AJP - Renal AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 282: F898-F909, 2002. First published December 18, 2001; doi:10.1152/ajprenal.00268.2001
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/5/F898    most recent
00268.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Itani, O. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Itani, O. A.
Vol. 282, Issue 5, F898-F909, May 2002

Genomic organization of the 5' end of human beta -ENaC and preliminary characterization of its promoter

Christie P. Thomas, Randy W. Loftus, Kang Z. Liu, and Omar A. Itani

Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, Iowa 52242-1081


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

The mRNA for the beta -subunit of the epithelial Na+ channel (beta -ENaC) is regulated developmentally and, in some tissues, in response to corticosteroids. To understand the mechanisms of transcriptional regulation of the human beta -ENaC gene, we characterized the 5' end of the gene and its 5'-flanking regions. Adaptor-ligated human kidney and lung cDNA were amplified by 5' rapid amplification of cDNA ends, and transcription start sites of two 5' variant transcripts were determined by nuclease protection or primer extension assays. Cosmid clones that contain the 5' end of the gene were isolated, and analysis of these clones indicated that alternate first exons ~1.5 kb apart and ~ 45 kb upstream of a common second exon formed the basis of these transcripts. Genomic fragments that included the proximal 5'-flanking region of either transcript were able to direct expression of a reporter gene in lung epithelia and to bind Sp1 in nuclear extracts, confirming the presence of separate promoters that regulate beta -ENaC expression.

amiloride; gene regulation; transcription start sites; RNA splicing; gel mobility shift assay; beta -subunit of the epithelial sodium channel


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

WITH THE CLONING OF THE THREE component subunits (alpha , beta , and gamma ) of the epithelial Na+ channel (ENaC) the identity of the amiloride-sensitive Na+ channel in the collecting ducts of the kidney and in other sites such as the distal colon, sweat glands, and salivary glands has been firmly established (6, 13). However, the role of ENaC subunits in other sites such as the placenta, brain, and urinary bladder is unknown (25, 35). The activity of the Na+ channel in the collecting duct is increased by dietary Na+ depletion and by conditions that elevate circulating mineralocorticoids, although the exact mechanism for the changes in channel activity is not understood. The importance of the ENaC complex in the regulation of extracellular blood volume and blood pressure has become clear from observations of the effects of mutations of ENaC subunits in humans and, in some cases, is confirmed by the effects of targeted deletions of ENaC subunits in mice (36). Gain of function mutations that disrupt the PY motif in the COOH terminus of beta -ENaC or gamma -ENaC leads to unregulated Na+ reabsorption accompanied by hypertension and hypokalemia that is dominantly inherited (21). Homozygous inactivating mutations in any of the three ENaC subunits lead to salt wasting and hyperkalemia, a phenotype that can be recapitulated by targeted deletion of beta -ENaC or gamma -ENaC (7, 26). The consequences of mutations in ENaC subunits are not always limited to their effects on the kidney and on regulation of Na+ reabsorption. ENaC subunits are expressed throughout the airway epithelia and in alveolar type II cells and are thought to regulate the volume and ionic composition of airway surface liquid. Inactivating mutations in alpha -ENaC or beta -ENaC have now been demonstrated in several patients with a pulmonary syndrome characterized by chest congestion, chronic cough, tachypnea, and recurrent respiratory infections (17, 33).

The identification of mutations in ENaC that cause monogenic hypertension has led to the logical hypothesis that milder defects in channel function or regulation may contribute to the more common form of high blood pressure, essential hypertension. A polymorphism common in African-Americans and in London residents of African descent, the T594M variant in beta -ENaC is associated with hypertension, at least in the London population (5, 38). Another polymorphism in beta -ENaC, the G442V variant, is also more prevalent in African-Americans and is associated with parameters that suggest enhanced activity of the ENaC channel, such as a suppression of the urinary aldosterone-potassium ratio, although there was no clear association with hypertension (2). Mutations or polymorphisms in the untranslated regions (UTRs) of ENaC mRNA or in 5' regulatory regions may also contribute to altered regulation or expression.

The hbeta -ENaC gene (SCNN1B) is located on chromosome 16 (16p12) in close proximity to the gamma -ENaC gene (SCNN1G) (46). Like gamma -ENaC, beta -ENaC mRNA is regulated by dietary Na+ deprivation and by systemic administration of aldosterone or glucocorticoids. To begin to understand the factors that regulate gene expression, we have cloned and characterized the 5' end of the hbeta -ENaC gene and identified alternate promoters that determine basal expression of separate transcripts.


    EXPERIMENTAL
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

Materials. Human kidney RNA and human placental DNA were from Clontech (Palo Alto, CA). All radionucleotides were from NEN Life Science Products (Boston, MA). Culture media were obtained from Life Technologies (Gaithersburg, MD), and DNA sequencing and synthesis were a service provided by the University of Iowa DNA core facility. H441 cells were cultured in RPMI 1640 as previously described (42). COS-7 and A549 cells were obtained from the American Tissue Culture Collection (Manassas, VA). COS-7 cells were cultured in Dulbecco's modified Eagle's medium, and A549 cells were cultured in minimum essential medium containing 10% fetal bovine serum.

5' Rapid amplification of cDNA ends. 5' Rapid amplification of cDNA ends (RACE) was performed with two modified human cDNA libraries (Clontech). The single-strand 5'-RACE-ready human lung cDNA has an anchor sequence 5'-CACGAATTCACTATCGATTCTGGAACCTTCAGAGG-NH2 ligated to its 3' end. The double-strand human kidney Marathon-ready cDNA has an adapter sequence 5'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT ligated to both ends. Gene-specific reverse primers beta 1 (5'-GGTGAGCAGGAACCACATGGCTTTCTTC; +168 to +141 from the original initiation codon; see Fig. 1 and Ref. 25), beta 2 (CCACACCAGCAGCTCCTTGTACGTGTAGCC; +84 to +55 from the original initiation codon), and beta 4 (5'-GGCCCTTCTGCAGCCGATGCAG; +52 to +31 from the original initiation codon) were used with anchor- or adapter-specific primers in PCR reactions. PCR with human kidney cDNA was performed for 35-40 cycles with Taq polymerase (Promega, Madison, WI) or with rTth XL (Perkin-Elmer, Foster City, CA) by using primer beta 1 with an annealing step at 63 and 68°C, respectively. Seminested PCR was performed with human lung cDNA by using Taq polymerase and beta 2 and beta 4 primers in sequential reactions with primer annealing at 65 and 63°C, respectively. Amplified fragments were cloned into pCRII (Invitrogen, Carlsbad, CA), and individual clones were sequenced.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1.   5' Variant beta -subunit of the epithelial Na+ channel (beta -ENaC) cDNAs identified in human kidney and lung. A: schematic of cDNA clones identified by 5'-rapid amplification of cDNA ends (RACE). The initiation codon ATG and the start of the open reading frame (ORF) are shown. Arrows, adaptor primers and gene-specific primers; hatched bar, original cDNA; open bar, new sequence. B and C: beta -ENaC-1 and -2 sequences. Previously known sequence is shown in bold, primers used for 5'-RACE are indicated, and the putative translation initiation codon is boxed.

