AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 282: F330-F340, 2002. First published August 30, 2001; doi:10.1152/ajprenal.0168.2001
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/F330    most recent
0168.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deen, P. M. T.
Right arrow Articles by Caplan, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deen, P. M. T.
Right arrow Articles by Caplan, M. J.
Vol. 282, Issue 2, F330-F340, February 2002

Aquaporin-2: COOH terminus is necessary but not sufficient for routing to the apical membrane

Peter M. T. Deen1, Bas W. M. Van Balkom1, Paul J. M. Savelkoul1, Erik-Jan Kamsteeg1, Marcel Van Raak1, Michael L. Jennings2, Theodoor R. Muth3, Vanathy Rajendran4, and Michael J. Caplan4

1 Department of Cell Physiology, University Medical Center St. Radboud, Nijmegen 6500 HB, The Netherlands; 2 Department of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205; 3 Brooklyn College, Brooklyn, New York 11210; and 4 Department of Cellular and Molecular Physiology, Yale University, New Haven, Connecticut 06520


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Renal regulation of mammalian water homeostasis is mediated by the aquaporin-1 (AQP1) water channel, which is expressed in the apical and basolateral membranes of proximal tubules and descending limbs of Henle, and aquaporin-2 (AQP2), which is redistributed from intracellular vesicles to the apical membrane (AM) of collecting duct cells with vasopressin. In transfected Madin-Darby canine kidney cells, AQP1 and AQP2 are regulated similarly, which indicates that routing elements reside in their primary sequences. We studied the role of the AQP2 COOH terminus in apical routing and AQP2 shuttling. An AQP1 chimera (AQP1 with an AQP2 tail: AQP1/2-N220) was located only in the AM independent of forskolin treatment. Forskolin increased the apical expression of AQP1 and AQP1/2-N220 less than twofold; that of AQP2 increased more than fourfold with concomitant changes in osmotic water permeabilities. The dimeric AQP2 tail coupled to placental alkaline phosphatase (AQP2-Plap) was retained in intracellular vesicles different from those of homotetrameric wild-type AQP2; the same protein without the AQP2 tail (TMR-Plap) was only expressed in the AM. The study shows that the AQP2 COOH tail is necessary but not sufficient for routing to the AM and suggests that other parts of AQP2 are needed for AQP2 accumulation in intracellular vesicles.

routing; shuttling; Madin-Darby canine kidney cells; vasopressin


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE KIDNEY IS THE MAIN ORGAN for the regulation of water homeostasis. Of the 180 liters of pro-urine produced daily, 90% of the water is constitutively reabsorbed in the renal proximal tubules and descending thin limbs of Henle. This massive reabsorption has been attributed to the aquaporin-1 (AQP1) water channel, which is expressed in the apical and basolateral membranes of the epithelial cells that line these nephron segments. The remaining 10% can be reabsorbed in collecting ducts and is under control of the antidiuretic hormone arginine vasopressin (AVP). In the principal cells of collecting ducts, binding of AVP to its V2-type receptor, which is located in the basolateral membrane, initiates a cAMP signaling cascade that results in the activation of protein kinase A (PKA). One of the physiologically important substrates for this kinase is the aquaporin-2 (AQP2) water channel protein. As a result, AQP2 is redistributed from intracellular vesicles to the apical membrane, thereby rendering this membrane water permeable. Removal of AVP initiates endocytosis of AQP2 and restores the water-impermeable state of the apical membrane (35, 44, 46).

AQP2 is essential in this process, because humans who lack functional AQP2 suffer from nephrogenic diabetes insipidus (NDI), a disease in which the kidneys are unable to concentrate urine in response to AVP, resulting in a daily water loss of 10-15 l (7). Expression studies (43) of AQP2 missense mutants identified in patients with recessive NDI revealed that all mutants were retained in the endoplasmic reticulum, presumably as a consequence of misfolding. When expressed in oocytes, the only AQP2 mutant associated with dominant NDI that has been studied to date was not misfolded but was retained in the Golgi complex region (31). Heterotetramerization with wild-type AQP2 (WT-AQP2), precluding its further transport to the membrane, provided an explanation for the dominant NDI phenotype (18).

As is the case in renal proximal tubules, AQP1 expressed in transfected Madin-Darby canine kidney (MDCK) cells is found in both the apical and basolateral membranes and confers a water permeability that is not influenced by activation of either PKA or protein kinase C (PKC) (5). Additionally, as in collecting duct cells, AQP2 heterologously expressed in MDCK cells is stored in intracellular vesicles without PKA stimulation, whereas on stimulation of the cAMP signaling cascade, AQP2 is redistributed to the apical membrane, which results in a three- to fourfold increase in transcellular osmotic water permeability (6). These differences in subcellular localization and regulation for AQP1 and AQP2 expressed in the same MDCK cell type indicate that the signals necessary for specifying the routing of the respective proteins must reside in their primary sequences.

The COOH-terminal tail of AQP1 and AQP2 might be responsible for the differential regulation of these proteins. Whereas human AQP1 and AQP2 have an overall identity of 48%, the COOH-terminal tails differ extensively. In addition, the COOH-terminal tail bears the PKA phosphorylation site of AQP2 (10), and two mutations of AQP2 that cause dominant NDI are located in this segment (25, 31). Prevention of phosphorylation of AQP2 at the PKA phosphorylation site (as has been shown for the AQP2-S256A construct in LLC-PK1 cells and oocytes) results in retention of this AQP2 protein in intracellular vesicles (9, 17, 20), whereas the AQP2-E258K construct in dominant NDI is retained in the Golgi complex region (31). Thus to identify signals potentially involved in the routing and regulation of AQP2, chimeras of the COOH-terminal tail of AQP2 coupled to AQP1 or aquaporin-unrelated reporter segments were generated, expressed in MDCK cells, and analyzed for routing and function.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Expression constructs. pCB6-TMR-Plap consists of the mammalian expression vector pCB6 (which confers resistance to G418) and a cDNA that encodes the ectodomain of human placental alkaline phosphatase (Plap) linked to the transmembrane region (TMR) of the vesicular stomatitis virus G (VSV-G) protein (2). To generate pCB6-AQP2-Plap, the human AQP2 cDNA in pBluescript (pBS-AQP2) (7) was used as a template with the sense primer CGAAGCTTTTTCCGCCAGCCAAGAGCC and the antisense primer GCTCTAGAGCGGCCGCTCAGGCCTTGGTA in a standard PCR reaction. The amplified fragment of 169 bp, which was flanked by HindIII and XbaI restriction sites (underlined) coded for the COOH terminus of AQP2 starting with a phenylalanine located at position 224. After digestion with HindIII and XbaI, the fragment was cloned into the corresponding sites of pCB6-TMR-Plap; this resulted in a construct in which the cDNA of the AQP2 tail was cloned in frame with the TMR-encoding region.

In the chimeric construct encoding AQP1/2-N220, the AQP2 COOH-terminal tail sequence was substituted for the corresponding portion of AQP1. To generate this chimera in which asparagine at position 220 (N220) of human AQP2 is preceded by Y227 of rat AQP1, a three-point PCR reaction was performed. For this, the primer CCCTGGCAGTGCTGATCTATAACTACGTGCTGTTTCCGCC (of which the first half encodes part of rat AQP1 ending at Y227 and the second half encodes part of human AQP2 starting at N220) was used in combination with the T3 RNA polymerase primer and pBS-AQP2 in a standard PCR reaction. The resulting fragment of 185 bp was isolated and used in combination with pBS-AQP1 (5) (of which the T3 RNA polymerase start site had been removed), the T3 RNA polymerase primer, and the sense primer rAQP1-446S (TGGCTCGAGGTGTGAACTCC, which codes for Leu129 to Ser135 of rat AQP1) to generate a chimeric 517-bp AQP1-AQP2 cDNA fragment. Next this fragment was digested with NarI and ClaI and cloned in the corresponding sites of pBS-AQP1 to generate a cDNA that completely coded for the chimeric protein. Finally, the obtained construct was digested with SacI and HindIII, and the cDNA fragment encoding AQP1/2-N220 was isolated and cloned into the corresponding sites of pCB6. For all of the final constructs, proper nucleotide sequences of the cDNA inserts were checked by double-stranded DNA sequence analysis.

