|
|
||||||||
-ENaC and
preliminary characterization of its promoter
Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, Iowa 52242-1081
| |
ABSTRACT |
|---|
|
|
|---|
The mRNA for the
-subunit of
the epithelial Na+ channel (
-ENaC) is regulated
developmentally and, in some tissues, in response to corticosteroids.
To understand the mechanisms of transcriptional regulation of the human
-ENaC gene, we characterized the 5' end of the gene and its
5'-flanking regions. Adaptor-ligated human kidney and lung cDNA were
amplified by 5' rapid amplification of cDNA ends, and transcription
start sites of two 5' variant transcripts were determined by nuclease
protection or primer extension assays. Cosmid clones that contain the
5' end of the gene were isolated, and analysis of these clones
indicated that alternate first exons ~1.5 kb apart and ~ 45 kb
upstream of a common second exon formed the basis of these transcripts.
Genomic fragments that included the proximal 5'-flanking region of
either transcript were able to direct expression of a reporter gene in
lung epithelia and to bind Sp1 in nuclear extracts, confirming the
presence of separate promoters that regulate
-ENaC expression.
amiloride; gene regulation; transcription start sites; RNA
splicing; gel mobility shift assay;
-subunit of the epithelial
sodium channel
| |
INTRODUCTION |
|---|
|
|
|---|
WITH THE CLONING
OF THE THREE component subunits (
,
, and
) of the
epithelial Na+ channel (ENaC) the identity of the
amiloride-sensitive Na+ channel in the collecting ducts of
the kidney and in other sites such as the distal colon, sweat glands,
and salivary glands has been firmly established (6, 13).
However, the role of ENaC subunits in other sites such as the placenta,
brain, and urinary bladder is unknown (25, 35). The
activity of the Na+ channel in the collecting duct is
increased by dietary Na+ depletion and by conditions that
elevate circulating mineralocorticoids, although the exact mechanism
for the changes in channel activity is not understood. The importance
of the ENaC complex in the regulation of extracellular blood volume and
blood pressure has become clear from observations of the effects of
mutations of ENaC subunits in humans and, in some cases, is confirmed
by the effects of targeted deletions of ENaC subunits in mice
(36). Gain of function mutations that disrupt the PY motif
in the COOH terminus of
-ENaC or
-ENaC leads to unregulated
Na+ reabsorption accompanied by hypertension and
hypokalemia that is dominantly inherited (21). Homozygous
inactivating mutations in any of the three ENaC subunits lead to salt
wasting and hyperkalemia, a phenotype that can be recapitulated by
targeted deletion of
-ENaC or
-ENaC (7, 26). The
consequences of mutations in ENaC subunits are not always limited to
their effects on the kidney and on regulation of Na+
reabsorption. ENaC subunits are expressed throughout the airway epithelia and in alveolar type II cells and are thought to regulate the
volume and ionic composition of airway surface liquid. Inactivating mutations in
-ENaC or
-ENaC have now been demonstrated in
several patients with a pulmonary syndrome characterized by chest
congestion, chronic cough, tachypnea, and recurrent respiratory
infections (17, 33).
The identification of mutations in ENaC that cause monogenic
hypertension has led to the logical hypothesis that milder defects in
channel function or regulation may contribute to the more common form
of high blood pressure, essential hypertension. A polymorphism common
in African-Americans and in London residents of African descent, the
T594M variant in
-ENaC is associated with hypertension, at least in
the London population (5, 38). Another polymorphism in
-ENaC, the G442V variant, is also more prevalent in
African-Americans and is associated with parameters that suggest
enhanced activity of the ENaC channel, such as a suppression of the
urinary aldosterone-potassium ratio, although there was no clear
association with hypertension (2). Mutations or
polymorphisms in the untranslated regions (UTRs) of ENaC mRNA or in 5'
regulatory regions may also contribute to altered regulation or expression.
The h
-ENaC gene (SCNN1B) is located on chromosome 16 (16p12) in
close proximity to the
-ENaC gene (SCNN1G) (46). Like
-ENaC,
-ENaC mRNA is regulated by dietary Na+
deprivation and by systemic administration of aldosterone or glucocorticoids. To begin to understand the factors that regulate gene
expression, we have cloned and characterized the 5' end of the
h
-ENaC gene and identified alternate promoters that determine basal
expression of separate transcripts.
| |
EXPERIMENTAL |
|---|
|
|
|---|
Materials. Human kidney RNA and human placental DNA were from Clontech (Palo Alto, CA). All radionucleotides were from NEN Life Science Products (Boston, MA). Culture media were obtained from Life Technologies (Gaithersburg, MD), and DNA sequencing and synthesis were a service provided by the University of Iowa DNA core facility. H441 cells were cultured in RPMI 1640 as previously described (42). COS-7 and A549 cells were obtained from the American Tissue Culture Collection (Manassas, VA). COS-7 cells were cultured in Dulbecco's modified Eagle's medium, and A549 cells were cultured in minimum essential medium containing 10% fetal bovine serum.
5' Rapid amplification of cDNA ends.
5' Rapid amplification of cDNA ends (RACE) was performed with two
modified human cDNA libraries (Clontech). The single-strand 5'-RACE-ready human lung cDNA has an anchor sequence
5'-CACGAATTCACTATCGATTCTGGAACCTTCAGAGG-NH2 ligated to its
3' end. The double-strand human kidney Marathon-ready cDNA has an
adapter sequence
5'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT ligated to both
ends. Gene-specific reverse primers
1
(5'-GGTGAGCAGGAACCACATGGCTTTCTTC; +168 to +141 from the original
initiation codon; see Fig. 1 and Ref.
