AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 281: F1148-F1156, 2001;
0363-6127/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stuart, R. O.
Right arrow Articles by Nigam, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stuart, R. O.
Right arrow Articles by Nigam, S. K.
Vol. 281, Issue 6, F1148-F1156, December 2001

EEG1, a putative transporter expressed during epithelial organogenesis: comparison with embryonic transporter expression during nephrogenesis

Robert O. Stuart1,2,3, Anna Pavlova4, David Beier4, Zhixing Li2, Yelena Krijanovski4, and Sanjay K. Nigam2,3,4

1 Veterans Affairs San Diego Healthcare System, 2 Division of Nephrology and Hypertension, Department of Medicine and Pediatrics, 3 Cancer Center, University of California San Diego, La Jolla, California 92093; and 4 Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts 02115


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

A screen for genes differentially regulated in a model of kidney development identified the novel gene embryonic epithelia gene 1 (EEG1). EEG1 exists as two transcripts of 2.4 and 3.5 kb that are most highly expressed at embryonic day 7 and later in the fetal liver, lung, placenta, and kidney. The EEG1 gene is composed of 14 exons spanning a 20-kb region at human chromosome 11p12 and the syntenic region of mouse chromosome 2. Six EEG1 exons have previously been assigned to a longer isoform of eosinophil major basic protein termed proteoglycan 2. Another gene distantly related to EEG1, POV1/PB39, is located 88 kb upstream from the EEG1 gene on chromosome 11. Temporal expression of 65 members of the solute carrier (SLC)-class of transport proteins was followed during kidney development using DNA arrays. POV-1 and EEG1, like glucose transporters, displayed very early maximal gene expression. In contrast, other SLC genes, such as organic anion and cation transporters, amino acid permeases, and nucleoside transporters, had maximal expression later in development. Thus, although the bulk of transporters are expressed late in kidney development, a fraction are expressed near the onset of nephrogenesis. The data raise the possibility that EEG1 and POV1 may define a new family of transport proteins involved in the transport of nutrients or metabolites in rapidly growing and/or developing tissues.

microarray; organogenesis; bioinformatics; embryonic epithelia gene 1


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

DIVERSE EPITHELIAL TISSUES appear to share a core developmental program, which manifests as an ability to form tight sheets of cells that can be organized into hollow tubes that serve as the interface between physiological compartments and that are specialized for the transport of various substances. The search for developmentally important genes in epithelial and other embryonic organs is hampered by the multiplicity of cell types and lack of temporal synchronization. Kidney development is characterized by the interactions of two primordial tissues: the metanephric mesenchyme (MM) and an epithelial component termed the ureteric bud (UB). The UB is induced to undergo many rounds of branching morphogenesis by factor(s) produced by the MM (15). The MM in turn is induced to undergo a mesenchymal to epithelial transformation in response to factor(s) produced by the UB. A well-characterized system utilizing two cultured cell lines derived from embryonic kidney reproduces in vitro certain aspects of this developmental program (13). UB cells (representing the epithelial component of the embryonic kidney) are cultured in a three-dimensional extracellular matrix and subsequently are exposed to the conditioned media from BSN cells (representing their mesenchymal component). The UB cells subsequently enter a morphogenetic program, which proceeds though cellular processes, branching multicellular cords, and eventually branching multicellular tubular structures with lumens (13). The various stages, i.e., processes, cords, and tubules, are associated with distinct patterns of gene expression (7, 12). Here, we describe the cloning, chromosomal localization, and characterization of embryonic epithelia gene 1 (EEG1), a putative transport gene that is differentially expressed in the cell culture model and in a variety of embryonic epithelial tissues. We also compared its developmental expression pattern to a large number of members of the major facilitator class of membrane transporters during kidney development.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

UB cell tubulogenesis assay. The induction of branching morphogenesis in UB cells has been described in detail (13). Briefly, the "tubulogenic" condition consisted of UB cells suspended in a three-dimensional extracellular matrix consisting of an 80:20% mixture of collagen-I and Matrigel and exposed to the conditioned media derived from BSN cells [BSN-conditioned medium (CM)]. Other "nontubulogenic" conditions included UB cells suspended in 100% collagen, 100% Matrigel, or monolayer culture with exposure to 10% FCS, BSN-CM, or serum-free media. The combination of collagen-I, Matrigel, and BSN-CM results eventually in the formation of branching tubular structures with lumens (13). Total RNA was collected from UB cells from each condition. Equivalent aliquots of RNA were reverse transcribed (Superscript-II, Life Technologies) and screened via differential display PCR for differentially regulated bands. Up- as well as downregulated bands were excised, subcloned, and sequenced.

Cloning and characterization of EEG1. Apparently novel sequences were prioritized for further characterization. One such 279-bp amplicon was employed in the design of a probe for cDNA isolation using GeneTrapper technology (Life Technologies). A single 2.4-kb clone was identified in an adult mouse kidney library. Sequence derived from this clone revealed a set of overlapping expressed sequence tag (EST) entries, one of which (GenBank accession no. AI588018) was identical to the original clone with the exception of a probable deletion of a retained intron.

