Vol. 281, Issue 6, F1148-F1156, December 2001
EEG1, a putative transporter expressed during epithelial
organogenesis: comparison with embryonic transporter expression during
nephrogenesis
Robert O.
Stuart1,2,3,
Anna
Pavlova4,
David
Beier4,
Zhixing
Li2,
Yelena
Krijanovski4, and
Sanjay K.
Nigam2,3,4
1 Veterans Affairs San Diego Healthcare System,
2 Division of Nephrology and Hypertension, Department of
Medicine and Pediatrics, 3 Cancer Center, University of
California San Diego, La Jolla, California 92093; and
4 Department of Medicine, Brigham and Women's Hospital,
Harvard Medical School, Boston, Massachusetts 02115
 |
ABSTRACT |
A screen for genes differentially regulated in a model of kidney
development identified the novel gene embryonic epithelia gene 1 (EEG1). EEG1 exists as two transcripts of 2.4 and 3.5 kb that are most
highly expressed at embryonic day 7 and later in the fetal
liver, lung, placenta, and kidney. The EEG1 gene is composed of 14 exons spanning a 20-kb region at human chromosome 11p12 and the
syntenic region of mouse chromosome 2. Six EEG1 exons have previously
been assigned to a longer isoform of eosinophil major basic protein
termed proteoglycan 2. Another gene distantly related to EEG1,
POV1/PB39, is located 88 kb upstream from the EEG1 gene on chromosome
11. Temporal expression of 65 members of the solute carrier (SLC)-class
of transport proteins was followed during kidney development using DNA
arrays. POV-1 and EEG1, like glucose transporters, displayed very early
maximal gene expression. In contrast, other SLC genes, such as organic
anion and cation transporters, amino acid permeases, and nucleoside
transporters, had maximal expression later in development. Thus,
although the bulk of transporters are expressed late in kidney
development, a fraction are expressed near the onset of nephrogenesis.
The data raise the possibility that EEG1 and POV1 may define a new family of transport proteins involved in the transport of nutrients or
metabolites in rapidly growing and/or developing tissues.
microarray; organogenesis; bioinformatics; embryonic epithelia gene
1
 |
INTRODUCTION |
DIVERSE EPITHELIAL
TISSUES appear to share a core developmental program, which
manifests as an ability to form tight sheets of cells that can be
organized into hollow tubes that serve as the interface between
physiological compartments and that are specialized for the transport
of various substances. The search for developmentally important genes
in epithelial and other embryonic organs is hampered by the
multiplicity of cell types and lack of temporal synchronization. Kidney
development is characterized by the interactions of two primordial
tissues: the metanephric mesenchyme (MM) and an epithelial component
termed the ureteric bud (UB). The UB is induced to undergo many rounds
of branching morphogenesis by factor(s) produced by the MM
(15). The MM in turn is induced to undergo a mesenchymal
to epithelial transformation in response to factor(s) produced by the
UB. A well-characterized system utilizing two cultured cell lines
derived from embryonic kidney reproduces in vitro certain aspects of
this developmental program (13). UB cells (representing
the epithelial component of the embryonic kidney) are cultured in a
three-dimensional extracellular matrix and subsequently are exposed to
the conditioned media from BSN cells (representing their mesenchymal
component). The UB cells subsequently enter a morphogenetic program,
which proceeds though cellular processes, branching multicellular
cords, and eventually branching multicellular tubular structures with
lumens (13). The various stages, i.e., processes, cords,
and tubules, are associated with distinct patterns of gene expression
(7, 12). Here, we describe the cloning, chromosomal
localization, and characterization of embryonic epithelia gene 1 (EEG1), a putative transport gene that is differentially expressed in
the cell culture model and in a variety of embryonic epithelial
tissues. We also compared its developmental expression pattern to a
large number of members of the major facilitator class of membrane
transporters during kidney development.
 |
METHODS |
UB cell tubulogenesis assay.
The induction of branching morphogenesis in UB cells has been described
in detail (13). Briefly, the "tubulogenic" condition consisted of UB cells suspended in a three-dimensional extracellular matrix consisting of an 80:20% mixture of collagen-I and Matrigel and
exposed to the conditioned media derived from BSN cells
[BSN-conditioned medium (CM)]. Other "nontubulogenic" conditions
included UB cells suspended in 100% collagen, 100% Matrigel, or
monolayer culture with exposure to 10% FCS, BSN-CM, or serum-free
media. The combination of collagen-I, Matrigel, and BSN-CM results
eventually in the formation of branching tubular structures with lumens
(13). Total RNA was collected from UB cells from each
condition. Equivalent aliquots of RNA were reverse transcribed
(Superscript-II, Life Technologies) and screened via differential
display PCR for differentially regulated bands. Up- as well as
downregulated bands were excised, subcloned, and sequenced.
Cloning and characterization of EEG1.
Apparently novel sequences were prioritized for further
characterization. One such 279-bp amplicon was employed in the design of a probe for cDNA isolation using GeneTrapper technology (Life Technologies). A single 2.4-kb clone was identified in an adult mouse
kidney library. Sequence derived from this clone revealed a set of
overlapping expressed sequence tag (EST) entries, one of which (GenBank
accession no. AI588018) was identical to the original clone with the
exception of a probable deletion of a retained intron.
Chromosomal localization.