25),
2 (CCACACCAGCAGCTCCTTGTACGTGTAGCC; +84 to +55 from the original initiation codon), and
4 (5'-GGCCCTTCTGCAGCCGATGCAG; +52 to +31 from the original initiation codon) were used with anchor-
or adapter-specific primers in PCR reactions. PCR with human kidney
cDNA was performed for 35-40 cycles with Taq polymerase (Promega, Madison, WI) or with rTth XL (Perkin-Elmer, Foster
City, CA) by using primer
1 with an annealing step at 63 and 68°C, respectively. Seminested PCR was performed with human lung cDNA by
using Taq polymerase and
2 and
4 primers in sequential
reactions with primer annealing at 65 and 63°C, respectively.
Amplified fragments were cloned into pCRII (Invitrogen, Carlsbad, CA),
and individual clones were sequenced.
|
Genomic library screening.
The longest 5'-RACE clone (Fig. 1B) was labeled with
[
-32P]dCTP by using random hexamers and the Klenow
fragment of DNA polymerase. A human chromosome 16-specific cosmid
library (a gift from Norman Doggett, Los Alamos, NM) arrayed at high
density on nylon membranes was screened by using the labeled h
-ENaC
probe as previously described (43). Putative positive
clones were confirmed by PCR of cosmid clones by using
T
(5'-GCACGTGAAGAAGTACCTGCTGAAGGGCCTG) and
3 (5'
TTGGGCCCCTCACAGATGATGCG) to amplify a 138-bp fragment. Portions of
h
-ENaC genomic DNA in cosmid clones were then mapped by restriction
analysis and partially sequenced. Primary DNA sequence analysis was
performed with OMIGA (Genetics Computer Group, Madison, WI); the
sequence was screened for CpG islands by using the GRAIL program at
http://compbio.ornl.gov/Grail-1.3/ and for interspersed repeats by
using the Censor program at http://www.girinst.org/Censor_Server.html.
RNase protection assay.
Human placental RNA was prepared by using the RNeasy Mini kit (Qiagen,
Valencia, CA) following the manufacturer's recommendations, and
human kidney RNA was purchased from Clontech. To map the
transcription start site of h
-ENaC-2, a genomic DNA fragment that
included exon 1B and the putative 5'-flanking region was
amplified by PCR from placental genomic DNA by using primers
20
(5'-CAGTCCACAAAAGGCACATCT) and
11 (5'-CCCATCGGTAGGCATTATCC) and
cloned into pCRXL-TOPO (Invitrogen) antisense to the T7 polymerase
promoter. To assess the relative abundance of each transcript, a cDNA
fragment that included the 5' end of exon 2, exon
1C, and the 3' portion of exon 1B [nucleotides (nt)
+61 to +330] was ligated into pCRII antisense to the SP6 polymerase
promoter. The templates were linearized and used to synthesize
antisense [
-32P]UTP-labeled cRNAs. These probes were
hybridized overnight with 10 µg of sample RNA or yeast RNA at 45°C
in 80% formamide, 400 mM NaCl, 1 mM EDTA, and 40 mM PIPES (pH 6.4);
digested with 50 U/ml RNAse T1 and 2.5 µg/ml RNAse A (Ambion, Austin,
Tx); and analyzed by denaturing PAGE as previously described
(42). To accurately localize transcription start sites,
the cDNA template was sequenced by the dideoxy method with primer
11
by using [35S]dATP, and a 1-bp ladder was run alongside
nuclease-protected fragments.
Primer extension.
Primer extension in kidney RNA was performed to map the transcription
start site of h
-ENaC-1. A primer
6b (5' GTGTTGGTACACTGGGACA) was
synthesized, end labeled with [
-32P]ATP, and purified
on a Sephadex G25 column (Quickspin, Roche Biochemicals, Indianapolis,
IN). Labeled primer (100,000 counts/min) and 10 µg kidney or yeast
RNA were heated together at 90°C for 3 min and then hybridized at
65°C for 90 min. A primer extension reaction was then performed with
400 U of Superscript II reverse transcriptase (Life Technologies) at
43°C for 120 min in a reaction mixture that contained (in mM) 75 KCl,
50 Tris · HCl (pH 8.3), 3 MgCl2, 20 dithiothreitol,
and 1.25 2-deoxynucleotide 5'-triphosphates. The labeled products were
analyzed by PAGE, and the transcription start site was localized by
running the products alongside a 1-bp ladder generated by sequencing a
-ENaC genomic DNA fragment with primer
6b.
In vitro translation of
-ENaC.
Full-length h
-ENaC-1 cDNA with a COOH-terminal hemagglutinin (HA)
epitope (a gift from P. Snyder and M. Welsh, University of Iowa) in
pMT3 (1) was recloned into the
EcoRV-XhoI site of pcDNA3 (Invitrogen). The
cloned 5' variant
-ENaCs were spliced to the 5' end of
-ENaC-1 by
using an NheI site to generate full-length HA-tagged
-ENaC-2 and
-ENaC-3. The first ATG (met) of
-ENaC-1 was
mutated to GCG (ala) in h
-ENaC-2 by using the Quikchange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primers GGGTGCCACTGCGCACGTGAAGAAG and CTTCTTCACGTGCGCAGTGGCACCC to generate h
-ENaC-2/mut. The 5'-UTR in all constructs were <30 nt. Sequential transcription and translation of
-ENaC clones were performed by
using the TnT Quick Coupled Transcription/Translation system (Promega)
following the manufacturer's instructions.
[35S]methionine was used to label the synthesized
peptides and the products visualized by SDS-PAGE and autoradiography.
Transfection and immunoblotting of epitope-tagged h
-ENaC
cDNAs.