Genomic library screening. The longest 5'-RACE clone (Fig. 1B) was labeled with [alpha -32P]dCTP by using random hexamers and the Klenow fragment of DNA polymerase. A human chromosome 16-specific cosmid library (a gift from Norman Doggett, Los Alamos, NM) arrayed at high density on nylon membranes was screened by using the labeled hbeta -ENaC probe as previously described (43). Putative positive clones were confirmed by PCR of cosmid clones by using beta T (5'-GCACGTGAAGAAGTACCTGCTGAAGGGCCTG) and beta 3 (5' TTGGGCCCCTCACAGATGATGCG) to amplify a 138-bp fragment. Portions of hbeta -ENaC genomic DNA in cosmid clones were then mapped by restriction analysis and partially sequenced. Primary DNA sequence analysis was performed with OMIGA (Genetics Computer Group, Madison, WI); the sequence was screened for CpG islands by using the GRAIL program at http://compbio.ornl.gov/Grail-1.3/ and for interspersed repeats by using the Censor program at http://www.girinst.org/Censor_Server.html.

RNase protection assay. Human placental RNA was prepared by using the RNeasy Mini kit (Qiagen, Valencia, CA) following the manufacturer's recommendations, and human kidney RNA was purchased from Clontech. To map the transcription start site of hbeta -ENaC-2, a genomic DNA fragment that included exon 1B and the putative 5'-flanking region was amplified by PCR from placental genomic DNA by using primers beta 20 (5'-CAGTCCACAAAAGGCACATCT) and beta 11 (5'-CCCATCGGTAGGCATTATCC) and cloned into pCRXL-TOPO (Invitrogen) antisense to the T7 polymerase promoter. To assess the relative abundance of each transcript, a cDNA fragment that included the 5' end of exon 2, exon 1C, and the 3' portion of exon 1B [nucleotides (nt) +61 to +330] was ligated into pCRII antisense to the SP6 polymerase promoter. The templates were linearized and used to synthesize antisense [alpha -32P]UTP-labeled cRNAs. These probes were hybridized overnight with 10 µg of sample RNA or yeast RNA at 45°C in 80% formamide, 400 mM NaCl, 1 mM EDTA, and 40 mM PIPES (pH 6.4); digested with 50 U/ml RNAse T1 and 2.5 µg/ml RNAse A (Ambion, Austin, Tx); and analyzed by denaturing PAGE as previously described (42). To accurately localize transcription start sites, the cDNA template was sequenced by the dideoxy method with primer beta 11 by using [35S]dATP, and a 1-bp ladder was run alongside nuclease-protected fragments.

Primer extension. Primer extension in kidney RNA was performed to map the transcription start site of hbeta -ENaC-1. A primer beta 6b (5' GTGTTGGTACACTGGGACA) was synthesized, end labeled with [gamma -32P]ATP, and purified on a Sephadex G25 column (Quickspin, Roche Biochemicals, Indianapolis, IN). Labeled primer (100,000 counts/min) and 10 µg kidney or yeast RNA were heated together at 90°C for 3 min and then hybridized at 65°C for 90 min. A primer extension reaction was then performed with 400 U of Superscript II reverse transcriptase (Life Technologies) at 43°C for 120 min in a reaction mixture that contained (in mM) 75 KCl, 50 Tris · HCl (pH 8.3), 3 MgCl2, 20 dithiothreitol, and 1.25 2-deoxynucleotide 5'-triphosphates. The labeled products were analyzed by PAGE, and the transcription start site was localized by running the products alongside a 1-bp ladder generated by sequencing a beta -ENaC genomic DNA fragment with primer beta 6b.

In vitro translation of beta -ENaC. Full-length hbeta -ENaC-1 cDNA with a COOH-terminal hemagglutinin (HA) epitope (a gift from P. Snyder and M. Welsh, University of Iowa) in pMT3 (1) was recloned into the EcoRV-XhoI site of pcDNA3 (Invitrogen). The cloned 5' variant beta -ENaCs were spliced to the 5' end of beta -ENaC-1 by using an NheI site to generate full-length HA-tagged beta -ENaC-2 and beta -ENaC-3. The first ATG (met) of beta -ENaC-1 was mutated to GCG (ala) in hbeta -ENaC-2 by using the Quikchange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primers GGGTGCCACTGCGCACGTGAAGAAG and CTTCTTCACGTGCGCAGTGGCACCC to generate hbeta -ENaC-2/mut. The 5'-UTR in all constructs were <30 nt. Sequential transcription and translation of beta -ENaC clones were performed by using the TnT Quick Coupled Transcription/Translation system (Promega) following the manufacturer's instructions. [35S]methionine was used to label the synthesized peptides and the products visualized by SDS-PAGE and autoradiography.

Transfection and immunoblotting of epitope-tagged hbeta -ENaC cDNAs. For transfection of COS-7 cells, monolayers from two T225 flasks were trypsinized and then resuspended at a density of 2.5 million cells/ml in a solution containing (in mM) 120 KCl, 10 K2HPO4, 10 KH2PO4, 2 EGTA 5 MgCl2, 100 ATP, 250 glutathione, and 25 HEPES and also 150 µM CaCl2 (pH 7.6). An 800-µl aliquot of cells was combined with 20 µg of HA-tagged hbeta -ENaC in a 0.4-cm Micropulser cuvette and then electroporated (Gene Pulser II, Bio-Rad, Hercules, CA) at 320 V and 950 µF. Cells were then plated in a 60-mm2 dish and, 48 h after transfection, lysed in 500 µl of 2% SDS containing leupeptin and aprotinin and passed 4-6 times through a 22-g needle. The lysates were centrifuged at 13,000 rpm for 10 min at 4°C, and 80 µl of the supernatant were run on a 5% SDS gel and transferred to a nitrocellulose membrane. The membrane was blocked in TBS containing 0.05% Tween 20 (Roche Biochemicals) and 5% nonfat dry milk and then incubated with a monoclonal anti-HA antibody (Roche Biochemicals) followed by a 1:10,000 dilution of a peroxidase-conjugated rabbit anti-mouse antibody (Sigma, St. Louis, MO). Peroxidase was detected by using Supersignal West Chemiluminescent Substrate (Pierce, Rockford, IL).

Transfection of hbeta -ENaC promoter constructs and reporter gene assays. H441 cells were grown in 12-well plates for transfection analysis. A genomic fragment that extended from -472 to +143 of beta -ENaC-1 (see Fig. 6A) was amplified by PCR using primers beta 15 (5' AAGAGGCGGAGGGAAGAACG) and beta 7 (5' AGCGGGGACACGGAGGATGC) and cloned in both orientations into pGL3basic (Promega) upstream of the coding region for firefly luciferase. A genomic fragment that extended from -745 to +82 of beta -ENaC-2 (see Fig. 6B) was amplified with primers beta 11 and beta 20 and was also cloned into pGL3basic. Various deletions of these constructs were made by using internal restriction sites or by PCR amplification of shorter fragments. H441 cells were transfected with luciferase constructs and with a control plasmid pRL-SV40 (Promega) by using Lipofectin (Life Technologies) as previously described (32). Forty-eight hours after transfection, cell lysates were prepared, and reporter gene activity was determined by the Dual Luciferase Assay Kit in a Monolight 2010 luminometer (Analytical Luminescence Laboratories, Ann Arbor, MI).

Gel mobility shift assays. Nuclear extracts were made from confluent cultures of H441 and A549 cells as previously described (4). Single-strand oligonucleotides that correspond to mapped 5'-flanking elements of beta -ENaC-1 and beta -ENaC-2 were synthesized and then annealed together
<AR><R><C><TT>&bgr;ENaC-1: 
</TT></C></R><R><C><TT>ctagGGGCGCTCCCCGTGCTTCCCCGCCCCTGAACCTG   
</TT></C></R><R><C><TT>      CCCGCGAGGGGCACGAAGGGGCGGGGACTTGGACgatc</TT></C></R></AR>

<AR><R><C><TT>&bgr;ENaC-2: 
</TT></C></R><R><C><TT>ctagGGGCGGATCACTTGAGGTCAGGAGTTTGAGACCAGCCCAGCCTA
</TT></C></R><R><C><TT>      CCCGCCTAGTGAACTCCAGTCCTCAAACTCTGGTCGGGTCGGATgatc</TT></C></R></AR>
A consesus Sp1 binding oligonucleotide and a nonspecific (NS) oligonucleotide were also synthesized
Double-strand oligonucleotides were end-labeled with [gamma -32P]ATP and incubated with A549 and H441 nuclear extracts as previously described (4). A 50-fold excess of nonradioactive oligonucleotides were used for competition experiments. For supershift assays, H441 nuclear extracts were preincubated with 1 µl of anti-Sp1 Ab (Promega) or 1 µl of anti-Sp3 Ab (Santa Cruz Biotechnology, Santa Cruz, CA) and then added to the labeled probe. Samples were then analyzed on a nondenaturing polyacrylamide gel in 0.5× TBE buffer that was run at 150 V, and the gel was dried and subjected to autoradiography.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

Although the human beta -ENaC cDNA had been cloned and portions of the gene structure characterized, the 5' regions of the beta -ENaC gene have not been previously studied (25, 29, 31, 46). To first determine the potential extent of the beta -ENaC RNA in the kidney and lung, 5'-RACE was performed by using reverse primers (beta 1 and beta 4) complementary to beta -ENaC mRNA downstream of the previously described translation start codon. Amplified fragments were recovered by ligation into pCRII, and several clones were sequenced. Thirteen of fourteen clones corresponded to the known 5'-UTR of beta -ENaC, whereas one clone corresponded to a sequence that diverged from beta -ENaC at -9 to the original translation start site (Fig. 1A). This clone, referred to as hbeta -ENaC-2, contained in-frame upstream translation start codons that when translated are predicted to create new NH2-terminal forms of beta -ENaC (Fig. 1B and also see Fig. 5A).

To determine the genomic organization of the 5' end of hbeta -ENaC and to understand the basis for the variant cDNAs, the longest 5'-RACE clone was used to screen a human genomic library and three cosmid clones were isolated. These clones were mapped by restriction analysis and by partial sequencing and appeared to contain overlapping clones that covered a physical distance of ~70 kb (Fig. 2). Our analysis indicated that the 5'-UTR of hbeta -ENaC-1 begins in exon 1A, ~44 kb upstream of the exon (exon 2) that contains the translation initiation codon. The 5'-UTR of hbeta -ENaC-2 begins in exon 1B, ~1.5 kb downstream of exon 1A and splices to a 26-bp exon (exon 1C) ~19 kb downstream and then to the common second exon. As expected, a splice donor site is present just downstream of exon 1B, and a consensus splice acceptor and donor site flank exon 1C. While this study was being completed, primary sequence information in the region of chromosome 16p became available (23) and was used to confirm the position and extent of the cosmid clones.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Schematic of the 5' end of the hbeta -ENaC gene. Map of the hbeta -ENaC gene showing transcribed sequences as open (untranslated) or closed (translated) bars and nontranscribed sequences as lines. Top: extents of the overlapping cosmid clones 355F5, 359G1, and 434E7. Bottom: splicing patterns and putative translation initiation codon (ATG) for each form. On the basis of transcription start mapping in Fig. 3, there are two separate initiation codons in exon 1B. Precise extents of exons 1A and 1B are also based on data from Fig. 3.

To determine the transcription start sites for beta -ENaC-2, genomic DNA fragments that included exon 1B and adjacent 5'-flanking sequences were amplified by PCR and used as a template to synthesize antisense cRNAs for RNase protection assay (RPA) of human kidney and placental RNA. Several bands were protected from nuclease digestion of kidney RNA, and the pattern was identical in placental RNA (data not shown), indicating the presence of multiple transcription start sites for beta -ENaC-2 (Fig. 3A). The 5'-most transcription start site is 22 nt upstream of the 5' terminus identified by 5'-RACE. We were unable to identify protected bands for hbeta -ENaC-1 by RPA using a similar strategy; therefore, we performed primer extension analysis to determine the transcription start site for hbeta -ENaC-1. A single band 19 nt upstream of the 5' terminus identified by 5'-RACE was seen with placental RNA (Fig. 3B)


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3.   Transcription start sites for exons 1B and 1A. A: genomic fragment including the putative 5'-flanking region of exon 1B and 5' portions of exon 1B used to synthesize a cRNA probe. When hybridized to human kidney (Kid) RNA in a RNase protection assay (RPA), several bands are protected from nuclease digestion, confirming the presence of multiple transcription start sites for beta -ENaC-2 (arrowheads). Riboprobe template was sequenced with a primer that anneals to the 3' end of the genomic fragment and was used to precisely identify transcription start sites. B: primer extension reaction using a radiolabeled oligonucleotide within exon 1A and run alongside a sequenced genomic DNA template. Single transcription start site for beta -ENaC-1 is seen in placental (Plac) RNA.