Culturing of MDCK cells and selection of transfected clones. Native MDCK-HRS (type I) cells, and MDCK cells expressing rat AQP1 [clone K (5)] or human AQP2 [WT10 (6)] were grown in DMEM supplemented with 5% (vol/vol) fetal calf serum at 37°C in 5% CO2. For transfection of MDCK cells, 25-30 µg of circular DNA (of expression constructs) purified over a Qiagen column were transfected using the calcium-phosphate precipitation technique as described previously (5). After 24 h, the cells were trypsinized, divided among six to eight petri dishes of 57 cm2, and cultured in medium containing 800 µg/ml G418 (GIBCO Europe, Breda, The Netherlands). Within 10-14 days after transfection, individual colonies were selected (using cloning rings) and expanded. After approximately eight passages after selection of a clone, the selection drug was omitted from the medium.

Transcellular osmotic water permeability measurements. Cells derived from 0.33 cm2 of confluent monolayers were seeded onto 0.33-cm2 polycarbonate filters (Costar, Cambridge, MA). On the second day after seeding, the medium was aspirated and replaced by fresh medium in the presence of 5 × 10-5 M indomethacin to reduce basal intracellular cAMP levels (6). Osmotic water transport was assayed 3 days after seeding in the presence of indomethacin, with or without 5 × 10-5 M forskolin, by incubation of the apical compartment with 150 µl of 0.5× Krebs-Henseleit buffer [KHB; 1× KHB contains (in mM) 1.2 MgSO4, 128 NaCl, 5 KCl, 2 NaHPO4, 10 sodium acetate, 20 HEPES, 1 CaCl2, 1 L-alanine, and 4 L-lactate; pH 7.4] with 30 mg/l phenol red and the addition of 800 µl of KHB to the basal compartment. After incubation for 2 h at 37°C, the content of the apical compartment was mixed with a pipette, and two aliquots of 50 µl per insert were put into Eppendorf tubes and diluted to 600 µl with Tris-buffered saline (TBS; 20 mM Tris and 73 mM NaCl; pH 7.6) to which 1% (wt/vol) extrane was added (Merck, Darmstadt, Germany). Cells were mixed and centrifuged, and absorbance at 479 nm was measured. The facilitated osmotic water transport (Pf ± SE in µm/s) was calculated from the acquired absorbances as described previously (5).

Fluid-phase endocytosis. Cells grown to confluence on 2-cm2 filters and pretreated with indomethacin were subjected to a fluid-phase endocytosis assay essentially as described by Katsura (21). Briefly, cells were incubated for 30 min in medium with or without 1 × 10-8 M deamino-8-D-arginine vasopressin (dDAVP), a chemical analog of AVP. The medium at the apical side of the cells was then replaced by a small volume of the same medium with drugs that also contained 10 mg/ml FITC-dextran (mol wt 9,400; Sigma, St. Louis, MO) and incubated for 15 min at 37°C. The cells were washed twice with ice-cold PBS with 1 mM MgCl2 and 0.1 mM CaCl2 (PBS-CM), fixed in 3% paraformaldehyde in PBS, washed with PBS, mounted on slides in Vectashield (Vector Laboratories, Burlingame, CA), and analyzed by confocal laser scanning microscopy (CLSM) as described (see In vivo immunocytochemistry).

Immunocytochemistry. Cells grown on 2-cm2 filters and incubated as described were rinsed with ice-cold PBS and fixed for 30 min in 3% (wt/vol) paraformaldehyde in PBS-CM at reverse transcription; this was followed by two washes with PBS-CM. Subsequently, the cells were permeabilized for 15 min in permeabilization buffer (0.3% Triton X-100 and 0.1% BSA in PBS), incubated for 15 min in 50 mM NH4Cl in PBS, washed with PBS, and washed with permeabilization buffer. Nonspecific binding was then blocked for 30 min in goat serum dilution buffer (GSDB: 16% goat serum, 0.3% Triton X-100, and 0.3 M NaCl in PBS), and the filters were cut from the plastic support and incubated overnight with 25-30 µl of antibody diluted in GSDB. The filters were then washed three times with permeabilization buffer, incubated with a 1:100 dilution of secondary antibody in GSDB for 45 min in the dark, washed three times for 5 min with permeabilization buffer, and mounted on slides in Vectashield. As primary antibodies, a 1:100 dilution of affinity-purified rabbit or guinea pig anti-AQP2 antibodies raised against the AQP2 COOH terminus (4), a 1:100 dilution of affinity-purified rabbit anti-AQP1 antibodies, and/or a 1:100 dilution of rabbit antiserum against human Plap (Fitzgerald Industries, Concord, MA) were used. As secondary antibodies, a 1:100 dilution of affinity-purified goat anti-rabbit IgG coupled to Alexa 488 or goat anti-guinea pig IgG coupled to Alexa 594 (Molecular Probes, Leiden, The Netherlands) were employed.

In vivo immunocytochemistry. To detect only the population of chimeric Plap proteins expressed in the plasma membrane, the selected AQP2-Plap and TMR-Plap clones grown and incubated as described were washed in ice-cold PBS-CM and incubated for 3 h with rabbit anti-Plap antibodies in 1% BSA in PBS-CM at 4°C. After three washes with ice-cold PBS-CM, the cells were fixed in 3% paraformaldehyde in PBS and incubated for 15 min in permeabilization medium. Subsequent wash steps, incubation with secondary antibodies, and mounting were as described.

Horizontal extended-focus images and vertical images were obtained with a Bio-Rad MRC-1000 laser scanning confocal imaging system using a ×60 oil-immersion objective, a 32 Kalman collection filter, an aperture diaphragm of 2.5, and an axial resolution of 0.14 µm/pixel. The images were contrast-stretched, and a threshold value with pseudocolor was applied. As controls, incubation of native MDCK cells or omission of primary or secondary antibodies revealed no labeling.

Sucrose-gradient centrifugation. Stably transfected MDCK clones grown to confluence in 75-cm2 flasks were scraped from the flasks in 10 ml of PBS, spun down, and homogenized in 5 ml of homogenization buffer A [HbA; 20 mM Tris (pH 7.4), 5 mM MgCl2, 5 mM NaH2PO4, 1 mM EDTA, 80 mM sucrose, 1 mM PMSF, and 5 µg/ml leupeptin and pepstatin]. After centrifugation at 1,000 g for 10 min and 4°C to remove cellular debris and nuclei, the supernatant was spun for 30 min at 200,000 g at 4°C to recover the microsomal membranes. These membranes were dissolved in 300 µl of solubilization buffer [4% sodium deoxycholate, 20 mM Tris (pH 8.0), 5 mM EDTA, 10% glycerol, 1 mM polymethylsulfonyl fluoride (PMSF), and 5 µg/ml leupeptin and pepstatin] for 1 h at 37°C and centrifuged at 100,000 g for 1 h at 4°C to remove undissolved membranes essentially according to Neely and Agre (34). Briefly, 5-17.5% sucrose-step gradients were prepared with 533 µl of 5, 7.5, 10, 12.5, 15, and 17.5% sucrose each in medium containing 20 mM Tris (pH 8.0), 5 mM EDTA, 0.1% Triton X-100, 1 mM PMSF, and 5 µg/ml of leupeptin and pepstatin. Samples (300 µl) of membrane proteins in sodium deoxycholate were loaded and subjected to 150,000 g centrifugation for 16 h at 8°C. Fractions (200 µl) were taken off carefully, designated a through s, and analyzed by immunoblotting. As sedimentation markers, a mixture of BSA (67 kDa), phosphorylase B (97 kDa), yeast alcohol dehydrogenase (150 kDa), and catalase (232 kDa) was used. All markers were from Sigma.