The chromosomal localization of EEG1 was determined by radiation hybrid
mapping using the T31 radiation hybrid screening panel (10). Primers (forward: GTTCCCCCTGTTCAAAGTCTC; reverse:
GATTTTGTCTTCTCAGCACGG) were designed to amplify the 3' untranslated
region of EEG1 and were utilized to test samples of genomic DNA from
each of the 96-radiation hybrid clones. The results were tabulated and
analyzed using RH Mapper
(http://www.genome.wi.mit.edu/cgi-bin/mouse_rh/rhmap-auto/rhmapper.cgi). On the basis of linkage to adjacent sequence-tagged site
markers, EEG1 was assigned to chromosome 2, 22.56 cR from
D2Mit126 (lod >10.0). This marker is localized at 49 cM on
chromosome 2 in the mouse genome database
(http://www.informatics.jax.org/). This region shows conservation of
synteny with human chromosome 11p11-12.
In situ hybridization, Northern analysis, and GeneChip assays.
Multiple tissue and whole embryonic mouse Northern blots were purchased
from Clontech. The blots were probed with digoxigenin-labeled DNA
probes generated by PCR using the appropriate plasmid template (Boehringer Mannheim). Paraffin-embedded mouse embryo tissue slides and
reagents for in situ hybridization were from Novagen. In situ hybridization was performed as previously described (11).
Specific PCR primers used to generate probes spanning the EEG1 sequence were EEG1-563r: 5'-catcctgcgcttttaaatcagaaggc, EEG1-197f:
5'-aagctccatggttattc, EEG1-1396r: 5'-cacgccaaagaactgg,
EEG1-698f: 5'-atcatcattgccttcacc, EEG1-1914r:
5'-cgagtaatgaacagaaaagg, EEG1-1624f: 5'-tgtatggatgcaatgctgc, and
EEG1-2012r: 5'-ggtttgtttcttgtggtgg.
DNA array analysis.
The GeneChip assays have previously been described in detail
(14). Briefly, rat genome U34A GeneChips (Affymetrix)
were employed to investigate changes in expression during rat
kidney development from embryonic day 13 (the beginning of
metanephrogenesis) through adulthood. Here, the data were used to
investigate the expression of 65 members of the major facilitator
transporter class present on the arrays, 35 of which were seen to
change significantly (P < 0.05). The database and
custom analytical tools are available at organogenesis.ucsd.edu, as are
lists of transport genes described here.
 |
RESULTS |
Identification and cloning.
A number of methodologies exist for the identification of
differentially expressed sequences. A few such techniques, including differential display (dd) PCR, microarrays, serial analysis of gene
expression, and subtractive hybridization, allow for the identification
of novel and/or unclassified transcripts. Although the material
requirements for DNA array analysis are steadily shrinking, ddPCR is
particularly suited for the analysis of very small samples and for the
identification of sequences that are unavailable on arrays. We employed
ddPCR in a search for up- as well as downregulated transcripts in the
UB-BSN cell model of kidney development. Equivalent aliquots of total
RNA were isolated from UB cells under various "tubulogenic" and
"nontubulogenic" conditions as described in METHODS. A
number of bands were observed to increase. However, a small number were
observed to decrease in response to BSN-CM (Fig.
1), and one of these, a 279-bp amplicon, was employed as a probe for cDNA isolation using the GeneTrapper kit
(Life Technologies). One 2.4 kb cDNA, initially termed 617e1, was
isolated from an adult mouse kidney library.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Differential display. Total RNA was obtained from
ureteric bud (UB) cells in 3D culture under various conditions of
cytokine and/or extracellular matrix exposure, which resulted in
varying degrees of branching morphogenesis in the UB/extracellular
matrix (BSN) cell system. Equal aliquots were reverse transcribed and
used as a template in a ddPCR-based search for genes differentially
regulated in this model. Most amplicons either showed no change in
response to serum or the conditioned media from the mesenchymal cell
line (BSN cells), BSN-stimulated with conditioned media (CM)
(band 1) or were uniformly up- or downregulated by addition
of serum or BSN-CM (band 2). One amplicon displayed the
unusual property of differential downregulation by BSN-cm, an effect
not seen with 10% FCS (band 3), and was prioritized for
cloning.
|
|
Sequence analysis.
Sequence analysis revealed a number of overlapping EST
database (dbEST) matches, one of which, AI588018, was identical to the
original clone with the exception of an intron deletion (9). Another human EST, AL157431, was the full length cDNA of the human ortholog (18). On the basis of high
expression in embryonic epithelial tissues (see below) we termed this
gene, EEG1, for expressed in "Embryonic Epithelia Gene 1." Here,
the murine form is referred to as mEEG1 and the human ortholog as hEEG1. Homology searches also yielded a single high-scoring match in
the nonredundant database belonging to proteoglycan-2 (PRG2). PRG2 has
been described as a longer isoform of eosinophil major basic protein
(MBP) produced from transcription at an alternate upstream promoter
(6). Another previously cloned gene of unknown function,
POV1/PB39 (1), displays 28% amino acid identity and 44%
amino acid similarity to the EEG1 translation. The degree of similarity
between EEG1 and POV1 is consistent with that seen between distantly
related members of a gene family, e.g., transporters, such as hOAT1 and
hOCT1 (32% identity, and 49% similarity), isoforms of the human
organic anion, and cation transporters, respectively (4,
8).