Chromosomal localization. The chromosomal localization of EEG1 was determined by radiation hybrid mapping using the T31 radiation hybrid screening panel (10). Primers (forward: GTTCCCCCTGTTCAAAGTCTC; reverse: GATTTTGTCTTCTCAGCACGG) were designed to amplify the 3' untranslated region of EEG1 and were utilized to test samples of genomic DNA from each of the 96-radiation hybrid clones. The results were tabulated and analyzed using RH Mapper (http://www.genome.wi.mit.edu/cgi-bin/mouse_rh/rhmap-auto/rhmapper.cgi). On the basis of linkage to adjacent sequence-tagged site markers, EEG1 was assigned to chromosome 2, 22.56 cR from D2Mit126 (lod >10.0). This marker is localized at 49 cM on chromosome 2 in the mouse genome database (http://www.informatics.jax.org/). This region shows conservation of synteny with human chromosome 11p11-12.

In situ hybridization, Northern analysis, and GeneChip assays. Multiple tissue and whole embryonic mouse Northern blots were purchased from Clontech. The blots were probed with digoxigenin-labeled DNA probes generated by PCR using the appropriate plasmid template (Boehringer Mannheim). Paraffin-embedded mouse embryo tissue slides and reagents for in situ hybridization were from Novagen. In situ hybridization was performed as previously described (11). Specific PCR primers used to generate probes spanning the EEG1 sequence were EEG1-563r: 5'-catcctgcgcttttaaatcagaaggc, EEG1-197f: 5'-aagctccatggttattc, EEG1-1396r: 5'-cacgccaaagaactgg, EEG1-698f: 5'-atcatcattgccttcacc, EEG1-1914r: 5'-cgagtaatgaacagaaaagg, EEG1-1624f: 5'-tgtatggatgcaatgctgc, and EEG1-2012r: 5'-ggtttgtttcttgtggtgg.

DNA array analysis. The GeneChip assays have previously been described in detail (14). Briefly, rat genome U34A GeneChips (Affymetrix) were employed to investigate changes in expression during rat kidney development from embryonic day 13 (the beginning of metanephrogenesis) through adulthood. Here, the data were used to investigate the expression of 65 members of the major facilitator transporter class present on the arrays, 35 of which were seen to change significantly (P < 0.05). The database and custom analytical tools are available at organogenesis.ucsd.edu, as are lists of transport genes described here.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Identification and cloning. A number of methodologies exist for the identification of differentially expressed sequences. A few such techniques, including differential display (dd) PCR, microarrays, serial analysis of gene expression, and subtractive hybridization, allow for the identification of novel and/or unclassified transcripts. Although the material requirements for DNA array analysis are steadily shrinking, ddPCR is particularly suited for the analysis of very small samples and for the identification of sequences that are unavailable on arrays. We employed ddPCR in a search for up- as well as downregulated transcripts in the UB-BSN cell model of kidney development. Equivalent aliquots of total RNA were isolated from UB cells under various "tubulogenic" and "nontubulogenic" conditions as described in METHODS. A number of bands were observed to increase. However, a small number were observed to decrease in response to BSN-CM (Fig. 1), and one of these, a 279-bp amplicon, was employed as a probe for cDNA isolation using the GeneTrapper kit (Life Technologies). One 2.4 kb cDNA, initially termed 617e1, was isolated from an adult mouse kidney library.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1.   Differential display. Total RNA was obtained from ureteric bud (UB) cells in 3D culture under various conditions of cytokine and/or extracellular matrix exposure, which resulted in varying degrees of branching morphogenesis in the UB/extracellular matrix (BSN) cell system. Equal aliquots were reverse transcribed and used as a template in a ddPCR-based search for genes differentially regulated in this model. Most amplicons either showed no change in response to serum or the conditioned media from the mesenchymal cell line (BSN cells), BSN-stimulated with conditioned media (CM) (band 1) or were uniformly up- or downregulated by addition of serum or BSN-CM (band 2). One amplicon displayed the unusual property of differential downregulation by BSN-cm, an effect not seen with 10% FCS (band 3), and was prioritized for cloning.

Sequence analysis. Sequence analysis revealed a number of overlapping EST database (dbEST) matches, one of which, AI588018, was identical to the original clone with the exception of an intron deletion (9). Another human EST, AL157431, was the full length cDNA of the human ortholog (18). On the basis of high expression in embryonic epithelial tissues (see below) we termed this gene, EEG1, for expressed in "Embryonic Epithelia Gene 1." Here, the murine form is referred to as mEEG1 and the human ortholog as hEEG1. Homology searches also yielded a single high-scoring match in the nonredundant database belonging to proteoglycan-2 (PRG2). PRG2 has been described as a longer isoform of eosinophil major basic protein (MBP) produced from transcription at an alternate upstream promoter (6). Another previously cloned gene of unknown function, POV1/PB39 (1), displays 28% amino acid identity and 44% amino acid similarity to the EEG1 translation. The degree of similarity between EEG1 and POV1 is consistent with that seen between distantly related members of a gene family, e.g., transporters, such as hOAT1 and hOCT1 (32% identity, and 49% similarity), isoforms of the human organic anion, and cation transporters, respectively (4, 8).

