|
|
||||||||
Division of Nephrology, School of Medicine, Johns Hopkins University, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
Tonicity-responsive enhancer binding protein (TonEBP)- nuclear factor of activated T cell family 5 is a DNA binding protein that plays a key role in the response of cells to hypertonicity. However, TonEBP is expressed and active in tissues that are in an isotonic milieu. To explore the biological role of TonEBP, we cloned mouse TonEBP that shares 92% of amino acids with the human counterpart. TonEBP is expressed in embryonic stem cells and throughout the stages of fetal development. Immunohistochemical analysis shows expression of TonEBP in most, if not all, developing tissues, including the brain, colon, heart, muscle, and eyes. Widespread alternative splicing in exons 2-4 was detected throughout development and in different adult tissues. As a result, four different polypeptides are produced with different lengths at the NH2 terminus. Two of the isoforms differ in their ability to stimulate transcription. In conclusion, the presence of TonEBP mRNA during mouse embryogenesis suggests that TonEBP functions at all stages of mouse development, as well as in isotonic adult tissues.
organic/compatible osmolytes; hypertonicity; transcription factor; tonicity-responsive enhancer binding protein; nuclear factor of activated T cell family
| |
INTRODUCTION |
|---|
|
|
|---|
TONICITY-RESPONSIVE ENHANCER (TonE) binding protein (TonEBP) was cloned initially (14) as the key transcription factor that stimulates genes coding for proteins that catalyze cellular accumulation of compatible osmolytes (also called organic osmolytes). These proteins are plasma membrane transporters for compatible osmolytes, the sodium-myo-inositol cotransporter and sodium-chloride-betaine cotransporter, and aldose reductase, which reduces glucose to sorbitol, another compatible osmolyte (7). When cells are exposed to a hypertonic environment, the activity of TonEBP is enhanced because of a combination of increased nuclear translocation (2) and increased overall abundance (induction) (19). The ensuing increase in activity of the transporters and aldose reductase leads to cellular accumulation of compatible osmolytes. In the hypertonic renal medulla, the accumulation of compatible osmolytes lowers cellular ionic strength toward an isotonic level (1). Because high cellular ionic strength causes DNA damage (10) and cell death (5), lowering cellular ionic strength toward an isotonic level is critical for survival of renal medullary cells. Thus TonEBP plays a key regulatory role in protecting the renal medulla from the deadly stress of hypertonicity.
Near the NH2 terminus of TonEBP is a domain of ~300 amino
acids that shares ~42% of its amino acids with the Rel homology domain of the nuclear factor of the activated T cell family (NFAT) (12, 13, 14). On the basis of this homology, TonEBP is
also called NFAT5 (12) or NFATL1 (18).
Indeed, expression of TonEBP is markedly increased in T cells after
activation of the T cell receptor (18), and TonEBP
stimulates transcription of tumor necrosis factor-
and
lymphotoxin-
in response to hypertonicity (11).
However, unlike the NFAT family, nuclear localization of TonEBP is not
regulated by calcineurin, and TonEBP does not interact with activator
protein-1 for DNA binding (13). In addition, TonEBP
appears to form a dimer by means of its Rel homology domain-like nuclear factor-
B, even though the similarity in amino acid sequence is minimal (12, 13). TonEBP is clearly different from the NFAT family in structure and regulation despite the similarity in amino
acid sequence.
Although TonEBP plays a key role in hypertonicity-induced stimulation of gene transcription in the renal medulla and T cells, TonEBP is active under isotonic conditions. Expression of dominant-negative TonEBP reduces TonE-driven transcription under isotonic conditions (14). Exposure of cells to hypotonicity (low osmolality) results in decreased activity of TonEBP and decreased expression of its target genes (19). A number of tissues bathed in isotonic millieu, such as the brain, heart, and activated T cells, express TonEBP abundantly (13, 14, 18). The widespread expression of TonEBP in isotonic tissues raises the possibility that TonEBP plays a general role that is not yet recognized. To explore this question, we cloned the mouse TonEBP and investigated its expression during development. We found that TonEBP is expressed early in mouse embryos and throughout fetal development. There is widespread alternative splicing that generates functionally distinct forms of TonEBP.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
cDNA and bacterial artificial chromosome cloning.
Commercial cDNA libraries (Clontech, Palo Alto, CA) prepared from mouse
kidney and mouse brain in vector
gt10 were screened by hybridization
with human TonEBP cDNA (14). From >30 positive clones, 6 overlapping cDNAs were completely sequenced. A mouse genomic library
(Genome Systems, St. Louis, MO) in the bacterial artificial chromosome
(BAC) was screened by using PCR. The primers used were
GCAGCATCCATCAACCCC (sense primer: nucleotides 501-518 of cDNA)
and TTTGGCACTGTCGGCATC (antisense primer: nucleotides 787-884).
