AJP - Renal Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 282: F559-F576, 2002; doi:10.1152/ajprenal.00320.2001
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (90)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stockand, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stockand, J. D.
Vol. 282, Issue 4, F559-F576, April 2002

INVITED REVIEW
New ideas about aldosterone signaling in epithelia

James D. Stockand

Department of Physiology, University of Texas Health Science Center at San Antonio, San Antonio Texas 78229-3900


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

The systemic actions of aldosterone are well documented; however, in comparison, our understanding of the cellular and molecular mechanisms by which aldosterone orchestrates these actions is rudimentary. Aldosterone exerts most of its physiological actions by modifying gene expression. It is now apparent that aldosterone represses almost as many genes as it induces. Several aldosterone-sensitive genes, including serum and glucocorticoid-inducible kinase (sgk) and small, monomeric Kirsten Ras GTP-binding protein (Ki-ras) have recently been identified. The molecular mechanisms and elements bestowing corticosteroid sensitivity on these and many other genes are becoming clear. Induction of Ki-Ras and Sgk is necessary and sufficient for some portion of aldosterone action in epithelia. These two signaling factors are components of a converging pathway with phosphatidylinositol 3-kinase positioned between them that enables both stabilizing the epithelial Na+ channel (ENaC) in the open state as well as increasing the number of ENaC in the apical membrane. This aldosterone-induced signaling pathway contains many potential sites for feedback regulation and cross talk from other cascades and potentially impinges directly on the activity of transport proteins and/or cellular differentiation to modify electrolyte transport.

mineralocorticoid; Sgk; Ki-Ras; corticosteroid hormone-induced factor; sodium-potassium-adenosinetriphosphatase; NEDD4; epithelial sodium channel; epithelial; hypertension; transport; sodium absorption; potassium secretion


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

THE ADRENAL CORTICOSTEROID HORMONE aldosterone plays a pivotal role in homeostasis. This is particularly apparent when one considers that dysfunctional regulation of aldosterone secretion and inappropriate activity of aldosterone effectors are involved in many human diseases associated with electrolyte and fluid imbalance.1 In addition, aldosterone has attracted much attention lately as a possible mediator of pathological heart remodeling (129). Tissues targeted by aldosterone include cardiac fibroblasts and myocytes, neurons and their support cells, smooth muscle, endothelial cells, and adipose tissue (see Refs. 58, 70, 176, and 177 for further reference). Electrically tight epithelial monolayers, such as the renal distal tubule and collecting duct system, distal colon, and those in salivary glands, are considered classic aldosterone target tissues. Aldosterone action in these tissues, as well as in toad bladder and frog skin, has been the focus of much important investigation over the last half-century. Thus the natriferic and kaliuretic effects of aldosterone have long been established. In this regard, aldosterone, acting as a mineralocorticoid, targets epithelial cells to increase Na+ (re)absorption and K+ secretion. It is striking that all known forms of Mendelian hypertension in humans result from aberrant regulation of aldosterone or its downstream effectors that implement aldosterone's signal in sodium homeostasis (reviewed in Refs. 68 and 97). The interested reader has many excellent contemporary review articles available for a discussion of the effects of aldosterone at the systemic, tissue, cellular, and molecular levels and for a history of important findings in this field (51, 52, 58, 70, 176, 177). The scope of the present review is to summarize and discuss the results of numerous recent studies investigating the cellular and molecular mechanisms of aldosterone action. The review focuses primarily on the intracellular signal transduction pathways initiated by aldosterone and the relationship of aldosterone-sensitive signaling factors to each other and their final effectors, including the luminal epithelial Na+ channel (ENaC), secretory K+ channel, and serosal Na+/K+-ATPase. Only advances in our understanding of the classic genomic mechanism of aldosterone action in epithelial cells are considered. Because several comprehensive reviews have been published recently in this journal (12, 51, 139, 177), background concepts underpinning regulation of ENaC and other aldosterone-sensitive effectors, as well as mineralocorticoid specificity and the actions and regulation of nuclear receptors and their accessory proteins, are explicitly not (re-)covered in great detail.


    ALDOSTERONE REGULATES GENE EXPRESSION
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

Aldosterone and other adrenal corticosteroids exert many of their physiological actions through modulation of gene expression. This results in a substantial lag period (~0.5-1 h) preceding overt changes in cellular activity. Similar to other steroids, aldosterone also affects cellular activity through faster (<1 min), nongenomic actions mediated presumably by distinct plasma membrane/cytosolic receptors. Nongenomic actions, while important, are for the most part beyond the focus of the present review. (The interested reader is referred to Refs. 51, 57, 70, 137, and 188 for further development of this topic.)

Molecular Mechanisms of Action

Inhibitors of transcription and translation, as well as other experimental maneuvers, have been employed to definitively demonstrate that induction of gene expression is necessary, in part, for aldosterone action in epithelia (reviewed in Refs. 51, 137, 176, and 177). However, the contrary view, that gene repression is needed, in part, for aldosterone action, has been more difficult to demonstrate. This has arisen primarily because genes negatively influenced by aldosterone have not been well described in the past. Recently, a number of aldosterone-repressed transcripts have been identified (135, 154). It is now apparent that aldosterone represses almost as many genes as it induces. It follows, then, that aldosterone-sensitive gene repression plays an important but yet undefined role in the final cellular response.

Aldosterone, as well as other corticosteroid hormones, binds cytosolic steroid receptors that translocate to the nucleus in a ligand-dependent manner (reviewed in Refs. 51, 57, and 58). Once in the nucleus, corticosteroid receptors function as transcription factors through interaction with genomic DNA at a steroid-response element (SRE; consensus sequence AGAACAnnnTGTTCT). Aldosterone is a ligand for two distinct but similar types of nuclear receptors: the mineralocorticoid receptor (MR) and the glucocorticoid receptor (alpha -isoform; GRalpha ). Glucocorticoids, as well, are ligands for these receptors. It is well recognized that circulating levels of glucocorticoids are in excess of those of mineralocorticoids by 100- to 1,000-fold. In contrast to GR, which is ubiquitous, MR expression is confined primarily to epithelial cells. Thus circulating levels of corticosteroids and receptor expression patterns often define the cellular specificity of the glucocorticoid response mediated by GR. The cellular mechanism(s) specifying a mineralocorticoid response are more complex, considering that all cells expressing MR also express GR (reviewed in Refs. 51, 57, and 58).

Corticosteroids have similar affinities for both MR and GR, although, on- and off-rates, ligand-receptor half-lives, association with accessory proteins, and trans-activating potential differ. The ligand-independent GRbeta acts as a dominant negative regulator of both GRalpha and MR (7). The physiological significance of GRbeta to aldosterone signaling is unclear at this time. Both MR and GR form homo- and heterodimers with each other and other accessory factors. It has been speculated that unique receptor complexes may target distinct cis-acting elements (99, 172). Although it is commonly accepted that MR and GR are capable of mediating trans-activation through a common SRE, the concept that these receptors also target unique cis-acting elements remains quite controversial.

A novel MR splice variant that lacks a ligand-binding domain (MRDelta 5,6) has recently been described (196). MRDelta 5,6 is highly expressed (relative to other tissues) in the kidney. MRDelta 5,6 forms dimers with both MR and GR, with dimers binding DNA at the SRE and trans-activating in a ligand-independent manner. Thus MRDelta 5,6 appears to have the opposite function of GRbeta . It has been hypothesized that this novel MR variant plays a role in defining receptor specificity; however, the role of MRDelta 5,6 in a mineralocorticoid-specific response remains somewhat ambiguous, considering that it potentiates both MR and GR trans-activating ability to a similar degree. Several MR mRNA species, some of which encode unique proteins, have now been identified in various mammalian tissues (23, 90, 93, 195, 201). It is likely that all of these transcripts arise from differential splicing or alternative transcription start sites within a common gene. A good understanding of the physiological significance of each type of MR isoform remains elusive at this time. However, if the transcripts encoding unique proteins result in MR isoforms with different specificities for corticosteroids, accessory proteins, and SRE with distinct trans-acting capabilities, then they could play a role in defining specificity. Distinct promotors also have been reported to drive MR expression in a tissue-specific manner (93). These promotors enable MR levels in disparate tissues to be varied independently of each other. In addition, nuclear corticosteroid receptors are modified at the posttranslation level. Indeed, cAMP signaling via protein kinase A leads to phosphorylation of MR, with phosphorylated receptors having greater trans-activating potential compared with unmodified receptors (108). Thus further investigation of the function, posttranslational regulation, and transcriptional control of MR isoforms is needed to gain more precise insight into the physiological role played by each during a mineralocorticoid response.

Two distinct molecular mechanisms as depicted in Fig. 1 are widely accepted to define the actions of nuclear receptors on gene expression: 1) the classic mechanisms involving trans-activation and trans-repression via interaction with cognate DNA-binding sites, such as SRE and 2) mechanisms of transcription interference and synergy mediated by protein-protein interactions between corticosteroid receptors and other trans-acting factors. In contrast to direct trans-activation and repression, the corticosteroid receptor does not need to physically bind DNA in the latter cases, although this mechanism does impinge on gene expression. The relevance of these mechanisms of action to aldosterone signaling is considered below.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Molecular mechanisms for steroid receptor regulation of gene expression. The figure shows idealized schemes for both the classic mechanisms (left) involving trans-activation and trans-repression at steroid response elements (SREs) as well as the novel transcription synergy and interference mechanisms (right) mediated by protein-protein interactions independently of steroid response elements. hSRE, half-site; nSRE, negative SRE; cis, cis-acting element other than SRE; filled red circle, ligand-corticosteroid receptor complex; blue circle, trans-acting factor other than corticosteroid receptors; solid and crossed arrows, gene expression and repression, respectively. [From Booth et al. (26a)]

Trans-activation. Both MR and GR modulate gene expression through the canonical pentadecamer SRE, with the monomers of the dimeric receptor complex binding each "half-site" (hSRE). The finding that MR and GR have distinct effects on cognition and learning mediated by the hippocampus supports the possibility of unique MR and GR cis-acting elements or that unique protein-protein interactions involving these distinct receptors convey different signals (43, 44). MR and GR also have distinguishable actions in the colon (9, 27, 39, 181). Further support for unique cis-acting elements comes from the study of model systems. In one model system, MR has only 5% of the trans-acting activity of GR on the mouse mammary tumor virus promotor in CV-1 cells (4, 140). However, these results may just as easily reflect findings that trans-activation in response to MR and GR is ligand dependent and influenced differentially by numerous accessory factors (51, 137). The most direct support for MR and GR serving distinct functions comes from mice genetically engineered to be devoid of one receptor type or the other or to express a receptor mutant with a partial loss of function (16, 17, 40, 72, 78, 134; see Trans-repression). From these animals, it is clear that GR influences lung maturation, response to stress, metabolism, and inflammation as well as immune responses. MR, on the other hand, primarily mediates a mineralocorticoid response in epithelia to maintain electrolyte and fluid balance.

The cis-acting elements responsive to corticosteroid receptors for many aldosterone-induced genes have now been identified. A corticosteroid-sensitive gene encodes serum and glucocorticoid-inducible kinase (Sgk; 36, 45, 104, 186, 187). Presently, three isoforms of Sgk (Sgk1, Sgk2, and Sgk3) are recognized, of which only Sgk1 is corticosteroid sensitive (reviewed in Ref. 124). Thus, for simplicity, Sgk1 is referred to as Sgk. The promotor region of the sgk gene contains a classic but imperfect pentadecameric cis-acting SRE (AGGACAgaaTGTTCT; 104, 187). In mammary epithelia, this element is trans-activated in response to dexamethasone signaling (104, 187). Indirect evidence from numerous epithelia, including the renal distal nephron and distal colon, infers that this cis-element is also responsive to aldosterone via MR (18, 28, 36, 45, 101, 151). That glucocorticoids and aldosterone via GR and MR trans-activate sgk in distinct tissues through a common SRE suggests that both types of steroids may initiate a cellular response mediated by a common signaling pathway or one that contains many common signaling elements. Thus GR and MR likely have, at least partially, overlapping functions in epithelia expressing both receptors. This possibility, however, remains quite controversial. Functional redundancy is supported, nevertheless, by findings showing that aldosterone via MR and glucocorticoids via GR induce expression of many of the same genes and that the widely expressed GR is sometimes capable of complementing MR dysfunction or eliciting a mineralocorticoid response, especially in disease states (22, 37, 53, 58, 75, 97, 137).

A corticosteroid-sensitive gene also encodes the alpha -subunit of ENaC (42, 114). A classic but slightly imperfect SRE (AGAACAgaaTGTCCT) was recently identified as sufficient and necessary for trans-activation of the human and rat alpha -ENaC promotors in renal, lung, salivary, and colonic epithelial cell lines (98, 114, 142, 184, 197). This cis-acting element is responsive to MR and GR, with no overt specificity to either glucocorticoids or aldosterone. Taken together, these findings are consistent with those showing alpha -ENAC to be an aldosterone-induced transcript in renal epithelia but a glucocorticoid-induced transcript in lung epithelia (42, 114, 142).

The gene encoding the alpha 1-subunit of the Na+/K+-ATPase is also sensitive to corticosteroids (24, 52, 88, 128). The nucleic acid sequence AGTCACAGGAGGCACTCTGAGAGCA located in the 5'-flanking region of the human Na+/K+-ATPase alpha 1 gene functions as a cis-acting element responsive to both MR and GR (89). Although this sequence is distinct from the common SRE thought to mediate most GR and MR signaling, there are some similarities. It is believed that this newly identified SRE is influenced by GR/MR through a classic mechanism.

The genes encoding many small, monomeric GTP-binding proteins in the Ras family, such as Ha-Ras and Ki-Ras, are controlled by corticosteroids via regulation of transcription (127, 149, 154, 165). A recently identified family of GTP-binding proteins (DexRas) that share much sequence identity and many functional domains with Ras are also regulated at the level of transcription by glucocorticoids (81, 173). It is unclear at this time whether aldosterone affects DexRas levels and whether this protein plays a prominent role in mineralocorticoid signaling; however, DexRas is expressed in the kidney, where it is positively regulated by glucocorticoids (81). The cis-acting element modulating dexras expression has not yet been identified. However, more is known about those modulating Ha-ras and Ki-ras. Several cis-acting elements within the human, mouse, and rat Ha-ras and Ki-ras genes responsive to glucocorticoids have now been identified (121, 127, 149, 165). Although it is clear that the glucocorticoid-GR complex trans-activates ras expression in epidermal and mammary epithelial cells through these elements, it remains to be determined whether these elements function in other epithelia and whether aldosterone also modulates transcription at these sites. The promiscuity between GR and MR signaling, however, suggests that aldosterone likely affects Ras expression through these elements. Indeed, work from the Verrey laboratory (154, 155) on amphibian distal nephron epithelia demonstrates that aldosterone signaling through MR and/or GR results in a similar increase in Ki-ras transcript levels. Unpublished data from our laboratory and from that of Fuller (Fuller P, personal communication) show Ki-ras to be regulated at the level of transcription by aldosterone via MR in rodent heart and colon, respectively. These findings are also consistent with these cis-acting elements playing an important role during a mineralocorticoid response in epithelia.

Genes encoding gamma -fibrinogen, vitellogenin, and A-Raf are regulated at the level of transcription by glucocorticoids (3, 95, 136, 145, 166, 183). The effect of aldosterone on these genes is not presently known, and no information suggests that they are important to mineralocorticoid action; however, much may be learned about aldosterone signaling by considering the glucocorticoid paradigm. The cis-acting elements mediating glucocorticoid responsiveness for vitellogenin and gamma -fibrinogen are similar to those described for Ha-ras and Ki-ras (3, 96, 117, 118, 127, 149, 165). They are hSRE (containing variants of either AGAACA or TGTTCT) that lie near consensus sequences defining half- and full sites for other transcription factors and/or accessory proteins. As indicated in Fig. 1, the GR, after forming heterodimers with other trans-acting factors/accessory proteins, which themselves bind DNA, binds to these hSREs. Recent work demonstrates that the accessory protein XGRAF (Xenopus laevis GR accessory factor) forms a dimer with GR, with the GR-XGRAF complex binding DNA at both a hSRE and the nearby cognate XGRAF DNA-binding site (GAGTTAA; Refs. 96, 117, and 118). Binding of the GR-XGRAF heterodimer leads to trans-activation of the gamma -fibrinogen gene through a classic mechanism. It is possible that such a molecular mechanism, albeit with different accessory factors and/or other trans-acting factors, is utilized by GR to activate ras and vitellogenin. Although aldosterone clearly induces ras expression via MR in some tissues (155; Meszaros JG and Stockand JD, unpublished observations; Fuller P, personal communication), it is not known whether MR is capable of employing such a molecular mechanism of action involving hSREs. There are three isoforms of Raf kinase: A-Raf, B-Raf, and C-Raf [also called Raf-1 (103)]. B- and C-Raf phosphorylate mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) kinase (MEK) to activate the MAPK-ERK cascade. The function of A-Raf is less well documented. The promotor regions of the human and mouse A-raf genes contain functional SREs that are trans-activated by the dexamethasone-GR complex in HeLa cells (94, 95). The functional cis-element responsive to GR in this gene is two hSREs situated near each other and close to a cis-acting element responsive to the thyroid receptor. A-raf is expressed predominately in urogenital tissues, including the kidney (164). It is exciting that A-Raf is one primary effector of Ras signaling proteins, including Ki-Ras, which is encoded by a recently identified aldosterone-induced gene (154, 161).

Trans-repression. Glucocorticoids via GR repress expression of a host of genes. Recent studies also have identified several aldosterone-repressed genes and proteins (92, 135, 154). Compared with induction, less is known about the molecular mechanisms of direct gene repression in response to corticosteroids. Almost nothing is known about MR-mediated repression, including a complete paucity of information regarding cis-acting elements and accessory proteins involved in this action. The term "negative"-SRE (nSRE) is used here to define the cis-acting element that directly mediates trans-repression in response to glucocorticoid signaling via GR.

GR interacts directly with the 5'-ATTTTTGTCAATGGACAAGTCATAAGAA-3' nSRE sequence in the promotor region of the corticotropin-releasing hormone gene to trans-repress cAMP-activated expression of this gene (105, 106). A cis-acting element in the promotor of the prolactin gene that is bound by ligand-activated GR also has been identified (141). This element exerts positive tonic regulation of prolactin and heterologous promotors in the absence of liganded GR. Tonic regulation is suppressed in the presence of ligand-activated GR. In a study involving both in vivo and in vitro work, Burke and colleagues (30) mapped the cis-acting element bound by GR during trans-repression of the bovine vasopressin gene. The nSRE in the gene encoding proopiomelanocortin (POMC; 5'-GGAAGGTCACGTCCA-3') has also been identified (35, 48, 49). Compared with SRE involved in trans-activation, which bind GR dimers, the nSRE in POMC simultaneously binds a GR homodimer and monomer in a cooperative manner. It is not presently known how the novel arrangement of three GR around this nSRE affects transcription machinery and other factors to repress expression. The effects of MR on these nSREs have not been studied, and thus it remains to be determined whether MR is capable of modulating expression via these sorts of nSREs.

As of the writing of this review, no nSRE definitively responsive to MR has been reported, and it is unclear whether one actually exists. The recent identification of a number of putative aldosterone-repressed genes and proteins (92, 135, 154) points to possible candidates worthy of further investigation in this regard. Another consideration worthy of further study is that gene repression in response to aldosterone does not directly involve binding to nSRE. This alternative mechanism could take one of two forms: 1) a secondary response dependent on the primary induction of factors that ultimately negatively influence transcription of the repressed genes and 2) a response dependent on protein-protein interactions between MR and other accessory or transcription factors that then negatively influence expression without MR actually binding DNA.

It has become apparent in the last couple of years that many genes repressed by glucocorticoids in fact do not contain an nSRE directly bound by ligand-activated GR. It is accepted that these genes are repressed by direct protein-protein interactions between ligand-activated GR and other trans-acting factors, which bind DNA in the promotor region of the repressed genes. Indeed, it is now believed that most corticosteroid gene repression actually results from a molecular mechanism involving transcription interference mediated by protein-protein interactions and not direct trans-repression of expression (reviewed in Ref. 78). Also being reevaluated is whether such protein-protein interactions actually play a more prominent role in trans-activation than was initially thought (134).

Protein-protein interactions during MR and GR modulation of gene expression. The beta -casein gene is induced by GR independently of SRE (163). The mechanism of action here entails GR "tethering" through a protein-protein interaction to signal transducer and activator of transcription-5 (Stat-5), with the latter factor associating with its respective cis-element in the promotor region of the beta -casein gene (see Fig. 1). Induction of beta -casein in response to glucocorticoids, then, is actually dependent on formation of GR-Stat-5 heterodimers that bind to Stat-5 response elements without ligand-activated GR actually interacting with its cognate DNA-binding site. GR forms an equivalent type of complex with the transcription factor organic cation transporter-2 (130) and has also been reported to associate with Stat-3 (200). It is not known whether MR also binds these and/or other such tethering factors, and thus such a mechanism of action involving transcription synergy for MR is purely speculative at this time. If MR has limited interaction with these tethering factors or interacts with distinct ones, this mechanism might then distinguish between GR and MR responses.

Abundant results demonstrate that GR negatively influences the actions of activator protein (AP)-1 and nuclear factor (NF)-kappa B on transcription via direct protein-protein interactions (reviewed in Refs. 78 and 79). This action of GR is rapid and independent of induction of GR-responsive genes. Such cross talk between GR and AP-1 and NF-kappa B plays a critical role in the anti-inflammatory and immunosuppressive functions of glucocorticoids. A possible role for such a mechanism of action during a mineralocorticoid response remains to be determined, but because signaling through GR and MR has much in common, it merits further consideration.

The functional consequence of protein-protein interactions involving GR in vivo have been clarified by the use of a transgenic mouse model containing mutant GR incapable of forming dimers (GRdim), which thus cannot bind and trans-activate at SRE (72, 78). Also, trans-repression of POMC and prolactin via nSRE is compromised in GRdim/dim mice, but these mice retain the ability for ligand-activated GR to interfere via protein-protein interactions with transcription initiated by other trans-acting factors (134). Indeed, the ability of activated GR via AP-1 to interfere with trans-activation of genes encoding collagenase and gelatinase is retained in GRdim/dim mice. The ability of GR to interfere with NF-kappa B activity also is retained in GRdim/dim mice. Distinct activation-deficient GR mutants, as well, retain their ability to interfere with AP-1 activity, repress interleukin-2 production and c-myc expression, and induce apoptosis in lymphocytes (74). It is presently unclear whether MR has such an extraordinary ability to mediate some of its cellular actions via protein-protein interactions involved in transcription interference and/or synergy.

The promotor regions of the aldosterone-sensitive genes sgk, Ki-ras, and alpha -ENaC all contain consensus AP-1 sites (104, 114, 127). A possible role for these cis-acting elements in the context of corticosteroid regulation has not been directly investigated. In a series of elegant studies, the laboratory of Ann (98, 184, 197, 198) clearly showed that GR-mediated trans-activation of alpha -ENaC is suppressed by an interference mechanism involving activation of the MAPK signaling cascade. Importantly, the MAPK cascade can ultimately lead to activation of the AP-1 complex, with the MAPK-activated trans-acting factor c-Jun forming homo- and heterodimers with c-Fos to target AP-1 sites. It is provocative that GR and c-Jun/c-Fos form low-affinity protein-protein interactions capable of mutually interfering with each other's function (reviewed in Refs. 78 and 79). Although such protein-protein interactions clearly abrogate both GR and AP-1 trans-activation (193), it is unclear whether coassociation of GR with AP-1 components compromises DNA binding or directly interferes with their respective trans-acting potential. Thus one could evoke a dynamic mechanism for regulation of alpha -ENaC, ras, and sgk involving both classic trans-activation and transcription interference by GR. It will be interesting to learn whether MR also mutually interferes with AP-1 elements via protein-protein interactions.

The promotor region of the glucocorticoid-induced gene encoding phosphoenolpyruvate carboxykinase (PEPCK) contains both AP-1 and NF-kappa B response elements, as well as classic SRE (183). In contrast to glucocorticoids, AP-1 signaling decreases PEPCK expression. Similarly, NF-kappa B represses induction of PEPCK by glucocorticoids. The intereference of both AP-1 and NF-kappa B with GR is mutually antagonistic (87, 111-113). NF-kappa B interferes with trans-activation of PEPCK by GR independently of the former protein's interaction with its cognate DNA-binding element. Thus it is not unreasonable to suggest that a system involving GR trans-activation through SRE- and GR-mediated interference of AP-1 and NF-kappa B repression combines to control PEPCK levels. As mentioned immediately above, it is unclear whether MR affects AP-1, but MR clearly interferes with NF-kappa B trans-activation via protein-protein interactions (87). The role of NF-kappa B with regard to mutual interference with MR/GR during a mineralocorticoid response remains unexplored.

The laboratory of Firestone (104) recently identified for the first time a novel mechanism of reciprocal interference between GR and the p53 protein. Induction of sgk by GR signaling is abrogated by simultaneous activation of p53. p53 interferes with GR via protein-protein interactions by preventing its interaction with its cognate SRE. Substantiating this mechanism are findings that p53 interferes with glucocorticoid-induction of the AGP gene, which contains a SRE but no p53 binding site in its promotor region (10). Because sgk is clearly induced by aldosterone via MR in some epithelia capable of Na+ reabsorption (36, 119), it is possible that interference from p53 may play an important but as yet unexplored regulatory role modulating this and other functions of epithelia influenced by Sgk during a mineralocorticoid response.

Although not directly or extensively studied, abundant circumstantial evidence, such as that described immediately above, suggests that transcription interference and synergy via MR and/or GR may play a role in mineralocorticoid signaling. Thus further study of this novel aspect of aldosterone signaling is warranted.


    ALDOSTERONE-INDUCED PROTEINS
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

Significant advances clearly have been made in the last couple of years in identifying aldosterone-induced transcripts and proteins, as well as in determining the molecular mechanism for modulation of aldosterone-sensitive genes. Similarly, our general understanding of the function of aldosterone-induced proteins during a mineralocorticoid response is also becoming clearer. However, much remains to be learned about the mechanism by which aldosterone-induced proteins exert their final control over cellular activity. This is particularly evident when one considers that very little detailed information exists about how aldosterone-induced proteins specifically interact and regulate their respective effectors in epithelia. Our understanding of the cellular signaling cascade transducing the actions of aldosterone at the nucleus outward toward the plasma membrane, where its final effectors are located, is also very limited. These areas of aldosterone signaling are the primary focus of most contemporary research investigating the mineralocorticoid response.

Temporal Actions of Aldosterone

The genomic actions of aldosterone are traditionally divided into an early and late phase (reviewed in Refs. 176-178). This division is somewhat arbitrary, and it is unclear whether and/or how the two phases are related. Moreover, the physiological significance of each discrete phase has never been definitively quantified. However, it has been suggested that the later phase of aldosterone action sets the capacity of transport epithelia for solute and water (re)absorption, and thus this phase may be considered a trophic or chronic response (159, 176, 178). At a superficial level, the genes affected by aldosterone during the later phase, those encoding transport proteins and proteins involved in energy metabolism for example, appear to support this contention. The early phase, in comparison, is predicted to respond to acute changes in salt and water balance to allow for more rapid responses to movements away from homeostasis. That aldosterone primarily affects transcription of signaling factors, such as Sgk and Ki-Ras, during the early phase is consistent with such a mechanism. Because the in vivo effects of aldosterone have been almost exclusively studied at extremes, little information exists regarding dose-dependent actions and threshold effects during either phase in the integrated system. In addition, the significance of time-dependent aldosterone responses in whole animal studies is often obscured by experimental limitations.

The early phase of aldosterone action is most often demarcated as the period where Na+ transport is increased without an accompanying increase in the levels of the transport proteins involved in this action. This phase directly follows the 0.5- to 1.0-h latent period required for changes in gene expression and proceeds for 2-4 h. The second phase, then, is classified as that following this period and is associated with a further or sustained increase in transport accompanied by increases in the number of transport proteins, such as ENaC and the Na+/K+-ATPase (reviewed in Refs. 52 and 176-178). Both phases clearly have an absolute requirement on induction/repression of gene expression. For the early phase, aldosterone action is considered to be exclusively mediated through a primary effect on gene expression. In contrast, the later phase results from both primary and secondary effects on gene expression. Both phases also involve regulation at the level of posttranslation. The distinction between these phases demonstrates that aldosterone induces signaling proteins during the early phase that result in activation via posttranslational control of existing proteins involved in transport. These early signaling factors potentially could also lead into the later phase by stimulating a second round of gene expression to increase production and guarantee proper regulation of transport proteins.

Early actions of aldosterone. The initial actions of aldosterone with respect to increasing Na+ (re)absorption and K+ secretion are mediated by existing transport proteins that are targeted by diffusible signaling factors, the expression of which is regulated at the level of transcription by steroids. The limiting step in both transcellular Na+ and K+ movement are the activities of the apical ion channels mediating (re)absorption and secretion, respectively. Although the serosal Na+/K+-ATPase is essential to the maintenance of the electrochemical forces necessary for transport, there is enough inherent capacity within pump number and activity to ensure a constant gradient favoring Na+ (re)absorption and K+ secretion (reviewed in Refs. 52, 60, and 176). Thus the activity of the Na+/K+-ATPase is not typically considered to be limiting during the early phase of aldosterone action. Considering this, then, there are ultimately only two ways aldosterone can enhance transport: 1) by increasing the open probability of apical ion channels and 2) by increasing the number of active ion channels in the luminal membrane. There is considerable and often conflicting evidence supporting both mechanisms of action (47, 56, 59, 67, 73, 80, 84, 85, 189). Importantly, an aldosterone-induced change in channel-gating kinetics and number during the early phase of action is not necessarily mutually exclusive. In fact, as described below, Sgk is presently believed to increase ENaC number in the apical membrane, whereas Ki-RasA is believed to influence channel gating, with both happening during the early phase.

Late actions of aldosterone. The late actions of aldosterone are primarily trophic. During this phase, there is a clear increase in the amount of ENaC protein within the cell, as well as at the apical membrane (100, 107, 189). However, controversy surrounds which subunits of the heteromultimeric ENaC are induced by aldosterone, with some studies showing increases in alpha -ENaC levels (100, 107, 110, 114) and some increases in beta -ENaC levels (158, 189), and yet others reporting increases in both (42, 47). Moreover, controversy surrounds the idea that expression and insertion into the apical membrane of ENaC subunits are discordantly and independently regulated by aldosterone (67, 100, 107, 139, 189). Similar to ENaC, the number of Na+/K+-ATPase pumps and of the secretory, apical K+ channel (ROMK) increase in response to steroids (180). Indeed, aldosterone definitively induces, at the level of transcription, expression of the gene encoding the alpha 1- and possibly beta 1-subunits of the Na+/K+-ATPase (24, 88, 89), as well as inducing expression of corticosteroid hormone-induced factor (CHIF; see below), a protein that shares much similarity with the gamma -subunit of the Na+/K+-ATPase. In addition to increases in these transport proteins, enzymes essential to energy metabolism increase (52, 176, 178). All three actions combine to establish a cell programmed for prolonged ion transport. Thus the programming associated with the trophic action of aldosterone could in a general sense be considered further differentiation of these epithelial cells. It is provocative, as described further below, that many of the early signals of aldosterone are also associated with cellular growth and differentiation.

The mechanism of action involving the transport proteins that are directly regulated by aldosterone at the level of transcription is straightforward. Because activity of transport proteins is dependent on both activity and number, an increase in expression, with all else being equal, then leads to an increase in specific activity. Obviously, biological systems are more complicated. Myriad posttranslational inputs, both temporally and spatially distinct, exist and potentially influence the final cellular effect of increases in transport protein number.

Function of Aldosterone-Induced/Regulated Proteins

As described above, aldosterone influences expression of a broad pool of genes, and its actions are pleiotropic, involving regulation of several distinct end-effectors through the amalgamation of diverse intermediaries and signaling inputs. A definitive understanding of the roles played by most aldosterone-induced proteins is presently lacking; however, it is accepted that aldosterone signaling is quite complex with much convergence and divergence onto key signaling factors that program the intended cellular response. The two signaling factors induced by aldosterone that have recently garnered much attention as key mediators in a mineralocorticoid response are Sgk and Ki-RasA.2 Figure 2 shows a working model of aldosterone signaling that includes some of the known aldosterone-induced proteins and their activators and effectors.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Aldosterone signaling to epithelial sodium channel (ENaC). Blue and red, aldosterone-induced and -repressed proteins, respectively; blue and red arrows, stimulation and inhibition, respectively; solid arrows, direct links; dashed arrows, the mechanism of association remains to be elucidated; solid-dashed arrows, signaling intermediates have been omitted from the figure; *, trophic action. With this signaling cascade, aldosterone would both induce Kirsten Ras GTP binding protein (Ki-RasA) and activate this protein through positive-feedback regulation via phosphatidylinositol 3-kinase (PI3K) right-arrowphosphoinositide-dependent kinase-1 (PDK-1)right-arrowSOS. Aldosterone would similarly induce serum and glucocorticoid-inducible kinase (Sgk) expression and promote Sgk activation via Ki-RasAright-arrowPI3Kright-arrow PDK-1. Aldosterone would also promote activation of Sgk by inhibiting the negative regulator of Sgk, PP2A. Active Sgk would direct Ki-RasA signaling onto itself by inhibiting Raf. In addition, numerous feedback pathways within the mitogen-activated protein kinase (MAPK) cascade would lessen the initial effect this cascade had on ENaC during aldosterone signaling; however, this cascade may eventually prevail in the continued presence of aldosterone after a reduction in Sgk. The end results of aldosterone would be activation of Ki-RasA, PI3K, and Sgk, all of which stimulate ENaC through yet to be identified mechanisms.

Function of Sgk. Of the recently identified aldosterone-induced genes, sgk has received the most attention (reviewed in Refs. 120, 124, and 125). This gene was established originally in fibroblasts and mammary epithelia as an immediate-early gene induced by glucocorticoids at the level of transcription independently of de novo protein synthesis (186, 187). Subsequently, the Pearce (36) and Naray-Fejes-Toth (119) laboratories simultaneously identified sgk as a primary aldosterone-induced gene in amphibian and mammalian renal epithelia. This transcript also is strongly induced by corticosteroids throughout the gastrointestinal tract but not the lungs (28, 151). From these findings, it is clear that a more complete understanding of how corticosteroids target induction of sgk in kidney and gut but not lung will yield insight into the cellular/molecular mechanisms bestowing steroid specificity. The sgk transcript is also commonly expressed in many nonepithelial tissues in a corticosteroid-insensitive manner, suggesting that some sgk expression must be constitutive (36, 187). Corticosteroids, through both GR and MR, increase sgk levels within 15-30 min of treatment, with levels peaking after 1-2 h and subsequently tending to pretreatment values soon afterward. Induction by aldosterone of Sgk protein in renal epithelia follows a similar time course, with protein levels increasing within 30 min, peaking by 6 h, and returning to pretreatment levels by 24 h (36).

Sgk is a serine/threonine kinase that shares much homology with protein kinase B (PKB)/Akt kinases and phosphorylates at a consensus sequence (RXRXXS/T; optimal site KKRNRRLSVA) similar to that targeted by PKB/Akt, protein kinase C, and p90 ribosomal protein S6 kinase (86, 122). Sgk itself is a phosphoprotein, with phosphorylation by PDK-1 being required for Sgk activity (86, 122). Interestingly, aldosterone increases both absolute and phospho-Sgk levels in renal A6 cells (185), suggesting that, in addition to inducing sgk expression, aldosterone activates a converging signaling cascade that ensures proper phosphorylation of Sgk. The lipid/protein kinase PI3K is upstream of PDK-1 in the PI3K signaling cascade and is required for activation of PDK-1 and, subsequently, Sgk, by insulin, insulin-like growth factor (IGF)-1, and other stimuli (122). Thus Sgk is a constituent of the PI3K signaling cascade positioned downstream of PDK-1 in parallel with PKB/Akt (77, 86, 175). In renal A6 epithelia, inhibition of PI3K attenuates aldosterone-induced increases in Na+ transport and in the active (phosphorylated) but not absolute levels of Sgk (185). This maneuver also blocks activation of Sgk and Na+ transport by insulin in the same cells. These observations are consistent with aldosterone-stimulating Sgk activation by control of sgk transcription and posttranslational modification. It is exciting that, in A6 cells, aldosterone stimulates PI3K activity independently of inducing PI3K expression (20, 21) and induces expression of Ki-RasA (154, 161), which is an upstream activator of PI3K (55, 192). Thus, as discussed further in this and the subsequent subsection, two primary aldosterone-induced genes encode signaling factors Sgk and Ki-RasA, which belong to a converging signaling cascade. Also exciting are results from a recent proteomic analysis of A6 cells treated with aldosterone that identified the alpha -isoform of the catalytic subunit of protein phosphatase 2A (PP2A; PP2Aalpha ) as being decreased fourfold 3 h after steroid treatment (Stockand JD, unpublished observations). PP2A dephosphorylates and inactivates Sgk in in vitro experiments (122). All of these observations strongly suggest that Sgk is a critical factor in the aldosterone-signaling cascade initiated in epithelia. Moreover, they suggest that there are multiple sites at which aldosterone affects the active levels of Sgk to fine-tune a final response.

Sgk localizes to both the cytosol and nucleus and plays a role in preventing apoptosis and promoting cell proliferation (2, 31, 65, 115, 122). It is unclear how such an action could ultimately lead to increased transport. Moreover, effector proteins phosphorylated by Sgk and those that physically interact with Sgk for the most part remain unspecified. Zhang et al. (199) recently identified B-Raf as an effector of Sgk, with phosphorylation by Sgk negatively regulating this protein. It is intriguing that some isoforms of Raf are induced by corticosteroids (95) and are activated by Ki-RasA, which itself is an aldosterone-induced protein (154, 161). Could Sgk inhibition of Raf direct Ki-RasA signaling to its alternative first effector, PI3K (55, 138, 192), with subsequent positive feedback onto Sgk itself via PDK-1 (see Fig. 2)? In addition to B-Raf, the Forkhead family member FKHRL1, a proapoptotic transcription factor, is targeted by Sgk (29). A role for negative regulation of FKHRL1 by Sgk during a mineralocorticoid response is presently unclear. The ubiquitin ligase NEDD4 directly interacts with the COOH termini of ENaC subunits at the PY motif and targets this channel for degradation (156, 157). Snyder and colleagues (153) recently showed that Sgk directly interacts with NEDD4-2 to decrease the latter protein's function and binding to alpha -ENaC. One consequence is that ENaC levels increase in the luminal membrane in response to Sgk signaling via suppression of normal retrieval pathways. Debonneville and colleagues have observed similar results (42a). However, conflicting data showing that mutations within ENaC that destroy the NEDD4-binding site and other domains targeting retrieval do not interfere with Sgk activation of this channel in oocytes have also been reported (45, 101, 179). Resolution of this apparent controversy is paramount to understanding Sgk actions on ENaC.

The only other known activator of Sgk besides PDK-1 (86) that directly interacts with this kinase is Big MAPK-1 (BMK-1; a newly described member of the MAPK/ERK family, also termed ERK5; 71). BMK-1 activates Sgk via phosphorylation at a site distinct from that targeted by PDK-1. Thus BMK-1 and PDK-1 may serve similar functions with respect to Sgk. Because BMK-1 is required for growth factor-induced cell proliferation controlling entry into the S phase of the cell cycle, it is presently unclear whether and how BMK-1-Sgk interactions relate to induction of Na+ transport by aldosterone in polarized, differentiated epithelia.

Bolstering a direct role for Sgk in mediating transport are findings that Sgk physically interacts with the COOH termini of both alpha - and beta -ENaC, when the latter proteins are expressed as glutathione S-transferase fusion proteins (185). These domains are similar to those targeted by NEDD4 (see paragraph earlier in this subsection), and thus it is possible that NEDD4 acts as a linker coupling Sgk to ENaC. Moreover, several laboratories have shown that overexpression of Sgk with ENaC in the heterologous X. laevis oocyte expression system leads to activation of the channel (36, 45, 101, 119, 151, 179). Enthusiasm for these experiments must be tempered, however, for they were performed in a nonpolar, non-aldosterone-sensitive, nonepithelial cell only after chronic Sgk and ENaC overexpression. This heterologous system obviously is quite different from the in vivo situation of aldosterone-stimulated Na+ transport across polarized, differentiated epithelial cells. Moreover, the effects of Sgk on ENaC when overexpressed in oocytes may reflect nonspecific actions for overexpression of this kinase with the cystic fibrosis transmembrane conductance regulator (179), as well as certain voltage-gated K+ channels (91) also leads to activation of these latter channels in the oocyte. In addition to regulating ion channels, preliminary evidence from oocytes suggests that Sgk also promotes activation of the Na+/K+-ATPase and Na+-K+-Cl- cotransporter BSC-1 via promoting insertion into the plasma membrane when these proteins are chronically cooverexpressed with the kinase (194). It is not immediately clear how a "specific" mediator of a mineralocorticoid response could activate such diverse channel types and transporters, which localize to distinct membranes in polarized epithelia. One possible explanation is that Sgk affects membrane trafficking via a general mechanism. Indeed, this idea is presently the most favored explanation of Sgk action on transport (124), but this again raises the specter of how specificity is determined with such a mechanism of action. Studies of Sgk's effects on ENaC when both are overexpressed in the oocyte confirm that, in this system, Sgk does increase the number of ENaC within the plasma membrane independently of overt effects on the gating kinetics of this channel (45, 101, 179). An alternative to Sgk directly affecting membrane cycling is that this kinase establishes a cellular program, in part, through antiapoptotic signals that induce a transport phenotype without directly affecting transport proteins themselves. In fact, indirect actions or secondary effects of Sgk on gene expression cannot be excluded from mediating this kinase's action on transport in any of the studies performed thus far.

Initial thoughts about the mechanism of Sgk's action during the early phase of aldosterone signaling included the notion that it directly phosphorylated ENaC to dynamically regulate ion channel insertion into and/or retrieval from the apical membrane. Because experimental manipulations and the introduction of mutations in ENaC that delete signals which promote retrieval from the membrane to the lysosomal and/or proteosomal compartments do not abrogate Sgk actions on the channel in oocytes (38, 45, 151), it is likely that this kinase regulates insertion. A report demonstrating that ENaC in a heterologous system was phosphorylated by protein kinase C (152), which has a consensus sequence similar to that targeted by Sgk (see paragraph earlier in this subsection), seemed to bolster the idea that Sgk directly affected the channel to promote insertion into the plasma membrane. However, experiments directly testing this notion have been negative (45), and attempts to phosphorylate native as well as in vitro transcribed/translated ENaC with active, purified, recombinant Sgk have been unsuccessful to date (38, 160). However, the same preparation of active Sgk phosphorylates at least seven proteins in A6 cell lysate in a dose-dependent manner (160). This is strong evidence that direct phosphorylation of ENaC by Sgk does not play a significant role in aldosterone signaling and thus that Sgk-to-ENaC signaling must be indirect. Further identification of Sgk substrates in epithelia is anxiously awaited and should better define how Sgk signals to ENaC. When the studies performed in epithelia to determine the mechanism of Sgk action on transport, as well as those investigating the actions of Sgk on cell proliferation and apoptosis, are considered, a logical suggestion is that Sgk is a pleiotropic signaling factor capable of programming several distinct cellular responses to include regulation of membrane trafficking. This notion is supported by findings showing that Sgk resides at distinct cellular locales in proliferative compared with differentiated cells (2, 65) and that corticosteroids regulate expression at the level of transcription of other signaling factors, such as Ras, Raf, and p21waf1/cip1, also important to the regulation of cell cycle progression (34, 41, 94, 95, 121, 127, 148, 149, 154).

It must be mentioned here that, although extensively studied in the context of being a specific mediator of mineralocorticoid action, a preponderance of the evidence suggesting that Sgk actually serves this function in epithelia is indirect. Only with more direct studies performed in whole animals and on native epithelial cells will Sgk be definitively established as a specific mediator of aldosterone action. Such definitive studies are presently ongoing in several different laboratories. Indeed, preliminary studies from Lang and colleagues (Lang F, personal communication) described linkage between the sgk locus and hypertension in humans. Moreover, preliminary findings from the Kuhl laboratory (191) appear to conclusively demonstrate for the first time that Sgk plays a pivotal role in the mineralocorticoid response. These investigators generated a mouse model containing sgk1 lacking a functional kinase domain. These mice show significantly decreased prenatal viability, which may be related to loss of the proliferative and antiapoptotic actions of Sgk. Surviving -/- mice show no gross functional abnormalities, and histology is normal in all organs assayed, including the gut and kidney. Moreover, these mice have normal Na+ and K+ metabolism when maintained on a normal diet but present with inappropriate Na+ wasting when stressed with a low-Na+ diet. The relatively mild phenotype of these mice, compared with those of ENaC (76) and MR (16, 17) knockout mice, is thought to suggest that Sgk1-independent signaling must also regulate Na+ metabolism. One possibility is that Sgk2 and/or Sgk3 isoforms, which are constitutively expressed in renal epithelia independently of corticosteroids and stimulate ENaC-mediated Na+ transport in heterologous systems (reviewed in Ref. 124), in part complement loss of Sgk1. Thus there may be functional redundancy between Sgk isoforms.

Liddle's syndrome shows inappropriately high levels of Na+ reabsorption in the distal nephron due to gain-of-function mutations in ENaC that result in an inability for proper retrieval of this channel from the apical membrane (69, 143, 144). It is striking that this avid Na+ reabsorption happens in the complete absence of effective aldosterone levels, suggesting that, in part, a mineralocorticoid response is independent of actions on channel insertion, which presumably is the domain of Sgk. Thus it is obvious, when the phenotypes of Sgk knockout mice and Liddle's syndrome are considered, that other signals in addition to Sgk must be important for mediating a mineralocorticoid response.

Function of Ki-RasA. The small, monomeric GTP-binding protein Ki-RasA, like Sgk, is encoded by an aldosterone-induced transcript and plays a pivotal role in mediating aldosterone action in renal epithelia. Spindler and colleagues (154) were the first to identify Ki-ras as an aldosterone-induced gene. In particular, this group identified the A splice variant of Ki-ras as sensitive to aldosterone. There are four homologous Ras proteins: Ha-Ras, N-Ras, Ki-RasA, and Ki-RasB. The latter two result from splice variants encoded by a common gene (reviewed in Ref. 8). Induction of Ki-rasA is a primary action of aldosterone that is independent of de novo protein synthesis. Previously, the Shekhar (127, 149) and Pelling laboratories (121, 165) showed that both the Ha-ras and Ki-ras genes were induced by glucocorticoids. It is unclear why aldosterone does not induce Ha-ras expression in epithelia capable of vectorial Na+ (re)absorption, but this appears to be a common finding among investigators studying aldosterone action (1, 154, 161; Stockand JD, unpublished observations; Fuller P, personal communication). Further study of this apparent controversy may shed light on aldosterone/glucocorticoid and MR/GR specificity. Subsequent to the initial study by Spindler and colleagues (154), Stockand et al. (161) and Spindler et al. (155) showed that aldosterone increased Ki-RasA protein levels. Aldosterone induces Ki-RasA during the early phase of action, with levels rising as early as 30 min after treatment. Controversy has surrounded the importance of Ki-RasA to aldosterone signaling. This controversy centers on concerns that aldosterone-dependent induction of Ki-rasA does not appear common to all epithelia capable of a mineralocorticoid response. Aldosterone via MR preferentially increases Ki-RasA transcript and protein levels in amphibian distal nephron (155), rodent colon (Fuller P, personal communication) and heart (Stockand JD and Meszaros JG, unpublished observations) and via GR in amphibian renal A6 cells (154, 161). Corticosteroids via GR, in addition, increase Ha-ras and Ki-ras levels in epidermal (165) and mammary epithelia (127, 149). In contrast to these findings, the Brown (131) and Verrey laboratories (personal communication) have been unable to detect the effects of aldosterone on Ki-ras in mouse and rat kidney. Robert-Nicoud and colleagues (135), using a distinctly molecular strategy, were also unable to identify sgk and Ki-ras as being induced by aldosterone in a collecting duct cell line. As pointed out by this group, such negative findings likely reflect, in part, the low expression levels of these transcripts in differentiated cells, which make them difficult to identify much less quantify. Resolution of this apparent conflict, however, is essential for distinguishing whether Ki-RasA plays a fundamental and universal role in aldosterone signaling or whether it is critical to steroid signaling only in select tissues and particular species. Nonetheless, in cells where aldosterone does increase Ki-RasA, this protein plays an important role in mediating the mineralocorticoid response.

Mastroberardino and colleagues (109) showed in the heterologous X. laevis oocyte expression system that overexpression of constitutively active Ki-RasA with ENaC has conflicting actions on the ion channel, both stabilizing the open probability and decreasing the number of channels in the plasma membrane. The effect on channel number resulted from nonspecific actions of activated Ki-RasA on induction of oocyte maturation. Although exciting, interpretation of these results was somewhat limited for they were performed in a heterologous system utilizing a nonpolarized, nonepithelial cell type not responsive to aldosterone or capable of regulated solute transport, and only after chronic overexpression of both ENaC and activated Ki-RasA proteins. We demonstrated in a subsequent study that induction of Ki-RasA during the early phase is necessary and sufficient for some part of aldosterone's action on Na+ transport in polarized renal A6 epithelial cells (161). In this study, as well as in a follow-up study (1), Ras was shown to be critical for stabilization of ENaC in the open state. The molecular mechanism by which Ras does this remains elusive. Indirect evidence from several other studies (11, 162), however, suggests that Ras must be in close proximity to ENaC and that the Ras-to-ENaC signal mediating changes in gating kinetics is, at least partially, membrane delimited (reviewed in Ref. 159). Thus direct interaction between Ras and ENaC leading to channel stabilization is not unexpected. Alternatively, Ras could signal to ENaC through effector proteins that are also localized to the plasma membrane. Although aldosterone-induced Ki-RasA clearly affects ENaC gating during the early phase of action, its action on channel number is less clear, but Ras signaling is known to activate PI3K in numerous cell types (55, 138, 192) and possibly Sgk in A6 epithelia (160), both of which affect ENaC number (20, 21, 123, 124).

During states of chronic and unrestricted activation of Ras and its downstream effector cascades, specifically the MAPK cascade, ENaC levels are ultimately decreased in both native epithelia and heterologous systems (98, 109, 184, 198). Aldosterone likely does more than just increase Ki-RasA levels. In addition, Ki-RasA activates several distinct effector cascades, including the MAPK and PI3K cascades, which differentially affect ENaC (21, 98, 123, 185, 198). Thus the decrease in ENaC levels resulting from prolonged and unrestricted activation of Ras and MAPK signaling not unexpectedly may reveal a potential, classic negative-feedback pathway that could temper avid Na+ reabsorption in the continued presence of aldosterone. Preliminary results presented in abstract form (160) indeed demonstrate that MAPK signaling downstream of Ki-RasA does not play a role in the positive actions of aldosterone but that Ras-dependent PI3K signaling does. As noted above, Ras and MAPK signaling decrease alpha -ENaC expression through a mechanism of transcription interference with corticosteroid signaling (98, 184, 198). Thus ENaC is potentially both positively (via direct actions) and negatively (via secondary actions mediated by Rasright-arrowMAPK signaling) regulated by aldosterone at the level of transcription. With this signaling cascade, the primary actions of aldosterone on induction of Ki-RasA and ENaC would favor increased Na+ transport during the early and late phases, respectively, with continued Ki-RasA signaling eventually leading, via the MAPK cascade and, possibly, AP-1 interference with corticosteroid signaling, to a secondary suppression of ENaC expression during the later phase, which would then temper Na+ reabsorption.

Function of PI3K during an aldosterone and insulin response. PI3K, a multimeric enzyme containing both catalytic and regulatory subunits, is important to both aldosterone- and insulin-dependent actions on epithelia (20, 21, 123, 133). However, PI3K is not an aldosterone-induced protein, but its activity is increased by both aldosterone and insulin in renal epithelial cells. Blockade of PI3K impedes both the early and late phases of aldosterone actions, with PI3K apparently promoting/protecting ENaC levels in the apical membrane. Similar effects are observed when PI3K is inhibited during insulin induction of Na+ transport. Thus PI3K is either permissive for Na+ transport or it is common to both the aldosterone- and insulin-signaling pathways that culminate in increased Na+ transport (see Fig. 2). If the latter scenario is true, then PI3K activity must be directly and continuously linked to ENaC activity for, when this kinase is inhibited, sustained Na+ transport is quickly diminished even in the continued presence of aldosterone and insulin. This observation, in conjunction with those showing that aldosterone-sensitive Sgk levels rise within 1-2 h and then return by 4-6 h to pretreatment levels in the continued presence of aldosterone (see above), seems to indicate that PI3K plays a role in addition to that of activating Sgk during chronic aldosterone signaling. At this time, the Sgk-independent role for PI3K is unclear. It is possible, however, that some epithelia have enough basal Sgk1 and/or Sgk2 and -3 expression to enable constant PI3K signaling to ENaC through this pathway.

In contrast to aldosterone, which results in an increase in transport only after a latent period required for gene expression, insulin quickly (within minutes) stimulates transport independently of gene modulation, utilizing a signaling cascade that is initiated at the plasma membrane. Insulin is recognized to stimulate PI3K through a transduction pathway involving several adapter proteins that ultimately couple PI3K activity to allosteric changes in the insulin receptor. How aldosterone induces PI3K activity and where this kinase fits into the aldosterone transduction pathway remain less clear. One possibility that is consistent with all present findings is that aldosterone-dependent induction of Ki-RasA leads to activation of PI3K (see Fig. 2). PI3K is a well-known first effector of Ras proteins, including Ki-RasA (55, 192). With such mechanisms of PI3K activation, insulin would quickly affect the kinase, whereas aldosterone would only affect the kinase after the latent period required for Ki-RasA transcription and translation.

In addition to aldosterone and insulin, vasopressin has been reported to stimulate Na+ transport in A6 cells through a mechanism dependent, in part, on PI3K (50). Thus PI3K may be a focal point where insulin, vasopressin, and aldosterone signal transduction converge to activate a common cascade directed toward ENaC and/or the Na+/K+-ATPase.

Function of CHIF. CHIF was first identified as a corticosteroid-induced gene in rat colon (6). CHIF is expressed in epithelia of the distal colon and nephron (6, 33, 181). This protein is localized primarily to the basolateral membrane, where it presumably interacts with its final effector to stimulate transport (150). Corticosteroids via MR but not GR regulate CHIF expression at the level of transcription in colon but not kidney (27, 33, 181, 182). Induction of CHIF in the colon in response to corticosteroids is a primary action independent of de novo protein synthesis, with CHIF levels increasing as early as 1 h after steroid treatment (27). In contrast to the colon, in the kidney, CHIF expression is modulated by aldosterone at the level of translation and/or posttranslation (150). Thus CHIF expression must be regulated differently by aldosterone in the colon and kidney. How aldosterone modulates CHIF translation in the kidney remains a mystery, but identification of the cis-acting element and molecular mechanism regulating CHIF expression in the colon is excitedly awaited. Because this element is responsive to MR but not GR, identifying it in the gut will likely yield great insight into the mechanisms defining corticosteroid hormone receptor specificity.

CHIF is a member of the newly identified FXYD protein family as defined by Sweadner and Rael (167). CHIF, similar to other FXYD proteins, is a transmembrane regulator of ion channels and other transport proteins (6, 147). The gamma -subunit of the Na+/K+-ATPase is also a FXYD protein. It is unclear whether family membranes can substitute functionally for one another; however, this remains a distinct possibility and may readily explain the role played by CHIF during a mineralocorticoid response. The gamma -subunit is well known to modulate the activity of the Na+/K+-ATPase (5, 14, 171). Recent reports showing that CHIF associates with the pump in renal tissue and stimulates pump activity in the heterologous oocyte expression system suggest that CHIF may serve a similar function (13, 194). Although CHIF is proposed to modulate primarily K+ homeostasis, it likely also plays an important role in Na+ homeostasis, considering that its primary target appears to be the serosal Na+/K+-ATPase. By activating the serosal pump, CHIF likely serves a supportive function in maintaining cellular electrochemical gradients favorable for luminal Na+ absorption and K+ secretion but has little role in directly modulating the limiting steps of transcellular transport. This mechanism is consistent with findings showing that, during the early phase of aldosterone action, preexisting Na+/K+-ATPase pumps are activated in response to the genomic actions of this steroid (128).

Function of glucocorticoid-induced leucine zipper protein. Robert-Nicoud et al. (135), using serial analysis of gene expression, identified in an immortalized mouse principal cell line, which contains MR, the glucocorticoid-induced leucine zipper protein (GILZ) as being encoded by an aldosterone-induced gene (135). GILZ transcript levels were increased by aldosterone within 30 min, indicating that it is an early signal. GILZ belongs to the transforming growth factor-beta -stimulated clone 22 (TSC-22)/DSIP-immunoreactive leucine zipper protein/bunched (TSC-22/DIP/bun) family of proteins originally thought to be transcription factors but recently reconsidered to serve an as yet undetermined function. How GILZ could affect proteins involved in transport remains unclear; however, it is becoming clear that leucine zippers, in addition to affecting transcription, are also capable of modulating ion channel activity in a dynamic manner (reviewed in Ref. 102). While serving this function, leucine zippers act as adapter proteins to recruit kinases and phosphatases into a macromolecular complex with the regulated ion channel. Interestingly, using a distinct genomics approach, we also identified TSC-22 with two different probes as being encoded by a corticosteroid-induced transcript in the M-1 cell line that is increased within 3 h of steroid treatment (Stockand JD and Eaton DC, unpublished observations).

Function of Aldosterone-Induced Transport Proteins

As discussed above (see Late actions of aldosterone), aldosterone induces expression of ENaC, ROMK, and the Na+/K+-ATPase pump at the level of transcription, with this induction being part of the trophic, late actions of aldosterone. The functional consequences of these effects of aldosterone with respect to a mineralocorticoid response are straightforward. In addition to these transport proteins, aldosterone induces expression of the luminal Na+/H+ exchanger (NHE3) in the proximal but not distal portion of the colon (39) and the luminal, thiazide-sensitive Na+-Cl- cotransporter (NCC) in the distal renal tubule (83). Presesntly, it is unclear whether induction of NHE3 and NCC are primary responses to aldosterone, but both actions appear to be associated with the trophic effects of this steroid. Again, the functional consequences of these actions with respect to a mineralocorticoid response are straightforward. Increases in NHE3 and NCC translate into the sustained elevation of electroneutral Na+ (re)absorption in the colon and kidney associated with volume contraction (54, 174).


    AN INTEGRATED MODEL
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

It is hard to overlook the fact that there is possibly a linear signaling relationship between aldosterone-induced Ki-RasA and Sgk, with PI3K positioned between these factors. In addition, other corticosteroid-regulated proteins, such as PP2Aalpha and A-Raf, potentially influence or are influenced by these factors. When the common nature of these factors to signaling cascades that control cellular growth, apoptosis and differentiation is considered, one generalized view of the actions of aldosterone on epithelia is that this steroid programs the cell to "differentiate" more toward a Na+-reabsorbing state and that Ki-RasA and Sgk are merely the early messengers of this signal. Adding further support for such a generalized mechanism is that corticosteroids, via the initiation of a complex interaction between Ras and PI3K signaling, are known to induce functional polarity and promote formation of tight junctions and transepithelial resistances in mammary epithelia (32, 190). Moreover, signaling through MR promotes differentiation of brown adipocytes (126), and PI3K is a central switch directing tubulogenesis of epithelial cells (82). This generalized cascade would contain multiple converging and diverging pathways, exerting pleiotropic effects on epithelia. Shown in Fig. 2 is one possible signaling cascade that includes many of the known aldosterone-regulated proteins. What is clear in this idealized cascade are the many sites for possible cross talk and feedback. For instance, Ki-RasA can activate PI3K, which in turn can activate PDK1, which then activates Sgk. Ki-RasA also activates the MAPK cascade via stimulation of Raf. Active Sgk is a negative regulator of B-Raf through phosphorylation (199). Could Sgk possibly also regulate the corticosteroid-induced gene A-Raf and other Raf proteins, such as c-Raf, that are known effectors of aldosterone-induced Ki-RasA? PKB/Akt, which shares much homology with Sgk, phosphorylates a similar consensus site and is positioned at the same site as Sgk in the PI3K signaling cascade, inhibits both B- and c-Raf via phosphorylation (66, 77, 138, 202). An additional site of possible cross talk regulation is between MAPK and Sgk, for MAPK signaling in response to stimulation of Raf induces expression of sgk in fibroblasts (116). Here again is a possible positive-feedback signal with aldosterone-induced Ki-RasA activating Raf and the MAPK cascade to further ensure sgk expression, which subsequently directs Ki-RasA signaling to the PI3K cascade by Akt-mediated inactivation of Raf. Thus Sgk expression and proper phosphorylation could, in part, be influenced by Ki-RasA signaling. Numerous other points of possible cross talk exist in this cascade. For instance, aldosterone-induced Ki-RasA via MAPK signaling has been shown in A6 cells to lead to induction of MAPK phosphatase-1 (MKP-1) (160), which is a negative-feedback regulator of MAPK. Indeed, activation of MKP-1 directs Rasright-arrowRaf signaling to cascades other than the MAPK cascade (148). MAPK, in addition, is a negative regulator of the GTP exchange factors, such as SOS, that stimulate Ras activity (25, 26, 55). Interestingly, PI3K via PDK-1 on the other hand, positively influences GTP exchange factors to prolong Ras signaling (46, 132). Thus, if all of these points of cross talk hold true in corticosteroid-sensitive epithelia, then aldosterone induction of Ki-RasA simultaneously with Sgk would preferentially lead to Rasright-arrowPI3Kright-arrowSgk signaling with inhibited MAPK signaling. Such a system of transduction is consistent with all the present literature describing the positive actions of Sgk and Ki-RasA, as well as the negative actions of prolonged MAPK signaling on transport.


    ACKNOWLEDGEMENTS

Drs. A. Firulli, K. Hamilton, and R. T. Worrell are recognized for critical evaluation of this article.


    FOOTNOTES

1 The diseases include, in part, Cushing's syndrome; Conn's syndrome; Addison's disease; hypertension; syndrome of apparent mineralocorticoid excess; Liddle's syndrome; glucocorticoid-remediable aldosteronism; pseudohypoaldosteronism; Gordon's syndrome; some forms of familial hypertension exacerbated by pregnancy; and Gitelman's syndrome (68, 97).

2 Many earlier studies identified aldosterone-induced (and -repressed) proteins using conventional biochemical means. The relationship of the proteins to a mineralocorticoid response and aldosterone effectors has not been clearly established and thus is not discussed here.

Address for reprint requests and other correspondence: J. D. Stockand, Dept. of Physiology, University of Texas Health Science Center at San Antonio, MC-7756, 7703 Floyd Curl Dr., San Antionio, TX 78229-3900 (E-mail: stockand{at}uthscsa.edu).

10.1152/ajprenal.00320.2001


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
ALDOSTERONE REGULATES GENE...
ALDOSTERONE-INDUCED PROTEINS
AN INTEGRATED MODEL
REFERENCES

1.   Al-Baldawi, NF, Stockand JD, Al-Khalili OK, Yue G, and Eaton DC. Aldosterone induces Ras methylation in A6 epithelia. Am J Physiol Cell Physiol 279: C429-C439, 2000[Abstract/Free Full Text].

2.   Alliston, TN, Gonzalez-Robayna IJ, Buse P, Firestone GL, and Richards JS. Expression and localization of serum/glucocorticoid-induced kinase in the rat ovary: relation to follicular growth and differentiation. Endocrinology 141: 385-395, 2000[Abstract/Free Full Text].

3.   Ankenbauer, W, Strahle U, and Schutz G. Synergistic action of glucocorticoid and estradiol responsive elements. Proc Natl Acad Sci USA 85: 7526-7530, 1988[Abstract/Free Full Text].

4.   Arriza, JL, Simerly RB, Swanson LW, and Evans RM. The neuronal mineralocorticoid receptor as a mediator of glucocorticoid response. Neuron 1: 887-900, 1988[Web of Science][Medline].

5.   Arystarkhova, E, Wetzel RK, Asinovski NK, and Sweadner KJ. The gamma subunit modulates Na(+) and K(+) affinity of the renal Na,K-ATPase. J Biol Chem 274: 33183-33185, 1999[Abstract/Free Full Text].

6.   Attali, B, Latter H, Rachamim N, and Garty H. A corticosteroid-induced gene expressing an "IsK-like" K+ channel activity in Xenopus oocytes. Proc Natl Acad Sci USA 92: 6092-6096, 1995[Abstract/Free Full Text].

7.   Bamberger, CM, Bamberger AM, Wald M, Chrousos GP, and Schulte HM. Inhibition of mineralocorticoid activity by the beta-isoform of the human glucocorticoid receptor. J Steroid Biochem Mol Biol 60: 43-50, 1997[Web of Science][Medline].

8.   Bar-Sagi, D. A Ras by any other name. Mol Cell Biol 21: 1441-1443, 2001[Free Full Text].

9.   Bastl, CP, and Hayslett JP. The cellular action of aldosterone in target epithelia. Kidney Int 42: 250-264, 1992[Web of Science][Medline].

10.   Baumann, H, Jahreis GP, Morella KK, Won KA, Pruitt SC, Jones VE, and Prowse KR. Transcriptional regulation through cytokine and glucocorticoid response elements of rat acute phase plasma protein genes by C/EBP and JunB. J Biol Chem 266: 20390-20399, 1991[Abstract/Free Full Text].

11.   Becchetti, A, Kemendy AE, Stockand JD, Sariban- Sohraby S, and Eaton DC. Methylation increases the open probability of ENaC in A6 epithelia. J Biol Chem 275: 16550-16559, 2000[Abstract/Free Full Text].

12.   Beck, FX, Neuhofer W, and Muller E. Molecular chaperones in the kidney: distribution, putative roles, and regulation. Am J Physiol Renal Physiol 279: F203-F215, 2000[Abstract/Free Full Text].

13.   Beguin, P, Crambert G, Guennoun S, Garty H, Horisberger JD, and Geering K. CHIF, a member of the FXYD protein family, is a regulator of Na,K-ATPase distinct from the gamma-subunit. EMBO J 20: 3993-4002, 2001[Web of Science][Medline].

14.   Beguin, P, Wang X, Firsov D, Puoti A, Claeys D, Horisberger JD, and Geering K. The gamma subunit is a specific component of the Na,K-ATPase and modulates its transport function. EMBO J 16: 4250-4260, 1997[Web of Science][Medline].

15.   Benjamin, WB, and Singer I. Aldosterone-induced protein in toad urinary bladder. Science 186: 269-272, 1974[Abstract/Free Full Text].

16.   Berger, S, Bleich M, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W, Warth R, Greger R, and Schutz G. Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95: 9424-9429, 1998[Abstract/Free Full Text].

17.   Berger, S, Bleich M, Schmid W, Greger R, and Schutz G. Mineralocorticoid receptor knockout mice: lessons on Na+ metabolism. Kidney Int 57: 1295-1298, 2000[Web of Science][Medline].

18.   Bhargava, A, Fullerton MJ, Myles K, Purdy TM, Funder JW, Pearce D, and Cole TJ. The serum- and glucocorticoid-induced kinase is a physiological mediator of aldosterone action. Endocrinology 142: 1587-1594, 2001[Abstract/Free Full Text].

19.   Blazer-Yost, B, Geheb M, Preston A, Handler J, and Cox M. Aldosterone-induced proteins in renal epithelia. Biochim Biophys Acta 719: 158-161, 1982[Medline].

20.   Blazer-Yost, BL, Liu X, and Helman SI. Hormonal regulation of ENaCs: insulin and aldosterone. Am J Physiol Cell Physiol 274: C1373-C1379, 1998[Abstract/Free Full Text].

21.   Blazer-Yost, BL, Paunescu TG, Helman SI, Lee KD, and Vlahos CJ. Phosphoinositide 3-kinase is required for aldosterone-regulated sodium reabsorption. Am J Physiol Cell Physiol 277: C531-C536, 1999[Abstract/Free Full Text].

22.   Bleich, M, Warth R, Schmidt-Hieber M, Schulz-Baldes A, Hasselblatt P, Fisch D, Berger S, Kunzelmann K, Kriz W, Schutz G, and Greger R. Rescue of the mineralocorticoid receptor knock-out mouse. Pflügers Arch 438: 245-254, 1999[Web of Science][Medline].

23.   Bloem, LJ, Guo C, and Pratt JH. Identification of a splice variant of the rat and human mineralocorticoid receptor genes. J Steroid Biochem Mol Biol 55: 159-162, 1995[Web of Science][Medline].

24.   Blot-Chabaud, M, Djelidi S, Courtois-Coutry N, Fay M, Cluzeaud F, Hummler E, and Farman N. Coordinate control of Na,K-ATPase mRNA expression by aldosterone, vasopressin and cell sodium delivery in the cortical collecting duct. Cell Mol Biol 47: 247-253, 2001.

25.   Bokemeyer, D, Lindemann M, and Kramer HJ. Regulation of mitogen-activated protein kinase phosphatase-1 in vascular smooth muscle cells. Hypertension 32: 661-667, 1998[Abstract/Free Full Text].

26.   Bokemeyer, D, Sorokin A, and Dunn MJ. Differential regulation of the dual-specificity protein-tyrosine phosphatases CL100, B23, and PAC1 in mesangial cells. J Am Soc Nephrol 8: 40-50, 1997[Abstract].

26a.   Booth, RE, Johnson JP, and Stockand JD. Aldosterone. Adv Physiol Educ 26: 6-18, 2002.

27.   Brennan, FE, and Fuller PJ. Acute regulation by corticosteroids of channel-inducing factor gene messenger ribonucleic acid in the distal colon. Endocrinology 140: 1213-1218, 1999[Abstract/Free Full Text].

28.   Brennan, FE, and Fuller PJ. Rapid upregulation of serum and glucocorticoid-regulated kinase (sgk) gene expression by corticosteroids in vivo. Mol Cell Endocrinol 166: 129-136, 2000[Web of Science][Medline].

29.   Brunet, A, Park J, Tran H, Hu LS, Hemmings BA, and Greenberg ME. Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21: 952-965, 2001[Abstract/Free Full Text].

30.   Burke, ZD, Ho MY, Morgan H, Smith M, Murphy D, and Carter D. Repression of vasopressin gene expression by glucocorticoids in transgenic mice: evidence of a direct mechanism mediated by proximal 5' flanking sequence. Neuroscience 78: 1177-1185, 1997[Web of Science][Medline].

31.   Buse, P, Tran SH, Luther E, Phu PT, Aponte GW, and Firestone GL. Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, Sgk, in mammary tumor cells. J Biol Chem 274: 7253-7263, 1999[Abstract/Free Full Text].

32.   Buse, P, Woo PL, Alexander DB, Reza A, and Firestone GL. Glucocorticoid-induced functional polarity of growth factor responsiveness regulates tight junction dynamics in transformed mammary epithelial tumor cells. J Biol Chem 270: 28223-28227, 1995[Abstract/Free Full Text].

33.   Capurro, C, Coutry N, Bonvalet JP, Escoubet B, Garty H, and Farman N. Cellular localization and regulation of CHIF in kidney and colon. Am J Physiol Cell Physiol 271: C753-C762, 1996[Abstract/Free Full Text].

34.   Cha, HH, Cram EJ, Wang EC, Huang AJ, Kasler HG, and Firestone GL. Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21waf1/cip1 promoter in rat hepatoma cells. J Biol Chem 273: 1998-2007, 1998[Abstract/Free Full Text].

35.   Charron, J, and Drouin J. Glucocorticoid inhibition of transcription from episomal proopiomelanocortin gene promoter. Proc Natl Acad Sci USA 83: 8903-8907, 1986[Abstract/Free Full Text].

36.   Chen, S, Bhargava S, Mastroberardino L, Meijer OC, Wang J, Firestone P, Verrey F, and Pearce D. Epithelial sodium channel regualted by aldosterone-induced protein sgk. Proc Nat Acad Sci USA 96: 2514-2519, 1999[Abstract/Free Full Text].

37.   Chen, SY, Wang J, Liu W, and Pearce D. Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor. Am J Physiol Cell Physiol 274: C39-C46, 1998[Abstract/Free Full Text].

38.   Chigaev, A, Lu G, Shi H, Asher C, Xu R, Latter H, Seger R, Garty H, and Reuveny E. In vitro phosphorylation of COOH termini of the epithelial Na+ channel and its effects on channel activity in Xenopus oocytes. Am J Physiol Renal Physiol 280: F1030-F1036, 2001[Abstract/Free Full Text].

39.   Cho, JH, Musch MW, Bookstein CM, McSwine RL, Rabenau K, and Chang EB. Aldosterone stimulates intestinal Na+ absorption in rats by increasing NHE3 expression of the proximal colon. Am J Physiol Cell Physiol 274: C586-C594, 1998[Abstract/Free Full Text].

40.   Cole, TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, and Schutz G. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9: 1608-1621, 1995[Abstract/Free Full Text].

41.   Cram, EJ, Ramos RA, Wang EC, Cha HH, Nishio Y, and Firestone GL. Role of the CCAAT/enhancer binding protein-alpha transcription factor in the glucocorticoid stimulation of p21waf1/cip1 gene promoter activity in growth-arrested rat hepatoma cells. J Biol Chem 273: 2008-2014, 1998[Abstract/Free Full Text].

42.   Dagenais, A, Denis C, Vives MF, Girouard S, Masse C, Nguyen T, Yamagata T, Grygorczyk C, Kothary R, and Berthiaume Y. Modulation of alpha -ENaC and alpha 1-Na+-K+- ATPase by cAMP and dexamethasone in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 281: L217-L230, 2001[Abstract/Free Full Text].

42a.   Debonneville, C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, and Staub O. Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J 20: 7052-7059, 2001[Web of Science][Medline].

43.   De Kloet, ER, Van Acker SA, Sibug RM, Oitzl MS, Meijer OC, Rahmouni K, and De Jong W. Brain mineralocorticoid receptors and centrally regulated functions. Kidney Int 57: 1329-1336, 2000[Web of Science][Medline].

44.   De Kloet, ER, Vreugdenhil E, Oitzl MS, and Joels M. Brain corticosteroid receptor balance in health and disease. Endocr Rev 19: 269-301, 1998[Abstract/Free Full Text].

45.   De La Rosa, DA, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, and Canessa CM. The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834-37839, 1999[Abstract/Free Full Text].

46.   DePaolo, D, Reusch JE, Carel K, Bhuripanyo P, Leitner JW, and Draznin B. Functional interactions of phosphatidylinositol 3-kinase with GTPase-activating protein in 3T3-L1 adipocytes. Mol Cell Biol 16: 1450-1457, 1996[Abstract].

47.   Dijkink, L, Hartog A, Deen PM, Van Os CH, and Bindels RJ. Time-dependent regulation by aldosterone of the amiloride-sensitive Na+ channel in rabbit kidney. Pflügers Arch 438: 354-360, 1999[Web of Science][Medline].

48.   Drouin, J, Sun YL, Chamberland M, Gauthier Y, De Lean A, Nemer M, and Schmidt TJ. Novel glucocorticoid receptor complex with DNA element of the hormone-repressed POMC gene. EMBO J 12: 145-156, 1993[Web of Science][Medline].

49.   Drouin, J, Trifiro MA, Plante RK, Nemer M, Eriksson P, and Wrange O. Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9: 5305-5314, 1989[Abstract/Free Full Text].

50.   Edinger, RS, Rokaw MD, and Johnson JP. Vasopressin stimulates sodium transport in A6 cells via a phosphatidylinositide 3-kinase-dependent pathway. Am J Physiol Renal Physiol 277: F575-F579, 1999[Abstract/Free Full Text].

51.   Farman, N, and Rafestin-Oblin ME. Multiple aspects of mineralocorticoid selectivity. Am J Physiol Renal Physiol 280: F181-F192, 2001[Abstract/Free Full Text].

52.   Feraille, E, and Doucet A. Sodium-potassium-adenosinetriphosphatase-dependent sodium transport in the kidney: hormonal control. Physiol Rev 81: 345-418, 2001[Abstract/Free Full Text].

53.   Ferrari, P, and Krozowski Z. Role of the 11beta-hydroxysteroid dehydrogenase type 2 in blood pressure regulation. Kidney Int 57: 1374-1381, 2000[Web of Science][Medline].

54.   Fisher, KA, Lee SH, Walker J, Dileto-Fang C, Ginsberg L, and Stapleton SR. Regulation of proximal tubule sodium/hydrogen antiporter with chronic volume contraction. Am J Physiol Renal Physiol 280: F922-F926, 2001[Abstract/Free Full Text].

55.   Foschi, M, Chari S, Dunn MJ, and Sorokin A. Biphasic activation of p21ras by endothelin-1 sequentially activates the ERK cascade and phosphatidylinositol 3-kinase. EMBO J 16: 6439-6451, 1997[Web of Science][Medline].

56.   Frindt, G, Masilamani S, Knepper MA, and Palmer LG. Activation of epithelial Na channels during short-term Na deprivation. Am J Physiol Renal Physiol 280: F112-F118, 2001[Abstract/Free Full Text].

57.   Fuller, PJ, Lim-Tio SS, and Brennan FE. Specificity in mineralocorticoid versus glucocorticoid action. Kidney Int 57: 1256-1264, 2000[Web of Science][Medline].

58.   Funder, JW. Glucocorticoid and mineralocorticoid receptors: biology and clinical relevance. Annu Rev Med 48: 231-240, 1997[Web of Science][Medline].

59.   Garty, H, and Edelman IS. Amiloride-sensitive trypsinization of apical sodium channels. Analysis of hormonal regulation of sodium transport in toad bladder. J Gen Physiol 81: 785-803, 1983[Abstract/Free Full Text].

60.   Garty, H, and Palmer LG. Epithelial sodium channels: function, structure, and regulation. Physiol Rev 77: 359-396, 1997[Abstract/Free Full Text].

61.   Geheb, M, Alvis R, Hercker E, and Cox M. Mineralocorticoid-specificity of aldosterone-induced protein synthesis in giant-toad (Bufo marinus) urinary bladders. Biochem J 214: 29-35, 1983[Web of Science][Medline].

62.   Geheb, M, Alvis R, Owen A, Hercker E, and Cox M. Steroid-induced protein synthesis in giant-toad (Bufo marinus) urinary bladders. Correlation with natriferic activity. Biochem J 218: 221-228, 1984[Web of Science][Medline].

63.   Geheb, M, Hercker E, Singer I, and Cox M. Subcellular localization of aldosterone-induced proteins in toad urinary bladders. Biochim Biophys Acta 641: 422-426, 1981[Medline].

64.   Geheb, M, Huber G, Hercker E, and Cox M. Aldosterone-induced proteins in toad urinary bladders. Identification and characterization using two-dimensional polyacrylamide gel electrophoresis. J Biol Chem 256: 11716-11723, 1981[Abstract/Free Full Text].

65.   Gonzalez-Robayna, IJ, Alliston TN, Buse P, Firestone GL, and Richards JS. Functional and subcellular changes in the A-kinase-signaling pathway: relation to aromatase and Sgk expression during the transition of granulosa cells to luteal cells. Mol Endocrinol 13: 1318-1337, 1999[Abstract/Free Full Text].

66.   Guan, KL, Figueroa C, Brtva TR, Zhu T, Taylor J, Barber TD, and Vojtek AB. Negative regulation of the serine/threonine kinase B-Raf by Akt. J Biol Chem 275: 27354-27359, 2000[Abstract/Free Full Text].

67.   Hager, H, Kwon TH, Vinnikova AK, Masilamani S, Brooks HL, Frokiær J, Knepper MA, and Nielsen S. Immunocytochemical and immunoelectron microscopic localization of alpha -, beta -, and gamma -ENaC in rat kidney. Am J Physiol Renal Physiol 280: F1093-F1106, 2001[Abstract/Free Full Text].

68.   Hamilton, KL, and Butt AG. The molecular basis of renal tubular transport disorders. Comp Biochem Physiol A Mol Integr Physiol 126: 305-321, 2000[Medline].

69.   Hansson, JH, Schild L, Lu Y, Wilson TA, Gautschi I, Shimkets R, Nelson-Williams C, Rossier BC, and Lifton RP. A de novo missense mutation of the beta subunit of the epithelial sodium channel causes hypertension and Liddle syndrome, identifying a proline-rich segment critical for regulation of channel activity. Proc Natl Acad Sci USA 92: 11495-11499, 1995[Abstract/Free Full Text].

70.   Harvey, BJ, Condliffe S, and Doolan CM. Sex and salt hormones: rapid effects in epithelia. News Physiol Sci 16: 174-177, 2001[Abstract/Free Full Text].

71.   Hayashi, M, Tapping RI, Chao TH, Lo JF, King CC, Yang Y, and Lee JD. BMK1 mediates growth factor-induced cell proliferation through direct cellular activation of serum and glucocorticoid-inducible kinase. J Biol Chem 276: 8631-8634, 2001[Abstract/Free Full Text].

72.   Heck, S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, and Cato AC. A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1. EMBO J 13: 4087-4095, 1994[Web of Science][Medline].

73.   Helman, SI, Liu X, Baldwin K, Blazer-Yost BL, and Els WJ. Time-dependent stimulation by aldosterone of blocker-sensitive ENaCs in A6 epithelia. Am J Physiol Cell Physiol 274: C947-C957, 1998[Abstract/Free Full Text].

74.   Helmberg, A, Auphan N, Caelles C, and Karin M. Glucocorticoid-induced apoptosis of human leukemic cells is caused by the repressive function of the glucocorticoid receptor. EMBO J 14: 452-460, 1995[Web of Science][Medline].

75.   Holmes, MC, Kotelevtsev Y, Mullins JJ, and Seckl JR. Phenotypic analysis of mice bearing targeted deletions of 11beta-hydroxysteroid dehydrogenases 1 and 2 genes. Mol Cell Endocrinol 171: 15-20, 2001[Web of Science][Medline].

76.   Hummler, E, and Horisberger JD. Genetic disorders of membrane transport. V. The epithelial sodium channel and its implication in human diseases. Am J Physiol Gastrointest Liver Physiol 276: G567-G571, 1999[Abstract/Free Full Text].

77.  Jun T, Gjoerup O, and Roberts TM. Tangled Webs: Evidence of Cross-Talk Between c-Raf-1 and Akt. Online. http://stke.sciencemag.org/cgi/content/full/OC-sigtrans;1999/13/pe1.

78.   Karin, M. New twists in gene regulation by glucocorticoid receptor: is DNA binding dispensable? Cell 93: 487-490, 1998[Web of Science][Medline].

79.   Karin, M, and Chang L. AP-1-glucocorticoid receptor crosstalk taken to a higher level. J Endocrinol 169: 447-451, 2001[Abstract].

80.   Kemendy, AE, Kleyman TR, and Eaton DC. Aldosterone alters the open probability of amiloride-blockable sodium channels in A6 epithelia. Am J Physiol Cell Physiol 263: C825-C837, 1992[Abstract/Free Full Text].

81.   Kemppainen, RJ, and Behrend EN. Dexamethasone rapidly induces a novel ras superfamily member-related gene in AtT-20 cells. J Biol Chem 273: 3129-3131, 1998[Abstract/Free Full Text].

82.   Khwaja, A, Lehmann K, Marte BM, and Downward J. Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway. J Biol Chem 273: 18793-18801, 1998[Abstract/Free Full Text].

83.   Kim, GH, Masilamani S, Turner R, Mitchell C, Wade JB, and Knepper MA. The thiazide-sensitive Na-Cl cotransporter is an aldosterone-induced protein. Proc Natl Acad Sci USA 95: 14552-14557, 1998[Abstract/Free Full Text].

84.   Kleyman, TR, Coupaye-Gerard B, and Ernst SA. Aldosterone does not alter apical cell-surface expression of epithelial Na+ channels in the amphibian cell line A6. J Biol Chem 267: 9622-9628, 1992[Abstract/Free Full Text].

85.   Kleyman, TR, Zuckerman JB, Middleton P, McNulty KA, Hu B, Su X, An B, Eaton DC, and Smith PR. Cell surface expression and turnover of the alpha -subunit of the epithelial sodium channel. Am J Physiol Renal Physiol 281: F213-F221, 2001[Abstract/Free Full Text].

86.   Kobayashi, T, and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319-328, 1999.

87.   Kolla, V, and Litwack G. Inhibition of mineralocorticoid-mediated transcription by NF-kappaB. Arch Biochem Biophys 383: 38-45, 2000[Web of Science][Medline].

88.   Kolla, V, and Litwack G. Transcriptional regulation of the human Na/K ATPase via the human mineralocorticoid receptor. Mol Cell Biochem 204: 35-40, 2000[Web of Science][Medline].

89.   Kolla, V, Robertson NM, and Litwack G. Identification of a mineralocorticoid/glucocorticoid response element in the human Na/K ATPase alpha1 gene promoter. Biochem Biophys Res Commun 266: 5-14, 1999[Web of Science][Medline].

90.   Kwak, SP, Patel PD, Thompson RC, Akil H, and Watson SJ. 5'-Heterogeneity of the mineralocorticoid receptor messenger ribonucleic acid: differential expression and regulation of splice variants within the rat hippocampus. Endocrinology 133: 2344-2350, 1993[Abstract/Free Full Text].

91.   Lang, P, Gamper N, Fillon S, Friedrich B, Beck S, Huber S, Wagner C, and Lang F. Regulation of Voltage Gated K-Channels by the Serum and Glucocorticoid Dependent Kinases Sgk1, 2, 3 (Abstract). In: Int Union Physiol Sci, 2001, p. 8-30.

92.   Laverty, G, Bjarnadottir S, Elbrond VS, and Arnason SS. Aldosterone suppresses expression of an avian colonic sodium-glucose cotransporter. Am J Physiol Regulatory Integrative Comp Physiol 281: R1041-R1050, 2001[Abstract/Free Full Text].

93.   Le Menuet, D, Viengchareun S, Penfornis P, Walker F, Zennaro MC, and Lombes M. Targeted oncogenesis reveals a distinct tissue-specific utilization of alternative promoters of the human mineralocorticoid receptor gene in transgenic mice. J Biol Chem 275: 7878-7886, 2000[Abstract/Free Full Text].

94.   Lee, JE, Beck TW, Brennscheidt U, DeGennaro LJ, and Rapp UR. The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1). Genomics 20: 43-55, 1994[Web of Science][Medline].

95.   Lee, JE, Beck TW, Wojnowski L, and Rapp UR. Regulation of A-raf expression. Oncogene 12: 1669-1677, 1996[Web of Science][Medline].

96.   Li, M, Ye X, Woodward RN, Zhu C, Nichols LA, and Holland LJ. Analysis of the DNA-binding site for Xenopus glucocorticoid receptor accessory factor. Critical nucleotides for binding specificity in vitro and for amplification of steroid-induced fibrinogen gene transcription. J Biol Chem 273: 9790-9796, 1998[Abstract/Free Full Text].

97.   Lifton, RP, Gharavi AG, and Geller DS. Molecular mechanisms of human hypertension. Cell 104: 545-556, 2001[Web of Science][Medline].

98.   Lin, HH, Zentner MD, Ho HL, Kim KJ, and Ann DK. The gene expression of the amiloride-sensitive epithelial sodium channel alpha-subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells. J Biol Chem 274: 21544-21554, 1999[Abstract/Free Full Text].

99.   Liu, W, Wang J, Sauter NK, and Pearce D. Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci USA 92: 12480-12484, 1995[Abstract/Free Full Text].

100.   Loffing, J, Pietri L, Aregger F, Bloch-Faure M, Ziegler U, Meneton P, Rossier BC, and Kaissling B. Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets. Am J Physiol Renal Physiol 279: F252-F258, 2000[Abstract/Free Full Text].

101.   Loffing, J, Zecevic M, Feraille E, Kaissling B, Asher C, Rossier BC, Firestone GL, Pearce D, and Verrey F. Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am J Physiol Renal Physiol 280: F675-F682, 2001[Abstract/Free Full Text].

102.  MacFarlane SN and Levitan IB. Unzipping Ion Channels. Online. www.stke.org/cgi/content/full/OC_sigtrans; 2001/98/pe1, 1-2. 9-4, 2001.

103.   Magnuson, NS, Beck T, Vahidi H, Hahn H, Smola U, and Rapp UR. The Raf-1 serine/threonine protein kinase. Semin Cancer Biol 5: 247-253, 1994[Web of Science][Medline].

104.   Maiyar, AC, Phu PT, Huang AJ, and Firestone GL. Repression of glucocorticoid receptor transactivation and DNA binding of a glucocorticoid response element within the serum/glucocorticoid- inducible protein kinase (sgk) gene promoter by the p53 tumor suppressor protein. Mol Endocrinol 11: 312-329, 1997[Abstract/Free Full Text].

105.   Malkoski, SP, and Dorin RI. Composite glucocorticoid regulation at a functionally defined negative glucocorticoid response element of the human corticotropin-releasing hormone gene. Mol Endocrinol 13: 1629-1644, 1999[Abstract/Free Full Text].

106.   Malkoski, SP, Handanos CM, and Dorin RI. Localization of a negative glucocorticoid response element of the human corticotropin releasing hormone gene. Mol Cell Endocrinol 127: 189-199, 1997[Web of Science][Medline].

107.   Masilamani, S, Kim GH, Mitchell C, Wade JB, and Knepper MA. Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104: R19-R23, 1999[Medline].

108.   Massaad, C, Houard N, Lombes M, and Barouki R. Modulation of human mineralocorticoid receptor function by protein kinase A. Mol Endocrinol 13: 57-65, 1999[Abstract/Free Full Text].

109.   Mastroberardino, L, Spindler B, Forster I, Loffing J, Assandri R, May A, and Verrey F. Ras pathway activates epithelial Na channel and decreases its surface expression in Xenopus oocytes. Mol Biol Cell 9: 3417-3427, 1998[Abstract/Free Full Text].

110.   May, A, Puoti A, Gaeggeler HP, Horisberger JD, and Rossier BC. Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells. J Am Soc Nephrol 8: 1813-1822, 1997[Abstract].

111.   McKay, LI, and Cidlowski JA. Cross-talk between nuclear factor-kappa B and the steroid hormone receptors: mechanisms of mutual antagonism. Mol Endocrinol 12: 45-56, 1998[Abstract/Free Full Text].

112.   McKay, LI, and Cidlowski JA. Molecular control of immune/inflammatory responses: interactions between nuclear factor-kappa B and steroid receptor-signaling pathways. Endocr Rev 20: 435-459, 1999[Abstract/Free Full Text].

113.   McKay, LI, and Cidlowski JA. CBP (CREB binding protein) integrates NF-kappaB (nuclear factor-kappaB) and glucocorticoid receptor physical interactions and antagonism. Mol Endocrinol 14: 1222-1234, 2000[Abstract/Free Full Text].

114.   Mick, VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, and Thomas CP. The alpha-subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5'-flanking region of the gene. Mol Endocrinol 15: 575-588, 2001[Abstract/Free Full Text].

115.   Mikosz, CA, Brickley DR, Sharkey MS, Moran TW, and Conzen SD. Glucocorticoid receptor-mediated protection from apoptosis is associated with induction of the serine/threonine survival kinase gene, sgk-1. J Biol Chem 276: 16649-16654, 2001[Abstract/Free Full Text].

116.   Mizuno, H, and Nishida E. The ERK MAP kinase pathway mediates induction of SGK (serum- and glucocorticoid-inducible kinase) by growth factors. Genes Cells 6: 261-268, 2001[Abstract].

117.   Morin, B, Woodcock GR, Nichols LA, and Holland LJ. Heterodimerization between the glucocorticoid receptor and the unrelated DNA-binding protein, Xenopus glucocorticoid receptor accessory factor. Mol Endocrinol 15: 458-466, 2001[Abstract/Free Full Text].

118.   Morin, B, Zhu C, Woodcock GR, Li M, Woodward RN, Nichols LA, and Holland LJ. The binding site for Xenopus glucocorticoid receptor accessory factor and a single adjacent half-GRE form an independent glucocorticoid response unit. Biochemistry 39: 12234-12242, 2000[Medline].

119.   Naray-Fejes-Toth, A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. sgk is an aldosterone-induced kinase in the renal collecting duct. J Biol Chem 274: 16973-16978, 1999[Abstract/Free Full Text].

120.   Naray-Fejes-Toth, A, and Fejes-Toth G. The sgk, an aldosterone-induced gene in mineralocorticoid target cells, regulates the epithelial sodium channel. Kidney Int 57: 1290-1294, 2000[Web of Science][Medline].

121.   Neades, R, Betz NA, Sheng XY, and Pelling JC. Transient expression of the cloned mouse c-Ha-ras 5' upstream region in transfected primary SENCAR mouse keratinocytes demonstrates its power as a promoter element. Mol Carcinog 4: 369-375, 1991[Web of Science][Medline].

122.   Park, J, Leong ML, Buse P, Maiyar AC, Firestone GL, and Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024-3033, 1999[Web of Science][Medline].

123.   Paunescu, TG, Blazer-Yost BL, Vlahos CJ, and Helman SI. LY-294002-inhibitable PI 3-kinase and regulation of baseline rates of Na+ transport in A6 epithelia. Am J Physiol Cell Physiol 279: C236-C247, 2000[Abstract/Free Full Text].

124.   Pearce, D. The role of SGK1 in hormone-regulated sodium transport. Trends Endocrinol Metab 12: 341-347, 2001[Web of Science][Medline].

125.   Pearce, D, Verrey F, Chen SY, Mastroberardino L, Meijer OC, Wang J, and Bhargava A. Role of SGK in mineralocorticoid-regulated sodium transport. Kidney Int 57: 1283-1289, 2000[Web of Science][Medline].

126.   Penfornis, P, Viengchareun S, Le Menuet D, Cluzeaud F, Zennaro MC, and Lombes M. The mineralocorticoid receptor mediates aldosterone-induced differentiation of T37i cells into brown adipocytes. Am J Physiol Endocrinol Metab 279: E386-E394, 2000[Abstract/Free Full Text].

127.   Pethe, V, and Shekhar PV. Estrogen inducibility of c-Ha-ras transcription in breast cancer cells. Identification of functional estrogen-responsive transcriptional regulatory elements in exon 1/intron 1 of the c-Ha-ras gene. J Biol Chem 274: 30969-30978, 1999[Abstract/Free Full Text].

128.   Pfeiffer, R, Beron J, and Verrey F. Regulation of Na+ pump function by aldosterone is alpha-subunit isoform specific. J Physiol (Lond) 516: 647-655, 1999[Abstract/Free Full Text].

129.   Pitt, B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, Palensky J, and Wittes J. The effect of spironolactone on morbidity and mortality in patients with severe heart failure. Randomized aldactone evaluation study investigators. N Engl J Med 341: 709-717, 1999[Abstract/Free Full Text].

130.   Prefontaine, GG, Lemieux ME, Giffin W, Schild-Poulter C, Pope L, LaCasse E, Walker P, and Hache RJ. Recruitment of octamer transcription factors to DNA by glucocorticoid receptor. Mol Cell Biol 18: 3416-3430, 1998[Abstract/Free Full Text].

131.   Ramage, LE, Christy C, Seckl JR, and Brown RW. Assessment of 2 candidate aldosterone regulated genes, Sgk and c-KRas-2, in adult kidney and during development (Abstract). J Endocrinol 164: 293, 2000.

132.   Rameh, LE, Arvidsson A, Carraway KL, Couvillon AD, III, Rathbun G, Crompton A, VanRenterghem B, Czech MP, Ravichandran KS, Burakoff SJ, Wang DS, Chen CS, and Cantley LC. A comparative analysis of the phosphoinositide binding specificity of pleckstrin homology domains. J Biol Chem 272: 22059-22066, 1997[Abstract/Free Full Text].

133.   Record, RD, Froelich LL, Vlahos CJ, and Blazer-Yost BL. Phosphatidylinositol 3-kinase activation is required for insulin-stimulated sodium transport in A6 cells. Am J Physiol Endocrinol Metab 274: E611-E617, 1998[Abstract/Free Full Text].

134.   Reichardt, HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, and Schutz G. DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93: 531-541, 1998[Web of Science][Medline].

135.   Robert-Nicoud, M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger JD, Vandewalle A, Rossier BC, and Firsov D. Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc Natl Acad Sci USA 98: 2712-2716, 2001[Abstract/Free Full Text].

136.   Roberts, LR, and Holland LJ. Coordinate transcriptional regulation of the three fibrinogen subunit genes by glucocorticoids in cultured primary liver cells from Xenopus laevis. Endocrinology 132: 2563-2570, 1993[Abstract/Free Full Text].

137.   Rogerson, FM, and Fuller PJ. Mineralocorticoid action. Steroids 65: 61-73, 2000[Web of Science][Medline].

138.   Rommel, C, Clarke BA, Zimmermann S, Nunez L, Rossman R, Reid K, Moelling K, Yancopoulos GD, and Glass DJ. Differentiation stage-specific inhibition of the Raf-MEK-ERK pathway by Akt. Science 286: 1738-1741, 1999[Abstract/Free Full Text].

139.   Rotin, D, Kanelis V, and Schild L. Trafficking and cell surface stability of ENaC. Am J Physiol Renal Physiol 281: F391-F399, 2001[Abstract/Free Full Text].

140.   Rupprecht, R, Arriza JL, Spengler D, Reul JM, Evans RM, Holsboer F, and Damm K. Transactivation and synergistic properties of the mineralocorticoid receptor: relationship to the glucocorticoid receptor. Mol Endocrinol 7: 597-603, 1993[Abstract/Free Full Text].

141.   Sakai, DD, Helms S, Carlstedt-Duke J, Gustafsson JA, Rottman FM, and Yamamoto KR. Hormone-mediated repression: a negative glucocorticoid response element from the bovine prolactin gene. Genes Dev 2: 1144-1154, 1988[Abstract/Free Full Text].

142.   Sayegh, R, Auerbach SD, Li X, Loftus RW, Husted RF, Stokes JB, and Thomas CP. Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5'-flanking region of the human epithelial sodium channel alpha subunit gene. J Biol Chem 274: 12431-12437, 1999[Abstract/Free Full Text].

143.   Schild, L, Lu Y, Gautschi I, Schneeberger E, Lifton RP, and Rossier BC. Identification of a PY motif in the epithelial Na channel subunits as a target sequence for mutations causing channel activation found in Liddle syndrome. EMBO J 15: 2381-2387, 1996[Web of Science][Medline].

144.   Schlatter, E, Lohrmann E, and Greger R. Properties of the potassium conductances of principal cells of rat cortical collecting ducts. Pflügers Arch 420: 39-45, 1992[Web of Science][Medline].

145.   Scott, DK, Mitchell JA, and Granner DK. The orphan receptor COUP-TF binds to a third glucocorticoid accessory factor element within the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271: 31909-31914, 1996[Abstract/Free Full Text].

146.   Scott, WN, and Sapirsten SV. Identification of aldosterone-induced proteins in the toad's urinary bladder. Proc Nat Acad Sci USA 72: 4056-4060, 1975[Abstract/Free Full Text].

147.   Sha, Q, Lansbery KL, Distefano D, Mercer RW, and Nichols CG. Heterologous expression of the Na(+),K(+)-ATPase gamma subunit in Xenopus oocytes induces an endogenous, voltage-gated large diameter pore. J Physiol (Lond) 535: 407-417, 2001[Abstract/Free Full Text].

148.   Shapiro, PS, and Ahn NG. Feedback regulation of Raf-1 and mitogen-activated protein kinase (MAP) kinase kinases 1 and 2 by MAP kinase phosphatase-1 (MKP-1). J Biol Chem 273: 1788-1793, 1998[Abstract/Free Full Text].

149.   Shekhar, PV, and Miller FR. Correlation of differences in modulation of ras expression with metastatic competence of mouse mammary tumor subpopulations. Invasion Metastasis 14: 27-37, 1994[Web of Science][Medline].

150.   Shi, H, Levy-Holzman R, Cluzeaud F, Farman N, and Garty H. Membrane topology and immunolocalization of CHIF in kidney and intestine. Am J Physiol Renal Physiol 280: F505-F512, 2001[Abstract/Free Full Text].

151.   Shigaev, A, Asher C, Latter H, Garty H, and Reuveny E. Regulation of sgk by aldosterone and its effects on the epithelial Na+ channel. Am J Physiol Renal Physiol 278: F613-F619, 2000[Abstract/Free Full Text].

152.   Shimkets, RA, Lifton R, and Canessa CM. In vivo phosphorylation of the epithelial sodium channel. Proc Natl Acad Sci USA 95: 3301-3305, 1998[Abstract/Free Full Text].

153.   Snyder, PM, Olson DR, and Thomas BC. Serum and glucocorticoid-regulated kinase modulates Nedd4-2-mediated inhibition of ENaC. J Biol Chem 277: 5-8, 2001[Abstract/Free Full Text].

154.   Spindler, B, Mastroberardino L, Custer M, and Verrey F. Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434: 323-331, 1997[Web of Science][Medline].

155.   Spindler, B, and Verrey F. Aldosterone action: induction of p21(ras) and fra-2 and transcription-independent decrease in myc, jun, and fos. Am J Physiol Cell Physiol 276: C1154-C1161, 1999[Abstract/Free Full Text].

156.   Staub, O, Abriel H, Plant P, Ishikawa T, Kanelis V, Saleki R, Horisberger JD, Schild L, and Rotin D. Regulation of the epithelial Na+ channel by Nedd4 and ubiquitination. Kidney Int 57: 809-815, 2000[Web of Science][Medline].

157.   Staub, O, Gautschi I, Ishikawa T, Breitschopf K, Ciechanover A, Schild L, and Rotin D. Regulation of stability and function of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J 16: 6325-6336, 1997[Web of Science][Medline].

158.   Stockand, JD, Bao HF, Schenck J, Malik B, Middleton P, Schlanger LE, and Eaton DC. Differential effects of protein kinase C on the levels of epithelial Na channel subunit proteins. J Biol Chem 275: 25760-25765, 2000[Abstract/Free Full Text].

159.  Stockand JD, Edinger R, Eaton DC, and Johnson JP. Toward understanding the role of methylation in aldosterone-sensitive Na transport (Abstract). News Physiol Sci 15: 2000.

160.   Stockand, JD, Johnson JP, and Edinger RS. Aldosterone signaling to the epithelial Na channel (Abstract). J Am Soc Nephrol 12: 40A, 2001.

161.   Stockand, JD, Spier BJ, Worrell RT, Yue G, Al-Baldawi N, and Eaton DC. Regulation of Na reabsorption by the aldosterone-induced, small G protein K-Ras2A. J Biol Chem 274: 35449-35454, 1999[Abstract/Free Full Text].

162.   Stockand, JD, Zeltwanger S, Bao HF, Worrell R, and Eaton DC. S-adenosyl-L-homocysteine hydrolase is necessary for aldosterone-induced activity of epithelial Na channels. Am J Physiol Cell Physiol 281: C773-C785, 2001[Abstract/Free Full Text].

163.   Stoecklin, E, Wissler M, Moriggl R, and Groner B. Specific DNA binding of Stat5, but not of glucocorticoid receptor, is required for their functional cooperation in the regulation of gene transcription. Mol Cell Biol 17: 6708-6716, 1997[Abstract].

164.   Storm, SM, Cleveland JL, and Rapp UR. Expression of raf family proto-oncogenes in normal mouse tissues. Oncogene 5: 345-351, 1990[Web of Science][Medline].

165.   Strawhecker, JM, Betz NA, Neades RY, Houser W, and Pelling JC. Binding of the 97 kDa glucocorticoid receptor to the 5' upstream flanking region of the mouse c-Ha-ras oncogene. Oncogene 4: 1317-1322, 1989[Web of Science][Medline].

166.   Sugiyama, T, Scott DK, Wang JC, and Granner DK. Structural requirements of the glucocorticoid and retinoic acid response units in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 12: 1487-1498, 1998[Abstract/Free Full Text].

167.   Sweadner, KJ, and Rael E. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics 68: 41-56, 2000[Web of Science][Medline].

168.   Szerlip, H, Palevsky P, Cox M, and Blazer-Yost B. Relationship of the aldosterone-induced protein, GP70, to the conductive Na+ channel. J Am Soc Nephrol 2: 1108-1114, 1991[Abstract].

169.   Szerlip, HM, and Cox M. Aldosterone-induced glycoproteins: further characterization. J Steroid Biochem 32: 815-822, 1989[Web of Science][Medline].

170.   Szerlip, HM, Weisberg L, Clayman M, Neilson E, Wade JB, and Cox M. Aldosterone-induced proteins: purification and localization of GP65,70. Am J Physiol Cell Physiol 256: C865-C872, 1989[Abstract/Free Full Text].

171.   Therien, AG, Karlish SJ, and Blostein R. Expression and functional role of the gamma subunit of the Na, K-ATPase in mammalian cells. J Biol Chem 274: 12252-12256, 1999[Abstract/Free Full Text].

172.   Trapp, T, Rupprecht R, Castren M, Reul JM, and Holsboer F. Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13: 1457-1462, 1994[Web of Science][Medline].

173.   Tu, Y, and Wu C. Cloning, expression and characterization of a novel human Ras-related protein that is regulated by glucocorticoid hormone. Biochim Biophys Acta 1489: 452-456, 1999[Medline].

174.   Turnamian, SG, and Binder HJ. Aldosterone and glucocorticoid receptor-specific agonists regulate ion transport in rat proximal colon. Am J Physiol Gastrointest Liver Physiol 258: G492-G498, 1990[Abstract/Free Full Text].

175.   Vanhaesebroeck, B, and Alessi DR. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 346: 561-576, 2000.

176.   Verrey, F. Transcriptional control of sodium transport in tight epithelial by adrenal steroids. J Membr Biol 144: 93-110, 1995[Web of Science][Medline].

177.   Verrey, F. Early aldosterone action: toward filling the gap between transcription and transport. Am J Physiol Renal Physiol 277: F319-F327, 1999[Abstract/Free Full Text].

178.   Verrey, F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, and Zecevic M. Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int 57: 1277-1282, 2000[Web of Science][Medline].

179.   Wagner, CA, Ott M, Klingel K, Beck S, Friedrich B, Wild KN, Broer S, Moschen I, Albers A, Waldegger S, Tummler B, Egan ME, Geibel JP, Kandolf R, and Lang F. Effects of the serine/threonine kinase sgk1 on the epithelial Na(+) channel (eNaC) and CFTR: implications for cystic fibrosis. Cell Physiol Biochem 11: 209-218, 2001[Web of Science][Medline].

180.   Wald, H, Garty H, Palmer LG, and Popovtzer MM. Differential regulation of ROMK expression in kidney cortex and medulla by aldosterone and potassium. Am J Physiol Renal Physiol 275: F239-F245, 1998[Abstract/Free Full Text].

181.   Wald, H, Goldstein O, Asher C, Yagil Y, and Garty H. Aldosterone induction and epithelial distribution of CHIF. Am J Physiol Renal Fluid Electrolyte Physiol 271: F322-F329, 1996[Abstract/Free Full Text].

182.   Wald, H, Popovtzer MM, and Garty H. Differential regulation of CHIF mRNA by potassium intake and aldosterone. Am J Physiol Renal Physiol 272: F617-F623, 1997[Abstract/Free Full Text].

183.   Waltner-Law, M, Daniels MC, Sutherland C, and Granner DK. NF-kappa B inhibits glucocorticoid and cAMP-mediated expression of the phosphoenolpyruvate carboxykinase gene. J Biol Chem 275: 31847-31856, 2000[Abstract/Free Full Text].

184.   Wang, HC, Zentner MD, Deng HT, Kim KJ, Wu R, Yang PC, and Ann DK. Oxidative stress disrupts glucocorticoid hormone-dependent transcription of the amiloride-sensitive epithelial sodium channel alpha-subunit in lung epithelial cells through ERK-dependent and thioredoxin-sensitive pathways. J Biol Chem 275: 8600-8609, 2000[Abstract/Free Full Text].

185.   Wang, J, Barbry P, Maiyar AC, Rozansky DJ, Bhargava A, Leong M, Firestone GL, and Pearce D. SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. Am J Physiol Renal Physiol 280: F303-F313, 2001[Abstract/Free Full Text].

186.   Webster, MK, Goya L, and Firestone GL. Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem 268: 11482-11485, 1993[Abstract/Free Full Text].

187.   Webster, MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031-2040, 1993[Abstract/Free Full Text].

188.   Wehling, M. Specific, nongenomic actions of steroid hormones. Annu Rev Physiol 59: 365-393, 1997[Web of Science][Medline].

189.   Weisz, OA, Wang JM, Edinger RS, and Johnson JP. Non-coordinate regulation of endogenous epithelial sodium channel (ENaC) subunit expression at the apical membrane of A6 cells in response to various transporting conditions. J Biol Chem 275: 39886-39893, 2000[Abstract/Free Full Text].

190.   Woo, PL, Ching D, Guan Y, and Firestone GL. Requirement for Ras and phosphatidylinositol 3-kinase signaling uncouples the glucocorticoid-induced junctional organization and transepithelial electrical resistance in mammary tumor cells. J Biol Chem 274: 32818-32828, 1999[Abstract/Free Full Text].

191.   Wulff, P, Vallon V, Huang DY, Pfaff I, Klingel K, Kauselmann D, Volkl H, Lang F, and Kuhl D. Deficient salt retention in the SGK1 knockout mouse (Abstract). J Am Soc Nephrol 12: 44A, 2001.

192.   Yan, J, Roy S, Apolloni A, Lane A, and Hancock JF. Ras isoforms vary in their ability to activate Raf-1 and phosphoinositide 3-kinase. J Biol Chem 273: 24052-24056, 1998[Abstract/Free Full Text].

193.   Yang-Yen, HF, Chambard JC, Sun YL, Smeal T, Schmidt TJ, Drouin J, and Karin M. Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein- protein interaction. Cell 62: 1205-1215, 1990[Web of Science][Medline].

194.  Zecevic M, Summa V, Bens M, Vandewalle A, Pearce D, and Verrey F. Does SGK mediate aldosterone action on both apical (ENaC) and basolateral (Na,K ATPase) Na transport proteins (Abstract)? J Am Soc Nephrol 12: 45A. 2001.

195.   Zennaro, MC, Farman N, Bonvalet JP, and Lombes M. Tissue-specific expression of alpha and beta messenger ribonucleic acid isoforms of the human mineralocorticoid receptor in normal and pathological states. J Clin Endocrinol Metab 82: 1345-1352, 1997[Abstract/Free Full Text].

196.   Zennaro, MC, Souque A, Viengchareun S, Poisson E, and Lombes M. A new human mr splice variant is a ligand-independent transactivator modulating corticosteroid action. Mol Endocrinol 15: 1586-1598, 2001[Abstract/Free Full Text].

197.   Zentner, MD, Lin HH, Deng HT, Kim KJ, Shih HM, and Ann DK. Requirement for high mobility group protein HMGI-C interaction with STAT3 inhibitor PIAS3 in repression of alpha-subunit of epithelial Na+ channel (alpha-ENaC) transcription by Ras activation in salivary epithelial cells. J Biol Chem 276: 29805-29814, 2001[Abstract/Free Full Text].

198.   Zentner, MD, Lin HH, Wen X, Kim KJ, and Ann DK. The amiloride-sensitive epithelial sodium channel alpha-subunit is transcriptionally down-regulated in rat parotid cells by the extracellular signal-regulated protein kinase pathway. J Biol Chem 273: 30770-30776, 1998[Abstract/Free Full Text].

199.   Zhang, BH, Tang ED, Zhu T, Greenberg ME, Vojtek AB, and Guan KL. Serum- and glucocorticoid-inducible kinase SGK phosphorylates and negatively regulates B-Raf. J Biol Chem 276: 31620-31626, 2001[Abstract/Free Full Text].

200.   Zhang, Z, Jones S, Hagood JS, Fuentes NL, and Fuller GM. STAT3 acts as a co-activator of glucocorticoid receptor signaling. J Biol Chem 272: 30607-30610, 1997[Abstract/Free Full Text].

201.   Zhou, MY, Gomez-Sanchez CE, and Gomez-Sanchez EP. An alternatively spliced rat mineralocorticoid receptor mRNA causing truncation of the steroid binding domain. Mol Cell Endocrinol 159: 125-131, 2000[Web of Science][Medline].

202.   Zimmermann, S, and Moelling K. Phosphorylation and regulation of Raf by Akt (protein kinase B). Science 286: 1741-1744, 1999[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 282(4):F559-F576
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Just
Going with the Wnt? Focus on "Hyperaldosteronism, hypervolemia, and increased blood pressure in mice expressing defective APC"
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R568 - R570.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. Aldehni, M. Spitzner, J. R. Martins, R. Barro-Soria, R. Schreiber, and K. Kunzelmann
Bestrophin 1 Promotes Epithelial-to-mesenchymal Transition of Renal Collecting Duct Cells
J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1556 - 1564.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. H. Kim, K. X. Kim, N. N. Raveendran, T. Wu, S. R. Pondugula, and D. C. Marcus
Regulation of ENaC-mediated sodium transport by glucocorticoids in Reissner's membrane epithelium
Am J Physiol Cell Physiol, March 1, 2009; 296(3): C544 - C557.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Grossmann, R. Freudinger, S. Mildenberger, B. Husse, and M. Gekle
EF Domains Are Sufficient for Nongenomic Mineralocorticoid Receptor Actions
J. Biol. Chem., March 14, 2008; 283(11): 7109 - 7116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Pochynyuk, V. Bugaj, A. Vandewalle, and J. D. Stockand
Purinergic control of apical plasma membrane PI(4,5)P2 levels sets ENaC activity in principal cells
Am J Physiol Renal Physiol, January 1, 2008; 294(1): F38 - F46.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
O. Pochynyuk, J. D. Stockand, and A. Staruschenko
Ion Channel Regulation by Ras, Rho, and Rab Small GTPases
Experimental Biology and Medicine, November 1, 2007; 232(10): 1258 - 1265.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
O. Pochynyuk, Q. Tong, J. Medina, A. Vandewalle, A. Staruschenko, V. Bugaj, and J. D. Stockand
Molecular Determinants of PI(4,5)P2 and PI(3,4,5)P3 Regulation of the Epithelial Na+ Channel
J. Gen. Physiol., September 24, 2007; 130(4): 399 - 413.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
O. Pochynyuk, Q. Tong, A. Staruschenko, and J. D. Stockand
Binding and direct activation of the epithelial Na+ channel (ENaC) by phosphatidylinositides
J. Physiol., April 15, 2007; 580(2): 365 - 372.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Sun, D.-H. Lin, T. Wang, E. Babilonia, Z. Wang, Y. Jin, R. Kemp, A. Nasjletti, and W.-H. Wang
Low Na intake suppresses expression of CYP2C23 and arachidonic acid-induced inhibition of ENaC
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1192 - F1200.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Makhanova, M. L.S. Sequeira-Lopez, R. A. Gomez, H.-S. Kim, and O. Smithies
Disturbed Homeostasis in Sodium-Restricted Mice Heterozygous and Homozygous for Aldosterone Synthase Gene Disruption
Hypertension, December 1, 2006; 48(6): 1151 - 1159.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. R. Cao, P. P. Shi, R. D. Sigmund, R. F. Husted, C. D. Sigmund, R. A. Williamson, J. B. Stokes, and B. Yang
Mice heterozygous for beta-ENaC deletion have defective potassium excretion
Am J Physiol Renal Physiol, July 1, 2006; 291(1): F107 - F115.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Pochynyuk, Q. Tong, A. Staruschenko, H.-P. Ma, and J. D. Stockand
Regulation of the epithelial Na+ channel (ENaC) by phosphatidylinositides
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F949 - F957.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Alvarez de la Rosa, I. Gimenez, B. Forbush, and C. M. Canessa
SGK1 activates Na+-K+-ATPase in amphibian renal epithelial cells
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C492 - C498.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, K. Z. Liu, and H. S. Vats
Medroxyprogesterone acetate binds the glucocorticoid receptor to stimulate {alpha}-ENaC and sgk1 expression in renal collecting duct epithelia
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F306 - F312.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. R. Pondugula, N. N. Raveendran, Z. Ergonul, Y. Deng, J. Chen, J. D. Sanneman, L. G. Palmer, and D. C. Marcus
Glucocorticoid regulation of genes in the amiloride-sensitive sodium transport pathway by semicircular canal duct epithelium of neonatal rat
Physiol Genomics, January 12, 2006; 24(2): 114 - 123.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. Makhanova, G. Lee, N. Takahashi, M. L. Sequeira Lopez, R. A. Gomez, H.-S. Kim, and O. Smithies
Kidney function in mice lacking aldosterone
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F61 - F69.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Wei, E. Babilonia, H. Sterling, Y. Jin, and W.-H. Wang
Mineralocorticoids decrease the activity of the apical small-conductance K channel in the cortical collecting duct
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1065 - F1071.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. M C Connell and E. Davies
The new biology of aldosterone
J. Endocrinol., July 1, 2005; 186(1): 1 - 20.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. D. Stockand
Preserving salt: in vivo studies with Sgk1-deficient mice define a modern role for this ancient protein
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R1 - R3.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
C. A. Wagner, K. E. Finberg, S. Breton, V. Marshansky, D. Brown, and J. P. Geibel
Renal Vacuolar H+-ATPase
Physiol Rev, October 1, 2004; 84(4): 1263 - 1314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. R. Pondugula, J. D. Sanneman, P. Wangemann, P. G. Milhaud, and D. C. Marcus
Glucocorticoids stimulate cation absorption by semicircular canal duct epithelium via epithelial sodium channel
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1127 - F1135.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Grossmann, R. Freudinger, S. Mildenberger, A. W. Krug, and M. Gekle
Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1226 - F1231.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Q. Tong, R. E. Booth, R. T. Worrell, and J. D. Stockand
Regulation of Na+ transport by aldosterone: signaling convergence and cross talk between the PI3-K and MAPK1/2 cascades
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1232 - F1238.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. B. Bruns, B. Hu, Y. J. Ahn, S. Sheng, R. P. Hughey, and T. R. Kleyman
Multiple epithelial Na+ channel domains participate in subunit assembly
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F600 - F609.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. L. Gumz, M. P. Popp, C. S. Wingo, and B. D. Cain
Early transcriptional effects of aldosterone in a mouse inner medullary collecting duct cell line
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F664 - F673.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Norregaard, T. R. Uhrenholt, C. Bistrup, O. Skott, and B. L. Jensen
Stimulation of 11-{beta}-hydroxysteroid dehydrogenase type 2 in rat colon but not in kidney by low dietary NaCl intake
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F348 - F358.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
O. G. Muller, R. G. Parnova, G. Centeno, B. C. Rossier, D. Firsov, and J.-D. Horisberger
Mineralocorticoid Effects in the Kidney: Correlation between {alpha}ENaC, GILZ, and Sgk-1 mRNA Expression and Urinary Excretion of Na+ and K+
J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1107 - 1115.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. E. Booth and J. D. Stockand
Targeted degradation of ENaC in response to PKC activation of the ERK1/2 cascade
Am J Physiol Renal Physiol, May 1, 2003; 284(5): F938 - F947.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Rauz, E. A. Walker, S. V. Hughes, M. Coca-Prados, M. Hewison, P. I. Murray, and P. M. Stewart
Serum- and Glucocorticoid-Regulated Kinase Isoform-1 and Epithelial Sodium Channel Subunits in Human Ocular Ciliary Epithelium
Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1643 - 1651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Alvarez de la Rosa and C. M. Canessa
Role of SGK in hormonal regulation of epithelial sodium channel in A6 cells
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C404 - C414.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. Stockand and J. G. Meszaros
Aldosterone stimulates proliferation of cardiac fibroblasts by activating Ki-RasA and MAPK1/2 signaling
Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H176 - H184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Masilamani, X. Wang, G.-H. Kim, H. Brooks, J. Nielsen, S. Nielsen, K. Nakamura, J. B. Stokes, and M. A. Knepper
Time course of renal Na-K-ATPase, NHE3, NKCC2, NCC, and ENaC abundance changes with dietary NaCl restriction
Am J Physiol Renal Physiol, October 1, 2002; 283(4): F648 - F657.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. Kamynina and O. Staub
Concerted action of ENaC, Nedd4-2, and Sgk1 in transepithelial Na+ transport
Am J Physiol Renal Physiol, September 1, 2002; 283(3): F377 - F387.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. Hendron and J. D. Stockand
Activation of Mitogen-activated Protein Kinase (Mitogen-activated Protein Kinase/Extracellular Signal-regulated Kinase) Cascade by Aldosterone
Mol. Biol. Cell, September 1, 2002; 13(9): 3042 - 3054.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (90)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stockand, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stockand, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online