Side-specific biotinylation. Selected clones were seeded and grown on 10-cm2 semipermeable filters as described. After incubation for 2 h with or without forskolin, the cells were washed in ice-cold PBS-CM and incubated twice for 20 min at 4°C with 500 µl of 1.5 mg/ml Sulfo-SS-Biotin (Pierce, Rockford, IL) in biotinylation buffer [that contained (in mM) 10 triethanolamine, 2 CaCl2, and 125 NaCl; pH 8.9] applied to the apical surface of the cells. After quenching the biotin with a 5-min incubation in 50 mM NH4Cl in PBS-CM, the filters were washed twice with PBS-CM and excised from the support. The cells were then lysed for 30 min at 37°C in 1 ml of lysis buffer (that contained 150 mM NaCl, 5 mM EDTA, 50 mM Tris, and 1% Triton X-100; pH 7.5) to which protease inhibitors had been added (1 µg/ml leupeptin and pepstatin and 1 mM PMSF). Next the cells were scraped from the filters and spun down for 5 min to remove cellular debris. The supernatant of each sample was added to 30 µl of washed ImmunoPure streptavidin beads (Pierce) and rotated for at least 2 h at 4°C. The beads were washed twice with high-salt buffer (that contained 500 mM NaCl, 5 mM EDTA, 50 mM Tris, and 0.1% Triton X-100; pH 7.5), twice with lysis buffer, and once with 10 mM Tris (pH 7.5). After removal of all liquid using a 30-g needle, the proteins bound to the beads were solubilized in 30 µl of 1.5× Laemmli buffer, denatured for 30 min at 37°C, and subjected to immunoblot analysis.

Immunoblotting. Cells were seeded and grown as described. The medium was aspirated and the cells were lysed in 1× Laemmli sample buffer containing 100 mM dithiothreitol, and subsequently denatured for 30 min at 37°C. Sometimes cells were homogenized in HbA and subjected to endoglycosidase F digestion according to the protocol provided by the manufacturer (New England Biolabs, Hertfordshire, U.K.) to remove the sugar moieties. After SDS-PAGE on a 13% acrylamide gel, the proteins were immunoblotted onto Immobilon polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). The efficiency of protein transfer was checked by staining the membranes with Ponceau red. Subsequently the blots were blocked for 1 h with 5% nonfat dried milk (NFDM) in TBS with Tween [TBS-T; 20 mM Tris and 73 mM NaCl (pH 7.6), supplemented with 0.2% (vol/vol) Tween] and incubated with a 1:3,000 dilution of affinity-purified rabbit anti-AQP2 antibodies, a 1:1,000 dilution of rabbit anti-human Plap antiserum, or a 1:50 dilution of a mouse monoclonal antibody raised against rabbit AQP1 (14) in TBS with 1% NFDM. As secondary antibodies, a 1:5,000 dilution of affinity-purified goat anti-rabbit antibodies or a 1:2,000 dilution of affinity-purified sheep anti-mouse antibodies, all coupled to horseradish peroxidase (Sigma), were used. Sites of antigen-antibody reactions were visualized with enhanced chemiluminescence according to the protocol provided by the manufacturer (ECL, Boehringer Mannheim, Mannheim, Germany). To compare relative aquaporin-expression levels, concentration series of AQP2 and AQP2-Plap were immunoblotted in parallel (data not shown).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Subcellular localization of AQP2 chimeric proteins. In MDCK cells, AQP1 and AQP2 are routed and regulated as in epithelial cells of the renal proximal tubules and collecting ducts, respectively. Therefore, to identify trafficking signals contained in the COOH tail of AQP2, a mammalian AQP1 expression construct was made that encodes a protein in which the COOH terminus of AQP1 was exchanged with that of AQP2 [starting at Asn220 (AQP1/2-N220)] and transfected to MDCK cells. In this chimera, the site of exchange was at the point of loss of amino acid identity between AQP1 and AQP2, which is located in the latter part of the sixth TMR of AQP1. To test whether the AQP2 tail itself would be sufficient for trafficking to (and shuttling from) the apical membrane, a construct was made that encodes the ectodomain of Plap coupled to the VSV-G protein TMR and the COOH terminus of AQP2 starting at F224 (AQP2-Plap). As a negative control, the construct coding for the Plap ectodomain coupled to the VSV-G protein TMR was used (TMR-Plap), because in MDCK type II cells, this protein targeted to the basolateral membrane (Muth TR and Caplan MJ, unpublished observations). Figure 1 shows diagrams of the proteins encoded by the different constructs. All constructs were transfected into MDCK cells, and G418-resistant clonal cell lines were selected. With immunoblotting of endoglycosidase F-treated cell homogenates, clones were selected in which the expression levels of the chimeric proteins were closest to that of WT-AQP2 as found in the established WT-AQP2-expressing MDCK cell line, WT10 [(6); see Fig. 2]. From this and other blots, it appeared that the amounts of AQP2 (29 kDa) and AQP1/2-N220 (28 kDa) were similar, whereas those of AQP2-Plap (63 kDa) and TMR-Plap (58 kDa) were threefold less (note that antibodies against AQP2 and Plap were used). The amount of AQP1 could not be related to that of the others, because AQP1 was detected with different antibodies.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic representation of the studied proteins. Aquaporin (AQP)1, AQP2, and the AQP1-AQP2 chimeric protein AQP1/2-N220 traverse the membrane six times with both termini located inside the cell. Characteristic NPA boxes are indicated. In the dimeric AQP2 tail coupled to placental alkaline phosphatase (AQP2-Plap) and the same protein without the AQP2 tail (TMR-Plap), the ectodomain of Plap and the vesicular stomatitis virus G (VSV-G) protein transmembrane region (TMR) are shown in light and dark gray, respectively.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2.   Immunoblot analysis of Madin-Darby canine kidney (MDCK) cell lines expressing AQP2-tail chimeric proteins. Cells of MDCK clonal lines stably expressing AQP1 (K), AQP2 (WT10), AQP1/2-N220 (Ch. N220), AQP2-Plap, or TMR-Plap were homogenized. Protein equivalents were directly lysed in Laemmli buffer (-) or after treatment (+) with endoglycosidase F (endo-F) and subjected to immunoblotting using rabbit AQP1 antibodies (K) or a combination of rabbit antibodies directed against AQP2 and Plap. Molecular masses of size markers are indicated in kilodaltons.

To determine the subcellular localization of the different chimeras in the absence or presence of forskolin, the selected clones were grown to confluence on semipermeable inserts and subjected to immunocytochemistry. Subsequent CLSM revealed that with or without forskolin stimulation, AQP1/2-N220 was mainly localized in the apical membrane, whereas some staining was found in the basolateral membrane (Fig. 3A, top). In contrast, AQP2-Plap was predominantly localized in an intracellular compartment, which was not changed with forskolin treatment (Fig. 3A, middle). TMR-Plap, however, was only found in the apical membrane independent of the presence of forskolin (Fig. 3A, bottom). As reported (5, 6), AQP1 was steadily expressed in the apical and basolateral membranes (Fig. 3B, top), whereas AQP2 was redistributed from intracellular vesicles to the apical membrane with forskolin (Fig. 3B, bottom).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3.   Immunocytochemical analysis of MDCK cells expressing AQP2-tail chimeric proteins. Cells of selected MDCK clones expressing AQP1/2-N220 (Ch. N220), AQP2-Plap, and TMR-Plap (A), and wild-type AQP2 (WT-AQP2) and WT-AQP1 (B) were grown to confluence on semipermeable filters, incubated with or without forskolin for 2 h, fixed, and subjected to immunocytochemistry. Confocal images were taken in the xy- (top) and xz-axes (bottom) for each cell type.