For transfection of COS-7 cells, monolayers from two T225 flasks were
trypsinized and then resuspended at a density of 2.5 million cells/ml
in a solution containing (in mM) 120 KCl, 10 K2HPO4, 10 KH2PO4, 2 EGTA 5 MgCl2, 100 ATP, 250 glutathione, and 25 HEPES and
also 150 µM CaCl2 (pH 7.6). An 800-µl aliquot of cells
was combined with 20 µg of HA-tagged h
-ENaC in a 0.4-cm Micropulser cuvette and then electroporated (Gene Pulser II, Bio-Rad, Hercules, CA) at 320 V and 950 µF. Cells were then plated in a 60-mm2 dish and, 48 h after transfection, lysed in 500 µl of 2% SDS containing leupeptin and aprotinin and passed 4-6
times through a 22-g needle. The lysates were centrifuged at 13,000 rpm
for 10 min at 4°C, and 80 µl of the supernatant were run on a 5%
SDS gel and transferred to a nitrocellulose membrane. The membrane was
blocked in TBS containing 0.05% Tween 20 (Roche Biochemicals) and 5%
nonfat dry milk and then incubated with a monoclonal anti-HA antibody
(Roche Biochemicals) followed by a 1:10,000 dilution of a
peroxidase-conjugated rabbit anti-mouse antibody (Sigma, St. Louis,
MO). Peroxidase was detected by using Supersignal West Chemiluminescent
Substrate (Pierce, Rockford, IL).
Transfection of h
-ENaC promoter constructs and reporter gene
assays.
H441 cells were grown in 12-well plates for transfection analysis. A
genomic fragment that extended from
472 to +143 of
-ENaC-1 (see
Fig. 6A) was amplified by PCR using primers
15
(5' AAGAGGCGGAGGGAAGAACG) and
7 (5' AGCGGGGACACGGAGGATGC) and cloned
in both orientations into pGL3basic (Promega) upstream of the coding
region for firefly luciferase. A genomic fragment that extended from
745 to +82 of
-ENaC-2 (see Fig. 6B) was amplified with
primers
11 and
20 and was also cloned into pGL3basic. Various
deletions of these constructs were made by using internal restriction
sites or by PCR amplification of shorter fragments. H441 cells were
transfected with luciferase constructs and with a control plasmid
pRL-SV40 (Promega) by using Lipofectin (Life Technologies) as
previously described (32). Forty-eight hours after
transfection, cell lysates were prepared, and reporter gene activity
was determined by the Dual Luciferase Assay Kit in a Monolight 2010 luminometer (Analytical Luminescence Laboratories, Ann Arbor, MI).
Gel mobility shift assays.
Nuclear extracts were made from confluent cultures of H441 and A549
cells as previously described (4). Single-strand
oligonucleotides that correspond to mapped 5'-flanking elements of
-ENaC-1 and
-ENaC-2 were synthesized and then annealed together
|
|
|
-32P]ATP and incubated with A549 and H441 nuclear
extracts as previously described (4). A 50-fold excess of
nonradioactive oligonucleotides were used for competition experiments.
For supershift assays, H441 nuclear extracts were preincubated with 1 µl of anti-Sp1 Ab (Promega) or 1 µl of anti-Sp3 Ab (Santa Cruz
Biotechnology, Santa Cruz, CA) and then added to the labeled probe.
Samples were then analyzed on a nondenaturing polyacrylamide gel in
0.5× TBE buffer that was run at 150 V, and the gel was dried and
subjected to autoradiography.
| |
RESULTS |
|---|
|
|
|---|
Although the human
-ENaC cDNA had been cloned and portions of
the gene structure characterized, the 5' regions of the
-ENaC gene
have not been previously studied (25, 29, 31, 46). To
first determine the potential extent of the
-ENaC RNA in the kidney
and lung, 5'-RACE was performed by using reverse primers (
1 and
4) complementary to
-ENaC mRNA downstream of the previously described translation start codon. Amplified fragments were recovered by ligation into pCRII, and several clones were sequenced. Thirteen of
fourteen clones corresponded to the known 5'-UTR of
-ENaC, whereas
one clone corresponded to a sequence that diverged from
-ENaC at
9
to the original translation start site (Fig. 1A). This
clone, referred to as h
-ENaC-2, contained in-frame upstream translation start codons that when translated are predicted to create
new NH2-terminal forms of
-ENaC (Fig. 1B and
also see Fig. 5A).
To determine the genomic organization of the 5' end of h
-ENaC and to
understand the basis for the variant cDNAs, the longest 5'-RACE clone
was used to screen a human genomic library and three cosmid clones were
isolated. These clones were mapped by restriction analysis and by
partial sequencing and appeared to contain overlapping clones that
covered a physical distance of ~70 kb (Fig.
2). Our analysis indicated that the
5'-UTR of h
-ENaC-1 begins in exon 1A, ~44 kb upstream
of the exon (exon 2) that contains the translation initiation codon. The 5'-UTR of h
-ENaC-2 begins in exon
1B, ~1.5 kb downstream of exon 1A and splices to a
26-bp exon (exon 1C) ~19 kb downstream and then to the
common second exon. As expected, a splice donor site is present just
downstream of exon 1B, and a consensus splice acceptor and
donor site flank exon 1C. While this study was being
completed, primary sequence information in the region of chromosome 16p
became available (23) and was used to confirm the position
and extent of the cosmid clones.
|
To determine the transcription start sites for
-ENaC-2, genomic DNA
fragments that included exon 1B and adjacent 5'-flanking sequences were amplified by PCR and used as a template to synthesize antisense cRNAs for RNase protection assay (RPA) of human kidney and
placental RNA. Several bands were protected from nuclease digestion of
kidney RNA, and the pattern was identical in placental RNA (data not
shown), indicating the presence of multiple transcription start sites
for
-ENaC-2 (Fig. 3A). The
5'-most transcription start site is 22 nt upstream of the 5' terminus
identified by 5'-RACE. We were unable to identify protected bands for
h
-ENaC-1 by RPA using a similar strategy; therefore, we performed
primer extension analysis to determine the transcription start site for h
-ENaC-1. A single band 19 nt upstream of the 5' terminus identified by 5'-RACE was seen with placental RNA (Fig. 3B)
|
To assess the relative proportion of exon 1A- vs. exon
1B-initiated transcripts, an RPA was done with kidney and
placental RNA by using the
-ENaC-2 cDNA clone identified by 5'-RACE
(Fig. 1B). Because this contains exon 1B,
exon 1C, and exon 2 sequences, protected
fragments longer than exon 2 must arise from
-ENaC-2 transcripts, whereas a protected band that corresponds to exon 2 alone arises from
-ENaC-1 transcripts that splice to
exon 2 from exon 1A. Several faint bands are seen
that correspond to
-ENaC-2 and are consistent with multiple
transcription start sites identified earlier (Fig.
4). A more intense band corresponding to
the exon 2 sequence in
-ENaC-1 is also seen, indicating,
as predicted by 5'-RACE analysis, that the
-ENaC-1 transcript is substantially more abundant than
-ENaC-2. Furthermore, there appeared to be no major differences in levels of expression or size of
protected transcripts between placenta and kidney.
|
At least two NH2-terminal variant proteins are predicted
from the transcription start sites for h
-ENaC-2 identified in
exon 1B (Fig. 5). The
protein h
-ENaC-2 would encode a 685-amino acid (aa) peptide with a
predicted molecular mass of 77.7 kDa and an NH2-terminal cytoplasmic tail of 95 aa, whereas
h
-ENaC-3, initiated from a codon 60 nt downstream of that for
h
-ENaC-2, would encode a 664-aa peptide with a
NH2-terminal tail of 74 aa (Fig. 5A). The
predicted translation start codon in
-ENaC-2 has a more favorable consensus translation initiation sequence compared with
-ENaC-1 and
-ENaC-3 (Fig. 5B). When expressed as an in vitro
translated protein, it is clear that h
-ENaC-2 and -3 use an
upstream start codon compared with h
-ENaC-1, because
h
- ENaC-2 > h
-ENaC-3 > h
-ENaC-1 (Fig.
5C). To determine whether the upstream ATG was used in vivo,
epitope-tagged
-ENaC-1 and -2 were expressed in COS-7 cells, and
lysates were immunoblotted with an anti-HA antibody. In contrast to the
results in vitro,
-ENaC-2 migrates at the same position as
-ENaC-1 in vivo, suggesting that the downstream ATG is the preferred
translation start codon despite having a less optimal translation
initiation sequence. However, the apparent molecular weight of both
-ENaC-1 and
-ENaC-2 is higher in vivo, probably
secondary to glycosylation or another posttranslational modification,
making direct comparison of size difficult. When the downstream ATG is
mutated (
-ENaC-2/mut), translation is initiated at the upstream ATG,
confirming that this ATG has the potential to serve as a translation
initiation codon under certain circumstances (Fig. 5D).
However, on the basis of the relatively feeble expression of
-ENaC-2
mRNA and the COS-7 expression data, it is difficult to assign any
functional relevance to the NH2-terminal variant form of
-ENaC. An analysis of the extended NH2 terminus of
-ENaC-2 did not reveal any sites for potential posttranslational
modifications of the protein (Fig. 5E).
|
We then examined the sequence 5' and flanking the transcription start
sites for
-ENaC-1 and
-ENaC-2. The upstream sequence for
h
-ENaC-1 does not contain a TATA or CAAT box, but many Sp1 and AP2
binding sites as well as a consensus estrogen response element and
several glucocorticoid response element (GRE) half-sites are seen
within the first exon and 5'-flanking sequences (Fig. 6A). This
region is GC rich and fulfills the definition of a CpG island
(12). The sequence surrounding the transcription start sites for h
-ENaC-2 contains a consensus TATAA sequence, but this is
seen downstream of several transcription start sites (Fig. 6B). A CAAT box is not seen, although several Sp1 and AP1
sites are seen. In addition, consensus binding sites for TTF and a cAMP response element (CRE) and GRE are also noted. Also within this region
and within 40 bp the 5'-most transcription start site, an
Alu-Sz sequence is noted (16).
|
To determine whether the 5'-flanking sequences for each initiating exon
contained transcriptional regulatory elements that could direct
transcription, genomic fragments that included cognate transcription
start sites were cloned in both orientations upstream of luciferase and
transfected into H441 cells. The H441 cell is a human lung epithelial
cell line with glucocorticoid-regulated Na+ transport and
ENaC expression (15, 32). Consistent with the presence of
a promoter upstream of exons 1A and 1B,
constructs that included 5'-flanking genomic DNA significantly
increased luciferase expression in H441 cells compared with an empty
plasmid pGL3basic (Fig. 7). In keeping
with the general paradigm for promoter function, 5'-flanking
fragments cloned in reverse had no activity in these cells.
|
To further characterize promoter activity, full-length and various
deletion constructs of
-ENaC-1 and
-ENaC-2 promoter were tested
in H441 cells. The first set of deletion constructs identified two
transcriptional regulatory regions in
-ENaC-1 between
142 and
23
and between
23 and +143 (Fig.
8A). Deletions of
-ENaC-2 in H441 cells demonstrated a progressive loss of function, with deletion to
127 abolishing transcriptional regulatory activity. To
begin to identify the core promoter that regulates the expression of
-ENaC-1 and -2, further deletions were created between
310 and
127 for
-ENaC-2 and
23 and +143 for
-ENaC-1 and tested in
H441 cells. A regulatory region was identified between
310 and
266
for
-ENaC-2 and between
23 and +13 and +13 and +45 for
-ENaC-1
(Fig. 8B).
|
We next used gel mobility shift analysis with oligonucleotides, which
corresponds to mapped regions with at least twofold activity over empty
plasmid, and nuclear extracts from H441 and A549 cells. The A549 cell
is a human lung epithelial cell line with glucocorticoid-regulated ENaC
expression and Na+ channels that correspond to the
ENaC heteromultimer (15, 20). For the initial
-ENaC-1
promoter experiments, a double-strand oligonucleotide that corresponded
to
22 to +12 of the gene was used as a probe, which revealed
the presence of several discrete complexes, p1-p5 (Fig.
9). To begin to localize the site of
DNA-protein interaction for these complexes, two overlapping internal
oligonucleotides,
1-Rt and
1-Lt, were used in competition and as
radiolabeled probes. These studies demonstrated that p3-p5 bound
to either internal nucleotides and could be competed by both, whereas
complexes p1-p2 were bound to and competed by
1-Rt only. The
pattern of bound complexes was very similar to H441 cell extracts and
suggested that p1 and p2 bound to a region of
1-Lt that was not
completely shared with
1-Rt, whereas p3-p5 bound to the common
region between
1-Lt and
1-Rt. Analysis of these regions indicated
an MZF1 site in the common region and an Sp1 site that was partly
unshared.
|
We performed similar experiments by using a double-strand
oligonucleotide, which corresponded to
310 to +267 of the
-ENaC-2 gene, which also revealed the presence of discrete
complexes, p1-p5 (Fig. 10). Using
a comparable strategy, we localized the site of DNA-protein interaction
by using two overlapping internal oligonucleotides,
2-Rt and
2-Lt, in competition and as radiolabeled probes. Like the
-ENaC-1
analysis, these studies demonstrated that p3-p5 bound to either
internal nucleotides and could be competed by both, whereas complexes
p1-p2 were bound to and competed by
2-Rt only. The pattern of
bound complexes was identical to H441 cell extracts and suggested that
p1 and p2 bound to a region of
2-Lt that was not common with
2-Rt, whereas p3-p5 bound to the shared region between
2-Lt
and
2-Rt. Analysis of these regions indicated a CF1 site in the
common region and an Sp1 site that was unshared.
|
Given the importance of Sp1 in directing transcription of TATA-less
promoters, we then asked whether Sp1 could specifically bind to the
core promoter of
-ENaC-1 and -2. For these experiments,
1-Rt,
2-Rt, and a consensus Sp1-binding sequence from the h
-ENaC promoter were used separately as probes with H441 nuclear extracts (4). When
1-Rt was used as a probe, complexes p1 and p2
were competed by the consensus Sp1 oligonucleotide but not by an NS oligonucleotide (Fig. 11). Complex p1
was supershifted by an antibody to Sp1, whereas complex p2 was
supershifted by an antibody to Sp3. Similarly, when
2-Rt was used as
a probe, p1 and p2 were competed by the Sp1 oligonucleotide and
supershifted by anti-Sp1 and anti-Sp3, respectively.
|
These results suggest that Sp1, a ubiquitous transcription factor that
binds to many TATA-less promoters, may be important for the activity of
-ENaC promoters. However, these data do not explain the
tissue-specific or regulated expression of the
-ENaC promoter, which
is likely to be related to the expression of cell-specific enhancers
and repressors or the agonist-dependent acetylation of histones and
unwinding of chromatin in discrete areas of the
-ENaC gene to expose
and enhance binding of cis-elements to appropriate trans-acting factors.
| |
DISCUSSION |
|---|
|
|
|---|
In this paper, we report the structure of the 5' end of the
h
-ENaC gene, complementing earlier work in which the 3' portions of
the gene had been characterized (29, 31). With this
report, the genomic organization for each of the three human ENaC genes is now available (10, 24, 29, 31, 42, 43). Beginning with
the first exon (exon 2) that contains the principal
translation start codon, the size and number of exons are remarkably
similar, and the position of the exon-intron junctions are perfectly
preserved between each of the three subunits, clearly indicating a
common evolutionary origin. Furthermore, there is significant homology between each of the three subunits at the aa level (25).
However, there are enormous differences in the organization of these
genes at their 5' end. h
-ENaC appears to have a single transcription start site that gives rise to a 5' untranslated exon ~4 kb upstream of exon 2 (43). h
-ENaC has two principal
transcription start sites 724 bp apart that give rise to alternate
first exons less than about 700 bp upstream of exon 2 (42). Unlike h
-ENaC, h
-ENaC transcripts encode two
NH2-terminal variant forms of the
-ENaC protein that are
both abundantly expressed. h
-ENaC has two principal exons
(exons 1A and 1B) in which transcription is
initiated and that are ~45 kb away from exon 2. Like
h
-ENaC, h
-ENaC transcripts appear to encode
NH2-terminal variant proteins, although, compared with the
originally described
-ENaC form, these transcripts are not very
abundant, at least in normal human kidney and placenta (Fig. 4).
Given the tremendous differences at the 5' ends of each of the three
genes, it is not surprising that the 5'-flanking sequences that
regulate the expression of these genes are also very different. The
h
-ENaC gene appears to have two distinct promoters that direct the
expression of at least two transcripts similar to that seen with the
h
-ENaC gene (32). The h
-ENaC gene has a single
promoter that, like the upstream promoter of
-ENaC, is within a CpG
island and contains numerous Sp1 binding sites (4). The
upstream h
-ENaC promoter appears to be TATA-less, whereas the
downstream promoter contains a TATA box that is within the
transcriptional unit. Both promoters contain Sp1 binding sites, and in
this study we demonstrate that Sp1 and Sp3 bind to the core promoter of
both transcripts. Other core promoter motifs that can direct
transcription in TATA-less promoters, such as the initiator (Inr) and
the transcription factor IIB recognition element (BRE), are not seen in
close proximity to the transcription start sites for either
-ENaC
transcript and may account for the multiplicity of start sites
(19, 34). Interestingly, a partial downstream
promoter element sequence G[A/T]CG, previously shown to be sufficient
to regulate the TATA-less Abd-B promoter in
Drosophila, is seen 21 bp downstream of the 5'-most
transcription start site for
-ENaC-1 (8, 18).
The heterogeneity at the 5' end of the h
-ENaC gene appears to lead
to the translation of three variant
-ENaC proteins that differ in
the length of the intracytoplasmic NH2 termini. However, when expressed from a heterologous promoter and without its cognate 5'-UTR in COS-7 cells, we were unable to demonstrate that the most
upstream ATG is utilized, unless the downstream ATG, which serves as
the translation start codon for
-ENaC-1, is first mutated. Furthermore, the NH2-terminal extensions do not contain
additional motifs that predict posttranslational modifications or
protein-protein interactions (Fig. 5E). Unlike the COOH
terminus, no clear role for the NH2 terminus of ENaC
subunits has been identified, although it appears to be important for
subunit association (1, 9). A point mutation in
the NH2 terminus of
that leads to
pseudohypoaldosteronism appears to do so by disrupting the gating of
the assembled ENaC heteromer (14). The roles and function
of the NH2 terminus of
-ENaC and its variants should
become clear as more studies are performed. However, the studies
presented in this paper do not point to a significant role for
NH2-terminal
-ENaC-2 variants in vivo.
Little is known about the transcriptional regulation of the h
-ENaC
gene. The gene is developmentally regulated with expression in the
renal collecting duct and airway epithelium that are first evident in
late fetal life (39, 40, 44, 47, 48). Glucocorticoids increase expression of
-ENaC,
-ENaC, and
-ENaC in the
mammalian lung and in airway epithelial cells, although the effects of
corticosteroids on
-ENaC and
-ENaC expression have not been
consistently observed (30, 37, 45). Glucocorticoids,
mineralocorticoids, and dietary Na+ deprivation increase
expression of
-ENaC and
-ENaC but not
-ENaC in the mammalian
distal colon and increase expression of
-ENaC in regions of the
kidney (3, 11, 28, 30, 37). Although the basis for the
increase in h
-ENaC mRNA by glucocorticoids and mineralocorticoids is
transcriptional (10, 22, 27, 32), the mechanism of
corticosteroid regulation of
-ENaC or
-ENaC has not been
determined. Actinomycin D, a general inhibitor of transcription,
abolished the glucocorticoid-regulated expression of
-ENaC in H441
cells, suggesting that the glucocorticoid effect on
-ENaC is
transcriptional (15). Alhough the 5'-flanking region of
h
-ENaC contains imperfect GREs, these are not functional in H441cells (data not shown). These results suggest that the
glucocorticoid effect is mediated by means of cis-elements
elsewhere in the gene. It is important to note that both
and
are coordinately regulated by corticosteroids in several tissues.
Because
-ENaC and
-ENaC are located on 16p12 within 400 kb of
each other, an interesting possibility is that a common locus control
element directs the corticosteroid regulation of
-ENaC and
-ENaC.
The cloning and availability of large tracts of genomic DNA flanking
the h
-ENaC gene should facilitate the evaluation of distant
sequences that may regulate
-ENaC expression.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Norman Doggett for the gift of a human genomic library, Kristyn Cornish and Mona Brake for technical support, and the University of Iowa DNA core facility for providing DNA synthesis and sequencing services.
| |
FOOTNOTES |
|---|
This work was supported in part by grants-in-aid from March of Dimes Birth Defects Foundation Research Grant 6-FY99-444, United States Public Health Service Grant DK-54348, and a Career Investigator Award from the American Lung Association to C. P. Thomas.
The nucleotide sequences reported in this paper will appear in DDBJ, EMBL, GenBank, and GSDB Nucleotide Sequence databases under accession nos. AF260226, AF260227, and AF260228.
Address for reprint requests and other correspondence: C. P. Thomas, Dept. of Internal Medicine, Univ. of Iowa College of Medicine, 200 Hawkins Dr., Iowa City, IA 52242-1081 (E-mail: christie-thomas{at}uiowa.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published December 18, 2001;10.1152/ajprenal.00268.2001
Received 27 August 2001; accepted in final form 23 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adams, CM,
Snyder PM,
and
Welsh MJ.
Interactions between subunits of the human epithelial sodium channel.
J Biol Chem
272:
27295-27300,
1997.
2.
Ambrosius, WT,
Bloem LJ,
Zhou L,
Rebhun JF,
Snyder PM,
Wagner MA,
Guo C,
and
Pratt JH.
Genetic variants in the epithelial sodium channel in relation to aldosterone and potassium excretion and risk for hypertension.
Hypertension
34:
631-637,
1999.
3.
Asher, C,
Wald H,
Rossier BC,
and
Garty H.
Aldosterone-induced increase in abundance of Na+ channel subunits.
Am J Physiol Cell Physiol
271:
C605-C611,
1996.
4.
Auerbach, SD,
Loftus RW,
Itani OA,
and
Thomas CP.
The human amiloride-sensitive epithelial sodium channel
subunit promoter: functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation.