To assess the relative proportion of exon 1A- vs. exon 1B-initiated transcripts, an RPA was done with kidney and placental RNA by using the beta -ENaC-2 cDNA clone identified by 5'-RACE (Fig. 1B). Because this contains exon 1B, exon 1C, and exon 2 sequences, protected fragments longer than exon 2 must arise from beta -ENaC-2 transcripts, whereas a protected band that corresponds to exon 2 alone arises from beta -ENaC-1 transcripts that splice to exon 2 from exon 1A. Several faint bands are seen that correspond to beta -ENaC-2 and are consistent with multiple transcription start sites identified earlier (Fig. 4). A more intense band corresponding to the exon 2 sequence in beta -ENaC-1 is also seen, indicating, as predicted by 5'-RACE analysis, that the beta -ENaC-1 transcript is substantially more abundant than beta -ENaC-2. Furthermore, there appeared to be no major differences in levels of expression or size of protected transcripts between placenta and kidney.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4.   Relative expression levels of beta -ENaC-1 and -2 in kidney and placenta. The beta -ENaC-2 cDNA clone was used to synthesize an antisense cRNA transcript and then hybridized to kidney, placenta, or yeast RNA. After digestion, ribonuclease-protected fragments were analyzed by PAGE alongside undigested riboprobe (probe). A: on a short exposure, a single prominent band that corresponds to exon 2 sequences and thus arises from beta -ENaC-1 is seen in both kidney and placenta. On a longer exposure, several minor bands are seen in both tissues, corresponding to beta -ENaC-2 transcripts. The pattern is similar in kidney and placenta and confirms that beta -ENaC-2 is a minor transcript and has multiple transcription start sites. B: schematic of cDNA used for RPA.

At least two NH2-terminal variant proteins are predicted from the transcription start sites for hbeta -ENaC-2 identified in exon 1B (Fig. 5). The protein hbeta -ENaC-2 would encode a 685-amino acid (aa) peptide with a predicted molecular mass of 77.7 kDa and an NH2-terminal cytoplasmic tail of 95 aa, whereas hbeta -ENaC-3, initiated from a codon 60 nt downstream of that for hbeta -ENaC-2, would encode a 664-aa peptide with a NH2-terminal tail of 74 aa (Fig. 5A). The predicted translation start codon in beta -ENaC-2 has a more favorable consensus translation initiation sequence compared with beta -ENaC-1 and beta -ENaC-3 (Fig. 5B). When expressed as an in vitro translated protein, it is clear that hbeta -ENaC-2 and -3 use an upstream start codon compared with hbeta -ENaC-1, because hbeta - ENaC-2 > hbeta -ENaC-3 > hbeta -ENaC-1 (Fig. 5C). To determine whether the upstream ATG was used in vivo, epitope-tagged beta -ENaC-1 and -2 were expressed in COS-7 cells, and lysates were immunoblotted with an anti-HA antibody. In contrast to the results in vitro, beta -ENaC-2 migrates at the same position as beta -ENaC-1 in vivo, suggesting that the downstream ATG is the preferred translation start codon despite having a less optimal translation initiation sequence. However, the apparent molecular weight of both beta -ENaC-1 and beta -ENaC-2 is higher in vivo, probably secondary to glycosylation or another posttranslational modification, making direct comparison of size difficult. When the downstream ATG is mutated (beta -ENaC-2/mut), translation is initiated at the upstream ATG, confirming that this ATG has the potential to serve as a translation initiation codon under certain circumstances (Fig. 5D). However, on the basis of the relatively feeble expression of beta -ENaC-2 mRNA and the COS-7 expression data, it is difficult to assign any functional relevance to the NH2-terminal variant form of beta -ENaC. An analysis of the extended NH2 terminus of beta -ENaC-2 did not reveal any sites for potential posttranslational modifications of the protein (Fig. 5E).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 5.   NH2-terminal variant beta -ENaC proteins encoded by alternate transcripts. A: predicted NH2-terminal portion for each of three beta -ENaC proteins is aligned together. First transmembrane domains of the proteins are underlined. beta -ENaC-3 and -2 are 24 and 45 aa longer than beta -ENaC-1, respectively. B: translation start codons are aligned with the consensus sequence for translation initiation. C: in vitro translation of beta -ENaC-1, -2, and -3 are analyzed by SDS-PAGE. Molecular mass markers are indicated on the left. D: expression of hemagglutinin-tagged beta -ENaC-1, -2, and -2/mut cDNAs in COS-7 cells. E: motifs within the beta -ENaC protein for posttranslational modification or for known protein-protein interactions are indicated. TM, transmembrane domain.

We then examined the sequence 5' and flanking the transcription start sites for beta -ENaC-1 and beta -ENaC-2. The upstream sequence for hbeta -ENaC-1 does not contain a TATA or CAAT box, but many Sp1 and AP2 binding sites as well as a consensus estrogen response element and several glucocorticoid response element (GRE) half-sites are seen within the first exon and 5'-flanking sequences (Fig. 6A). This region is GC rich and fulfills the definition of a CpG island (12). The sequence surrounding the transcription start sites for hbeta -ENaC-2 contains a consensus TATAA sequence, but this is seen downstream of several transcription start sites (Fig. 6B). A CAAT box is not seen, although several Sp1 and AP1 sites are seen. In addition, consensus binding sites for TTF and a cAMP response element (CRE) and GRE are also noted. Also within this region and within 40 bp the 5'-most transcription start site, an Alu-Sz sequence is noted (16).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Nucleotide sequence data of portions of the 5'-flanking regions for beta -ENaC-1 (A) and beta -ENaC-2 (B). Putative transcription factor binding sites are boxed, and the position of an Alu repeat (beta -ENaC-2) and a CpG island (beta -ENaC-1) are indicated by brackets. Transcription start sites identified by RPA or primer extension are shown with a bent arrow (major) or with * (minor), and those identified by 5'-RACE are indicated with and  above the appropriate nucleotide. Translation initiation codons are doubly underlined, and the position of the first intron is also shown. Primers used for amplification of genomic DNA are indicated. GRE, glucocorticoid response element; ATF, activating transcription factor; CREB, cAMP response element binding protein.