If the Plap chimeric proteins are (partly) expressed in the plasma membranes, they should be well detectable by in vivo immunocytochemistry using the Plap antibody, because the Plap protein would be on the extracellular surface of the cell. Using this technique, CLSM revealed that some AQP2-Plap was present in the apical and basolateral membranes which was not redistributed upon forskolin treatment (Fig. 4, top). Furthermore, in vivo labeling confirmed the forskolin-independent apical localization of TMR-Plap (Fig. 4, bottom).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   In vivo immunocytochemical analysis of MDCK cells expressing AQP2-Plap or TMR-Plap proteins. Cells of selected MDCK clones expressing AQP2-Plap or TMR-Plap were grown to confluence on semipermeable filters, incubated with or without forskolin for 2 h, washed, and subsequently incubated at 4°C for 3 h with rabbit anti-Plap antibodies. Cells were then washed, fixed, permeabilized, and incubated with goat anti-rabbit antibodies coupled to Alexa 488, after which the filters were mounted on glass slides. For each cell type, confocal images were taken in the xy-axis (top) and xz-axis (bottom).

Expression of AQP2 chimeric proteins in apical membrane and conferred transcellular water permeabilities. To determine the effect of forskolin on the apical expression of the AQP2 chimeric proteins, the selected clones were subjected to side-specific biotinylation with subsequent immunoblotting for AQP2 (Fig. 5) and densitometric analysis of the signals. In the MDCK clone that expresses AQP1/2-N220, forskolin increased its apical expression 1.4-fold. Interestingly, apical expression of AQP1 was increased 1.5-fold with forskolin. In contrast, forskolin increased the apical expression of WT-AQP2 by 4.5-fold, whereas the drug had no effect on the level of apical expression of AQP2-Plap nor on that of TMR-Plap.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5.   Apical expression of AQP2-tail chimeric proteins in stably transfected MDCK clones. Cells of selected MDCK clones expressing wild-type AQP2 (WT10), AQP1/2-N220 (Ch. N220), AQP2-Plap, TMR-Plap, or WT-AQP1 (K) were grown to confluence on semipermeable filters, incubated with (F) or without (-) forskolin for 2 h, and subjected to a standard biotinylation assay of proteins expressed in the apical plasma membrane. After solubilization of the membranes, biotinylated proteins were bound to streptavidin beads, spun down, and subjected to immunoblotting for AQP2 (WT10, Ch. N220), Plap (AQP2-Plap, TMR-Plap), or AQP1 (K).

To test the effect of forskolin on the conferred water permeability (measured as Pf), the selected clones were subjected to a standard transcellular osmotic water-transport assay (Fig. 6). In AQP1/2-N220-expressing cells, the Pf value of 42.9 ± 2 was not changed by forskolin (42.4 ± 3). Also, in clone K cells, forskolin did not change the Pf value (from 41.6 ± 2 to 44.4 ± 2). In contrast, forskolin increased the Pf value of WT-AQP2-expressing cells 2.8-fold (from 13.4 ± 1 to 37.9 ± 2). As expected, the Pf values for cells that expressed AQP2-Plap (7.3 ± 1 and 11.7 ± 1) or TMR-Plap (5.8 ± 1 and 7.7 ± 2) were not different from that for nontransfected MDCK cells (6.2 ± 0 and 9 ± 1).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6.   Transcellular osmotic water permeability of MDCK cells expressing AQP1 and AQP2 proteins. Native cells (MDCK) or cells of selected MDCK clones expressing Ch. N220, AQP2-Plap, TMR-Plap, WT10, or K cells were grown to confluence on semipermeable filters, incubated with (F) or without (-) forskolin for 2 h, and subjected to a standard transcellular osmotic water transport assay. Obtained water permeability values (Pf ± SE in µm/s) are indicated.

AQP2-mediated increase in AVP-induced endocytosis. With the use of extracellularly supplied FITC-dextran as a fluid-phase marker for endocytosis, it has been shown that in LLC-PK1 cells, heterologous expression of AQP2 but not AQP1 significantly increases the AVP-induced exo- and endocytosis of vesicles (21). We wished to test whether a similar phenomenon occurs for MDCK cells expressing AQP1 or AQP2. Toward this end, native MDCK, clone K (AQP1), and WT10 (AQP2) cells were subjected to the fluid-phase endocytosis assay with or without dDAVP. With native and AQP1- or AQP2-transfected MDCK cells, hardly any intracellular staining was observed without dDAVP, whereas substantial intracellular staining was obtained with AVP treatment; this clearly indicates that AVP induces an increase in exocytosis and, consequently, endocytosis also in MDCK cells (Fig. 7; only WT10 cells). However, at 15 min of treatment with AVP, no difference in the level of endocytosis was observed between native, AQP1-, or AQP2-expressing MDCK cells (only shown for native and WT10 cells), which illustrates that in MDCK cells, neither AQP2 nor AQP1 has an additive effect on AVP-induced endocytosis.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 7.   Fluid-phase endocytosis in native MDCK cells and AQP2-transfected MDCK cells. Native MDCK cells and MDCK cells stably expressing WT10 were grown to confluence on semipermeable filters and incubated for 30 min with or without deamino-8-D-arginine vasopressin (dDAVP) after which 10 mg/ml FITC-dextran was added to the apical compartment for 15 min. The fluid-phase endocytosis in MDCK and WT10 cells is clearly increased with dDAVP but is not different between nontransfected and AQP2-expressing MDCK cells.

Are AQP2-Plap and WT-AQP2 localized in the same intracellular compartment? Without forskolin stimulation, AQP2-Plap and WT-AQP2 are located in intracellular compartments (see Fig. 3). It might be that AQP2-Plap is stored in the same intracellular compartment as WT-AQP2 without stimulation but that it is not redistributed to the apical membrane with forskolin. To investigate this, WT10 cells were transfected with the AQP2-Plap expression construct, and G418-resistant clones were selected. A representative clone was subjected to immunocytochemical analysis using antibodies directed against Plap and AQP2. Because the Plap antibodies only recognize AQP2-Plap whereas the AQP2 antibodies will reveal AQP2-Plap and WT-AQP2, colocalization would be indicated when all sites stained by AQP2 antibodies were also stained with Plap antibodies. CLSM analysis of the cell clone expressing WT-AQP2 and AQP2-Plap, however, revealed many AQP2-stained sites that did not stain for Plap (Fig. 8), which indicates that AQP2-Plap and WT-AQP2 are predominantly located in different vesicles. To determine the localization of AQP2-Plap, MDCK cells expressing this chimera were subjected to immunocytochemistry with antibodies directed against Plap and the endoplasmic reticulum marker protein, protein disulphide isomerase (PDI), the Golgi marker proteins giantin, 58K, or mannosidase II, or the late endosome-lysosomal marker protein LAMP-1. CLSM analysis, however, revealed that AQP2-Plap did not colocalize with any of the marker proteins (data not shown).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 8.   Subcellular localization of AQP2-Plap. A selected subclone of WT10 cells stably expressing AQP2-Plap was grown to confluence on semipermeable filters. Subsequently, the cells were incubated with rabbit anti-Plap (alpha -Plap) antibodies combined with guinea pig anti-AQP2 (alpha -AQP2) antibodies directed against the last 15 amino acids of the COOH-terminal tail. Latter antibodies recognize AQP2-Plap and WT-AQP2. Presence of signals with alpha -AQP2 antibodies that do not stain for AQP2-Plap (shown by arrows) indicates that WT-AQP2 and AQP2-Plap either partly colocalize or do not colocalize at all.

Oligomerization state of AQP2-Plap and WT-AQP2. Using sucrose-gradient centrifugation, we have previously shown that renal AQP2 and WT-AQP2, heterologously expressed in Xenopus oocytes, occur as homotetramers (18). To test whether in MDCK cells a difference in the oligomerization state might explain the different subcellular localization of WT-AQP2 and AQP2-Plap, membrane proteins of the WT10 cell line expressing AQP2-Plap were subjected to a sucrose-gradient sedimentation centrifugation. Immunoblotting of fractions of this gradient for AQP2 revealed that AQP2-Plap peaked in fraction H, whereas WT-AQP2 peaked in fraction I (Fig. 9). By comparison with parallel sedimented marker proteins, these fractions correspond with a molecular mass for AQP2-Plap and WT-AQP2 between 97 and 150 kDa.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 9.   Oligomerization state of WT-AQP2 and AQP2-Plap. Selected subclone of WT10 cells stably expressing AQP2-Plap was grown to confluence on semipermeable filters. Subsequently, membranes were isolated, solubilized in desoxycholate, and sedimented through a 5-17.5% sucrose gradient by centrifugation. Fractions (a-p) were collected and immunoblotted for AQP2. Fractions with peak intensities of the marker proteins BSA (67 kDa), phosphorylase B (97 kDa), yeast alcohol dehydrogenase (150 kDa), and catalase (232 kDa) are indicated by numbers 1-4, respectively. Molecular masses of marker proteins are indicated in kilodaltons at left.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In general, conditions of hypovolemia or hypernatremia stimulate the pituitary to release AVP, which induces the reabsorption of water in renal collecting duct cells in the short term by initiating the redistribution of AQP2 from intracellular vesicles to the apical membrane and in the long term by increasing the expression of AQP2. This process is reversed with the removal of AVP. However, in some conditions this process is not so straightforward. For example, in lithium-treated rats that developed NDI, the expression of AQP2 was reduced and AQP2 was located in intracellular vesicles (29). Treatment of these rats with dDAVP for 7 days redistributed AQP2 to the apical membrane but did not increase the AQP2 expression levels. In contrast, dehydration of such rats for 48 h increased AQP2 expression but did not result in a redistribution of AQP2 to the apical membrane. In addition, in rats that are given a water load after being infused with dDAVP for many days, AQP2 remained localized in the apical membrane of collecting duct cells, but the AQP2 expression level was instantaneously decreased. This process is known as the "vasopressin escape response" (8).

Several studies have reported on the mechanism and proteins involved in AQP2 shuttling. It is believed that the docking and fusion of AQP2-containing vesicles with the apical membrane occurs via specialized integral membrane proteins that are similar to proteins found in neuronal synaptic vesicles (the SNARE hypothesis; see Refs. 39, 40), because vesicle-associated membrane protein 2 (VAMP-2) has been found to colocalize with AQP2 in vesicles of collecting duct cells (15, 26, 36), and the vesicle-targeting receptor syntaxin 4, to which VAMP-2 might bind, has been identified in the apical membrane of the same cells (27). The essential role of an AVP-induced cAMP cascade is exemplified by the findings that in cultured cells, this hormone induces an A-kinase anchoring-protein-dependent tethering of PKA to AQP2-containing vesicles and a RhoA-mediated rearrangement of the cytoskeleton, both of which appear to be essential for AQP2 translocation to the plasma membrane (22, 23). Recent studies in oocytes and collecting duct cells furthermore suggest that AVP might induce the translocation of AQP2 to the apical plasma membrane of inner medullary collecting duct cells by increasing the number of PKA-phosphorylated monomers in AQP2 tetramers, although this might be overruled by alternative regulatory mechanisms (3, 17, 41, 48).

Despite this knowledge on the regulation of the AQP2 shuttling mechanism, hardly any information exists on the parts of AQP2 that are important in these processes or on the proteins that AQP2 interacts with. In transfected MDCK cells, AQP1 is routed as in renal proximal tubules in that the random (i.e., apical and basolateral) localization of AQP1 is not influenced by activation of PKA through forskolin (5). In contrast, forskolin redistributes AQP2 from intracellular vesicles to the apical membrane in transfected MDCK cells (6). These differences in routing and regulation of AQP1 and AQP2 in the same cell indicate that the determinants for this behavior must reside in the protein itself. The aquaporin isoforms differ from one another mainly in the termini. Interestingly, many routing determinants of proteins are found in the COOH termini (e.g., see Refs. 16, 45). Furthermore, the COOH tail of AQP2 contains the PKA phosphorylation site (10), which has been shown to be essential for redistribution of AQP2 to the plasma membrane (9, 20). The present studies were undertaken, therefore, to determine whether the COOH tail of AQP2 was necessary and sufficient for routing of AQP2 to the apical membrane of MDCK cells.

COOH terminus of AQP2 is necessary for routing to apical membrane. To study the role of the AQP2 tail in targeting AQP2 to the apical membrane, we decided to exchange it with the tail of AQP1 for three reasons. First, all aquaporins analyzed are expressed as tetramers (18, 24, 32, 34), a structure that is believed to be essential for stability. This hypothesis is underscored by the steady-state localization and oligomeric states of AQP1/2-N220, AQP2-Plap, and TMR-Plap (see Figs. 3 and 9). Second, in most cells, AQP1 is expressed in vivo in the basolateral and apical membranes in contrast to other AQPs, which are expressed in the basolateral membrane [AQP3 and AQP4 (12)], apical membrane [AQP5 (12)], or vesicles [AQP6 (47)]. Because basolateral and possibly vesicular targeting sequences are thought to be dominant over apical targeting signals, whereas proteins without targeting sequences (and thus delivered by bulk-flow transport) are mostly found in both plasma membranes (i.e., as with AQP1), AQP1 seemed a more sensitive protein to use to determine whether the AQP2 tail contains apical targeting signals. Third, the steady-state localization of expression of AQP1 is similar in proximal tubules and MDCK type I cells and has been well documented in these latter cells (5).

Immunocytochemical (see Fig. 3), biotinylation (see Fig. 5), and water transport (see Fig. 6) analyses of MDCK cells expressing AQP1/2-N220, in which the COOH-terminal tail of AQP1 has been totally exchanged for that of AQP2, revealed that, like AQP2, this chimera was predominantly routed to the apical membrane. However, its regulation was more similar to that of AQP1, because 1) without forskolin stimulation, AQP1/2-N220 and AQP1 were predominantly localized in plasma membranes, whereas WT-AQP2 was mainly stored in intracellular vesicles (see Fig. 3); 2) the forskolin-induced increase in expression in the apical membrane was less than twofold, whereas that of WT-AQP2 increased more than fourfold (see Fig. 5); and 3) forskolin treatment resulted in no more than a 1.5-fold increase in transcellular water permeability, whereas that of WT-AQP2 was increased nearly threefold (see Fig. 6).

In unstimulated renal collecting duct and WT10 cells, AQP2 is located in intracellular vesicles, and an AVP-mediated rise in intracellular cAMP levels, which results in PKA-mediated phosphorylation of AQP2 and other proteins, is thought to initiate redistribution of AQP2 to the apical membrane. In addition, the retention of AQP2-S256A in intracellular vesicles of transfected LLC-PK1 cells on incubation with AVP revealed that PKA phosphorylation of S256 in AQP2 is essential for its redistribution from vesicles to the plasma membrane (9, 20). In this respect, the predominant apical localization in nonstimulated cells of AQP1/2-N220, which contains the intact PKA phosphorylation consensus site of AQP2, is striking. Because AQP2 is thought to be continuously shuttled, irrespective of whether its steady-state localization is at the apical membrane or in intracellular vesicles (17, 19), a possible explanation for the apical localization is that AQP1/2-N220 lacks a portion of AQP2 that is essential for its targeting to storage vesicles. Alternatively, retrieval to the storage vesicles might be mediated by the COOH tail of AQP2, which could be blocked by a segment of the AQP1 protein in the AQP1/2-N220 chimeric protein. This latter explanation is corroborated by the constitutive plasma membrane localization of AQP2 coupled to green fluorescent protein (GFP) at its COOH terminus in transfected LLC-PK1 cells (11).