Two overlapping clones were obtained. Exons were identified by
subcloning and sequencing.
Embryonic stem cell culture and immunoblot analysis. TL-1 mouse embryonic stem (ES) cells were a generous gift from Charles Heilig (Johns Hopkins University) and were cultured as described (17). Cells were grown to confluence and then switched to hypertonic medium by addition of 100 mM NaCl for 16 h. Immunoblot analysis for detection of TonEBP was performed as described (14, 19).
RNase protection assay. Total RNA was isolated from mouse embryos freshly collected at gestational stage days 7, 9, 12, 15, and 17 and from pups at birth and postnatal day 1. Adult tissues were sampled from mice aged 8-10 wk. A RNase protection assay (RPA) was performed by using a commercial kit according to the instructions of the manufacturer (Ambion, Austin, TX). A radiolabeled probe corresponding to nucleotides 1785-2067 was used. The 28S rRNA probe was obtained from Ambion. Radioactivity of protected bands was visualized and quantified by using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Immunolocalization of TonEBP in embryos. Paraffin-embedded sections of mouse embryos at gestational stage days 10.5, 12.5, 15.5, and 17.5 were obtained from a commercial source (Paragon Biotech, Baltimore, MD). Standard procedures were used to remove paraffin and to hydrate the sections. Endogenous alkaline phosphatase was blocked with 20% acetic acid for 5 min before subsequent blocking with 10% donkey serum. The sections were incubated overnight at 4°C with TonEBP antibody (14) at a dilution of 1:400, followed by 2-h incubation at room temperature with alkaline phosphatase-conjugated secondary antibody. Alkaline phosphatase was stained blue by using 5-bromo-4-chloro-3-indolyl phosphate-nitroblue tetrazolium (Sigma, St. Louis, MO).
RT-PCR. To study alternative splicing, 2 µg of total RNA were reverse transcribed by using a commercial kit (Ambion) in 20 µl. Control reactions were performed without reverse transcriptase. Primers for PCR were GCCCTCGGACTTCATCTCATTG (exon 1, see Fig. 4A for position) and GATGGATGCTGCTGAACTGTGTTAC3 (exon 5). A 5-µl aliquot of each RT reaction was amplified for 5 min at 95°C, followed by 35 cycles of 1 min at 95°C, 30 s at 50°C, and 30 s at 72°C, and terminated by 10 min at 72°C. The RT-PCR products were resolved on 2% agarose gels. Each of three bands shown in Fig. 4C was isolated and cloned in pCRII vector (Invitrogen, Carlsbad, CA). Three clones were sequenced from each band.
Transfection, immunofluorescence, immunoblot analysis, and luciferase assays. The cDNA coding for TonEBP-a or TonEBP-c (see Fig. 4) was cloned into mammalian expression vectors pCMV-Tag2 or pCMV-Tag3 (Stratagene, La Jolla, CA), which allows expression of TonEBP fused with Flag or myc epitope, respectively. For immunofluoresence detection of TonEBP, COS-7 cells were grown on glass coverslips. The cells were transfected with 2 µg/coverslip of the TonEBP expression plasmids. The endogenous or the myc- or Flag-tagged TonEBP was detected as described previously (2) except that Alexa (Molecular Probes, Eugene, OR) was used instead of rhodamine. COS-7 cells grown in six-well clusters were transiently transfected with 1 µg/well of a TonE-driven luciferase reporter plasmid (18), 10 ng of pRL-CMV (Promega, Madison, WI) directing Renilla luciferase expression driven by cytomegalovirus promoter, and various combinations of pCMV-Tag2-3 constructs as indicated (see Fig. 5). Cells were lysed and TonEBP was detected by immunoblot analysis using an myc antibody (Covance, Denver, PA) or Flag antibody (Sigma). To examine effects of TonEBP expression in TonE-driven transcription, some of the transfected COS-7 cells were switched to a hypertonic medium created by addition of 100 mM NaCl 24 h after transfection. Activity of luciferase was measured 20 h later in cell lysates. In each well, the activity of Photinus luciferase was normalized by the activity Renilla luciferase to correct for transfection efficiency.
| |
RESULTS |
|---|
|
|
|---|
Cloning mouse TonEBP cDNA.