To determine whether the 5'-flanking sequences for each initiating exon contained transcriptional regulatory elements that could direct transcription, genomic fragments that included cognate transcription start sites were cloned in both orientations upstream of luciferase and transfected into H441 cells. The H441 cell is a human lung epithelial cell line with glucocorticoid-regulated Na+ transport and ENaC expression (15, 32). Consistent with the presence of a promoter upstream of exons 1A and 1B, constructs that included 5'-flanking genomic DNA significantly increased luciferase expression in H441 cells compared with an empty plasmid pGL3basic (Fig. 7). In keeping with the general paradigm for promoter function, 5'-flanking fragments cloned in reverse had no activity in these cells.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 7.   Transcriptional regulatory activity of beta -ENaC 5'-flanking sequences in H441 cells. Genomic fragments containing 5'-flanking sequence and cognate transcription start sites for beta -ENaC-1 (-472 to +143) and beta -ENaC-2 (-745 to +82) were coupled to firefly luciferase (luciferase I) in sense (S) and antisense (AS) orientation and transfected into H441 cells, and its activity was compared with empty plasmid pGL3basic. To control for transfection efficiency, a control plasmid expressing the sea pansy luciferase under the control of the SV40 promoter (luciferase II) was cotransfected in all wells.

To further characterize promoter activity, full-length and various deletion constructs of beta -ENaC-1 and beta -ENaC-2 promoter were tested in H441 cells. The first set of deletion constructs identified two transcriptional regulatory regions in beta -ENaC-1 between -142 and -23 and between -23 and +143 (Fig. 8A). Deletions of beta -ENaC-2 in H441 cells demonstrated a progressive loss of function, with deletion to -127 abolishing transcriptional regulatory activity. To begin to identify the core promoter that regulates the expression of beta -ENaC-1 and -2, further deletions were created between -310 and -127 for beta -ENaC-2 and -23 and +143 for beta -ENaC-1 and tested in H441 cells. A regulatory region was identified between -310 and -266 for beta -ENaC-2 and between -23 and +13 and +13 and +45 for beta -ENaC-1 (Fig. 8B).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 8.   Identification of putative regulatory regions of beta -ENaC-1 and beta -ENaC-2 promoters. A: full-length and deletion constructs of both 5'-flanking regions coupled to firefly luciferase (luciferase I) were transfected into H441 cells along with pRLSV40 expressing sea pansy luciferase (luciferase II). B: second set of deletion constructs were tested in H441 cells and compared with pGl3basic. Note the difference in the scale of the y-axis between A and B. *P < 0.001, #P < 0.01 compared with pGL3basic (Student's t-test).

We next used gel mobility shift analysis with oligonucleotides, which corresponds to mapped regions with at least twofold activity over empty plasmid, and nuclear extracts from H441 and A549 cells. The A549 cell is a human lung epithelial cell line with glucocorticoid-regulated ENaC expression and Na+ channels that correspond to the ENaC heteromultimer (15, 20). For the initial beta -ENaC-1 promoter experiments, a double-strand oligonucleotide that corresponded to -22 to +12 of the gene was used as a probe, which revealed the presence of several discrete complexes, p1-p5 (Fig. 9). To begin to localize the site of DNA-protein interaction for these complexes, two overlapping internal oligonucleotides, beta 1-Rt and beta 1-Lt, were used in competition and as radiolabeled probes. These studies demonstrated that p3-p5 bound to either internal nucleotides and could be competed by both, whereas complexes p1-p2 were bound to and competed by beta 1-Rt only. The pattern of bound complexes was very similar to H441 cell extracts and suggested that p1 and p2 bound to a region of beta 1-Lt that was not completely shared with beta 1-Rt, whereas p3-p5 bound to the common region between beta 1-Lt and beta 1-Rt. Analysis of these regions indicated an MZF1 site in the common region and an Sp1 site that was partly unshared.


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 9.   Gel mobility shift assay. Overlapping double-strand oligonucleotides that correspond to the beta -ENaC-1 promoter incubated with nuclear extracts from H441 and A549 cells. Top: radiolabeled probes. Bottom: competing oligonucleotides. Compared with free probe, multiple proteins p1-p5 that retard DNA mobility are seen. Oligonucleotide beta 1-Rt binds and displaces p1-p5, whereas beta 1-Lt binds and displaces p3-p5 only.

We performed similar experiments by using a double-strand oligonucleotide, which corresponded to -310 to +267 of the beta -ENaC-2 gene, which also revealed the presence of discrete complexes, p1-p5 (Fig. 10). Using a comparable strategy, we localized the site of DNA-protein interaction by using two overlapping internal oligonucleotides, beta 2-Rt and beta 2-Lt, in competition and as radiolabeled probes. Like the beta -ENaC-1 analysis, these studies demonstrated that p3-p5 bound to either internal nucleotides and could be competed by both, whereas complexes p1-p2 were bound to and competed by beta 2-Rt only. The pattern of bound complexes was identical to H441 cell extracts and suggested that p1 and p2 bound to a region of beta 2-Lt that was not common with beta 2-Rt, whereas p3-p5 bound to the shared region between beta 2-Lt and beta 2-Rt. Analysis of these regions indicated a CF1 site in the common region and an Sp1 site that was unshared.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 10.   Gel mobility shift assay. Overlapping double-strand oligonucleotides that correspond to the beta -ENaC-2 promoter incubated with nuclear extracts from H441 and A549 cells. Top: radiolabeled probes. Bottom: competing oligonucleotides. Compared with free probe, multiple proteins p1-p5 that retard DNA mobility are seen. Oligonucleotide beta 2-Rt binds and displaces p1-p5, whereas beta 2-Lt binds and displaces p3-p5 only.

Given the importance of Sp1 in directing transcription of TATA-less promoters, we then asked whether Sp1 could specifically bind to the core promoter of beta -ENaC-1 and -2. For these experiments, beta 1-Rt, beta 2-Rt, and a consensus Sp1-binding sequence from the hgamma -ENaC promoter were used separately as probes with H441 nuclear extracts (4). When beta 1-Rt was used as a probe, complexes p1 and p2 were competed by the consensus Sp1 oligonucleotide but not by an NS oligonucleotide (Fig. 11). Complex p1 was supershifted by an antibody to Sp1, whereas complex p2 was supershifted by an antibody to Sp3. Similarly, when beta 2-Rt was used as a probe, p1 and p2 were competed by the Sp1 oligonucleotide and supershifted by anti-Sp1 and anti-Sp3, respectively.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 11.   Gel mobility shift assay. Double-strand oligonucleotides corresponding to beta 1-Rt and beta 2-Rt incubated with H441 nuclear (Nuc.) extracts in the presence of cold competitor, self, nonspecific (NS) oligonucleotide, or a consensus Sp1 binding oligonucleotide. Proteins p1 and p2 are not competed by NS oligo and are "supershifted" by anti-Sp1 and anti-Sp3, respectively. In the middle panel, an Sp1 oligo is used as the labeled probe.

These results suggest that Sp1, a ubiquitous transcription factor that binds to many TATA-less promoters, may be important for the activity of beta -ENaC promoters. However, these data do not explain the tissue-specific or regulated expression of the beta -ENaC promoter, which is likely to be related to the expression of cell-specific enhancers and repressors or the agonist-dependent acetylation of histones and unwinding of chromatin in discrete areas of the beta -ENaC gene to expose and enhance binding of cis-elements to appropriate trans-acting factors.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

In this paper, we report the structure of the 5' end of the hbeta -ENaC gene, complementing earlier work in which the 3' portions of the gene had been characterized (29, 31). With this report, the genomic organization for each of the three human ENaC genes is now available (10, 24, 29, 31, 42, 43). Beginning with the first exon (exon 2) that contains the principal translation start codon, the size and number of exons are remarkably similar, and the position of the exon-intron junctions are perfectly preserved between each of the three subunits, clearly indicating a common evolutionary origin. Furthermore, there is significant homology between each of the three subunits at the aa level (25). However, there are enormous differences in the organization of these genes at their 5' end. hgamma -ENaC appears to have a single transcription start site that gives rise to a 5' untranslated exon ~4 kb upstream of exon 2 (43). halpha -ENaC has two principal transcription start sites 724 bp apart that give rise to alternate first exons less than about 700 bp upstream of exon 2 (42). Unlike hgamma -ENaC, halpha -ENaC transcripts encode two NH2-terminal variant forms of the alpha -ENaC protein that are both abundantly expressed. hbeta -ENaC has two principal exons (exons 1A and 1B) in which transcription is initiated and that are ~45 kb away from exon 2. Like halpha -ENaC, hbeta -ENaC transcripts appear to encode NH2-terminal variant proteins, although, compared with the originally described beta -ENaC form, these transcripts are not very abundant, at least in normal human kidney and placenta (Fig. 4).

Given the tremendous differences at the 5' ends of each of the three genes, it is not surprising that the 5'-flanking sequences that regulate the expression of these genes are also very different. The hbeta -ENaC gene appears to have two distinct promoters that direct the expression of at least two transcripts similar to that seen with the halpha -ENaC gene (32). The hgamma -ENaC gene has a single promoter that, like the upstream promoter of beta -ENaC, is within a CpG island and contains numerous Sp1 binding sites (4). The upstream hbeta -ENaC promoter appears to be TATA-less, whereas the downstream promoter contains a TATA box that is within the transcriptional unit. Both promoters contain Sp1 binding sites, and in this study we demonstrate that Sp1 and Sp3 bind to the core promoter of both transcripts. Other core promoter motifs that can direct transcription in TATA-less promoters, such as the initiator (Inr) and the transcription factor IIB recognition element (BRE), are not seen in close proximity to the transcription start sites for either beta -ENaC transcript and may account for the multiplicity of start sites (19, 34). Interestingly, a partial downstream promoter element sequence G[A/T]CG, previously shown to be sufficient to regulate the TATA-less Abd-B promoter in Drosophila, is seen 21 bp downstream of the 5'-most transcription start site for beta -ENaC-1 (8, 18).

The heterogeneity at the 5' end of the hbeta -ENaC gene appears to lead to the translation of three variant beta -ENaC proteins that differ in the length of the intracytoplasmic NH2 termini. However, when expressed from a heterologous promoter and without its cognate 5'-UTR in COS-7 cells, we were unable to demonstrate that the most upstream ATG is utilized, unless the downstream ATG, which serves as the translation start codon for beta -ENaC-1, is first mutated. Furthermore, the NH2-terminal extensions do not contain additional motifs that predict posttranslational modifications or protein-protein interactions (Fig. 5E). Unlike the COOH terminus, no clear role for the NH2 terminus of ENaC subunits has been identified, although it appears to be important for subunit association (1, 9). A point mutation in the NH2 terminus of beta  that leads to pseudohypoaldosteronism appears to do so by disrupting the gating of the assembled ENaC heteromer (14). The roles and function of the NH2 terminus of beta -ENaC and its variants should become clear as more studies are performed. However, the studies presented in this paper do not point to a significant role for NH2-terminal beta -ENaC-2 variants in vivo.

Little is known about the transcriptional regulation of the hbeta -ENaC gene. The gene is developmentally regulated with expression in the renal collecting duct and airway epithelium that are first evident in late fetal life (39, 40, 44, 47, 48). Glucocorticoids increase expression of alpha -ENaC, beta -ENaC, and gamma -ENaC in the mammalian lung and in airway epithelial cells, although the effects of corticosteroids on beta -ENaC and gamma -ENaC expression have not been consistently observed (30, 37, 45). Glucocorticoids, mineralocorticoids, and dietary Na+ deprivation increase expression of beta -ENaC and gamma -ENaC but not alpha -ENaC in the mammalian distal colon and increase expression of alpha -ENaC in regions of the kidney (3, 11, 28, 30, 37). Although the basis for the increase in halpha -ENaC mRNA by glucocorticoids and mineralocorticoids is transcriptional (10, 22, 27, 32), the mechanism of corticosteroid regulation of gamma -ENaC or beta -ENaC has not been determined. Actinomycin D, a general inhibitor of transcription, abolished the glucocorticoid-regulated expression of beta -ENaC in H441 cells, suggesting that the glucocorticoid effect on beta -ENaC is transcriptional (15). Alhough the 5'-flanking region of hbeta -ENaC contains imperfect GREs, these are not functional in H441cells (data not shown). These results suggest that the glucocorticoid effect is mediated by means of cis-elements elsewhere in the gene. It is important to note that both beta  and gamma  are coordinately regulated by corticosteroids in several tissues. Because beta -ENaC and gamma -ENaC are located on 16p12 within 400 kb of each other, an interesting possibility is that a common locus control element directs the corticosteroid regulation of beta -ENaC and gamma -ENaC. The cloning and availability of large tracts of genomic DNA flanking the hbeta -ENaC gene should facilitate the evaluation of distant sequences that may regulate beta -ENaC expression.


    ACKNOWLEDGEMENTS

The authors thank Norman Doggett for the gift of a human genomic library, Kristyn Cornish and Mona Brake for technical support, and the University of Iowa DNA core facility for providing DNA synthesis and sequencing services.


    FOOTNOTES

This work was supported in part by grants-in-aid from March of Dimes Birth Defects Foundation Research Grant 6-FY99-444, United States Public Health Service Grant DK-54348, and a Career Investigator Award from the American Lung Association to C. P. Thomas.

The nucleotide sequences reported in this paper will appear in DDBJ, EMBL, GenBank, and GSDB Nucleotide Sequence databases under accession nos. AF260226, AF260227, and AF260228.

Address for reprint requests and other correspondence: C. P. Thomas, Dept. of Internal Medicine, Univ. of Iowa College of Medicine, 200 Hawkins Dr., Iowa City, IA 52242-1081 (E-mail: christie-thomas{at}uiowa.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published December 18, 2001;10.1152/ajprenal.00268.2001

Received 27 August 2001; accepted in final form 23 November 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL
RESULTS
DISCUSSION
REFERENCES

1.   Adams, CM, Snyder PM, and Welsh MJ. Interactions between subunits of the human epithelial sodium channel. J Biol Chem 272: 27295-27300, 1997.

2.   Ambrosius, WT, Bloem LJ, Zhou L, Rebhun JF, Snyder PM, Wagner MA, Guo C, and Pratt JH. Genetic variants in the epithelial sodium channel in relation to aldosterone and potassium excretion and risk for hypertension. Hypertension 34: 631-637, 1999.

3.   Asher, C, Wald H, Rossier BC, and Garty H. Aldosterone-induced increase in abundance of Na+ channel subunits. Am J Physiol Cell Physiol 271: C605-C611, 1996.

4.   Auerbach, SD, Loftus RW, Itani OA, and Thomas CP. The human amiloride-sensitive epithelial sodium channel gamma  subunit promoter: functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation. Biochem J 347: 105-114, 2000.

5.   Baker, EH, Dong YB, Sagnella GA, Rothwell M, Onipinla AK, Markandu ND, Cappuccio FP, Cook DG, Persu A, Corvol P, Jeunemaitre X, Carter ND, and MacGregor GA. Association of hypertension with T594M mutation in beta -subunit of epithelial sodium channels in black people resident in London. Lancet 351: 1388-1392, 1998.

6.   Barbry, P, and Hofman P. Molecular biology of Na+ absorption. Am J Physiol Gastrointest Liver Physiol 273: G571-G585, 1997.

7.   Barker, P, Nguyen M, Gatzy J, Grubb B, Norman H, Hummler E, Rossier B, Boucher R, and Koller B. Role of gamma ENaC subunit in lung liquid clearance and electrolye balance in newborn mice. J Clin Invest 102: 1634-1640, 1998.

8.   Burke, TW, and Kadonaga JT. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes Dev 11: 3020-3031, 1997.

9.   Chalfant, ML, Denton JS, Langloh AL, Karlson KH, Loffing J, Benos DJ, and Stanton BA. The NH2 terminus of the epithelial sodium channel contains an endocytic motif. J Biol Chem 274: 32889-32896, 1999.

10.   Chow, YH, Wang Y, Plumb J, O'Brodovich H, and Hu J. Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel alpha  subunit gene. Pediatr Res 46: 208-214, 1999.

11.   Escoubet, B, Coureau C, Bonvalet JP, and Farman N. Noncoordinate regulation of epithelial Na+ channel and Na+ pump subunit mRNAs in kidney and colon by aldosterone. Am J Physiol Cell Physiol 272: C1482-C1491, 1997.

12.   Gardiner-Garden, M, and Frommer M. CpG islands in vertebrate genomes. J Mol Biol 196: 261-282, 1987.

13.   Garty, H, and Palmer LG. Epithelial sodium channels: function and regulation. Physiol Rev 77: 359-396, 1997.

14.   Grunder, S, Firsov D, Chang SS, Jaeger NF, Gautschi I, Schild L, Lifton RP, and Rossier BC. A mutation causing pseudohypoaldosteronism type 1 identifies a conserved glycine that is involved in the gating of the epithelial sodium channel. EMBO J 16: 899-907, 1997.

15.  Itani OA, Auerbach SD, Husted RF, Volk KA, Ageloff S, Knepper MA, Stokes JB, and Thomas CP. Glucocorticoid-stimulated Na+ transport in human lung epithelia is associated with regulated ENaC and sgk1 expression. Am J Physiol Lung Cell Mol Physiol (October 5, 2001). 10.1152/ajplung.00085.2001.

16.   Jurka, J, Klonowski P, Dagman V, and Pelton P. CENSOR---a program for identification and elimination of repetitive elements from DNA sequences. Comput Chem 20: 119-122, 1996.

17.   Kerem, E, Bistritzer T, Hanukoglu A, Hofman T, Zhou Z, Bennett W, MacLaughlin E, Barker P, Nash M, Quittell L, Boucher R, and Knowles MR. Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N Engl J Med 341: 156-162, 1999.

18.   Kutach, AK, and Kadonaga JT. The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol Cell Biol 20: 4754-4764, 2000.

19.   Lagrange, T, Kapanidis AN, Tang H, Reinberg D, and Ebright RH. New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB. Genes Dev 12: 34-44, 1998.

20.   Lazrak, A, Samanta A, Venetsanou K, Barbry P, and Matalon S. Modification of biophysical properties of lung epithelial Na+ channels by dexamethasone. Am J Physiol Cell Physiol 279: C762-C770, 2000.

21.   Lifton, R. Molecular genetics of human blood pressure variation. Science 272: 676-680, 1996.

22.   Lin, HH, Zentner MD, Ho HLL, Kim KJ, and Ann DK. The gene expression of the amiloride-sensitive epithelial sodium channel alpha -subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells. J Biol Chem 274: 21544-21554, 1999.

23.   Loftus, BJ, Kim UJ, Sneddon VP, Kalush F, Brandon R, Fuhrmann J, Mason T, Crosby ML, Barnstead M, Cronin L, Deslattes Mays A, Cao Y, Xu RX, Kang HL, Mitchell S, Eichler EE, Harris PC, Venter JC, and Adams MD. Genome duplications and other features in 12 Mb of DNA sequence from human chromosome 16p and 16q. Genomics 60: 295-308, 1999.

24.   Ludwig, M, Bolkenius U, Wickert L, Marynen P, and Bidlingmaier F. Structural organization of the gene encoding the alpha -subunit of the human amiloride-sensitive epithelial sodium channel. Hum Genet 102: 576-581, 1998.

25.   McDonald, FJ, Price MP, Snyder PM, and Welsh MJ. Cloning and expression of the beta - and gamma -subunits of the human epithelial sodium channel. Am J Physiol Cell Physiol 268: C1157-C1163, 1995.

26.   McDonald, FJ, Yang B, Hrstka R, Drummond H, Tarr D, McCray P, Jr, Stokes J, Welsh M, and Williamson R. Disruption of the beta  subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death associated with pseudohypoaldosteronism phenotype. Proc Natl Acad Sci USA 96: 1727-1731, 1999.

27.   Mick, VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, and Thomas CP. The alpha  subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene. Mol Endocrinol 15: 575-588, 2001.

28.   Ono, S, Kusano E, Muto S, Ando Y, and Asano Y. A low-Na+ diet enhances expression of mRNA for epithelial Na+ channel in rat renal inner medulla. Pflügers Arch 434: 756-763, 1997.

29.   Persu, A, Barbry P, Bassilana F, Houot AM, Mengual R, Lazdunski M, Corvol P, and Jeunemaitre X. Genetic analysis of the beta -subunit of the epithelial Na+ channel in essential hypertension. Hypertension 32: 129-137, 1998.

30.   Renard, S, Voilley N, Bassilana F, Lazdunski M, and Barbry P. Localization and regulation by steroids of the alpha , beta  and gamma  subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney. Pflügers Arch 430: 299-307, 1995.

31.   Saxena, A, Hanukoglu I, Strautnieks SS, Thompson RJ, Gardiner RM, and Hanukoglu A. Gene structure of the human amiloride-sensitive epithelial sodium channel beta -subunit. Biochem Biophys Res Commun 252: 208-213, 1998.

32.   Sayegh, R, Auerbach SD, Li X, Loftus R, Husted R, Stokes JB, and Thomas CP. Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5' flanking region of the human epithelial sodium channel alpha  subunit gene. J Biol Chem 274: 12431-12437, 1999.

33.   Schaedel, C, Marthinsen L, Kristoffersson AC, Kornfalt R, Nilsson KO, Orlenius B, and Holmberg L. Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the alpha -subunit of the epithelial sodium channel. J Pediatr 135: 739-745, 1999.

34.   Smale, ST, and Baltimore D. The "Initiator" as a transcription control element. Cell 57: 103-113, 1989.

35.   Smith, P, Mackler S, Weiser P, Brooker D, Ahn Y, Harte B, McNulty K, and Kleyman T. Expression and localization of epithelial sodium channel in mammalian urinary bladder. Am J Physiol Renal Physiol 274: F91-F96, 1998.

36.   Stokes, JB. Disorders of the epithelial sodium channel: insights into the regulation of extracellular volume and blood pressure. Kidney Int 56: 2318-2333, 1999.

37.   Stokes, JB, and Sigmund RD. Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue and steroid heterogeneity. Am J Physiol Cell Physiol 274: C1699-C1707, 1998.

38.   Su, YR, Rutkowski MP, Klanke CA, Wu X, Cui Y, Pun RY, Carter V, Reif M, and Menon AG. A novel variant of the beta -subunit of the amiloride-sensitive sodium channel in African Americans. J Am Soc Nephrol 7: 2543-2549, 1996.

39.   Talbot, CL, Bosworth DG, Briley EL, Fenstermacher DA, Boucher RC, Gabriel SE, and Barker PM. Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung. Am J Respir Cell Mol Biol 20: 398-406, 1999.

40.   Tchepichev, S, Ueda J, Canessa CM, Rossier BC, and O'Brodovich HM. The lung epithelial Na+ channel subunits are differentially regulated during development and by steroids. Am J Physiol Cell Physiol 269: C805-C812, 1995.

42.   Thomas, CP, Auerbach SD, Stokes JB, and Volk KA. 5' heterogeneity in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol Cell Physiol 274: C1312-C1323, 1998.

43.   Thomas, CP, Doggett NA, Fisher R, and Stokes JB. Genomic organization and the 5' flanking region of the gamma  subunit of the human amiloride-sensitive epithelial sodium channel. J Biol Chem 271: 26062-26066, 1996.

44.   Vehaskari, VM, Hempe JM, Manning J, Aviles DH, and Carmichael MC. Developmental regulation of ENaC subunit mRNA levels in rat kidney. Am J Physiol Cell Physiol 274: C1661-C1666, 1998.

45.   Venkatesh, VC, and Katzberg HD. Glucocorticoid regulation of epithelial sodium channel genes in human fetal lung. Am J Physiol Lung Cell Mol Physiol 273: L227-L233, 1997.

46.   Voilley, N, Bassilana F, Mignon C, Merscher S, Mattei MG, Carle GF, Lazdunski M, and Barbry P. Cloning, chromosomal localization, and physical linkage of the beta - and gamma -subunits (SCNN1B and SCNN1G) of the human epithelial amiloride-sensitive sodium channel. Genomics 28: 560-565, 1995.

47.   Watanabe, S, Matsushita K, McCray PB, and Stokes JB. Developmental expression of the epithelial Na+ channel in kidney and uroepithelia. Am J Physiol Renal Physiol 276: F304-F314, 1999.

48.   Watanabe, S, Matsushita K, Stokes J, and McCray P. Developmental regulation of epithelial sodium channel subunit mRNA expression in rat colon and lung. Am J Physiol Gastrointest Liver Physiol 275: G1227-G1235, 1998.


Am J Physiol Renal Fluid Electrolyte Physiol 282(5):F898-F909
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted
cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1
Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. Ramminger, K. Richard, S. K. Inglis, S. C. Land, R. E. Olver, and S. M. Wilson
A regulated apical Na+ conductance in dexamethasone-treated H441 airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L411 - L419.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. Otulakowski, B. Rafii, and H. O'Brodovich
Differential Translational Efficiency of ENaC Subunits During Lung Development
Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 862 - 870.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. P. Thomas, J. Zhou, K. Z. Liu, V. E. Mick, E. MacLaughlin, and M. Knowles
Systemic Pseudohypoaldosteronism from Deletion of the Promoter Region of the Human {beta} Epithelial Na+ Channel Subunit
Am. J. Respir. Cell Mol. Biol., September 1, 2002; 27(3): 314 - 319.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/5/F898    most recent
00268.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Itani, O. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Itani, O. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online