The four genes shared some degree of similarity at either the amino
acid or nucleotide level. Radiation hybrid mapping of the mEEG1 3'-UTR
placed the mEEG1 gene on mouse chromosome 2 [22.56 cR from D2Mit126,
lod >10.0], in a region with conservation of synteny with human
chromosome 11p11-12. hPOV1, PRG2, and MBP also map to this human
chromosomal region, indicating the possibility that EEG1 shared exons
in common with PRG2 (1, 6). It remained extremely unlikely
that the EEG1 sequence was a cloning artifact, given the fact that
multiple overlapping dbEST entries spanned its entire length.
Nevertheless, contiguous overlapping PCR amplicons spanning the entire
EEG1 transcript were generated from whole mouse embryonic cDNA and
confirmed by sequence (Fig.
2A).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 2.
Embryonic epithelia gene 1 (EEG1) molecular analysis. A: overlapping PCR amplicons
corresponding to the entire putative murine (m)EEG1 transcript were
amplified from e12 whole mouse embryo cDNA and sequenced. RACE
amplicons (5') demonstrated the presence of one 38-bp retained intron
in the original sequence. In the absence of this intron sequence, the
predicted transcription initiation site occurs at the first ATG codon
and conforms to Kozak's rules (5). B: genomic
structure of the human (h)EEG1 gene on human chromosome 11. The mouse
EEG1 and human sequence derived from expressed sequence tag (EST)
AL157431 shared considerable sequence overlap with a previously
characterized gene, proteoglycan 2 (PRG2). PRG2 was, in turn, a
putative longer isoform of another nearby gene, major base protein
(MBP). To resolve the relationships between potentially 3 genes, the
relevant Celera chromosome 11 sequence was investigated for exons via
sequence comparisons to the RNA. hEEG1 is constructed from 14 exons
spanning 20 kb of genomics on the reverse strand of genomic scaffold
GA_x2HTBL4CBQV (shown in reverse orientation for clarity). The
canonical MBP gene containing the coding region is located ~36 kb
downstream and shares no sequence in common with EEG1. Arrows
correspond to coding regions of the EEG1, MBP, and PRG2 transcripts.
C: structure of the PRG2 transcript. A chimeric transcript
containing 6 exons from EEG1, 2 alternative exons (5 and 8), and the 5 coding exons from MBP have been described in human eosinophils and bone
marrow. A transcript spanning the putative EEG1/MBP boundary is not
represented in the dbEST. Of more than 100 EST clones representing the
MBP sequence, not one extends more 5' than exon 10 "EST
cutoff." Furthermore, the PRG2 transcript as described is predicted
to be translated as a protein distinct from both MBP and EEG1 [open
reading frame (orf1)]. Plain numbers correspond to EEG1 exons defined
here. Prime numbers correspond to PRG2 exons as defined previously
(6).
|
|
Recent human genome sequencing efforts raised the possibility of
resolving confusion regarding the precise relationships of these genes
(4a, 17). The Celera chromosome scaffold (GA_x2HTBL4CBQV) contained 500 kb of human chromosome 11 sequence. With the chromosome 11 sequence, it was possible to select a 55-kb region containing the
hEEG1, PRG2, and MBP gene regions (Fig. 2B). Twenty-two
exons and their relationships to the mRNA sequences were defined. hEEG1 is composed of 14 exons covering a 20-kb region. The unambiguous MBP
gene containing the coding region and corresponding to more than 100 dbEST entries is located 36 kb downstream and shares no sequence in
common with hEEG1. The PRG2 sequence contains the coding exons from MBP
and eight alternative exons, as previously described (6).
Several lines of evidence suggested that the PRG2 sequence is extremely
rare or is observed only in particular circumstances. Of more than 100 dbEST entries showing high homology to PRG2, not a single entry shows
sequence more 5' than exon 10 when the PRG2 sequence is used
as the query (Fig. 2C). Furthermore, the putative PRG2
transcript would not likely code for MBP because a 5' open reading
frame exists and would likely be preferentially translated
(5). A second open reading frame (ORF) exists that would result in a hybrid EEG1/MBP molecule, which does not exist as an
identifiable dbEST entry. Nevertheless, a PRG2 transcript has been
reported in immature human eosinophils, a tissue source not well
represented in the dbEST (6).
Although EEG1 conceivably shares exons with nearby genes in certain
special contexts, it represents a distinct RNA species. Northern
analysis revealed the presence of two transcripts of 2.4 and 3.5 kb in
the mouse (Fig. 3). The entire 2.4-kb
mEEG1 transcript contained two retained introns, one of 350 bp between exons 3 and 4, and another (also present in EST
AI588088) of 38 bp. The precise chromosomal location of this intron
identified through 5'RACE remains undefined, as the mouse chromosomal
sequence is unavailable. The putative, fully processed mouse RNA
species contains 2,004 nucleotides and a single ORF of 1,392 nt,
specifying a protein of 464 amino acids. The putative transcription
start site at position 323 (362 in the Genbank entry) represents the first ATG in the sequence and conforms to Kozak's rules for
translation initiation (CAGACCATGGCAA) (Fig.
2A) (5). The human ortholog specified by
AL157431 contains a 1,473- bp ORF specifying a 491-amino acid protein.
The mouse and human EEG1 transcripts differed significantly in two
regions. In predicted exon 10, mouse EEG1 contains a series
of cag-repeats specifying 14 contiguous glutamine residues interrupted
by one glutamate residue. In addition, the original mouse 617e1 clone
terminated in a poly-A tail after predicted exon 13, thus
eliminating exon 14, which encodes the 3'UTR and 33 terminal
amino acids.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 3.
Northern analysis. Whole mouse embryo Northern blots
(Clontech) were analyzed with probes containing shared EEG1 and PRG2
sequence (EST) or with probes derived from EEG1-specific sequence. The
results are identical and suggest that the shared exons exist
overwhelmingly, or entirely, in the EEG1 transcript derived from the
whole embryo. The data also show that EEG1 is highly expressed in the
early embryo. Expression progressively decreases with increasing fetal
age. In the adult, expression is highest in the heart (h), followed by
the lung (lu), liver (li), spleen (sp), and kidney (k). The adult
tissue distribution of EEG1 is somewhat different than in the embryo,
particularly in the heart (Fig. 5). b, Brain; sk, skeletal muscle; t,
testis.
|
|
hEEG1 and hPOV1 share 44% amino acid similarity concentrated in
two long sequence intervals representing over 50% of their respective
lengths. Their close proximity on human chromosome 11 suggests an
ancient gene duplication event. Both hEEG1 and hPOV1 are predicted by
hydropathy profile to contain multiple transmembrane domains (Fig.
4, A and B). In the
case of hPOV1, 12 transmembrane domains are predicted, and in the case
of hEEG1, 10 are predicted. Comparison of the hEEG1 hydropathy profile
with those of all known or predicted proteins
(http://bioinformatics.weizmann.ac.il/hydroph/) yields a highest
scoring match with the human folate-like transporter (Swiss-Prot
O60779) with which hEEG1 shares 18% amino acid identity over the
length of the sequence (Fig. 4C). The remaining high-scoring matches were all sugar- transporting proteins. The high-scoring match for hPOV1 was a hypothetical C. elegans protein, YSPK (Swiss-Prot Q19425) (Fig.
4D). The PSORT2 program
(http://bioweb.pasteur.fr/seqanal/interfaces/psort2.html) predicted a possible NH2-terminal signal
peptide from amino acids 1-29, further suggesting that hEEG1 is a
membrane protein.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
EEG1 and POV1 hydropathy.
Kyte-Doolittle hydropathy plot and transmembrane segment prediction for
hEEG1 (A) and hPOV1 (B). Both hEEG and hPOV1
demonstrate multiple predicted membranes spanning domains according to
the TMPred program
(http://www.ch.embnet.org/software/TMPRED_form.html). The number
and location of the 12 predicted domains for POV1 conform to that
expected for major facilitator transport proteins (MFP). The EEG1
sequence has 10 predicted transmembrane domains. In addition, the EEG1
translation conforms to the Pfam definition for "sugar
transporter." Comparisons of the hEEG1 (C) and hPOV1
(D) hydropathy profiles against all known or putative
proteins (bioinformatics.weizmann.ac.il/hydroph/) appear. The
highest scoring match with hEEG1 was the human folate-like
transporter (hFLOH); all other matches were sugar transporters. The
highest scoring match with hPOV1 was an uncharacterized C. elegans protein, YSPK. Thus multiple lines of evidence suggest
that EEG1 and POV1 are related transmembrane transport
proteins.
|
|
Expression of EEG1.
The 2.4- and 3.5-kb transcripts revealed similar patterns of expression
on Northern analysis (Fig. 3). Both are highly expressed in the early
embryo; expression is very high at embryonic day 7 compared
with later times. A 3'-probe was generated that contained only an
EEG1-specific sequence whereas the EST probe contained sequence shared
with the putative PRG2 transcript. No difference in expression pattern
was noted. Expression in the adult was strongest in the heart followed
by the lung, liver, spleen, and kidney. In situ hybridization using the
3'-probe revealed intense signal from the placenta in e9.5 mouse
embryos (Fig. 5). In addition, the whole
of the mesenchymal region representing presumptive liver, spleen, and
kidney showed expression of EEG1. By embryonic day 12, EEG1
is found primarily in the liver and lung, a pattern that continues
through at least day 16. In addition, expression was noted
in the kidney cortex at this time (Fig. 5).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
Embryonic tissue expression by in situ hybridization (e9.5 mouse
embryo). mEEG1 was highly expressed in placenta (P) and in the
mesenchymal region (M) containing the presumptive liver, gut, and
kidneys (e12.5 mouse embryo). High expression was found in the fetal
liver with lesser expression noted in the lung. Faint expression was
also widely noted in tissues excluding the central nervous system
(e16.5 mouse embryo). Intense expression was again noted in liver and
lung with somewhat lesser expression in the kidney cortex. Note the
relatively low expression in fetal heart compared with findings on
Northern analysis of adult tissue. Probe was the 3' EEG1-specific
sequence (Fig. 2A). Sense controls yielded barely detectable
signals (not shown).
|
|
We have also investigated the expression of some 8,740 genes utilizing
the Affymetrix RG-U34A GeneChip during rat kidney development (14). Stand-alone blast investigations of the RG-U34A
target sequences revealed that the EEG1 sequence is not represented on this DNA array, even as an uncharacterized EST sequence. However, we
have already described (Figs. 4 and 5) whole embryonic mouse Northern
data and in situ hybridization data, indicating that EEG1 has a high
expression in the early embryo including the kidney, followed by a
marked decline over the course of development. On the other hand, the
rat POV1 ortholog is represented. POV1 expression is highest in the
developing rat kidney at the onset of organogenesis (e13.5) and
decreases linearly with advancing embryonic and postnatal age (Fig.
6). On the basis of hydropathy
similarity, we hypothesized that EEG1 and POV1 are novel members of the
major facilitator class of membrane transport proteins (MFP). We
therefore sought to compare the temporal expression in the developing
kidney of POV1 with other members of this class.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 6.
Expression profiles of major
facilitator proteins during rat kidney development. Total RNA (5 µg,
duplicate samples) was isolated from rat kidneys at embryonic
days 13, 15, 17, and 19, newborn
(nb), 1 wk old (wk), and adult, and hybridized to Affymetrix RG-U34A
GeneChips. MFP were identified on the GeneChips on the basis of
Affymetrix target sequence homology to reference GenBank sequences
corresponding to the solute carrier series (SLC) of the human gene
nomenclature database (www.gene.ucl.ac.uk). The y-axis
represents relative gene expression of each gene after compression of
the dynamic expression range to a maximum of 3 (decreasing). Very few
transport genes were found with a decreasing pattern of expression
during kidney development. The POV1 expression profile is plotted with
this group (arrow). The rat EEG1 ortholog was not present on the
RG-U34A array. This group of genes included SLC4A3 (band 3 Cl/HCO3 exchanger), SLC2A1 (GLUT1), SLC2A3 (GLUT3), and SLC1A3
(glutamate transporter; increasing). A larger group of transporters was
observed to increase during development and consisted of a number of
organic anion and cation transporters, phosphate transporters, Na/H
exchangers, and SLC group 3 proteins involved in stimulating
amino acid transport (midpeak). A small number of genes had maximal
expression in midembryonic or neonatal life. Interestingly, this group
was composed almost uniquely of nucleoside transporters (SLC28A1,
SLC29A1, SLC29A2) but also included the glycerol-3-phosphate
transporter, SLC37A1 (amino acid permeases). The amino acid permeases
(SLC group 7) displayed relatively flat expression profiles
in the developing kidney. However, their regulators (SLC group
3) display a marked increase in expression toward adulthood.
Regulation of amino acid transport in developing through adult kidney
may therefore be a function of SLC3 expression. The functional role of
SLC group 7 molecules in the absence of their positive
regulators remains undefined.
|
|
All human MFP were identified, and corresponding probe sets on the
RG-U34A GeneChip were identified on the basis of sequence similarity to
solute carrier (SLC) genes in the human gene nomenclature database
(www.gene.ucl.ac.uk). A priori, it was expected that many transporters
would be markers of terminal differentiation, and it was, indeed, the
case that a large number of the 65 transporter-specifying RNAs were
maximally expressed in the adult kidney (Fig. 6). This group included a
heterogeneous collection of organic anion/cation transporters,
phosphate transporters, Na/H exchangers, and regulators (though not
actual transporters) of amino acid transport. These results are in
keeping with previous observations for NKT/OAT1, OAT2, Roct, OCT1,
NaPi, and SGLT1 (11, 16, 19). Several genes peaked in
either midembryogenesis or neonatal life. This group consisted almost
exclusively of nucleoside transporters of SLC groups 28 and
29 (Fig. 6). Whereas the amino acid transporter regulators
of SLC group 3 were observed to increase during development, the targets of their regulation, the SLC group 7 amino acid
permeases displayed essentially flat expression profiles (Fig. 6). Thus it may be that regulation of amino acid transport as a function of
developmental age is ultimately regulated by expression of SLC
group 3 members. Only a very limited subset of genes was
identified, which, like POV1, was more highly expressed in the
embryonic than in the adult kidney. This group included SLC4A3
(band 3 Cl/HCO3 exchanger), SLC2A1 (GLUT1), SLC2A3 (GLUT3),
and SLC1A3 (glutamate transporter) (Fig. 6).
To confirm early embryonic vs. later expression of transporters, we
generated electronic "eBlots" based on the source library frequency
distribution of corresponding EST sequences in the dbEST. dbEST source
libraries are encoded with information as to tissue of origin, and
embryonic vs. adult source. We have previously described a custom
computer application, eBlot, which associates source library
information available in the dbEST with sequences present on Affymetrix
GeneChips using blast-derived homology as a linking field
(14). Using eBlot, we were able to determine to what
degree the early expression observed here during kidney development was
reflected in a much larger database (dbEST). It was found that those
MFP genes observed to decrease during kidney development were
significantly associated with embryonic source libraries, whereas those
MFP genes increasing during kidney development were almost entirely
associated with adult source libraries (Fig. 7). Both EEG1 and POV1 are likewise
associated with embryonic source libraries. In the case of POV1, of 20 representative EST sequences, 12 were derived from embryonic libraries.
In the case of EEG1, 5 of 20 representative entries were derived
from embryonic sources. In fact, of 8,740 genes assayed via DNA
microarrays, the rat POV gene was one of only eight sequences
representing the intersection of 1) significantly high early
embryonic kidney expression, 2) unknown function, and
3) association with ESTs derived from embryonic libraries.
Data, gene lists, and analytic tools are available at
www.organogenesis.ucsd.edu.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
eBlot database (db)EST source library associations
according to MFP expression profile. The dbEST sequences and associated
source library information may be surveyed to gain insight into the
tissue distribution of a given gene or group of genes. The eBlot
program associates gene sequences grouped by cluster membership with
dbEST entries on the basis of sequence similarity and calculates
summary statistics for tissue source including derivation from
embryonic libraries. Those dbEST entries corresponding to MFP
transporters that had expression patterns in the kidney similar to POV1
(Dec) were largely derived from embryonic source libraries. In
contrast, those dbEST entries corresponding to MFP transporters that
increased temporally during kidney development (Inc) were comparatively
rarely observed in embryonic libraries. Genes from the Mid cluster had
an intermediate association with embryonic source libraries. The eBlot
results demonstrate that the early/mid/late distinction observed by
microarray analysis in the developing kidney is concordant with what
has been observed in a very large number of tissues and experiments
(~7,000 source libraries in dbEST).
|
|
 |
DISCUSSION |
EEG1 was isolated in a screen for sequences differentially
regulated in a cell culture model of kidney development. We have isolated many such sequences chosen on the basis of upregulation in
this model, including Timeless, a putative transcription factor that
appears to be necessary for early embryonic survival and branching
morphogenesis of the UB (3, 7). Nevertheless, interesting
sequences may actually decrease during renal development, as many
morphoregulatory genes are expressed early in development and decline
towards birth. Recent DNA microarray analyses of kidney development
confirm this notion (14) and lead us to analyze sequences
that were isolated from ddPCR gels on the basis of downregulation in
the cell culture model system. Among these sequences was a novel
amplicon representing EEG1. In addition to cloning and analyzing this
gene, we define the genomic structure of EEG1, elucidate the complex
relationship of EEG1 to other genes in the region, and characterize its
expression in embryonic and adult tissues.
Much of the EEG1 nucleotide sequence has previously been assigned to
another gene, PRG2, located in the same region of human chromosome 11. The PRG2 sequence is a chimera of six EEG1 exons, two novel exons, and
the five coding-region exons of MBP (Fig. 2B). The PRG2
transcript has previously been demonstrated in HL-60 cells (a human
leukemic cell line), peripheral blood eosinophils from patients with
hypereosinophilic syndrome, and bone marrow. It is not known if the
bone marrow was "normal." On the other hand, the human dbEST
contains millions of randomly cloned sequences from some 7,000 source
libraries. And, while the database contains abundant examples of the
short 1-kb MBP transcript, not a single instance of PRG2 is found.
Furthermore, the PRG2 transcript would not likely translate as the MBP
protein as there are many ORF preceding the putative MBP initiation
site (5). The PRG2 transcript is infrequently observed,
and the shared exons are more appropriately identified as belonging to
the EEG1 gene. Despite the lack of evidence for PRG2 in the dbEST, EEG1
and MBP may, in some cell types, under certain conditions, form a
hybrid transcript termed PRG2, though this hypothesis awaits confirmation.
Multiple lines of evidence suggested that EEG1 represents a novel and
distinct RNA species predicted to encode a protein with characteristics
of a membrane transporter. The closest known EEG1 homolog is POV1/PB39.
POV1 is located 88 kb upstream (on the reverse strand) of EEG1 on human
chromosome 11. The proximity of the two genes at 11p12, taken together
with their significant amount of sequence divergence, suggests an
ancient gene duplication event. And, both genes (perhaps distant
paralogs of a novel class) have features typical of membrane transport
proteins including 12 (POV1) or 10 (EEG1) transmembrane spanning
segments. Furthermore, hydropathy pattern matching yielded similar
functional associations for both proteins. The known protein most
similar to EEG1 (in terms of hydropathy) is the human folate-like
transporter with numerous sugar transporter near-matches, whereas POV1
has considerable similarity to several cation and amino acid
transporters. Nevertheless, it is important to note that neither EEG1
nor POV1 closely resembles members of a major facilitator superfamily
at the nucleotide or amino acid level, despite the similarities in
hydropathy, suggesting that they may be transporters. Therefore, their
assignment into this class remains tentative.
A very limited subset of transport proteins in the kidney appear to
have significantly higher embryonic than adult expression. A priori,
this circumstance might be hypothesized for transporters of nutrient
molecules needed for growth. Indeed, we have found that MFP
transporters with the highest embryonic expression were involved in
glucose or glutamate uptake. This was noted in the kidney specifically
and for tissues generally, as reflected in the dbEST. EEG1 was not
present on the DNA arrays employed here; however, in situ hybridization
showed that EEG1 is highly expressed in several embryonic epithelial
tissues including the kidney, lung, and particularly the liver. No
precisely quantitative data regarding the time course of EEG1
expression in the developing kidney could be derived. Nevertheless, it
was likely from Northern analysis, taken together with the in situ
data, that peak expression in liver, lung, and kidney occurred during
embryogenesis. The nearest EEG1 homolog, POV1, was present on the DNA
arrays and similarly showed a decreasing temporal pattern of expression
coincident with two sugar and one glutamate transporter. At least in
the context of present knowledge, EEG1 and POV1 may represent unusual examples of transport proteins with high early embryonic expression. They may serve in transport of nutrients and/or metabolites of particular importance in early development and growth.
 |
ACKNOWLEDGEMENTS |
R. O. Stuart is supported by the Medical Education and Research
Foundation and National Institute of Diabetes and Digestive and Kidney
Diseases (NIDDK) Grant K08-DK-02392. S. K. Nigam is supported by
NIDDK Grants PO1 DK-54711 and RO1 DK-49517.
 |
FOOTNOTES |
Address for reprint requests and other correspondence: R. Stuart, 9500 Gilman Dr., La Jolla, CA 92093 (E-mail:
rostuart{at}ucsd.edu).
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9 April 2001; accepted in final form 23 July 2001.
 |
REFERENCES |
1.
Cole, KA,
Chuaqui RF,
Katz K,
Pack S,
Zhuang Z,
Cole CE,
Lyne JC,
Linehan WM,
Liotta LA,
and
Emmert-Buck MR.
cDNA sequencing and analysis of POV1 (PB39): a novel gene up-regulated in prostate cancer.
Genomics
51:
282-287,
1998[ISI][Medline].
3.
Gotter, AL,
Manganaro T,
Weaver DR,
Kolakowski LF,
Possidente B,
Sriram S,
MacLaughlin DT,
and
Reppert SM.
A time-less function for mouse timeless.
Nat Neurosci
3:
755-756,
2000[ISI][Medline].
4.
Grundemann, D,
Gorboulev V,
Gambaryan S,
Veyhl M,
and
Koepsell H.
Drug excretion mediated by a new prototype of polyspecific transporter.
Nature
372:
549-552,
1994[Medline].
4a.
International Human Genome Project Collaborators.
Initial sequencing and analysis of the human genome.
Nature
409:
860-921,
2001[Medline].
5.
Kozak, M.
Interpreting cDNA sequences: some insights from studies on translation.
Mamm Genome
7:
563-574,
1996[ISI][Medline].
6.
Li, MS,
Sun L,
Satoh T,
Fisher LM,
and
Spry CJ.
Human eosinophil major basic protein, a mediator of allergic inflammation, is expressed by alternative splicing from two promoters.
Biochem J
305:
921-927,
1995.
7.
Li, Z,
Stuart RO,
Qiao J,
Pavlova A,
Bush KT,
Pohl M,
Sakurai H,
and
Nigam SK.
A role for Timeless in epithelial morphogenesis during kidney development.
Proc Natl Acad Sci USA
97:
10038-10043,
2000[Abstract/Free Full Text].
8.
Lopez-Nieto, CE,
You G,
Bush KT,
Barros EJ,
Beier DR,
and
Nigam SK.
Molecular cloning and characterization of NKT, a gene product related to the organic cation transporter family that is almost exclusively expressed in the kidney.
J Biol Chem
272:
6471-6478,
1997[Abstract/Free Full Text].
9.
Marra M, Hillier L, Kucaba T, Martin J, Beck C, Wylie T, Underwood K,
Steptoe M, Theising B, Allen M, Bowers Y, Person B, Swaller T, Gibbons
M, Pape D, Harvey N, Schurk R, Ritter E, Kohn S, Shin T, Jackson Y,
Cardenas M, McCann R, Waterston R, and Wilson R. The WashU-NCI
mouse EST project [Online]. Washington University-National Cancer
Institute. http://www.ncbi.nlm.nih.gov/entrez/ [1999].
10.
McCarthy, LC,
Terrett J,
Davis ME,
Knights CJ,
Smith AL,
Critcher R,
Schmitt K,
Hudson J,
Spurr NK,
and
Goodfellow PN.
A first-generation whole genome-radiation hybrid map spanning the mouse genome.
Genome Res
7:
1153-1161,
1997[Abstract/Free Full Text].
11.
Pavlova, A,
Sakurai H,
Leclercq B,
Beier DR,
Yu AS,
and
Nigam SK.
Developmentally regulated expression of organic ion transporters NKT (OAT1), OCT1, NLT (OAT2), and Roct.
Am J Physiol Renal Physiol
278:
F635-F643,
2000[Abstract/Free Full Text].
12.
Pavlova, A,
Stuart RO,
Pohl M,
and
Nigam SK.
Evolution of gene expression patterns in a model of branching morphogenesis.
Am J Physiol Renal Physiol
277:
F650-F663,
1999[Abstract/Free Full Text].
13.
Sakurai, H,
Barros EJ,
Tsukamoto T,
Barasch J,
and
Nigam SK.
An in vitro tubulogenesis system using cell lines derived from the embryonic kidney shows dependence on multiple soluble growth factors.
Proc Natl Acad Sci USA
94:
6279-6284,
1997[Abstract/Free Full Text].
14.
Stuart, R,
Bush K,
and
Nigam SK.
Changes in global gene expression patterns during development and maturation of the rat kidney.
Proc Natl Acad Sci USA
98:
5649-5654,
2001[Abstract/Free Full Text].
15.
Stuart, RO,
and
Nigam SK.
Developmental biology of the kidney.
In: The Kidney (6th ed.), edited by Brenner BM.. Philadelphia: Saunders, 2000, p. 68-92.
16.
Traebert, M,
Lotscher M,
Aschwanden R,
Ritthaler T,
Biber J,
Murer H,
and
Kaissling B.
Distribution of the sodium/phosphate transporter during postnatal ontogeny of the rat kidney.
J Am Soc Nephrol
10:
1407-1415,
1999[Abstract/Free Full Text].
17.
Venter, JC,
Adams MD,
Myers EW,
Li PW,
Mural RJ,
Sutton GG,
Smith HO,
Yandell M,
Evans CA,
Holt RA,
Gocayne JD,
Amanatides P,
Ballew RM,
Huson DH,
Wortman JR,
Zhang Q,
Kodira CD,
Zheng XH,
Chen L,
Skupski M,
Subramanian G,
Thomas PD,
Zhang J,
Gabor Miklos GL,
Nelson C,
Broder S,
Clark AG,
Nadeau J,
McKusick VA,
Zinder N,
Levine AJ,
Roberts RJ,
Simon M,
Slayman C,
Hunkapiller M,
Bolanos R,
Delcher A,
Dew I,
Fasulo D,
Flanigan M,
Florea L,
Halpern A,
Hannenhalli S,
Kravitz S,
Levy S,
Mobarry C,
Reinert K,
Remington K,
Abu-Threideh J,
Beasley E,
Biddick K,
Bonazzi V,
Brandon R,
Cargill M,
Chandramouliswaran I,
Charlab R,
Chaturvedi K,
Deng Z,
Di Francesco V,
Dunn P,
Eilbeck K,
Evangelista C,
Gabrielian AE,
Gan W,
Ge W,
Gong F,
Gu Z,
Guan P,
Heiman TJ,
Higgins ME,
Ji RR,
Ke Z,
Ketchum KA,
Lai Z,
Lei Y,
Li Z,
Li J,
Liang Y,
Lin X,
Lu F,
Merkulov GV,
Milshina N,
Moore HM,
Naik AK,
Narayan VA,
Neelam B,
Nusskern D,
Rusch DB,
Salzberg S,
Shao W,
Shue B,
Sun J,
Wang Z,
Wang A,
Wang X,
Wang J,
Wei M,
Wides R,
Xiao C,
Yan C,
Yao A,
Ye J,
Zhan M,
Zhang W,
Zhang H,
Zhao Q,
Zheng L,
Zhong F,
Zhong W,
Zhu S,
Zhao S,
Gilbert D,
Baumhueter S,
Spier G,
Carter C,
Cravchik A,
Woodage T,
Ali F,
An H,
Awe A,
Baldwin D,
Baden H,
Barnstead M,
Barrow I,
Beeson K,
Busam D,
Carver A,
Center A,
Cheng ML,
Curry L,
Danaher S,
Davenport L,
Desilets R,
Dietz S,
Dodson K,
Doup L,
Ferriera S,
Garg N,
Gluecksmann A,
Hart B,
Haynes J,
Haynes C,
Heiner C,
Hladun S,
Hostin D,
Houck J,
Howland T,
Ibegwam C,
Johnson J,
Kalush F,
Kline L,
Koduru S,
Love A,
Mann F,
May D,
McCawley S,
McIntosh T,
McMullen I,
Moy M,
Moy L,
Murphy B,
Nelson K,
Pfannkoch C,
Pratts E,
Puri V,
Qureshi H,
Reardon M,
Rodriguez R,
Rogers YH,
Romblad D,
Ruhfel B,
Scott R,
Sitter C,
Smallwood M,
Stewart E,
Strong R,
Suh E,
Thomas R,
Tint NN,
Tse S,
Vech C,
Wang G,
Wetter J,
Williams S,
Williams M,
Windsor S,
Winn-Deen E,
Wolfe K,
Zaveri J,
Zaveri K,
Abril JF,
Guigo R,
Campbell MJ,
Sjolander KV,
Karlak B,
Kejariwal A,
Mi H,
Lazareva B,
Hatton T,
Narechania A,
Diemer K,
Muruganujan A,
Guo N,
Sato S,
Bafna V,
Istrail S,
Lippert R,
Schwartz R,
Walenz B,
Yooseph S,
Allen D,
Basu A,
Baxendale J,
Blick L,
Caminha M,
Carnes-Stine J,
Caulk P,
Chiang YH,
Coyne M,
Dahlke C,
Mays A,
Dombroski M,
Donnelly M,
Ely D,
Esparham S,
Fosler C,
Gire H,
Glanowski S,
Glasser K,
Glodek A,
Gorokhov M,
Graham K,
Gropman B,
Harris M,
Heil J,
Henderson S,
Hoover J,
Jennings D,
Jordan C,
Jordan J,
Kasha J,
Kagan L,
Kraft C,
Levitsky A,
Lewis M,
Liu X,
Lopez J,
Ma D,
Majoros W,
McDaniel J,
Murphy S,
Newman M,
Nguyen T,
Nguyen N,
Nodell M,
Pan S,
Peck J,
Peterson M,
Rowe W,
Sanders R,
Scott J,
Simpson M,
Smith T,
Sprague A,
Stockwell T,
Turner R,
Venter E,
Wang M,
Wen M,
Wu D,
Wu M,
Xia A,
Zandieh A,
and
Zhu X.
The sequence of the human genome.
Science
291:
1304-1351,
2001[Abstract/Free Full Text].
18.
Weimann, S.
Molecular genome analysis. EST sequence Heidelberg, Germany: German Cancer Research Center, 2000.
19.
You, G,
Lee WS,
Barros EJ,
Kanai Y,
Huo TL,
Khawaja S,
Wells RG,
Nigam SK,
and
Hediger MA.
Molecular characteristics of Na(+)-coupled glucose transporters in adult and embryonic rat kidney.
J Biol Chem
270:
29365-29371,
1995[Abstract/Free Full Text].
Am J Physiol Renal Fluid Electrolyte Physiol 281(6):F1148-F1156