From six overlapping cDNA clones, a contiguous sequence of 4,734 bp was
constructed. The nucleotide sequence is available from GenBank
(accession no. AF369980). Except for the 5' end (for alternative
splicing, see Structure of TonEBP gene and alternative splicing), all the overlapping regions were identical.
There was a large open reading frame in nucleotides 340-4716 that
predicts a polypeptide of 1,458 amino acids. Mouse TonEBP shares 92%
of amino acids with human TonEBP (Fig.
1). The similarity is highest (99%) in
the NH2-terminal 500 amino acids, which include the
Rel-like DNA binding domain. As expected, the polyclonal antibody
raised against this region of the human TonEBP (14) also
recognizes mouse TonEBP (Fig.
2B).
|
|
Expression of TonEBP during development. To investigate TonEBP expression during development, RPA was performed to detect mRNA. As shown in Fig. 2A, TonEBP mRNA is expressed in all embryonic stages examined, i.e., embryonic age days 7-17 and postnatal days 0 and 1. To examine earlier stages, cultured ES cells were examined. ES cells express TonEBP mRNA and protein (Fig. 2, A and B). When cells were cultured in hypertonic medium for 16 h, the abundance of TonEBP mRNA and protein did not change significantly. Thus, unlike in most other cultured cells such as Madin-Darby canine kidney and COS-7 cells, TonEBP expression is not increased by hypertonicity in ES cells.
Immunostaining of embryonic sections with TonEBP antibody revealed that TonEBP expression is not ubiquitous. At embryonic day 10.5, TonEBP is clearly expressed in the brain and developing lens. This expression is extended to the embryonic liver on day 12.5. By day 17.5 (Fig. 3), abundant expression was seen in the brain, spinal cord, heart, and liver. Moderate expression was also seen in the salivary gland, lung, kidney, gut, and bladder.
|
Structure of TonEBP gene and alternative splicing.
By using PCR screening, we identified two overlapping mouse genomic BAC
clones containing a part of the TonEBP gene. From these clones, we
found 13 exons in a span of ~70 kbp covering exons
3-15 plus their associated introns (Tables
1 and 2).
After this work was done, the Human Genome Project released the
sequence of human TonEBP, which is >130 kbp (GenBank accession no.
11430578). The structure of the human gene is highly homologous to the
mouse gene, sharing a highly similar exon-intron structure throughout exons 3-15 and flanking introns (Tables 1 and 2). The
exons of the human gene were annotated based on the cDNA clone KIAA0827 (15). This clone was shown to produce a protein that
specifically binds TonE and the renamed osmotic response element
binding protein (9). KIAA0827 cDNA lacks exons
2 and 4, based on our analysis discussed immediately
below in this subsection. The human gene contains exon
4 (which is not presently annotated as such in the GenBank
database) at nucleotides 80480-80541 with proper exon-intron boundary sequences. Mouse exon 3 is annotated as exon
2 in the human gene. Nucleotides 1-68 of the mouse cDNA we
cloned are found at the end of human exon 1. Nucleotides
69-122 of the mouse cDNA must be exon 2 because a
matching sequence is present in nucleotides 2512-2565 of the human
gene with appropriate exon-intron boundary sequences. Recently, a human
cDNA containing both exon 2 and exon 4, i.e.,
same as the "full-length" shown in Fig.
4B, was released (3), independently confirming the exon-intron structure
shown in Tables 1 and 2. On the basis of this analysis, mouse exons are
defined as shown in Fig. 4A. The human gene has exons
1-3 spread over 60,000 bp. This is likely to be the case in
the mouse gene, because exons 3-15 are highly
homologous between humans and mice.
|
|
|
3,
4) form is a
new isoform not reported previously.
Spliced variants of TonEBP.
The widespread variations in splicing of exons 2-4
predict four different polypeptides, as illustrated in Fig. 4,
B and D. All the isoforms share the same
polypeptide of TonEBP-a. In the full-length and (
2) transcripts (Fig.
4B), the largest open reading frame encodes TonEBP-a. When
exon 4 is deleted, the start codon in exon 1 (Fig. 4, A and B) comes in the frame with
TonEBP-a, resulting in other isoforms that have additional amino acids
at the NH2 terminus, as shown in Fig. 4D. There
are stop codons in all three reading frames upstream of the start codon
in exon 1, eliminating the possibility of start codons
further upstream.