The four genes shared some degree of similarity at either the amino acid or nucleotide level. Radiation hybrid mapping of the mEEG1 3'-UTR placed the mEEG1 gene on mouse chromosome 2 [22.56 cR from D2Mit126, lod >10.0], in a region with conservation of synteny with human chromosome 11p11-12. hPOV1, PRG2, and MBP also map to this human chromosomal region, indicating the possibility that EEG1 shared exons in common with PRG2 (1, 6). It remained extremely unlikely that the EEG1 sequence was a cloning artifact, given the fact that multiple overlapping dbEST entries spanned its entire length. Nevertheless, contiguous overlapping PCR amplicons spanning the entire EEG1 transcript were generated from whole mouse embryonic cDNA and confirmed by sequence (Fig. 2A).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   Embryonic epithelia gene 1 (EEG1) molecular analysis. A: overlapping PCR amplicons corresponding to the entire putative murine (m)EEG1 transcript were amplified from e12 whole mouse embryo cDNA and sequenced. RACE amplicons (5') demonstrated the presence of one 38-bp retained intron in the original sequence. In the absence of this intron sequence, the predicted transcription initiation site occurs at the first ATG codon and conforms to Kozak's rules (5). B: genomic structure of the human (h)EEG1 gene on human chromosome 11. The mouse EEG1 and human sequence derived from expressed sequence tag (EST) AL157431 shared considerable sequence overlap with a previously characterized gene, proteoglycan 2 (PRG2). PRG2 was, in turn, a putative longer isoform of another nearby gene, major base protein (MBP). To resolve the relationships between potentially 3 genes, the relevant Celera chromosome 11 sequence was investigated for exons via sequence comparisons to the RNA. hEEG1 is constructed from 14 exons spanning 20 kb of genomics on the reverse strand of genomic scaffold GA_x2HTBL4CBQV (shown in reverse orientation for clarity). The canonical MBP gene containing the coding region is located ~36 kb downstream and shares no sequence in common with EEG1. Arrows correspond to coding regions of the EEG1, MBP, and PRG2 transcripts. C: structure of the PRG2 transcript. A chimeric transcript containing 6 exons from EEG1, 2 alternative exons (5 and 8), and the 5 coding exons from MBP have been described in human eosinophils and bone marrow. A transcript spanning the putative EEG1/MBP boundary is not represented in the dbEST. Of more than 100 EST clones representing the MBP sequence, not one extends more 5' than exon 10 "EST cutoff." Furthermore, the PRG2 transcript as described is predicted to be translated as a protein distinct from both MBP and EEG1 [open reading frame (orf1)]. Plain numbers correspond to EEG1 exons defined here. Prime numbers correspond to PRG2 exons as defined previously (6).

Recent human genome sequencing efforts raised the possibility of resolving confusion regarding the precise relationships of these genes (4a, 17). The Celera chromosome scaffold (GA_x2HTBL4CBQV) contained 500 kb of human chromosome 11 sequence. With the chromosome 11 sequence, it was possible to select a 55-kb region containing the hEEG1, PRG2, and MBP gene regions (Fig. 2B). Twenty-two exons and their relationships to the mRNA sequences were defined. hEEG1 is composed of 14 exons covering a 20-kb region. The unambiguous MBP gene containing the coding region and corresponding to more than 100 dbEST entries is located 36 kb downstream and shares no sequence in common with hEEG1. The PRG2 sequence contains the coding exons from MBP and eight alternative exons, as previously described (6).

Several lines of evidence suggested that the PRG2 sequence is extremely rare or is observed only in particular circumstances. Of more than 100 dbEST entries showing high homology to PRG2, not a single entry shows sequence more 5' than exon 10 when the PRG2 sequence is used as the query (Fig. 2C). Furthermore, the putative PRG2 transcript would not likely code for MBP because a 5' open reading frame exists and would likely be preferentially translated (5). A second open reading frame (ORF) exists that would result in a hybrid EEG1/MBP molecule, which does not exist as an identifiable dbEST entry. Nevertheless, a PRG2 transcript has been reported in immature human eosinophils, a tissue source not well represented in the dbEST (6).

Although EEG1 conceivably shares exons with nearby genes in certain special contexts, it represents a distinct RNA species. Northern analysis revealed the presence of two transcripts of 2.4 and 3.5 kb in the mouse (Fig. 3). The entire 2.4-kb mEEG1 transcript contained two retained introns, one of 350 bp between exons 3 and 4, and another (also present in EST AI588088) of 38 bp. The precise chromosomal location of this intron identified through 5'RACE remains undefined, as the mouse chromosomal sequence is unavailable. The putative, fully processed mouse RNA species contains 2,004 nucleotides and a single ORF of 1,392 nt, specifying a protein of 464 amino acids. The putative transcription start site at position 323 (362 in the Genbank entry) represents the first ATG in the sequence and conforms to Kozak's rules for translation initiation (CAGACCATGGCAA) (Fig. 2A) (5). The human ortholog specified by AL157431 contains a 1,473- bp ORF specifying a 491-amino acid protein. The mouse and human EEG1 transcripts differed significantly in two regions. In predicted exon 10, mouse EEG1 contains a series of cag-repeats specifying 14 contiguous glutamine residues interrupted by one glutamate residue. In addition, the original mouse 617e1 clone terminated in a poly-A tail after predicted exon 13, thus eliminating exon 14, which encodes the 3'UTR and 33 terminal amino acids.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3.   Northern analysis. Whole mouse embryo Northern blots (Clontech) were analyzed with probes containing shared EEG1 and PRG2 sequence (EST) or with probes derived from EEG1-specific sequence. The results are identical and suggest that the shared exons exist overwhelmingly, or entirely, in the EEG1 transcript derived from the whole embryo. The data also show that EEG1 is highly expressed in the early embryo. Expression progressively decreases with increasing fetal age. In the adult, expression is highest in the heart (h), followed by the lung (lu), liver (li), spleen (sp), and kidney (k). The adult tissue distribution of EEG1 is somewhat different than in the embryo, particularly in the heart (Fig. 5). b, Brain; sk, skeletal muscle; t, testis.

hEEG1 and hPOV1 share 44% amino acid similarity concentrated in two long sequence intervals representing over 50% of their respective lengths. Their close proximity on human chromosome 11 suggests an ancient gene duplication event. Both hEEG1 and hPOV1 are predicted by hydropathy profile to contain multiple transmembrane domains (Fig. 4, A and B). In the case of hPOV1, 12 transmembrane domains are predicted, and in the case of hEEG1, 10 are predicted. Comparison of the hEEG1 hydropathy profile with those of all known or predicted proteins (http://bioinformatics.weizmann.ac.il/hydroph/) yields a highest scoring match with the human folate-like transporter (Swiss-Prot O60779) with which hEEG1 shares 18% amino acid identity over the length of the sequence (Fig. 4C). The remaining high-scoring matches were all sugar- transporting proteins. The high-scoring match for hPOV1 was a hypothetical C. elegans protein, YSPK (Swiss-Prot Q19425) (Fig. 4D). The PSORT2 program (http://bioweb.pasteur.fr/seqanal/interfaces/psort2.html) predicted a possible NH2-terminal signal peptide from amino acids 1-29, further suggesting that hEEG1 is a membrane protein.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.   EEG1 and POV1 hydropathy. Kyte-Doolittle hydropathy plot and transmembrane segment prediction for hEEG1 (A) and hPOV1 (B). Both hEEG and hPOV1 demonstrate multiple predicted membranes spanning domains according to the TMPred program (http://www.ch.embnet.org/software/TMPRED_form.html). The number and location of the 12 predicted domains for POV1 conform to that expected for major facilitator transport proteins (MFP). The EEG1 sequence has 10 predicted transmembrane domains. In addition, the EEG1 translation conforms to the Pfam definition for "sugar transporter." Comparisons of the hEEG1 (C) and hPOV1 (D) hydropathy profiles against all known or putative proteins (bioinformatics.weizmann.ac.il/hydroph/) appear. The highest scoring match with hEEG1 was the human folate-like transporter (hFLOH); all other matches were sugar transporters. The highest scoring match with hPOV1 was an uncharacterized C. elegans protein, YSPK. Thus multiple lines of evidence suggest that EEG1 and POV1 are related transmembrane transport proteins.

Expression of EEG1. The 2.4- and 3.5-kb transcripts revealed similar patterns of expression on Northern analysis (Fig. 3). Both are highly expressed in the early embryo; expression is very high at embryonic day 7 compared with later times. A 3'-probe was generated that contained only an EEG1-specific sequence whereas the EST probe contained sequence shared with the putative PRG2 transcript. No difference in expression pattern was noted. Expression in the adult was strongest in the heart followed by the lung, liver, spleen, and kidney. In situ hybridization using the 3'-probe revealed intense signal from the placenta in e9.5 mouse embryos (Fig. 5). In addition, the whole of the mesenchymal region representing presumptive liver, spleen, and kidney showed expression of EEG1. By embryonic day 12, EEG1 is found primarily in the liver and lung, a pattern that continues through at least day 16. In addition, expression was noted in the kidney cortex at this time (Fig. 5).


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 5.   Embryonic tissue expression by in situ hybridization (e9.5 mouse embryo). mEEG1 was highly expressed in placenta (P) and in the mesenchymal region (M) containing the presumptive liver, gut, and kidneys (e12.5 mouse embryo). High expression was found in the fetal liver with lesser expression noted in the lung. Faint expression was also widely noted in tissues excluding the central nervous system (e16.5 mouse embryo). Intense expression was again noted in liver and lung with somewhat lesser expression in the kidney cortex. Note the relatively low expression in fetal heart compared with findings on Northern analysis of adult tissue. Probe was the 3' EEG1-specific sequence (Fig. 2A). Sense controls yielded barely detectable signals (not shown).

