AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 282: F802-F809, 2002. First published November 20, 2001; doi:10.1152/ajprenal.00123.2001
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/5/F802    most recent
00123.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (24)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maouyo, D.
Right arrow Articles by Kwon, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maouyo, D.
Right arrow Articles by Kwon, H. M.
Vol. 282, Issue 5, F802-F809, May 2002

Mouse TonEBP-NFAT5: expression in early development and alternative splicing

Djikolngar Maouyo, Jee Y. Kim, Sang D. Lee, Yanhong Wu, Seung K. Woo, and Hyug M. Kwon

Division of Nephrology, School of Medicine, Johns Hopkins University, Baltimore, Maryland 21205


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Tonicity-responsive enhancer binding protein (TonEBP)- nuclear factor of activated T cell family 5 is a DNA binding protein that plays a key role in the response of cells to hypertonicity. However, TonEBP is expressed and active in tissues that are in an isotonic milieu. To explore the biological role of TonEBP, we cloned mouse TonEBP that shares 92% of amino acids with the human counterpart. TonEBP is expressed in embryonic stem cells and throughout the stages of fetal development. Immunohistochemical analysis shows expression of TonEBP in most, if not all, developing tissues, including the brain, colon, heart, muscle, and eyes. Widespread alternative splicing in exons 2-4 was detected throughout development and in different adult tissues. As a result, four different polypeptides are produced with different lengths at the NH2 terminus. Two of the isoforms differ in their ability to stimulate transcription. In conclusion, the presence of TonEBP mRNA during mouse embryogenesis suggests that TonEBP functions at all stages of mouse development, as well as in isotonic adult tissues.

organic/compatible osmolytes; hypertonicity; transcription factor; tonicity-responsive enhancer binding protein; nuclear factor of activated T cell family


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

TONICITY-RESPONSIVE ENHANCER (TonE) binding protein (TonEBP) was cloned initially (14) as the key transcription factor that stimulates genes coding for proteins that catalyze cellular accumulation of compatible osmolytes (also called organic osmolytes). These proteins are plasma membrane transporters for compatible osmolytes, the sodium-myo-inositol cotransporter and sodium-chloride-betaine cotransporter, and aldose reductase, which reduces glucose to sorbitol, another compatible osmolyte (7). When cells are exposed to a hypertonic environment, the activity of TonEBP is enhanced because of a combination of increased nuclear translocation (2) and increased overall abundance (induction) (19). The ensuing increase in activity of the transporters and aldose reductase leads to cellular accumulation of compatible osmolytes. In the hypertonic renal medulla, the accumulation of compatible osmolytes lowers cellular ionic strength toward an isotonic level (1). Because high cellular ionic strength causes DNA damage (10) and cell death (5), lowering cellular ionic strength toward an isotonic level is critical for survival of renal medullary cells. Thus TonEBP plays a key regulatory role in protecting the renal medulla from the deadly stress of hypertonicity.

Near the NH2 terminus of TonEBP is a domain of ~300 amino acids that shares ~42% of its amino acids with the Rel homology domain of the nuclear factor of the activated T cell family (NFAT) (12, 13, 14). On the basis of this homology, TonEBP is also called NFAT5 (12) or NFATL1 (18). Indeed, expression of TonEBP is markedly increased in T cells after activation of the T cell receptor (18), and TonEBP stimulates transcription of tumor necrosis factor-alpha and lymphotoxin-beta in response to hypertonicity (11). However, unlike the NFAT family, nuclear localization of TonEBP is not regulated by calcineurin, and TonEBP does not interact with activator protein-1 for DNA binding (13). In addition, TonEBP appears to form a dimer by means of its Rel homology domain-like nuclear factor-kappa B, even though the similarity in amino acid sequence is minimal (12, 13). TonEBP is clearly different from the NFAT family in structure and regulation despite the similarity in amino acid sequence.

Although TonEBP plays a key role in hypertonicity-induced stimulation of gene transcription in the renal medulla and T cells, TonEBP is active under isotonic conditions. Expression of dominant-negative TonEBP reduces TonE-driven transcription under isotonic conditions (14). Exposure of cells to hypotonicity (low osmolality) results in decreased activity of TonEBP and decreased expression of its target genes (19). A number of tissues bathed in isotonic millieu, such as the brain, heart, and activated T cells, express TonEBP abundantly (13, 14, 18). The widespread expression of TonEBP in isotonic tissues raises the possibility that TonEBP plays a general role that is not yet recognized. To explore this question, we cloned the mouse TonEBP and investigated its expression during development. We found that TonEBP is expressed early in mouse embryos and throughout fetal development. There is widespread alternative splicing that generates functionally distinct forms of TonEBP.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

cDNA and bacterial artificial chromosome cloning. Commercial cDNA libraries (Clontech, Palo Alto, CA) prepared from mouse kidney and mouse brain in vector lambda gt10 were screened by hybridization with human TonEBP cDNA (14). From >30 positive clones, 6 overlapping cDNAs were completely sequenced. A mouse genomic library (Genome Systems, St. Louis, MO) in the bacterial artificial chromosome (BAC) was screened by using PCR. The primers used were GCAGCATCCATCAACCCC (sense primer: nucleotides 501-518 of cDNA) and TTTGGCACTGTCGGCATC (antisense primer: nucleotides 787-884). Two overlapping clones were obtained. Exons were identified by subcloning and sequencing.

Embryonic stem cell culture and immunoblot analysis. TL-1 mouse embryonic stem (ES) cells were a generous gift from Charles Heilig (Johns Hopkins University) and were cultured as described (17). Cells were grown to confluence and then switched to hypertonic medium by addition of 100 mM NaCl for 16 h. Immunoblot analysis for detection of TonEBP was performed as described (14, 19).

RNase protection assay. Total RNA was isolated from mouse embryos freshly collected at gestational stage days 7, 9, 12, 15, and 17 and from pups at birth and postnatal day 1. Adult tissues were sampled from mice aged 8-10 wk. A RNase protection assay (RPA) was performed by using a commercial kit according to the instructions of the manufacturer (Ambion, Austin, TX). A radiolabeled probe corresponding to nucleotides 1785-2067 was used. The 28S rRNA probe was obtained from Ambion. Radioactivity of protected bands was visualized and quantified by using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Immunolocalization of TonEBP in embryos. Paraffin-embedded sections of mouse embryos at gestational stage days 10.5, 12.5, 15.5, and 17.5 were obtained from a commercial source (Paragon Biotech, Baltimore, MD). Standard procedures were used to remove paraffin and to hydrate the sections. Endogenous alkaline phosphatase was blocked with 20% acetic acid for 5 min before subsequent blocking with 10% donkey serum. The sections were incubated overnight at 4°C with TonEBP antibody (14) at a dilution of 1:400, followed by 2-h incubation at room temperature with alkaline phosphatase-conjugated secondary antibody. Alkaline phosphatase was stained blue by using 5-bromo-4-chloro-3-indolyl phosphate-nitroblue tetrazolium (Sigma, St. Louis, MO).

RT-PCR. To study alternative splicing, 2 µg of total RNA were reverse transcribed by using a commercial kit (Ambion) in 20 µl. Control reactions were performed without reverse transcriptase. Primers for PCR were GCCCTCGGACTTCATCTCATTG (exon 1, see Fig. 4A for position) and GATGGATGCTGCTGAACTGTGTTAC3 (exon 5). A 5-µl aliquot of each RT reaction was amplified for 5 min at 95°C, followed by 35 cycles of 1 min at 95°C, 30 s at 50°C, and 30 s at 72°C, and terminated by 10 min at 72°C. The RT-PCR products were resolved on 2% agarose gels. Each of three bands shown in Fig. 4C was isolated and cloned in pCRII vector (Invitrogen, Carlsbad, CA). Three clones were sequenced from each band.

Transfection, immunofluorescence, immunoblot analysis, and luciferase assays. The cDNA coding for TonEBP-a or TonEBP-c (see Fig. 4) was cloned into mammalian expression vectors pCMV-Tag2 or pCMV-Tag3 (Stratagene, La Jolla, CA), which allows expression of TonEBP fused with Flag or myc epitope, respectively. For immunofluoresence detection of TonEBP, COS-7 cells were grown on glass coverslips. The cells were transfected with 2 µg/coverslip of the TonEBP expression plasmids. The endogenous or the myc- or Flag-tagged TonEBP was detected as described previously (2) except that Alexa (Molecular Probes, Eugene, OR) was used instead of rhodamine. COS-7 cells grown in six-well clusters were transiently transfected with 1 µg/well of a TonE-driven luciferase reporter plasmid (18), 10 ng of pRL-CMV (Promega, Madison, WI) directing Renilla luciferase expression driven by cytomegalovirus promoter, and various combinations of pCMV-Tag2-3 constructs as indicated (see Fig. 5). Cells were lysed and TonEBP was detected by immunoblot analysis using an myc antibody (Covance, Denver, PA) or Flag antibody (Sigma). To examine effects of TonEBP expression in TonE-driven transcription, some of the transfected COS-7 cells were switched to a hypertonic medium created by addition of 100 mM NaCl 24 h after transfection. Activity of luciferase was measured 20 h later in cell lysates. In each well, the activity of Photinus luciferase was normalized by the activity Renilla luciferase to correct for transfection efficiency.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning mouse TonEBP cDNA. From six overlapping cDNA clones, a contiguous sequence of 4,734 bp was constructed. The nucleotide sequence is available from GenBank (accession no. AF369980). Except for the 5' end (for alternative splicing, see Structure of TonEBP gene and alternative splicing), all the overlapping regions were identical. There was a large open reading frame in nucleotides 340-4716 that predicts a polypeptide of 1,458 amino acids. Mouse TonEBP shares 92% of amino acids with human TonEBP (Fig. 1). The similarity is highest (99%) in the NH2-terminal 500 amino acids, which include the Rel-like DNA binding domain. As expected, the polyclonal antibody raised against this region of the human TonEBP (14) also recognizes mouse TonEBP (Fig. 2B).


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 1.   Amino acid alignment of mouse and human tonicity-responsive enhancer binding protein (TonEBP). See Fig. 4 for nucleotide sequence and spliced variants. star , Identical residues.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of TonEBP in embryonic stem (ES) cells and in mouse embryos. A: RNase protection assays of total RNA from ES cells, embryos E7, E9, E12, E15, and E17 corresponding to gestational stage days 7, 9, 12, 15, and 17, respectively, and pups at postnatal days 0 (PN0) and 1 (PN1). ES cells were cultured in isotonic (ES-I) and hypertonic (ES-H) medium for 16 h. Protected bands for TonEBP and 28S rRNA are shown. B: immunoblot detection of TonEBP from ES-I and ES-H.

Expression of TonEBP during development. To investigate TonEBP expression during development, RPA was performed to detect mRNA. As shown in Fig. 2A, TonEBP mRNA is expressed in all embryonic stages examined, i.e., embryonic age days 7-17 and postnatal days 0 and 1. To examine earlier stages, cultured ES cells were examined. ES cells express TonEBP mRNA and protein (Fig. 2, A and B). When cells were cultured in hypertonic medium for 16 h, the abundance of TonEBP mRNA and protein did not change significantly. Thus, unlike in most other cultured cells such as Madin-Darby canine kidney and COS-7 cells, TonEBP expression is not increased by hypertonicity in ES cells.

Immunostaining of embryonic sections with TonEBP antibody revealed that TonEBP expression is not ubiquitous. At embryonic day 10.5, TonEBP is clearly expressed in the brain and developing lens. This expression is extended to the embryonic liver on day 12.5. By day 17.5 (Fig. 3), abundant expression was seen in the brain, spinal cord, heart, and liver. Moderate expression was also seen in the salivary gland, lung, kidney, gut, and bladder.


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 3.   Immunolocalization of TonEBP in a 17.5-day-old embryo. Two adjacent sections were stained with preimmune serum (A) or immune serum (B). Blue coloration shows that TonEBP is highly expressed in brain (BR), roof of the midbrain (RMB), spinal cord (SC), liver (LV), and heart (HT). Moderate expression is also seen in salivary gland (SG), lung (LG), pancreas (PC), gut (DD), and bladder (BL).

Structure of TonEBP gene and alternative splicing. By using PCR screening, we identified two overlapping mouse genomic BAC clones containing a part of the TonEBP gene. From these clones, we found 13 exons in a span of ~70 kbp covering exons 3-15 plus their associated introns (Tables 1 and 2). After this work was done, the Human Genome Project released the sequence of human TonEBP, which is >130 kbp (GenBank accession no. 11430578). The structure of the human gene is highly homologous to the mouse gene, sharing a highly similar exon-intron structure throughout exons 3-15 and flanking introns (Tables 1 and 2). The exons of the human gene were annotated based on the cDNA clone KIAA0827 (15). This clone was shown to produce a protein that specifically binds TonE and the renamed osmotic response element binding protein (9). KIAA0827 cDNA lacks exons 2 and 4, based on our analysis discussed immediately below in this subsection. The human gene contains exon 4 (which is not presently annotated as such in the GenBank database) at nucleotides 80480-80541 with proper exon-intron boundary sequences. Mouse exon 3 is annotated as exon 2 in the human gene. Nucleotides 1-68 of the mouse cDNA we cloned are found at the end of human exon 1. Nucleotides 69-122 of the mouse cDNA must be exon 2 because a matching sequence is present in nucleotides 2512-2565 of the human gene with appropriate exon-intron boundary sequences. Recently, a human cDNA containing both exon 2 and exon 4, i.e., same as the "full-length" shown in Fig. 4B, was released (3), independently confirming the exon-intron structure shown in Tables 1 and 2. On the basis of this analysis, mouse exons are defined as shown in Fig. 4A. The human gene has exons 1-3 spread over 60,000 bp. This is likely to be the case in the mouse gene, because exons 3-15 are highly homologous between humans and mice.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Comparison of exons in human and mouse TonEBP genes


                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Comparison of introns in human and mouse TonEBP genes



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4.   A: first 395 of the 4,734 bp of mouse TonEBP cDNA cloned in this study (GenBank accession no AF369980) preceded by 5 bp from another overlapping mouse cDNA clone in GenBank (accession no. AF162853). Exons (see Table 1) are demarcated with arrowheads. Two start codons (see also B) are underlined. B: alternative splicing of exons 2-4 based on RT-PCR using primers indicated by open arrows (see C). Boxed numbers, first 5 exons; a-d, open reading frames of spliced isoforms, with start codons indicated by filled arrowheads. C: ethidium bromide gel showing RT-PCR products using primers shown in B. Size markers are in lane 1. All samples show the same bands. Sequencing showed that the top band was full length, the middle band contained (-2) and (-4) forms, and the bottom band (-2, -4) and (-3, -4) forms. Control experiments were performed without RT (RT-). EM, mixture of RNA from embryos at days 7-17; PN, mixture of RNA from postnatal days 0 and 1; AT, mixture of RNA from adult tissues. RNA (2 µg) was reverse transcribed (RT+) and PCR amplified. D: open reading frames b-d encode the same proteins as a, except that they have additional amino acids at the NH2 termini, as shown. Amino acids from a given exon are marked with a double arrow and the exon number. Sequences are identical to those of human counterparts, except for the residues underlined: T from exon 2 is N in humans, and P from exon 3 is S in humans.

Several cDNA clones that we obtained were at variance with the cDNA sequence shown in Fig. 4A, which is predicted to encode TonEBP-a (see Fig. 4B). The variations were deletions involving exons 2 and/or 4. There is a mouse cDNA in GenBank (accession no. AF162853) that lacks exons 2 and 4. Another report (12) proposed three spliced isoforms of mouse TonEBP that include TonEBP-a and TonEBP-c, as shown in Fig. 4B. Similar variations are also present in the human transcripts. Our original human cDNA (14) lacks exon 2 and encodes TonEBP-a. The KIAA0827 clone lacks exons 2 and 4 (see immediately above in this subsection) and encodes TonEBP-c. PCR analysis of cDNA libraries (4) revealed another isoform that lacks exon 4 in addition to the two isoforms described above. To investigate the pattern of alternative splicing in a comprehensive manner, RNA from different stages of development and various adult tissues was analyzed by RT-PCR. A pair of PCR primers covering exons 2-4 was used as indicated in Fig. 4B. All the RNA samples yielded the same bands shown in Fig. 4C, indicating that the pattern of splicing changes little between different tissues and during development in mice. Cloning and sequencing the bands revealed five spliced isoforms, including the full-length form, as shown in Fig. 4B. The (-3, -4) form is a new isoform not reported previously.

Spliced variants of TonEBP. The widespread variations in splicing of exons 2-4 predict four different polypeptides, as illustrated in Fig. 4, B and D. All the isoforms share the same polypeptide of TonEBP-a. In the full-length and (-2) transcripts (Fig. 4B), the largest open reading frame encodes TonEBP-a. When exon 4 is deleted, the start codon in exon 1 (Fig. 4, A and B) comes in the frame with TonEBP-a, resulting in other isoforms that have additional amino acids at the NH2 terminus, as shown in Fig. 4D. There are stop codons in all three reading frames upstream of the start codon in exon 1, eliminating the possibility of start codons further upstream.

To investigate the functional difference between TonEBP-a and TonEBP-c, they were fused to Flag or myc at the NH2 terminus, and their expression and ability to stimulate transcription were investigated in COS-7 cells. Endogenous TonEBP in COS-7 cells was distributed in both the cytoplasm and the nucleus in isotonic condition (Fig. 5A), as in Madin-Darby canine kidney cells (2, 14). Relative nuclear distribution of myc-TonEBP-a and -c appeared stronger than endogenous TonEBP in isotonic conditions. However, nuclear distribution clearly increased in all of them in response to hypertonicity. We did not observe differences in subcellular distribution between myc-TonEBP-a and -c. The same results were obtained when the TonEBP isoforms were fused to Flag (not shown).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5.   A: COS-7 cells were grown on coverslips and transfected with pCMV-Tag3, directing expression of myc-TonEBP-a and myc-TonEBP-c. Cells were treated with isotonic or hypertonic medium for 2 h. Immunofluorescence analysis was performed to detect endogenous TonEBP in control nontransfected cells (left) and myc-TonEBP-a and -c in transfected cells using myc antibody (middle and right, respectively). B: COS-7 cells were transfected with the TonE-driven luciferase reporter, pRL-CMV plus various combinations of pCMV-Tag2 (vector) and pCMV-Tag2 directing expression of Flag-tagged TonEBP-a or TonEBP-c, as described in EXPERIMENTAL PROCEDURES. After 36 h, an immunoblot was prepared from cell lysates and probed with Flag antibody. C: cells were transfected as in A and cultured in isotonic (Iso) or hypertonic medium (Hyp). Expression of Photinus luciferase corrected for transfection efficiency is shown relative to isotonic vector control (lane 1). Values are means ± SD; n = 3.

In immunoblot analysis, Flag-TonEBP-c cDNA produced a larger protein than Flag-TonEBP-a cDNA (Fig. 5B), as expected. When the same amount of expression plasmid DNA was transfected, the abundance of Flag-TonEBP-c was much higher than Flag-TonEBP-a (not shown). The level of their expression was equalized when the amount of DNA of the expression plasmid for Flag-TonEBP-c was reduced to 10-20% that of Flag-TonEBP-a (Fig. 5B). Similar results were obtained when TonEBP was fused to myc. Because the same expression vectors were used, it is likely that TonEBP-c has longer half-life than TonEBP-a.

When the TonE-driven luciferase reporter construct was cotransfected with the TonEBP expression plasmids under conditions where Flag-TonEBP-a and Flag-TonEBP-c express at comparable levels (Fig. 5B), luciferase expression was increased 29-fold by Flag-TonEBP-a and 80- to 94-fold by Flag-TonEBP-c (both P < 0.001) in isotonic conditions over vector control (Fig. 5C). In hypertonic conditions, Flag-TonEBP-a increased luciferase expression by 39% (P < 0.01), whereas myc-TonEBP-c increased by 173-186% (P < 0.001). Even though the level of Flag-TonEBP-c expression differed by more than twofold in lanes 3 and 4 of Fig. 5, B and C, expression of luciferase was comparable. Similar results were obtained when the TonEBP isoforms were coexpressed with fusion to myc or without fusion (not shown). Perhaps the level of Flag-TonEBP-c expression might be over the functional saturation point. At any rate, TonEBP-c is more efficient in stimulation of transcription than TonEBP-a.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The amino acid sequence and gene structure of TonEBP are highly homologous between humans and mice. A genome database search reveals that Rel-like transcription factors are present in Drosophila and mammals but not in Caenorhabditis elegans, yeast, and plants (16). Drosophila has one homolog of TonEBP named MESR1 (GenBank accession no. AF195496). MESR1 was identified as a modifier of RAS1 signaling involved in eye development (8). MESR1 shares a greater amino acid identity with TonEBP than to NFATs. Its DNA binding (Rel-like) domain shares 51% of amino acids with TonEBP compared with 37% with NFAT1. In addition, like TonEBP, it has two stretches of polyglutamines, whereas NFATs do not have polyglutamines. Of interest, the Rel-like domain of MESR1 shares 38% or fewer amino acids with other Drosophila Rel-homology proteins such as Relish and Dorsal. These data raise the possibility that MESR1 might be an ortholog of mammalian TonEBP. However, the biological role of MESR1 is not clear other than its role as a modifier in RAS1 signaling. Loss-of-function mutations have not been reported to date. There is no adult phenotype in animals overexpressing MESR1 (8).