|
| |
DISCUSSION |
|---|
|
|
|---|
The amino acid sequence and gene structure of TonEBP are highly homologous between humans and mice. A genome database search reveals that Rel-like transcription factors are present in Drosophila and mammals but not in Caenorhabditis elegans, yeast, and plants (16). Drosophila has one homolog of TonEBP named MESR1 (GenBank accession no. AF195496). MESR1 was identified as a modifier of RAS1 signaling involved in eye development (8). MESR1 shares a greater amino acid identity with TonEBP than to NFATs. Its DNA binding (Rel-like) domain shares 51% of amino acids with TonEBP compared with 37% with NFAT1. In addition, like TonEBP, it has two stretches of polyglutamines, whereas NFATs do not have polyglutamines. Of interest, the Rel-like domain of MESR1 shares 38% or fewer amino acids with other Drosophila Rel-homology proteins such as Relish and Dorsal. These data raise the possibility that MESR1 might be an ortholog of mammalian TonEBP. However, the biological role of MESR1 is not clear other than its role as a modifier in RAS1 signaling. Loss-of-function mutations have not been reported to date. There is no adult phenotype in animals overexpressing MESR1 (8).
The work presented here clearly demonstrates that TonEBP expression occurs early in development and is sustained throughout embryogenesis. Early and high-level expression of TonEBP in the brain and spinal cord coincides with the expression of a target gene, the sodium-myo-inositol cotransporter (6). Because inositol is considered an important nutrient for development of neurons, one function of TonEBP appears to be supplying nutrient for the developing nervous system by means of stimulation of the nutrient transporter. Although TonEBP targets genes in other tissues such as developing heart and liver are not known, they are likely to be important for development of these organs.
In the human fetal brain compared with adult brain, the abundance of the full-length TonEBP transcript is much higher than other spliced isoforms (4). In other tissues, there is little difference in the relative abundance of TonEBP isoforms between fetuses and adults. By using whole embryo extracts, we found that the pattern of alternative splicing involving exons 2-4 is constant throughout the developmental stages. The same pattern held in various adult tissues. It appears that the alternative splicing is an inherent property of the gene. The introns between these exons are very large; introns 2 and 3 are ~60 and ~20 kbp, respectively. Such large introns may contribute to frequent skipping of the exons. At any rate, the data in Fig. 5 demonstrate that the spliced variants produce functionally different proteins. Antibodies that distinguish the isoforms would be useful in investigating the role of different TonEBP isoforms.
| |
ACKNOWLEDGEMENTS |
|---|
We thank S. Ho for providing the hTonE-IL-2-GL3 plasmid.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-42479 to H. M. Kwon. S. K. Woo was supported by a fellowship from the Juvenile Diabetes Foundation International. Y. Wu was supported by an institutional National Research Service Award fellowship (DK-07712).
Address for reprint requests and other correspondence: H. M. Kwon, Div. of Nephrology, Johns Hopkins Univ. School of Medicine, 963 Ross Research Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: mkwon{at}jhmi.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published November 20, 2001;10.1152/ajprenal.00123.2001
Received 18 April 2001; accepted in final form 16 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Beck, FX,
Burger-Kentischer A,
and
Müller E.
Cellular response to osmotic stress in the renal medulla.
Pflügers Arch
436:
814-827,
1998.
2.
Dahl, SC,
Handler JS,
and
Kwon HM.
Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP.
Am J Physiol Cell Physiol
280:
C248-C253,
2001.
3.
Dalski, A,
Schwinger E,
and
Zühlke C.
Genomic organization of the human NFAT5 gene: exon-intron structure of the 14kb transcript and CpG-island analysis of the promoter region.
Cytogenet Cell Genet
93:
230-241,
2001.
4.
Dalski, A,
Wagner HJ,
Schwinger E,
and
Zühlke C.
Quantitative PCR analysis of different splice forms of NFAT5 revealed specific gene expression in fetal and adult brain.
Mol Brain Res
83:
125-127,
2000.
5.
Dmitrieva, N,
Kültz D,
Michea L,
Ferraris J,
and
Burg MB.
Protection of renal inner medullary epithelial cells from apoptosis by hypertonic stress-induced p53 activation.
J Biol Chem
275:
18243-18247,
2000.
6.
Guo, W,
Shimada S,
Tajiri H,
Yamauchi A,
Yamashita T,
Okada S,
and
Tohyama M.
Developmental regulation of Na+/myo-inositol cotransporter gene expression.
Mol Brain Res
51:
91-96,
1997.
7.
Handler, JS,
and
Kwon HM.
Cell and molecular biology of organic osmolyte accumulation in hypertonic renal cells.
Nephron
87:
106-110,
2001.
8.
Huang, AM,
and
Rubin GM.
A misexpression screen identifies genes that can modulate RAS1 pathway signaling in Drosophila melanogaster.
Genetics
156:
1219-1230,
2000.
9.