We have also investigated the expression of some 8,740 genes utilizing the Affymetrix RG-U34A GeneChip during rat kidney development (14). Stand-alone blast investigations of the RG-U34A target sequences revealed that the EEG1 sequence is not represented on this DNA array, even as an uncharacterized EST sequence. However, we have already described (Figs. 4 and 5) whole embryonic mouse Northern data and in situ hybridization data, indicating that EEG1 has a high expression in the early embryo including the kidney, followed by a marked decline over the course of development. On the other hand, the rat POV1 ortholog is represented. POV1 expression is highest in the developing rat kidney at the onset of organogenesis (e13.5) and decreases linearly with advancing embryonic and postnatal age (Fig. 6). On the basis of hydropathy similarity, we hypothesized that EEG1 and POV1 are novel members of the major facilitator class of membrane transport proteins (MFP). We therefore sought to compare the temporal expression in the developing kidney of POV1 with other members of this class.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6.   Expression profiles of major facilitator proteins during rat kidney development. Total RNA (5 µg, duplicate samples) was isolated from rat kidneys at embryonic days 13, 15, 17, and 19, newborn (nb), 1 wk old (wk), and adult, and hybridized to Affymetrix RG-U34A GeneChips. MFP were identified on the GeneChips on the basis of Affymetrix target sequence homology to reference GenBank sequences corresponding to the solute carrier series (SLC) of the human gene nomenclature database (www.gene.ucl.ac.uk). The y-axis represents relative gene expression of each gene after compression of the dynamic expression range to a maximum of 3 (decreasing). Very few transport genes were found with a decreasing pattern of expression during kidney development. The POV1 expression profile is plotted with this group (arrow). The rat EEG1 ortholog was not present on the RG-U34A array. This group of genes included SLC4A3 (band 3 Cl/HCO3 exchanger), SLC2A1 (GLUT1), SLC2A3 (GLUT3), and SLC1A3 (glutamate transporter; increasing). A larger group of transporters was observed to increase during development and consisted of a number of organic anion and cation transporters, phosphate transporters, Na/H exchangers, and SLC group 3 proteins involved in stimulating amino acid transport (midpeak). A small number of genes had maximal expression in midembryonic or neonatal life. Interestingly, this group was composed almost uniquely of nucleoside transporters (SLC28A1, SLC29A1, SLC29A2) but also included the glycerol-3-phosphate transporter, SLC37A1 (amino acid permeases). The amino acid permeases (SLC group 7) displayed relatively flat expression profiles in the developing kidney. However, their regulators (SLC group 3) display a marked increase in expression toward adulthood. Regulation of amino acid transport in developing through adult kidney may therefore be a function of SLC3 expression. The functional role of SLC group 7 molecules in the absence of their positive regulators remains undefined.

All human MFP were identified, and corresponding probe sets on the RG-U34A GeneChip were identified on the basis of sequence similarity to solute carrier (SLC) genes in the human gene nomenclature database (www.gene.ucl.ac.uk). A priori, it was expected that many transporters would be markers of terminal differentiation, and it was, indeed, the case that a large number of the 65 transporter-specifying RNAs were maximally expressed in the adult kidney (Fig. 6). This group included a heterogeneous collection of organic anion/cation transporters, phosphate transporters, Na/H exchangers, and regulators (though not actual transporters) of amino acid transport. These results are in keeping with previous observations for NKT/OAT1, OAT2, Roct, OCT1, NaPi, and SGLT1 (11, 16, 19). Several genes peaked in either midembryogenesis or neonatal life. This group consisted almost exclusively of nucleoside transporters of SLC groups 28 and 29 (Fig. 6). Whereas the amino acid transporter regulators of SLC group 3 were observed to increase during development, the targets of their regulation, the SLC group 7 amino acid permeases displayed essentially flat expression profiles (Fig. 6). Thus it may be that regulation of amino acid transport as a function of developmental age is ultimately regulated by expression of SLC group 3 members. Only a very limited subset of genes was identified, which, like POV1, was more highly expressed in the embryonic than in the adult kidney. This group included SLC4A3 (band 3 Cl/HCO3 exchanger), SLC2A1 (GLUT1), SLC2A3 (GLUT3), and SLC1A3 (glutamate transporter) (Fig. 6).

To confirm early embryonic vs. later expression of transporters, we generated electronic "eBlots" based on the source library frequency distribution of corresponding EST sequences in the dbEST. dbEST source libraries are encoded with information as to tissue of origin, and embryonic vs. adult source. We have previously described a custom computer application, eBlot, which associates source library information available in the dbEST with sequences present on Affymetrix GeneChips using blast-derived homology as a linking field (14). Using eBlot, we were able to determine to what degree the early expression observed here during kidney development was reflected in a much larger database (dbEST). It was found that those MFP genes observed to decrease during kidney development were significantly associated with embryonic source libraries, whereas those MFP genes increasing during kidney development were almost entirely associated with adult source libraries (Fig. 7). Both EEG1 and POV1 are likewise associated with embryonic source libraries. In the case of POV1, of 20 representative EST sequences, 12 were derived from embryonic libraries. In the case of EEG1, 5 of 20 representative entries were derived from embryonic sources. In fact, of 8,740 genes assayed via DNA microarrays, the rat POV gene was one of only eight sequences representing the intersection of 1) significantly high early embryonic kidney expression, 2) unknown function, and 3) association with ESTs derived from embryonic libraries. Data, gene lists, and analytic tools are available at www.organogenesis.ucsd.edu.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   eBlot database (db)EST source library associations according to MFP expression profile. The dbEST sequences and associated source library information may be surveyed to gain insight into the tissue distribution of a given gene or group of genes. The eBlot program associates gene sequences grouped by cluster membership with dbEST entries on the basis of sequence similarity and calculates summary statistics for tissue source including derivation from embryonic libraries. Those dbEST entries corresponding to MFP transporters that had expression patterns in the kidney similar to POV1 (Dec) were largely derived from embryonic source libraries. In contrast, those dbEST entries corresponding to MFP transporters that increased temporally during kidney development (Inc) were comparatively rarely observed in embryonic libraries. Genes from the Mid cluster had an intermediate association with embryonic source libraries. The eBlot results demonstrate that the early/mid/late distinction observed by microarray analysis in the developing kidney is concordant with what has been observed in a very large number of tissues and experiments (~7,000 source libraries in dbEST).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

EEG1 was isolated in a screen for sequences differentially regulated in a cell culture model of kidney development. We have isolated many such sequences chosen on the basis of upregulation in this model, including Timeless, a putative transcription factor that appears to be necessary for early embryonic survival and branching morphogenesis of the UB (3, 7). Nevertheless, interesting sequences may actually decrease during renal development, as many morphoregulatory genes are expressed early in development and decline towards birth. Recent DNA microarray analyses of kidney development confirm this notion (14) and lead us to analyze sequences that were isolated from ddPCR gels on the basis of downregulation in the cell culture model system. Among these sequences was a novel amplicon representing EEG1. In addition to cloning and analyzing this gene, we define the genomic structure of EEG1, elucidate the complex relationship of EEG1 to other genes in the region, and characterize its expression in embryonic and adult tissues.

Much of the EEG1 nucleotide sequence has previously been assigned to another gene, PRG2, located in the same region of human chromosome 11. The PRG2 sequence is a chimera of six EEG1 exons, two novel exons, and the five coding-region exons of MBP (Fig. 2B). The PRG2 transcript has previously been demonstrated in HL-60 cells (a human leukemic cell line), peripheral blood eosinophils from patients with hypereosinophilic syndrome, and bone marrow. It is not known if the bone marrow was "normal." On the other hand, the human dbEST contains millions of randomly cloned sequences from some 7,000 source libraries. And, while the database contains abundant examples of the short 1-kb MBP transcript, not a single instance of PRG2 is found. Furthermore, the PRG2 transcript would not likely translate as the MBP protein as there are many ORF preceding the putative MBP initiation site (5). The PRG2 transcript is infrequently observed, and the shared exons are more appropriately identified as belonging to the EEG1 gene. Despite the lack of evidence for PRG2 in the dbEST, EEG1 and MBP may, in some cell types, under certain conditions, form a hybrid transcript termed PRG2, though this hypothesis awaits confirmation.

Multiple lines of evidence suggested that EEG1 represents a novel and distinct RNA species predicted to encode a protein with characteristics of a membrane transporter. The closest known EEG1 homolog is POV1/PB39. POV1 is located 88 kb upstream (on the reverse strand) of EEG1 on human chromosome 11. The proximity of the two genes at 11p12, taken together with their significant amount of sequence divergence, suggests an ancient gene duplication event. And, both genes (perhaps distant paralogs of a novel class) have features typical of membrane transport proteins including 12 (POV1) or 10 (EEG1) transmembrane spanning segments. Furthermore, hydropathy pattern matching yielded similar functional associations for both proteins. The known protein most similar to EEG1 (in terms of hydropathy) is the human folate-like transporter with numerous sugar transporter near-matches, whereas POV1 has considerable similarity to several cation and amino acid transporters. Nevertheless, it is important to note that neither EEG1 nor POV1 closely resembles members of a major facilitator superfamily at the nucleotide or amino acid level, despite the similarities in hydropathy, suggesting that they may be transporters. Therefore, their assignment into this class remains tentative.

A very limited subset of transport proteins in the kidney appear to have significantly higher embryonic than adult expression. A priori, this circumstance might be hypothesized for transporters of nutrient molecules needed for growth. Indeed, we have found that MFP transporters with the highest embryonic expression were involved in glucose or glutamate uptake. This was noted in the kidney specifically and for tissues generally, as reflected in the dbEST. EEG1 was not present on the DNA arrays employed here; however, in situ hybridization showed that EEG1 is highly expressed in several embryonic epithelial tissues including the kidney, lung, and particularly the liver. No precisely quantitative data regarding the time course of EEG1 expression in the developing kidney could be derived. Nevertheless, it was likely from Northern analysis, taken together with the in situ data, that peak expression in liver, lung, and kidney occurred during embryogenesis. The nearest EEG1 homolog, POV1, was present on the DNA arrays and similarly showed a decreasing temporal pattern of expression coincident with two sugar and one glutamate transporter. At least in the context of present knowledge, EEG1 and POV1 may represent unusual examples of transport proteins with high early embryonic expression. They may serve in transport of nutrients and/or metabolites of particular importance in early development and growth.


    ACKNOWLEDGEMENTS

R. O. Stuart is supported by the Medical Education and Research Foundation and National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Grant K08-DK-02392. S. K. Nigam is supported by NIDDK Grants PO1 DK-54711 and RO1 DK-49517.


    FOOTNOTES

Address for reprint requests and other correspondence: R. Stuart, 9500 Gilman Dr., La Jolla, CA 92093 (E-mail: rostuart{at}ucsd.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 9 April 2001; accepted in final form 23 July 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Cole, KA, Chuaqui RF, Katz K, Pack S, Zhuang Z, Cole CE, Lyne JC, Linehan WM, Liotta LA, and Emmert-Buck MR. cDNA sequencing and analysis of POV1 (PB39): a novel gene up-regulated in prostate cancer. Genomics 51: 282-287, 1998[ISI][Medline].

3.   Gotter, AL, Manganaro T, Weaver DR, Kolakowski LF, Possidente B, Sriram S, MacLaughlin DT, and Reppert SM. A time-less function for mouse timeless. Nat Neurosci 3: 755-756, 2000[ISI][Medline].

4.   Grundemann, D, Gorboulev V, Gambaryan S, Veyhl M, and Koepsell H. Drug excretion mediated by a new prototype of polyspecific transporter. Nature 372: 549-552, 1994[Medline].

4a.   International Human Genome Project Collaborators. Initial sequencing and analysis of the human genome. Nature 409: 860-921, 2001[Medline].

5.   Kozak, M. Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7: 563-574, 1996[ISI][Medline].

6.   Li, MS, Sun L, Satoh T, Fisher LM, and Spry CJ. Human eosinophil major basic protein, a mediator of allergic inflammation, is expressed by alternative splicing from two promoters. Biochem J 305: 921-927, 1995.

7.   Li, Z, Stuart RO, Qiao J, Pavlova A, Bush KT, Pohl M, Sakurai H, and Nigam SK. A role for Timeless in epithelial morphogenesis during kidney development. Proc Natl Acad Sci USA 97: 10038-10043, 2000[Abstract/Free Full Text].

8.   Lopez-Nieto, CE, You G, Bush KT, Barros EJ, Beier DR, and Nigam SK. Molecular cloning and characterization of NKT, a gene product related to the organic cation transporter family that is almost exclusively expressed in the kidney. J Biol Chem 272: 6471-6478, 1997[Abstract/Free Full Text].

9.  Marra M, Hillier L, Kucaba T, Martin J, Beck C, Wylie T, Underwood K, Steptoe M, Theising B, Allen M, Bowers Y, Person B, Swaller T, Gibbons M, Pape D, Harvey N, Schurk R, Ritter E, Kohn S, Shin T, Jackson Y, Cardenas M, McCann R, Waterston R, and Wilson R. The WashU-NCI mouse EST project [Online]. Washington University-National Cancer Institute. http://www.ncbi.nlm.nih.gov/entrez/ [1999].

10.   McCarthy, LC, Terrett J, Davis ME, Knights CJ, Smith AL, Critcher R, Schmitt K, Hudson J, Spurr NK, and Goodfellow PN. A first-generation whole genome-radiation hybrid map spanning the mouse genome. Genome Res 7: 1153-1161, 1997[Abstract/Free Full Text].

11.   Pavlova, A, Sakurai H, Leclercq B, Beier DR, Yu AS, and Nigam SK. Developmentally regulated expression of organic ion transporters NKT (OAT1), OCT1, NLT (OAT2), and Roct. Am J Physiol Renal Physiol 278: F635-F643, 2000[Abstract/Free Full Text].

12.   Pavlova, A, Stuart RO, Pohl M, and Nigam SK. Evolution of gene expression patterns in a model of branching morphogenesis. Am J Physiol Renal Physiol 277: F650-F663, 1999[Abstract/Free Full Text].

13.   Sakurai, H, Barros EJ, Tsukamoto T, Barasch J, and Nigam SK. An in vitro tubulogenesis system using cell lines derived from the embryonic kidney shows dependence on multiple soluble growth factors. Proc Natl Acad Sci USA 94: 6279-6284, 1997[Abstract/Free Full Text].

14.   Stuart, R, Bush K, and Nigam SK. Changes in global gene expression patterns during development and maturation of the rat kidney. Proc Natl Acad Sci USA 98: 5649-5654, 2001[Abstract/Free Full Text].

15.   Stuart, RO, and Nigam SK. Developmental biology of the kidney. In: The Kidney (6th ed.), edited by Brenner BM.. Philadelphia: Saunders, 2000, p. 68-92.

16.   Traebert, M, Lotscher M, Aschwanden R, Ritthaler T, Biber J, Murer H, and Kaissling B. Distribution of the sodium/phosphate transporter during postnatal ontogeny of the rat kidney. J Am Soc Nephrol 10: 1407-1415, 1999[Abstract/Free Full Text].

17.   Venter, JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA, Gocayne JD, Amanatides P, Ballew RM, Huson DH, Wortman JR, Zhang Q, Kodira CD, Zheng XH, Chen L, Skupski M, Subramanian G, Thomas PD, Zhang J, Gabor Miklos GL, Nelson C, Broder S, Clark AG, Nadeau J, McKusick VA, Zinder N, Levine AJ, Roberts RJ, Simon M, Slayman C, Hunkapiller M, Bolanos R, Delcher A, Dew I, Fasulo D, Flanigan M, Florea L, Halpern A, Hannenhalli S, Kravitz S, Levy S, Mobarry C, Reinert K, Remington K, Abu-Threideh J, Beasley E, Biddick K, Bonazzi V, Brandon R, Cargill M, Chandramouliswaran I, Charlab R, Chaturvedi K, Deng Z, Di Francesco V, Dunn P, Eilbeck K, Evangelista C, Gabrielian AE, Gan W, Ge W, Gong F, Gu Z, Guan P, Heiman TJ, Higgins ME, Ji RR, Ke Z, Ketchum KA, Lai Z, Lei Y, Li Z, Li J, Liang Y, Lin X, Lu F, Merkulov GV, Milshina N, Moore HM, Naik AK, Narayan VA, Neelam B, Nusskern D, Rusch DB, Salzberg S, Shao W, Shue B, Sun J, Wang Z, Wang A, Wang X, Wang J, Wei M, Wides R, Xiao C, Yan C, Yao A, Ye J, Zhan M, Zhang W, Zhang H, Zhao Q, Zheng L, Zhong F, Zhong W, Zhu S, Zhao S, Gilbert D, Baumhueter S, Spier G, Carter C, Cravchik A, Woodage T, Ali F, An H, Awe A, Baldwin D, Baden H, Barnstead M, Barrow I, Beeson K, Busam D, Carver A, Center A, Cheng ML, Curry L, Danaher S, Davenport L, Desilets R, Dietz S, Dodson K, Doup L, Ferriera S, Garg N, Gluecksmann A, Hart B, Haynes J, Haynes C, Heiner C, Hladun S, Hostin D, Houck J, Howland T, Ibegwam C, Johnson J, Kalush F, Kline L, Koduru S, Love A, Mann F, May D, McCawley S, McIntosh T, McMullen I, Moy M, Moy L, Murphy B, Nelson K, Pfannkoch C, Pratts E, Puri V, Qureshi H, Reardon M, Rodriguez R, Rogers YH, Romblad D, Ruhfel B, Scott R, Sitter C, Smallwood M, Stewart E, Strong R, Suh E, Thomas R, Tint NN, Tse S, Vech C, Wang G, Wetter J, Williams S, Williams M, Windsor S, Winn-Deen E, Wolfe K, Zaveri J, Zaveri K, Abril JF, Guigo R, Campbell MJ, Sjolander KV, Karlak B, Kejariwal A, Mi H, Lazareva B, Hatton T, Narechania A, Diemer K, Muruganujan A, Guo N, Sato S, Bafna V, Istrail S, Lippert R, Schwartz R, Walenz B, Yooseph S, Allen D, Basu A, Baxendale J, Blick L, Caminha M, Carnes-Stine J, Caulk P, Chiang YH, Coyne M, Dahlke C, Mays A, Dombroski M, Donnelly M, Ely D, Esparham S, Fosler C, Gire H, Glanowski S, Glasser K, Glodek A, Gorokhov M, Graham K, Gropman B, Harris M, Heil J, Henderson S, Hoover J, Jennings D, Jordan C, Jordan J, Kasha J, Kagan L, Kraft C, Levitsky A, Lewis M, Liu X, Lopez J, Ma D, Majoros W, McDaniel J, Murphy S, Newman M, Nguyen T, Nguyen N, Nodell M, Pan S, Peck J, Peterson M, Rowe W, Sanders R, Scott J, Simpson M, Smith T, Sprague A, Stockwell T, Turner R, Venter E, Wang M, Wen M, Wu D, Wu M, Xia A, Zandieh A, and Zhu X. The sequence of the human genome. Science 291: 1304-1351, 2001[Abstract/Free Full Text].

18.   Weimann, S. Molecular genome analysis. EST sequence Heidelberg, Germany: German Cancer Research Center, 2000.

19.   You, G, Lee WS, Barros EJ, Kanai Y, Huo TL, Khawaja S, Wells RG, Nigam SK, and Hediger MA. Molecular characteristics of Na(+)-coupled glucose transporters in adult and embryonic rat kidney. J Biol Chem 270: 29365-29371, 1995[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 281(6):F1148-F1156



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
S. Broer
Amino Acid Transport Across Mammalian Intestinal and Renal Epithelia
Physiol Rev, January 1, 2008; 88(1): 249 - 286.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
M. Palacin, V. Nunes, M. Font-Llitjos, M. Jimenez-Vidal, J. Fort, E. Gasol, M. Pineda, L. Feliubadalo, J. Chillaron, and A. Zorzano
The Genetics of Heteromeric Amino Acid Transporters
Physiology, April 1, 2005; 20(2): 112 - 124.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stuart, R. O.
Right arrow Articles by Nigam, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stuart, R. O.
Right arrow Articles by Nigam, S. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online