COOH terminus of AQP2 is not sufficient for routing to apical membrane. Expressed in Heidelberg MDCK type II cells, the TMR-Plap protein is targeted to the basolateral membrane (Muth TR and Caplan MJ, unpublished observations). Because this protein does not contain any intracellular amino acids, a priori it seemed a good reporter protein to investigate whether the AQP2 COOH tail would be sufficient for apical targeting. In MDCK type I cells, however, it appeared to localize to the apical membrane (see Fig. 3A). Such a difference in targeting between different MDCK cell lines has also been encountered for the Na-K-ATPase (30) and underscores the dependence of the cell type on the routing of a particular protein, which is also encountered in vivo (28, 37). Because AQP2-Plap was impaired in its routing to the apical membrane, however, in retrospect this reporter protein appeared to be highly informative. Although some AQP2-Plap was localized in the plasma membrane (see Fig. 4), the majority was retained inside the cell (see Fig. 3B), which indicates that the AQP2 COOH terminus itself is not sufficient for routing to the apical membrane. This chimeric protein was not localized in the endoplasmic reticulum, Golgi complex, late endosomes, or lysosomes and appeared to be mainly localized in vesicles that were different from the WT-AQP2 storage vesicles (see Fig. 8). The apical localization of TMR-Plap, which differs from AQP2-Plap in that it lacks the AQP2 tail, clearly indicates that the AQP2 tail induces the intracellular retention of AQP2-Plap. This retention might be caused by the lack of tetramerization of AQP2-Plap. All aquaporin proteins are expressed as homotetramers, but because the monomer is the functional unit (42), it is unclear why aquaporins exist in a tetrameric complex. From studies on AQP2 mutants encoded in recessive and dominant NDI, it became clear that AQP2 mutants in recessive NDI (which are retained in the endoplasmic reticulum) are not able to oligomerize with WT-AQP2, whereas an AQP2 mutant in dominant NDI (AQP2-E258K, which was retained in the Golgi complex region) was able to form heteroligomers with WT-AQP2 (18). Possibly, WT-AQP2 tetramerizes in the endoplasmic reticulum as do many other proteins (13, 38), and endoplasmic reticulum-retained mutants are precluded from heteroligomerizing with WT-AQP2 because of compartmentalization. Alternatively, and as found for connexin 43, (33), AQP2 homotetramerization may occur in the Golgi complex and might be essential for further routing of AQP2 to the plasma membrane and/or to intracellular vesicles. As shown before for AQP2 expressed in renal tissue and Xenopus oocytes (18), sucrose-gradient centrifugation revealed that WT-AQP2 expressed in MDCK cells sedimented as a homotetramer (see Fig. 9). AQP2-Plap, however, which has a molecular mass of 63 kDa, sedimented as a dimeric complex (see Fig. 9). This sedimentation as a dimer is presumably caused by the Plap ectodomain, because it has been shown that the Plap protein is able to form dimers (1). The retention of the dimeric AQP2-Plap protein in an organelle different from endoplasmic reticulum, Golgi complex, late endosomes, or lysosomes, while tetrameric AQP2 and TMR Plap are routed to the apical membrane, indicates that proper packing of an AQP2 tetramer is essential for its further routing to the apical membrane and/or to intracellular vesicles. Analysis of a chimera in which the AQP2 tail is combined with an aquaporin-unrelated protein that also forms homotetramers might elucidate whether a homotetrameric AQP2 tail would be sufficient for further routing.

In conclusion, analysis of different chimeric AQP2 proteins revealed that the AQP2 tail is essential but not sufficient for routing of AQP2 to the apical membrane. Further studies on AQP1 and AQP2 chimeras in which a shorter part of the AQP1 COOH-terminal tail is exchanged for that of AQP2 might indicate a critical segment determining the apical localization of AQP2. In addition, the apical localization of AQP1/2-N220 in unstimulated MDCK cells indicated that another intracellular part of AQP2, possibly the NH2 terminus, might be necessary for endocytosis and subsequent routing of AQP2 to intracellular storage vesicles. Because trafficking of proteins occurs through interaction with other proteins, elucidation of the AQP2 routing signals will provide tools for identifying AQP2-interacting proteins, which eventually will lead to a better understanding of apical routing and the regulation of shuttling of AQP2 in health and disease.


    ACKNOWLEDGEMENTS

This study was supported by Grant R88-223 from the Netherlands Organization for Scientific Research (NWO) to P. M. T. Deen and from the National Institutes of Health to M. J. Caplan. P. M. T. Deen is a fellow of the Royal Netherlands Academy of Arts and Sciences.


    FOOTNOTES

Address for reprint requests and other correspondence: P. M. T. Deen, 162 Dept. of Cell Physiology, UMC St. Radboud, PO Box 9101, 6500 HB Nijmegen, The Netherlands (E-mail: peterd{at}sci.kun.nl).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published August 30, 2001; 10.1152/ajprenal.00168.2001

Received 29 May 2001; accepted in final form 21 September 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aridor, M, and Balch WE. Integration of endoplasmic reticulum signaling in health and disease. Nat Med 5: 745-751, 1999.

2.   Arreaza, G, and Brown DA. Sorting and intracellular trafficking of a glycosylphosphatidylinositol-anchored protein and two hybrid transmembrane proteins with the same ectodomain in Madin-Darby canine kidney epithelial cells. J Biol Chem 270: 23641-23647, 1995.

3.   Christensen, BM, Zelenina M, Aperia A, and Nielsen S. Localization and regulation of PKA-phosphorylated AQP2 in response to V2-receptor agonist/antagonist treatment. Am J Physiol Renal Physiol 278: F29-F42, 2000.

4.   Deen, PMT, Croes H, van Aubel RA, Ginsel LA, and van Os CH. Water channels encoded by mutant aquaporin-2 genes in nephrogenic diabetes insipidus are impaired in their cellular routing. J Clin Invest 95: 2291-2296, 1995.

5.   Deen, PMT, Nielsen S, Bindels RJM, and van Os CH. Apical and basolateral expression of Aquaporin-1 in transfected MDCK and LLC-PK cells and functional evaluation of their transcellular osmotic water permeabilities. Pflügers Arch 433: 780-787, 1997.

6.   Deen, PMT, Rijss JPL, Mulders SM, Errington RJ, van Baal J, and van Os CH. Aquaporin-2 transfection of Madin-Darby canine kidney cells reconstitutes vasopressin-regulated transcellular osmotic water transport. J Am Soc Nephrol 8: 1493-1501, 1997.

7.   Deen, PMT, Verdijk MAJ, Knoers NVAM, Wieringa B, Monnens LAH, van Os CH, and van Oost BA. Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science 264: 92-95, 1994.

8.   Ecelbarger, CA, Chou CL, Lee AJ, Digiovanni SR, Verbalis JG, and Knepper MA. Escape from vasopressin-induced antidiuresis: role of vasopressin resistance of the collecting duct. Am J Physiol Renal Physiol 274: F1161-F1166, 1998.

9.   Fushimi, K, Sasaki S, and Marumo F. Phosphorylation of serine 256 is required for cAMP-dependent regulatory exocytosis of the aquaporin-2 water channel. J Biol Chem 272: 14800-14804, 1997.

10.   Fushimi, K, Uchida S, Hara Y, Hirata Y, Marumo F, and Sasaki S. Cloning and expression of apical membrane water channel of rat kidney collecting tubule. Nature 361: 549-552, 1993.

11.   Gustafson, CE, Levine S, Katsura T, McLaughlin M, Aleixo MD, Tamarappoo BK, Verkman AS, and Brown D. Vasopressin regulated trafficking of a green fluorescent protein-aquaporin 2 chimera in LLC-PK1 cells. Histochem Cell Biol 110: 377-386, 1998.

12.   Hamann, S, Zeuthen T, La Cour M, Nagelhus EA, Ottersen OP, Agre P, and Nielsen S. Aquaporins in complex tissues: distribution of aquaporins 1-5 in human and rat eye. Am J Physiol Cell Physiol 274: C1332-C1345, 1998.

13.   Hurtley, SM, and Helenius A. Protein oligomerization in the endoplasmic reticulum. Annu Rev Cell Biol 5: 277-307, 1989.

14.   Jennings, ML. Monoclonal antibody against red blood cell CHIP28 protein (Abstract). J Gen Physiol 100: 21A, 1992.

15.   Jo, I, Harris HW, Amendt Raduege AM, Majewski RR, and Hammond TG. Rat kidney papilla contains abundant synaptobrevin protein that participates in the fusion of antidiuretic hormone-regulated water channel-containing endosomes in vitro. Proc Natl Acad Sci USA 92: 1876-1880, 1995.

16.   Jones, BG, Thomas L, Molloy SS, Thulin CD, Fry MD, Walsh KA, and Thomas G. Intracellular trafficking of furin is modulated by the phosphorylation state of a casein kinase II site in its cytoplasmic tail. EMBO J 14: 5869-5883, 1995.

17.   Kamsteeg, EJ, Heijnen I, van Os CH, and Deen PMT The subcellular localization of an aquaporin-2 tetramer depends on the stoichiometry of phosphorylated and nonphosphorylated monomers. J Cell Biol 151: 919-930, 2000.

18.   Kamsteeg, EJ, Wormhoudt TA, Rijss JPL, van Os CH, and Deen PMT An impaired routing of wild-type aquaporin-2 after tetramerization with an aquaporin-2 mutant explains dominant nephrogenic diabetes insipidus. EMBO J 18: 2394-2400, 1999.

19.   Katsura, T, Ausiello DA, and Brown D. Direct demonstration of aquaporin-2 water channel recycling in stably transfected LLC-PK1 epithelial cells. Am J Physiol 39: F548-F553, 1996.

20.   Katsura, T, Gustafson CE, Ausiello DA, and Brown D. Protein kinase A phosphorylation is involved in regulated exocytosis of aquaporin-2 in transfected LLC-PK1 cells. Am J Physiol 41: F816-F822, 1997.

21.   Katsura, T, Verbavatz JM, Farinas J, Ma T, Ausiello DA, Verkman AS, and Brown D. Constitutive and regulated membrane expression of aquaporin 1 and aquaporin 2 water channels in stably transfected LLC-PK1 epithelial cells. Proc Natl Acad Sci USA 92: 7212-7216, 1995.

22.   Klussmann, E, and Rosenthal W. Role and identification of protein kinase A anchoring proteins in vasopressin-mediated aquaporin-2 translocation. Kidney Int 60: 446-449, 2001.

23.   Klussmann, E, Tamma G, Lorenz D, Wiesner B, Maric K, Hofmann F, Aktories K, Valenti G, and Rosenthal W. An inhibitory role of rho in the vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 276: 20451-20457, 2001.

24.   Konig, N, Zampighi GA, and Butler PJG Characterisation of the major intrinsic protein (MIP) from bovine lens fibre membranes by electron microscopy and hydrodynamics. J Mol Biol 265: 590-602, 1997.

25.   Kuwahara, M, Iwai K, Uchida S, Gu Y, Terada Y, Sato K, Asai T, Bichet D, Sasaki S, and Marumo F. A novel mutation in the aquaporin-2 (AQP2) gene causing autosomal dominant nephrogenic diabetes insipidus (Abstract). J Am Soc Nephrol 9: 390A, 1998.

26.   Liebenhoff, U, and Rosenthal W. Identification of Rab3-, Rab5a- and synaptobrevin II-like proteins in a preparation of rat kidney vesicles containing the vasopressin-regulated water channel. FEBS Lett 365: 209-213, 1995.

27.   Mandon, B, Chou CL, Nielsen S, and Knepper MA. Syntaxin-4 is localized to the apical plasma membrane of rat renal collecting duct cells: possible role in aquaporin-2 trafficking. J Clin Invest 98: 906-913, 1996.

28.   Marinelli, RA, Pham L, Agre P, and LaRusso NF. Secretin promotes osmotic water transport in rat cholangiocytes by increasing aquaporin-1 water channels in plasma membrane: evidence for a secretin-induced vesicular translocation of aquaporin-1. J Biol Chem 272: 12984-12988, 1997.

29.   Marples, D, Christensen S, Christensen EI, Ottosen PD, and Nielsen S. Lithium-induced downregulation of aquaporin-2 water channel expression in rat kidney medulla. J Clin Invest 95: 1838-1845, 1995.

30.   Mays, RW, Siemers KA, Fritz BA, Lowe AW, van Meer G, and Nelson WJ. Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells. J Cell Biol 130: 1105-1115, 1995.

31.   Mulders, SM, Bichet DG, Rijss JPL, Kamsteeg EJ, Arthus MF, Lonergan M, Fujiwara M, Morgan K, Leijendekker R, van der Sluijs P, van Os CH, and Deen PMT An aquaporin-2 water channel mutant which causes autosomal dominant nephrogenic diabetes insipidus is retained in the Golgi complex. J Clin Invest 102: 57-66, 1998.

32.   Murata, K, Mitsuoka K, Hirai T, Walz T, Agre P, Heymann JB, Engel A, and Fujiyoshi Y. Structural determinants of water permeation through aquaporin-1. Nature 407: 599-605, 2000.

33.   Musil, LS, and Goodenough DA. Multisubunit assembly of an integral plasma membrane channel protein, gap junction connexin 43, occurs after exit from the ER. Cell 74: 1065-1077, 1993.

34.   Neely, JD, Christensen BM, Nielsen S, and Agre P. Heterotetrameric composition of aquaporin-4 water channels. Biochemistry 38: 11156-11163, 1999.

35.   Nielsen, S, Chou CL, Marples D, Christensen EI, Kishore BK, and Knepper MA. Vasopressin increases water permeability of kidney collecting duct by inducing translocation of aquaporin-CD water channels to plasma membrane. Proc Natl Acad Sci USA 92: 1013-1017, 1995.

36.   Nielsen, S, Marples D, Birn H, Mohtashami M, Dalby NO, Trimble W, and Knepper MA. Expression of VAMP2-like protein in kidney collecting duct intracellular vesicles: colocalization with aquaporin-2 water channels. J Clin Invest 96: 1834-1844, 1995.

37.   Nielsen, S, Smith BL, Christensen EI, and Agre P. Distribution of the aquaporin CHIP in secretory and resorptive epithelia and capillary endothelia. Proc Natl Acad Sci USA 90: 7275-7279, 1993.

38.   Rose, JK, and Doms RW. Regulation of protein export from the endoplasmic reticulum. Annu Rev Cell Biol 4: 257-288, 1988.

39.   Rothman, JE. The protein machinery of vesicle budding and fusion. Protein Sci 5: 185-194, 1996.

40.   Sollner, T, Whiteheart SW, Brunner M, Erdjument Bromage H, Geromanos S, Tempst P, and Rothman JE. SNAP receptors implicated in vesicle targeting and fusion (Comments). Nature 362: 318-324, 1993.

41.   Valenti, G, Procino G, Carmosino M, Frigeri A, Mannucci R, Nicoletti I, and Svelto M. The phosphatase inhibitor okadaic acid induces AQP2 translocation independently from AQP2 phosphorylation in renal collecting duct cells. J Cell Sci 113: 1985-1992, 2000.

42.   Van Hoek, AN, Hom ML, Luthjens LH, de Jong MD, Dempster JA, and van Os CH. Functional unit of 30 kDa for proximal tubule water channels as revealed by radiation inactivation. J Biol Chem 266: 16633-16635, 1991.

43.   van Os, CH, and Deen PMT Aquaporin-2 water channel mutations causing nephrogenic diabetes insipidus. Proc Assoc Am Physicians 110: 395-400, 1998.

44.   Wade, JB, Stetson DL, and Lewis SA. ADH action: evidence for a membrane shuttle mechanism. Ann NY Acad Sci 372: 106-117, 1981.

45.   Waters, MG, and Pfeffer SR. Membrane tethering in intracellular transport. Curr Opin Cell Biol 11: 453-459, 1999.

46.   Yamamoto, T, Sasaki S, Fushimi K, Ishibashi K, Yaoita E, Kawasaki K, Marumo F, and Kihara I. Vasopressin increases AQP-CD water channel in apical membrane of collecting duct cells in Brattleboro rats. Am J Physiol Cell Physiol 268: C1546-C1551, 1995.

47.   Yasui, M, Kwon TH, Knepper MA, Nielsen S, and Agre P. Aquaporin-6: an intracellular vesicle water channel protein in renal epithelia. Proc Natl Acad Sci USA 96: 5808-5813, 1999.

48.   Zelenina, M, Christensen BM, Palmer J, Nairn AC, Nielsen S, and Aperia A. Prostaglandin E2 interaction with AVP: effects on AQP2 phosphorylation and distribution. Am J Physiol Renal Physiol 278: F388-F394, 2000.


Am J Physiol Renal Fluid Electrolyte Physiol 282(2):F330-F340
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
M. Boone, M. Kortenoeven, J. H. Robben, and P. M. T. Deen
Effect of the cGMP pathway on AQP2 expression and translocation: potential implications for nephrogenic diabetes insipidus
Nephrol. Dial. Transplant., August 8, 2009; (2009) gfp409v1.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. S. P. Wildman, M. Boone, C. M. Peppiatt-Wildman, A. Contreras-Sanz, B. F. King, D. G. Shirley, P. M. T. Deen, and R. J. Unwin
Nucleotides Downregulate Aquaporin 2 via Activation of Apical P2 Receptors
J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1480 - 1490.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. T. Cliffe, J. M. Kramer, K. Hussain, J. H. Robben, E. K. de Jong, A. P. de Brouwer, E. Nibbeling, E.-J. Kamsteeg, M. Wong, J. Prendiville, et al.
SLC29A3 gene is mutated in pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome and interacts with the insulin signaling pathway
Hum. Mol. Genet., June 15, 2009; 18(12): 2257 - 2265.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
B. W.M. van Balkom, M. Boone, G. Hendriks, E.-J. Kamsteeg, J. H. Robben, H. C. Stronks, A. van der Voorde, F. van Herp, P. van der Sluijs, and P. M.T. Deen
LIP5 Interacts with Aquaporin 2 and Facilitates Its Lysosomal Degradation
J. Am. Soc. Nephrol., May 1, 2009; 20(5): 990 - 1001.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. H. Robben, M. Sze, N. V. Knoers, P. Eggert, P. Deen, and D. Muller
Relief of Nocturnal Enuresis by Desmopressin Is Kidney and Vasopressin Type 2 Receptor Independent
J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1534 - 1539.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. P. Shi, X. R. Cao, J. Qu, K. A. Volk, P. Kirby, R. A. Williamson, J. B. Stokes, and B. Yang
Nephrogenic diabetes insipidus in mice caused by deleting COOH-terminal tail of aquaporin-2
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1334 - F1344.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. H. Robben, M. Sze, N. V. A. M. Knoers, and P. M. T. Deen
Functional rescue of vasopressin V2 receptor mutants in MDCK cells by pharmacochaperones: relevance to therapy of nephrogenic diabetes insipidus
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F253 - F260.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Li, S. Shaw, E.-J. Kamsteeg, A. Vandewalle, and P. M.T. Deen
Development of Lithium-Induced Nephrogenic Diabetes Insipidus Is Dissociated from Adenylyl Cyclase Activity
J. Am. Soc. Nephrol., April 1, 2006; 17(4): 1063 - 1072.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. de Mattia, P. J.M. Savelkoul, E.-J. Kamsteeg, I. B.M. Konings, P. van der Sluijs, R. Mallmann, A. Oksche, and P. M.T. Deen
Lack of Arginine Vasopressin-Induced Phosphorylation of Aquaporin-2 Mutant AQP2-R254L Explains Dominant Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol., October 1, 2005; 16(10): 2872 - 2880.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen
Characterization of vasopressin V2 receptor mutants in nephrogenic diabetes insipidus in a polarized cell model
Am J Physiol Renal Physiol, August 1, 2005; 289(2): F265 - F272.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. de Mattia, P. J.M. Savelkoul, D. G. Bichet, E.-J. Kamsteeg, I. B.M. Konings, N. Marr, M.-F. Arthus, M. Lonergan, C. H. van Os, P. van der Sluijs, et al.
A novel mechanism in recessive nephrogenic diabetes insipidus: wild-type aquaporin-2 rescues the apical membrane expression of intracellularly retained AQP2-P262L
Hum. Mol. Genet., December 15, 2004; 13(24): 3045 - 3056.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. W. M. van Balkom, M. P. J. Graat, M. van Raak, E. Hofman, P. van der Sluijs, and P. M. T. Deen
Role of cytoplasmic termini in sorting and shuttling of the aquaporin-2 water channel
Am J Physiol Cell Physiol, February 1, 2004; 286(2): C372 - C379.
[Abstract] [Full Text]


Home page
JCBHome page
E.-J. Kamsteeg, D. G. Bichet, I. B.M. Konings, H. Nivet, M. Lonergan, M.-F. Arthus, C. H. van Os, and P. M.T. Deen
Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus
J. Cell Biol., December 8, 2003; 163(5): 1099 - 1109.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. J. Caplan
How megalin finds its way: identification of a novel apical sorting motif. Focus on "Identification of an apical sorting determinant in the cytoplasmic tail of megalin"
Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1101 - C1104.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Brown
The ins and outs of aquaporin-2 trafficking
Am J Physiol Renal Physiol, May 1, 2003; 284(5): F893 - F901.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
N. Marr, D. G. Bichet, S. Hoefs, P. J. M. Savelkoul, I. B. M. Konings, F. de Mattia, M. P. J. Graat, M.-F. Arthus, M. Lonergan, T. M. Fujiwara, et al.
Cell-Biologic and Functional Analyses of Five New Aquaporin-2 Missense Mutations that Cause Recessive Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol., September 1, 2002; 13(9): 2267 - 2277.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
N. Marr, D. G Bichet, M. Lonergan, M.-F. Arthus, N. Jeck, H. W. Seyberth, W. Rosenthal, C. H. van Os, A. Oksche, and P. M. T. Deen
Heteroligomerization of an Aquaporin-2 mutant with wild-type Aquaporin-2 and their misrouting to late endosomes/lysosomes explains dominant nephrogenic diabetes insipidus
Hum. Mol. Genet., April 1, 2002; 11(7): 779 - 789.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/F330    most recent
0168.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deen, P. M. T.
Right arrow Articles by Caplan, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deen, P. M. T.
Right arrow Articles by Caplan, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online