Biochem J
347:
105-114,
2000.
5.
Baker, EH,
Dong YB,
Sagnella GA,
Rothwell M,
Onipinla AK,
Markandu ND,
Cappuccio FP,
Cook DG,
Persu A,
Corvol P,
Jeunemaitre X,
Carter ND,
and
MacGregor GA.
Association of hypertension with T594M mutation in
-subunit of epithelial sodium channels in black people resident in London.
Lancet
351:
1388-1392,
1998.
6.
Barbry, P,
and
Hofman P.
Molecular biology of Na+ absorption.
Am J Physiol Gastrointest Liver Physiol
273:
G571-G585,
1997.
7.
Barker, P,
Nguyen M,
Gatzy J,
Grubb B,
Norman H,
Hummler E,
Rossier B,
Boucher R,
and
Koller B.
Role of
ENaC subunit in lung liquid clearance and electrolye balance in newborn mice.
J Clin Invest
102:
1634-1640,
1998.
8.
Burke, TW,
and
Kadonaga JT.
The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila.
Genes Dev
11:
3020-3031,
1997.
9.
Chalfant, ML,
Denton JS,
Langloh AL,
Karlson KH,
Loffing J,
Benos DJ,
and
Stanton BA.
The NH2 terminus of the epithelial sodium channel contains an endocytic motif.
J Biol Chem
274:
32889-32896,
1999.
10.
Chow, YH,
Wang Y,
Plumb J,
O'Brodovich H,
and
Hu J.
Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel
subunit gene.
Pediatr Res
46:
208-214,
1999.
11.
Escoubet, B,
Coureau C,
Bonvalet JP,
and
Farman N.
Noncoordinate regulation of epithelial Na+ channel and Na+ pump subunit mRNAs in kidney and colon by aldosterone.
Am J Physiol Cell Physiol
272:
C1482-C1491,
1997.
12.
Gardiner-Garden, M,
and
Frommer M.
CpG islands in vertebrate genomes.
J Mol Biol
196:
261-282,
1987.
13.
Garty, H,
and
Palmer LG.
Epithelial sodium channels: function and regulation.
Physiol Rev
77:
359-396,
1997.
14.
Grunder, S,
Firsov D,
Chang SS,
Jaeger NF,
Gautschi I,
Schild L,
Lifton RP,
and
Rossier BC.
A mutation causing pseudohypoaldosteronism type 1 identifies a conserved glycine that is involved in the gating of the epithelial sodium channel.
EMBO J
16:
899-907,
1997.
15.
Itani OA, Auerbach SD, Husted RF, Volk KA, Ageloff S, Knepper MA,
Stokes JB, and Thomas CP. Glucocorticoid-stimulated
Na+ transport in human lung epithelia is associated with
regulated ENaC and sgk1 expression. Am J Physiol Lung Cell
Mol Physiol (October 5, 2001). 10.1152/ajplung.00085.2001.
16.
Jurka, J,
Klonowski P,
Dagman V,
and
Pelton P.
CENSOR
a program for identification and elimination of repetitive elements from DNA sequences.
Comput Chem
20:
119-122,
1996.
17.
Kerem, E,
Bistritzer T,
Hanukoglu A,
Hofman T,
Zhou Z,
Bennett W,
MacLaughlin E,
Barker P,
Nash M,
Quittell L,
Boucher R,
and
Knowles MR.
Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism.
N Engl J Med
341:
156-162,
1999.
18.
Kutach, AK,
and
Kadonaga JT.
The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters.
Mol Cell Biol
20:
4754-4764,
2000.
19.
Lagrange, T,
Kapanidis AN,
Tang H,
Reinberg D,
and
Ebright RH.
New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB.
Genes Dev
12:
34-44,
1998.
20.
Lazrak, A,
Samanta A,
Venetsanou K,
Barbry P,
and
Matalon S.
Modification of biophysical properties of lung epithelial Na+ channels by dexamethasone.
Am J Physiol Cell Physiol
279:
C762-C770,
2000.
21.
Lifton, R.
Molecular genetics of human blood pressure variation.
Science
272:
676-680,
1996.
22.
Lin, HH,
Zentner MD,
Ho HLL,
Kim KJ,
and
Ann DK.
The gene expression of the amiloride-sensitive epithelial sodium channel
-subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells.
J Biol Chem
274:
21544-21554,
1999.
23.
Loftus, BJ,
Kim UJ,
Sneddon VP,
Kalush F,
Brandon R,
Fuhrmann J,
Mason T,
Crosby ML,
Barnstead M,
Cronin L,
Deslattes Mays A,
Cao Y,
Xu RX,
Kang HL,
Mitchell S,
Eichler EE,
Harris PC,
Venter JC,
and
Adams MD.
Genome duplications and other features in 12 Mb of DNA sequence from human chromosome 16p and 16q.
Genomics
60:
295-308,
1999.
24.
Ludwig, M,
Bolkenius U,
Wickert L,
Marynen P,
and
Bidlingmaier F.
Structural organization of the gene encoding the
-subunit of the human amiloride-sensitive epithelial sodium channel.
Hum Genet
102:
576-581,
1998.
25.
McDonald, FJ,
Price MP,
Snyder PM,
and
Welsh MJ.
Cloning and expression of the
- and
-subunits of the human epithelial sodium channel.
Am J Physiol Cell Physiol
268:
C1157-C1163,
1995.
26.
McDonald, FJ,
Yang B,
Hrstka R,
Drummond H,
Tarr D,
McCray P, Jr,
Stokes J,
Welsh M,
and
Williamson R.
Disruption of the
subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death associated with pseudohypoaldosteronism phenotype.