The work presented here clearly demonstrates that TonEBP expression occurs early in development and is sustained throughout embryogenesis. Early and high-level expression of TonEBP in the brain and spinal cord coincides with the expression of a target gene, the sodium-myo-inositol cotransporter (6). Because inositol is considered an important nutrient for development of neurons, one function of TonEBP appears to be supplying nutrient for the developing nervous system by means of stimulation of the nutrient transporter. Although TonEBP targets genes in other tissues such as developing heart and liver are not known, they are likely to be important for development of these organs.

In the human fetal brain compared with adult brain, the abundance of the full-length TonEBP transcript is much higher than other spliced isoforms (4). In other tissues, there is little difference in the relative abundance of TonEBP isoforms between fetuses and adults. By using whole embryo extracts, we found that the pattern of alternative splicing involving exons 2-4 is constant throughout the developmental stages. The same pattern held in various adult tissues. It appears that the alternative splicing is an inherent property of the gene. The introns between these exons are very large; introns 2 and 3 are ~60 and ~20 kbp, respectively. Such large introns may contribute to frequent skipping of the exons. At any rate, the data in Fig. 5 demonstrate that the spliced variants produce functionally different proteins. Antibodies that distinguish the isoforms would be useful in investigating the role of different TonEBP isoforms.


    ACKNOWLEDGEMENTS

We thank S. Ho for providing the hTonE-IL-2-GL3 plasmid.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-42479 to H. M. Kwon. S. K. Woo was supported by a fellowship from the Juvenile Diabetes Foundation International. Y. Wu was supported by an institutional National Research Service Award fellowship (DK-07712).

Address for reprint requests and other correspondence: H. M. Kwon, Div. of Nephrology, Johns Hopkins Univ. School of Medicine, 963 Ross Research Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: mkwon{at}jhmi.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published November 20, 2001;10.1152/ajprenal.00123.2001

Received 18 April 2001; accepted in final form 16 November 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Beck, FX, Burger-Kentischer A, and Müller E. Cellular response to osmotic stress in the renal medulla. Pflügers Arch 436: 814-827, 1998.

2.   Dahl, SC, Handler JS, and Kwon HM. Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP. Am J Physiol Cell Physiol 280: C248-C253, 2001.

3.   Dalski, A, Schwinger E, and Zühlke C. Genomic organization of the human NFAT5 gene: exon-intron structure of the 14kb transcript and CpG-island analysis of the promoter region. Cytogenet Cell Genet 93: 230-241, 2001.

4.   Dalski, A, Wagner HJ, Schwinger E, and Zühlke C. Quantitative PCR analysis of different splice forms of NFAT5 revealed specific gene expression in fetal and adult brain. Mol Brain Res 83: 125-127, 2000.

5.   Dmitrieva, N, Kültz D, Michea L, Ferraris J, and Burg MB. Protection of renal inner medullary epithelial cells from apoptosis by hypertonic stress-induced p53 activation. J Biol Chem 275: 18243-18247, 2000.

6.   Guo, W, Shimada S, Tajiri H, Yamauchi A, Yamashita T, Okada S, and Tohyama M. Developmental regulation of Na+/myo-inositol cotransporter gene expression. Mol Brain Res 51: 91-96, 1997.

7.   Handler, JS, and Kwon HM. Cell and molecular biology of organic osmolyte accumulation in hypertonic renal cells. Nephron 87: 106-110, 2001.

8.   Huang, AM, and Rubin GM. A misexpression screen identifies genes that can modulate RAS1 pathway signaling in Drosophila melanogaster. Genetics 156: 1219-1230, 2000.

