Okuda S,
and
Fujishima M.
Locally activated renin-angiotensin system associated with TGF-beta1 as a major factor for renal injury induced by chronic inhibition of nitric oxide synthase in rats.
J Am Soc Nephrol
11:
616-624,
2000
23.
Ketteler, M,
Noble NA,
and
Border WA.
Transforming growth factor-beta and angiotensin II: the missing link from glomerular hyperfiltration to glomerulosclerosis?
Annu Rev Physiol
57:
279-295,
1995[ISI][Medline].
24.
Kranzhofer, R,
Schmidt J,
Pfeiffer CA,
Hagl S,
Libby P,
and
Kubler W.
Angiotensin induces inflammatory activation of human vascular smooth muscle cells.
Arterioscler Thromb Vasc Biol
19:
1623-1629,
1999
25.
Krukoff, TL,
Gehlen F,
Ganten D,
and
Wagner J.
Gene expression of brain nitric oxide synthase and soluble guanylyl cyclase in hypothalamus and medulla of two-kidney, one clip hypertensive rats.
Hypertension
26:
171-176,
1995
26.
Largo, R,
Gómez-Garre D,
Soto K,
Marrón B,
Blanco J,
Gazapo RM,
Plaza JJ,
and
Egido J.
Angiotensin-converting enzyme is upregulated in the proximal tubules of rats with intense proteinuria.
Hypertension
33:
732-739,
1999
27.
Luft, FC,
Mervaala E,
Muller DN,
Gross V,
Schmidt F,
Park JK,
Schmitz C,
Lippoldt A,
Breu V,
Dechend R,
Dragun D,
Schneider W,
Ganten D,
and
Haller H.
Hypertension-induced end-organ damage: a new transgenic approach to an old problem.
Hypertension
33:
212-218,
1999
28.
Menard, J,
Bouhnik J,
Clauser E,
Richoux JP,
and
Corvol P.
Biochemistry and regulation of angiotensinogen.
Clin Exp Hypertens A
5:
1005-1019,
1983[ISI][Medline].
29.
Mercola, M,
Wang CY,
Kelly J,
Brownlee C,
Jackson-Grusby L,
Stiles C,
and
Bowen-Pope D.
Selective expression of PDGF A and its receptor during early mouse embryogenesis.
Dev Biol
138:
114-122,
1990[ISI][Medline].
30.
Miano, JM,
Topouzis S,
Majesky MW,
and
Olson EN.
Retinoid receptor expression and all trans-retinoic acid-mediated growth inhibition in vascular smooth muscle cells.
Circulation
93:
1886-1895,
1996
31.
Morath C, Dechow C, Lehrke I, Ihling C, Floege J, Ritz E, and Wagner
J. Retinoic acid suppresses TGF-
overexpression in a rat
model of glomerular damage. J Am Soc Nephrol. In press.
32.
Morita T, Yamamoto T, and Churg J. Mesangiolysis: an update.
Am J Kidney Dis 31: p. 559-573, 1998.
33.
Morsing, P.
Candesartan: a new-generation angiotensin II AT1 receptor blocker: pharmacology, antihypertensive efficacy, renal function, and renoprotection.
J Am Soc Nephrol
10, Suppl11:
S248-S254,
1999.
34.
Muller, DN,
Dechend R,
Mervaala EM,
Park JK,
Schmidt F,
Fiebeler A,
Theuer J,
Breu V,
Ganten D,
Haller H,
and
Luft FC.
NF-kappaB inhibition ameliorates angiotensin II-induced inflammatory damage in rats.
Hypertension
35:
193-201,
2000
35.
Nakamura, T,
Obata J,
Kimura H,
Ohno S,
Yoshida Y,
Kawachi H,
and
Shimizu F.
Blocking angiotensin II ameliorates proteinuria and glomerular lesions in progressive mesangioproliferative glomerulonephritis.
Kidney Int
55:
877-889,
1999[ISI][Medline].
36.
Nakamura, T,
Obata J,
Onizuka M,
Kimura H,
Ohno S,
Yoshida Y,
Kawachi H,
and
Shimizu F.
Candesartan prevents the progression of mesangioproliferative nephritis in rats.
Kidney Int
63, Suppl:
S226-S228,
1997.
37.
O'Donoghue, DJ,
Darvill A,
and
Ballardie FW.
Mesangial cell autoantigens in immunoglobulin A nephropathy and Henoch- Schonlein purpura.
J Clin Invest
88:
1522-1530,
1991.
38.
Orth, SR,
Weinreich T,
Bonisch S,
Weih M,
and
Ritz E.
Angiotensin II induces hypertrophy and hyperplasia in adult human mesangial cells.
Exp Nephrol
3:
23-33,
1995[ISI][Medline].
39.
Peters, J,
Münter K,
Bader M,
Hackenthal E,
Mullins JJ,
and
Ganten D.
Increased adrenal renin in transgenic hypertensive rats, TGR(mREN2)27, and its regulation by cAMP, angiotensin II, and calcium.
J Clin Invest
91:
742-747,
1993.
40.
Peters, J,
Obermüller N,
Woyth A,
Peters B,
Maser-Gluth C,
Kränzlin B,
and
Gretz N.
Losartan and angiotensin II inhibit aldosterone production in anephric rats via different actions on the intraadrenal renin-angiotensin system.
Endocrinology
140:
675-682,
1999
41.
Rosenberg, ME,
Smith LJ,
Correa-Rotter R,
and
Hostetter TH.
The paradox of the renin-angiotensin system in chronic renal disease.
Kidney Int
45:
403-410,
1994[ISI][Medline].
42.
Salbert, G,
Fanjul A,
Piedrafita FJ,
Lu XP,
Kim SJ,
Tran P,
and
Pfahl M.
Retinoic acid receptors and retinoid X receptor-alpha down-regulate the transforming growth factor-beta 1 promoter by antagonizing AP-1 activity.
Mol Endocrinol
7:
1347-1356,
1993[Abstract].
43.
Schule, R,
Rangarajan P,
Yang N,
Kliewer S,
Ransone LJ,
Bolado J,
Verma IM,
and
Evans RM.
Retinoic acid is a negative regulator of AP-1-responsive genes.
Proc Natl Acad Sci USA
88:
6092-6096,
1991
44.
Simonson, MS.
Anti-AP-1 activity of all-trans retinoic acid in glomerular mesangial cells.
Am J Physiol Renal Fluid Electrolyte Physiol
267:
F805-F815,
1994
45.
Stahl, RA,
Helmchen U,
Paravicini M,
Ritter LJ,
and
Schollmeyer P.
Glomerular prostaglandin formation in two-kidney, one-clip hypertensive rats.
Am J Physiol Renal Fluid Electrolyte Physiol
247:
F975-F981,
1984
46.
Takeda, K,
Ichiki T,
Funakoshi Y,
Ito K,
and
Takeshita A.
Downregulation of angiotensin II type 1 receptor by all-trans retinoic acid in vascular smooth muscle cells.
Hypertension
35:
297-302,
2000
47.
Tamura, K,
Umemura S,
Nyui N,
Yabana M,
Toya Y,
Fukamizu A,
Murakami K,
and
Ishii M.
Possible role of c-Jun in transcription of the mouse renin gene.
Kidney Int
54:
382-393,
1998[ISI][Medline].
48.
Wagner, J,
Dechow C,
Morath C,
Lehrke I,
Amann K,
Floege J,
and
Ritz E.
Retinoic acid reduces glomerular injury in a rat model of glomerular damage.
J Am Soc Nephrol
11:
1469-1475,
2000
49.
Wagner, J,
Gehlen F,
Ciechanowicz A,
and
Ritz E.
Angiotensin II receptor type 1 gene expression in human glomerulonephritis and diabetes mellitus.
J Am Soc Nephrol
10:
545-551,
1999
50.
Wagner, J,
Volk S,
Haufe CC,
Ciechanowicz A,
Paul M,
and
Ritz E.
Renin gene expression in human kidney biopsies from patients with glomerulonephritis or graft rejection.
J Am Soc Nephrol
5:
1469-1475,
1995[Abstract].
51.
Zhou, XF,
Shen XQ,
and
Shemshedini L.
Ligand-activated retinoic acid receptor inhibits AP-1 transactivation by disrupting c-Jun/c-Fos dimerization.
Mol Endocrinol
13:
276-285,
1999
This article has been cited by other articles:
![]() |
A. Zulli, S. Rai, B. F. Buxton, L. M. Burrell, and D. L. Hare Co-localization of angiotensin-converting enzyme 2-, octomer-4- and CD34-positive cells in rabbit atherosclerotic plaques Exp Physiol, May 1, 2008; 93(5): 564 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Choudhary, A. Palm-Leis, R. C. Scott III, R. S. Guleria, E. Rachut, K. M. Baker, and J. Pan All-trans retinoic acid prevents development of cardiac remodeling in aortic banded rats by inhibiting the renin-angiotensin system Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H633 - H644. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, H. Meng, Z.-H. Li, Z. Shu, X. Ma, and B.-X. Zhang Regulation of STIM1, store-operated Ca2+ influx, and nitric oxide generation by retinoic acid in rat mesangial cells Am J Physiol Renal Physiol, March 1, 2007; 292(3): F1054 - F1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Zhong, D.-Y. Huang, G.-F. Liu, H.-Y. Jin, Y.-M. Yang, Y.-F. Li, X.-H. Song, and K. Du Effects of all-trans retinoic acid on orphan receptor APJ signaling in spontaneously hypertensive rats Cardiovasc Res, February 15, 2005; 65(3): 743 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Zhong, D.-Y. Huang, Y.-M. Yang, Y.-F. Li, G.-F. Liu, X.-H. Song, and K. Du Upregulation of Angiotensin-Converting Enzyme 2 by All-trans Retinoic Acid in Spontaneously Hypertensive Rats Hypertension, December 1, 2004; 44(6): 907 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ma, T. Matsusaka, H. Yang, H. Kawachi, F. Shimizu, Y. Isaka, E. Imai, V. Kon, and I. Ichikawa Local Actions of Endogenous Angiotensin II in Injured Glomeruli J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1268 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liebler, B. Uberschar, H. Kubert, S. Brems, A. Schnitger, M. Tsukada, C. C. Zouboulis, E. Ritz, and J. Wagner The renal retinoid system: time-dependent activation in experimental glomerulonephritis Am J Physiol Renal Physiol, March 1, 2004; 286(3): F458 - F465. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||