Proc Natl Acad Sci USA
96:
1727-1731,
1999.
27.
Mick, VE,
Itani OA,
Loftus RW,
Husted RF,
Schmidt TJ,
and
Thomas CP.
The
subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene.
Mol Endocrinol
15:
575-588,
2001.
28.
Ono, S,
Kusano E,
Muto S,
Ando Y,
and
Asano Y.
A low-Na+ diet enhances expression of mRNA for epithelial Na+ channel in rat renal inner medulla.
Pflügers Arch
434:
756-763,
1997.
29.
Persu, A,
Barbry P,
Bassilana F,
Houot AM,
Mengual R,
Lazdunski M,
Corvol P,
and
Jeunemaitre X.
Genetic analysis of the
-subunit of the epithelial Na+ channel in essential hypertension.
Hypertension
32:
129-137,
1998.
30.
Renard, S,
Voilley N,
Bassilana F,
Lazdunski M,
and
Barbry P.
Localization and regulation by steroids of the
,
and
subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney.
Pflügers Arch
430:
299-307,
1995.
31.
Saxena, A,
Hanukoglu I,
Strautnieks SS,
Thompson RJ,
Gardiner RM,
and
Hanukoglu A.
Gene structure of the human amiloride-sensitive epithelial sodium channel
-subunit.
Biochem Biophys Res Commun
252:
208-213,
1998.
32.
Sayegh, R,
Auerbach SD,
Li X,
Loftus R,
Husted R,
Stokes JB,
and
Thomas CP.
Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5' flanking region of the human epithelial sodium channel
subunit gene.
J Biol Chem
274:
12431-12437,
1999.
33.
Schaedel, C,
Marthinsen L,
Kristoffersson AC,
Kornfalt R,
Nilsson KO,
Orlenius B,
and
Holmberg L.
Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the
-subunit of the epithelial sodium channel.
J Pediatr
135:
739-745,
1999.
34.
Smale, ST,
and
Baltimore D.
The "Initiator" as a transcription control element.
Cell
57:
103-113,
1989.
35.
Smith, P,
Mackler S,
Weiser P,
Brooker D,
Ahn Y,
Harte B,
McNulty K,
and
Kleyman T.
Expression and localization of epithelial sodium channel in mammalian urinary bladder.
Am J Physiol Renal Physiol
274:
F91-F96,
1998.
36.
Stokes, JB.
Disorders of the epithelial sodium channel: insights into the regulation of extracellular volume and blood pressure.
Kidney Int
56:
2318-2333,
1999.
37.
Stokes, JB,
and
Sigmund RD.
Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue and steroid heterogeneity.
Am J Physiol Cell Physiol
274:
C1699-C1707,
1998.
38.
Su, YR,
Rutkowski MP,
Klanke CA,
Wu X,
Cui Y,
Pun RY,
Carter V,
Reif M,
and
Menon AG.
A novel variant of the
-subunit of the amiloride-sensitive sodium channel in African Americans.
J Am Soc Nephrol
7:
2543-2549,
1996.
39.
Talbot, CL,
Bosworth DG,
Briley EL,
Fenstermacher DA,
Boucher RC,
Gabriel SE,
and
Barker PM.
Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung.
Am J Respir Cell Mol Biol
20:
398-406,
1999.
40.
Tchepichev, S,
Ueda J,
Canessa CM,
Rossier BC,
and
O'Brodovich HM.
The lung epithelial Na+ channel subunits are differentially regulated during development and by steroids.
Am J Physiol Cell Physiol
269:
C805-C812,
1995.
42.
Thomas, CP,
Auerbach SD,
Stokes JB,
and
Volk KA.
5' heterogeneity in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins.
Am J Physiol Cell Physiol
274:
C1312-C1323,
1998.
43.
Thomas, CP,
Doggett NA,
Fisher R,
and
Stokes JB.
Genomic organization and the 5' flanking region of the
subunit of the human amiloride-sensitive epithelial sodium channel.
J Biol Chem
271:
26062-26066,
1996.
44.
Vehaskari, VM,
Hempe JM,
Manning J,
Aviles DH,
and
Carmichael MC.
Developmental regulation of ENaC subunit mRNA levels in rat kidney.
Am J Physiol Cell Physiol
274:
C1661-C1666,
1998.
45.
Venkatesh, VC,
and
Katzberg HD.
Glucocorticoid regulation of epithelial sodium channel genes in human fetal lung.
Am J Physiol Lung Cell Mol Physiol
273:
L227-L233,
1997.
46.
Voilley, N,
Bassilana F,
Mignon C,
Merscher S,
Mattei MG,
Carle GF,
Lazdunski M,
and
Barbry P.
Cloning, chromosomal localization, and physical linkage of the
- and
-subunits (SCNN1B and SCNN1G) of the human epithelial amiloride-sensitive sodium channel.
Genomics
28:
560-565,
1995.
47.
Watanabe, S,
Matsushita K,
McCray PB,
and
Stokes JB.
Developmental expression of the epithelial Na+ channel in kidney and uroepithelia.
Am J Physiol Renal Physiol
276:
F304-F314,
1999.
48.
Watanabe, S,
Matsushita K,
Stokes J,
and
McCray P.
Developmental regulation of epithelial sodium channel subunit mRNA expression in rat colon and lung.
Am J Physiol Gastrointest Liver Physiol
275:
G1227-G1235,
1998.
This article has been cited by other articles:
![]() |
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1 Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Ramminger, K. Richard, S. K. Inglis, S. C. Land, R. E. Olver, and S. M. Wilson A regulated apical Na+ conductance in dexamethasone-treated H441 airway epithelial cells Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L411 - L419. [Abstract] [Full Text] [PDF] |
||||