9.   Ko, BCB, Turck CW, Lee KWY, Yang Y, and Chung SSM Purification, identification, and characterization of an osmotic responsive element binding protein. Biochem Biophys Res Commun 270: 52-61, 2000.

10.   Kültz, D, and Chakravarty D. Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells. Proc Natl Acad Sci USA 98: 1999-2004, 2001.

11.   López-Rodríguez, C, Arambu J, Jin L, Rakeman AS, Michino M, and Rao AJ. Bridging the NFAT and NF-kappa B families: NFAT5 dimerzation regulates cytokine gene transcription in response to osmotic stress. Immunity 15: 47-58, 2001.

12.   López-Rodríguez, C, Arambu J, Rakeman AS, Copeland NG, Gilbert DJ, Thomas S, Disteche C, Jenkins NA, and Rao AJ. NFAT5: the NFAT family of transcription factors expand in a new direction. Cold Spring Harb Symp Quant Biol 64: 517-526, 1999.

13.   López-Rodríguez, C, Aramburu J, Rakeman AS, and Rao A. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci USA 96: 7214-7219, 1999.

14.   Miyakawa, H, Woo SK, Dahl SC, Handler JS, and Kwon HM. Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96: 2538-2542, 1999.

15.   Nagase, T, Ishikawa K, Kikuno R, Hirosawa M, Miyajima N, Tanaka A, Kotani H, Nomura N, and Ohara O. Prediction of the coding sequences of unidentified humand genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res 5: 355-364, 1998.

16.   Riechmann, JL, Heard J, Martin G, Reuber L, Jiang CZ, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, Pilgrm M, Broun P, Zhang JZ, Ghandehari D, Sherman BK, and Yu GL. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 2105-2110, 2000.

17.   Robertson, EJ. Derivation and maintenance of embryonic stem cell cultures. Methods Mol Biol 75: 173-184, 1997.

18.   Trama, J, Lu Q, Hawley RG, and Ho SN. The NFAT-related protein NFATL1 (TonEBP/NFAT5) is induced upon T cell activation in a calcineurin-dependent manner. J Immunol 165: 4884-4894, 2000.

19.   Woo, SK, Dahl SC, Handler JS, and Kwon HM. Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity. Am J Physiol Renal Physiol 278: F1006-F1012, 2000.


Am J Physiol Renal Fluid Electrolyte Physiol 282(5):F802-F809
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
DiabetesHome page
B. Yang, A. D. Hodgkinson, P. J. Oates, H. M. Kwon, B. A. Millward, and A. G. Demaine
Elevated activity of transcription factor nuclear factor of activated T-cells 5 (NFAT5) and diabetic nephropathy.
Diabetes, May 1, 2006; 55(5): 1450 - 1455.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K.-H. Han, S. K. Woo, W.-Y. Kim, S.-H. Park, J.-H. Cha, J. Kim, and H. M. Kwon
Maturation of TonEBP expression in developing rat kidney
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F878 - F885.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. Lee, E. Colla, M. R. Sheen, K. Y. Na, and H. M. Kwon
Multiple Domains of TonEBP Cooperate to Stimulate Transcription in Response to Hypertonicity
J. Biol. Chem., November 28, 2003; 278(48): 47571 - 47577.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Zhang, J. D. Ferraris, H. L. Brooks, I. Brisc, and M. B. Burg
Expression of osmotic stress-related genes in tissues of normal and hyposmotic rats
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F688 - F693.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Y. Na, S. K. Woo, S. D. Lee, and H. M. Kwon
Silencing of TonEBP/NFAT5 Transcriptional Activator by RNA Interference
J. Am. Soc. Nephrol., February 1, 2003; 14(2): 283 - 288.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Trama, W. Y. Go, and S. N. Ho
The Osmoprotective Function of the NFAT5 Transcription Factor in T Cell Development and Activation
J. Immunol., November 15, 2002; 169(10): 5477 - 5488.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. K. Woo, S. D. Lee, K. Y. Na, W. K. Park, and H. M. Kwon
TonEBP/NFAT5 Stimulates Transcription of HSP70 in Response to Hypertonicity
Mol. Cell. Biol., August 15, 2002; 22(16): 5753 - 5760.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/5/F802    most recent
00123.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (24)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maouyo, D.
Right arrow Articles by Kwon, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maouyo, D.
Right arrow Articles by Kwon, H. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online