Ko, BCB,
Turck CW,
Lee KWY,
Yang Y,
and
Chung SSM
Purification, identification, and characterization of an osmotic responsive element binding protein.
Biochem Biophys Res Commun
270:
52-61,
2000.
10.
Kültz, D,
and
Chakravarty D.
Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells.
Proc Natl Acad Sci USA
98:
1999-2004,
2001.
11.
López-Rodríguez, C,
Arambu J,
Jin L,
Rakeman AS,
Michino M,
and
Rao AJ.
Bridging the NFAT and NF-
B families: NFAT5 dimerzation regulates cytokine gene transcription in response to osmotic stress.
Immunity
15:
47-58,
2001.
12.
López-Rodríguez, C,
Arambu J,
Rakeman AS,
Copeland NG,
Gilbert DJ,
Thomas S,
Disteche C,
Jenkins NA,
and
Rao AJ.
NFAT5: the NFAT family of transcription factors expand in a new direction.
Cold Spring Harb Symp Quant Biol
64:
517-526,
1999.
13.
López-Rodríguez, C,
Aramburu J,
Rakeman AS,
and
Rao A.
NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun.
Proc Natl Acad Sci USA
96:
7214-7219,
1999.
14.
Miyakawa, H,
Woo SK,
Dahl SC,
Handler JS,
and
Kwon HM.
Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity.
Proc Natl Acad Sci USA
96:
2538-2542,
1999.
15.
Nagase, T,
Ishikawa K,
Kikuno R,
Hirosawa M,
Miyajima N,
Tanaka A,
Kotani H,
Nomura N,
and
Ohara O.
Prediction of the coding sequences of unidentified humand genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro.
DNA Res
5:
355-364,
1998.
16.
Riechmann, JL,
Heard J,
Martin G,
Reuber L,
Jiang CZ,
Keddie J,
Adam L,
Pineda O,
Ratcliffe OJ,
Samaha RR,
Creelman R,
Pilgrm M,
Broun P,
Zhang JZ,
Ghandehari D,
Sherman BK,
and
Yu GL.
Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.
Science
290:
2105-2110,
2000.
17.
Robertson, EJ.
Derivation and maintenance of embryonic stem cell cultures.
Methods Mol Biol
75:
173-184,
1997.
18.
Trama, J,
Lu Q,
Hawley RG,
and
Ho SN.
The NFAT-related protein NFATL1 (TonEBP/NFAT5) is induced upon T cell activation in a calcineurin-dependent manner.
J Immunol
165:
4884-4894,
2000.
19.
Woo, SK,
Dahl SC,
Handler JS,
and
Kwon HM.
Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity.
Am J Physiol Renal Physiol
278:
F1006-F1012,
2000.
This article has been cited by other articles:
![]() |
B. Yang, A. D. Hodgkinson, P. J. Oates, H. M. Kwon, B. A. Millward, and A. G. Demaine Elevated activity of transcription factor nuclear factor of activated T-cells 5 (NFAT5) and diabetic nephropathy. Diabetes, May 1, 2006; 55(5): 1450 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Han, S. K. Woo, W.-Y. Kim, S.-H. Park, J.-H. Cha, J. Kim, and H. M. Kwon Maturation of TonEBP expression in developing rat kidney Am J Physiol Renal Physiol, November 1, 2004; 287(5): F878 - F885. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Lee, E. Colla, M. R. Sheen, K. Y. Na, and H. M. Kwon Multiple Domains of TonEBP Cooperate to Stimulate Transcription in Response to Hypertonicity J. Biol. Chem., November 28, 2003; 278(48): 47571 - 47577. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, J. D. Ferraris, H. L. Brooks, I. Brisc, and M. B. Burg Expression of osmotic stress-related genes in tissues of normal and hyposmotic rats Am J Physiol Renal Physiol, October 1, 2003; 285(4): F688 - F693. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Na, S. K. Woo, S. D. Lee, and H. M. Kwon Silencing of TonEBP/NFAT5 Transcriptional Activator by RNA Interference J. Am. Soc. Nephrol., February 1, 2003; 14(2): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Trama, W. Y. Go, and S. N. Ho The Osmoprotective Function of the NFAT5 Transcription Factor in T Cell Development and Activation J. Immunol., November 15, 2002; 169(10): 5477 - 5488. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Woo, S. D. Lee, K. Y. Na, W. K. Park, and H. M. Kwon TonEBP/NFAT5 Stimulates Transcription of HSP70 in Response to Hypertonicity Mol. Cell. Biol., August 15, 2002; 22(16): 5753 - 5760. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |