|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of 1 Pediatrics and 2 Howard Hughes Medical Institute, University of Michigan, Ann Arbor, Michigan 48109-0676
| |
ABSTRACT |
|---|
|
|
|---|
The
transmembrane sialoglycoprotein podocalyxin is thought to be essential
in the fine interdigitating foot process structure of the podocyte. The
intracellular COOH-terminal amino acids Asp-Thr-His-Leu (DTHL) of
podocalyxin comprise a putative ligand for a type I PSD95-Dlg-zona
occludens-1 (PDZ) domain. A 20-amino acid synthetic peptide
containing this motif was used to screen a cDNA library, and clones of
rabbit Na+/H+ exchange regulatory factor-2
(NHERF-2) were obtained. In vitro analysis demonstrated that each PDZ
domain of NHERF-2 could bind podocalyxin independently. NHERF-2
coprecipitated from glomerular extracts with podocalyxin, and
podocalyxin and NHERF-2 colocalized in the glomerular capillary loops,
indicating that podocalyxin and NHERF-2 may interact in vivo.
Podocalyxin peptide missing the terminal leucine (
DTHL) failed to
interact with NHERF-2 in vitro. Podocalyxin localized to the apical
membrane of transfected Madin-Darby canine kidney (MDCK) cells.
However, mutant podocalyxin (missing a functional DTHL COOH-terminal
motif) showed cytoplasmic and apical membrane localization in
transfected cells and was also less stable at the apical membrane, as
assessed by confocal microscopy and biotinylation studies. Mutant
podocalyxin did lower the transepithelial resistance of MDCK cell
monolayers, albeit to a lesser extent than full-length podocalyxin. We
conclude that podocalyxin can interact with both PDZ domains of NHERF-2
and that this interaction requires the intact COOH terminus of
podocalyxin, which is also responsible for the efficient apical
localization of podocalyxin in transfected MDCK cells. These results
suggest that the interaction of podocalyxin with NHERF-2 may function to efficiently retain podocalyxin at the apical surface of the podocyte
and provide a mechanism linking podocalyxin to the actin cytoskeleton.
podocyte; sialomucin; E3KARP; PSD95-Dlg-zona occludens-1 domain
| |
INTRODUCTION |
|---|
|
|
|---|
PODOCALYXIN IS A SULFATED sialoglycoprotein expressed on the apical surface of the glomerular podocytes, the luminal surface of vascular endothelial cells, hematopoietic stem cells, and platelets (2, 3, 10, 14, 15). On the podocyte, podocalyxin is thought to maintain the fine interdigitating foot process structure by the charge-repulsive effects of its highly anionic extracellular domain (21). Takeda et al. (29) have recently shown direct evidence for a charge-repulsive effect of podocalyxin on the surface of cultured cells whereby expression of podocalyxin inhibits cell-cell adhesion. In addition, expression of podocalyxin in Madin-Darby canine kidney (MDCK) cell monolayers decreases transepithelial resistance (TER) and causes a redistribution of junctional proteins, suggesting that podocalyxin may interact with the actin cytoskeleton to regulate cell junctions (29).
The intracellular domain of podocalyxin is highly conserved among species, with 96% amino acid identity between human and rabbit podocalyxin (also known as rabbit podocalyxin-like protein 1) (11, 12). The COOH-terminal amino acids [Asp-Thr-His-Leu (DTHL)] of podocalyxin resemble the consensus sequence (X-S/T-X-V/I) for COOH-terminal motifs of proteins that interact with PSD95-Dlg-zona occludens-1 (PDZ-1) protein interaction domains (25). Proteins that contain PDZ domains can act to link transmembrane proteins in multiprotein complexes that may include regulatory enzymes and the actin cytoskeleton. The interaction of transmembrane proteins with PDZ domain-containing proteins has been shown to be important in the localization, function, and regulation of transmembrane proteins (4, 23). To define the protein-protein interactions of the intracellular domain of podocalyxin, a podocalyxin COOH-terminal peptide probe was used to screen a rabbit glomerular cDNA phage library and clones coding for a PDZ domain-containing protein, sodium hydrogen exchange regulatory factor-2 (NHERF-2), were obtained. This study characterizes the interaction of podocalyxin with NHERF-2.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Peptides and primary antibodies. Peptides corresponding to the COOH-terminal 20 amino acid residues of human nephrin (GDLDTLEPDSLPFELRGHLV), rabbit podocalyxin (WIVPLDNLTKDDLDEEEDTHL), or a mutant podocalyxin missing the COOH-terminal leucine (WIVPLDNLTKDDLDEEEDTH) were synthesized at the University of Michigan Peptide Synthesis Facility (nephrin peptide) or the W. M. Keck Foundation Biotechnology Resource Laboratory at Yale University (podocalyxin peptides). Peptides were coupled to an NH2-terminal biotin and purified by high-pressure liquid chromatography.
Chickens were immunized with a purified NHERF-2 glutathione S-transferase (GST) fusion protein containing amino acids 53-316 using the custom antibody service of Lampire Biological Laboratories. Chicken IgY was purified from egg yolks with the EGGstract IgY purification system (Promega). IgY was affinity purified using full-length NHERF-2 fusion protein covalently linked to cyanogen bromide beads (Sigma). Rabbit serum against human NHERF-2, which recognizes rabbit NHERF-2, was kindly provided by C. Chris Yun (34). Mouse anti-podocalyxin monoclonal antibody (MAb) 4B3 and affinity-purified rabbit anti-mLin-7 have been previously described (12, 27). Anti-Myc MAb (clone 9E10) was used as a control MAb. Anti-uvomorulin (E-cadherin) antibody was from Sigma.Screening of phage libraries.
A phage library made with purified poly-A mRNA from isolated rabbit
glomeruli was prepared for expression screening at 20,000-40,000 plaque-forming units per plate as described previously
(12). Nitrocellulose filters were treated with
isopropyl-
-D-thiogalactopyranoside and incubated on top
of the plates at 37°C for 4 h. Filters were washed five times in
PBS with 0.1% Triton X-100, blocked for 1 h in 2% bovine serum
albumin in PBS. Biotinylated probe was prepared, and screening was
performed essentially as described by Sparks et al. (26).
For each filter, 25 pmol of biotinylated peptide were incubated with 1 µg of streptavidin-alkaline phosphatase (Sigma). Excess
biotin-binding sites were blocked by the addition of 500 pmol
D-biotin (Sigma), and the biotinylated
peptide/streptavidin-alkaline phosphatase complex was incubated with
the filters in fresh blocking solution overnight at 4°C. The filters
were washed four times for 15 min in PBS with 0.1% Triton X-100, and
plaques binding the biotinylated peptides were detected as blue spots
after incubation with an alkaline phosphatase color reagent
(nitroblue-tetrazolium-chloride and
5-bromo-4-chloro-3-indoyl-phosphate-p-toluidine salt in 0.1 M Tris · HCl, pH 9.4, 0.1 M NaCl, 50 mM MgCl2). The
library was also screened with rabbit NHERF-2 clone cDNA to obtain a
full-length NHERF-2 cDNA using techniques previously described
(11).
Bacterial expression and purification of fusion proteins.
GST fusion protein constructs of full-length NHERF-2 (amino acids
1-316, primers
cgtaggatccatggccgcgccggagccgtt/cgatatcgggctcagaagttgctgaaga); PDZ-1
(amino acids 1-118, primers
cgtaggatccatggccgcgccggagccgtt/atgatgtcggtcgtgggcgggcgggag); and
PDZ-2 (amino acids 149-257, primers
tacgcgtaggatcccctaggctctgccacctgcga/cgatatcggtgattggtgatggcagtgg) were
produced by PCR amplification of full-length rabbit NHERF-2 cDNA using
the primers listed containing unique restriction sites. Digested PCR products were ligated to pGEX4-T3 vector (Amersham Pharmacia Biotech), and clones were sequenced. A cDNA clone coding for
amino acids 53-316 of NHERF-2 was excised from pBluescript and
ligated in frame to pGEX4-T3. This construct was used to make a fusion
protein for antibody production. Fusion proteins were expressed in
Escherichia coli DH5
as described by Smith and Johnson (24). Fusion protein purification was performed as
described by Guan and Dixon (6), and quantitation was done
by a modified Bradford assay (Bio-Rad). A GST fusion protein containing
the fourth PDZ domain of MAGI-1 was a gift from Benjamin Margolis.
Glomerular isolation and Western and Far-Western blot analyses.
Rabbit glomeruli were isolated from New Zealand White rabbits
(2.0-2.5 kg) by iron oxide magnetization as described previously (12). For glomerular extraction, 5 × 104
glomeruli were suspended in 1 ml of either PBS containing 1% Triton
X-100, 0.1% SDS (PBS extract buffer), or 150 mM NaCl, 1% Nonidet
P-40, 0.5% deoxycholic acid, and 0.1% SDS in 50 mM Tris (RIPA extract
buffer). Glomerular extract (GE) prepared in this fashion contains ~1
µg/µl of protein. Complete protease inhibitor (Roche Molecular
Biochemicals) was added to all extracts. They were then sonicated in
six short bursts of 10 s each, and insoluble material was removed
by centrifugation at 12,000 g. SDS sample buffer
[100 mM Tris · HCl (pH 6.8), 4% SDS, 0.2% bromphenol blue, 20% glycerol with 5%
-mercaptoethanol] was added, and extracts were analyzed by SDS-PAGE and transferred to nitrocellulose
(12). Secondary antibodies were a peroxidase-conjugated
rabbit anti-chicken IgY (Sigma), a peroxidase-conjugated goat
anti-mouse IgG (Bio-Rad), and a peroxidase-conjugated goat
anti-rabbit IgG (Jackson ImmunoResearch Laboratories). To show blocking
of chicken anti-NHERF-2 antibody, 50 µg of either GST fusion protein
or NHERF-2 GST fusion protein were preincubated with affinity-purified
chicken anti-NHERF-2 antibody (1:500) overnight at 4°C before
membranes were probed. Far-Western blotting was performed by blocking
the blots in Tris-buffered saline (TBS) with 1% Triton X-100 and 3%
nonfat dried milk for 1 h. Blots were incubated overnight in 0.01 µg of biotinylated peptide complexed with 1 µl
streptavidin-horseradish peroxidase (Life Technologies) in 10 ml TBS
with 1% Triton X-100 with 0.5% bovine serum on a rocker at 4°C.
After blots were washed four times in TBS with 1% Triton X-100, they
were developed using the enhanced chemiluminesence reagent (Amersham).
Immunoprecipitation and affinity purification experiments. Immunoprecipitations were carried out using a modification of published protocols (8, 11). One hundred twenty microliters of rabbit GE in PBS extract buffer were preabsorbed with protein G-agarose beads (Sigma). The MAbs (4B3 and control IgG, 9E10) were incubated with 50 µl of protein G-agarose beads, washed four times with TBS, and incubated overnight with the preabsorbed rabbit GE in PBS extract buffer at 4°C on a rotor. Beads were washed six times with TBS, and samples were prepared for Western blot analysis. "Pull-down" experiments were performed with peptides or fusion proteins. For biotinylated peptide experiments, 200 µl of GE in RIPA extract buffer with protease inhibitors were precleared by incubation with 5 µl of streptavidin-agarose beads (Sigma) for 30 min at 4°C. After centrifugation, the supernatant was incubated with 3 µg of biotinylated peptide at 4°C on a rocker for 1 h. Twenty microliters of streptavidin-agarose beads were added, and incubation continued for 30 min. The beads were washed three times with ice-cold PBS and prepared for Western blot analysis. Purified GST fusion proteins (10 µg) complexed with glutathione-agarose beads (Sigma) were washed in ice-cold PBS. Twenty-five microliters of GE in PBS extract buffer were added, and the beads were incubated overnight on a rocker at 4°C. Beads were washed four times with PBS and used for Western blot analysis. For peptide inhibition experiments, 10 µg of NHERF-2 GST fusion protein complexed to glutathione-agarose beads were incubated with biotinylated peptides for 30 min at 4°C on a rocker. Twenty-five microliters of GE in PBS buffer were added and incubated overnight at 4°C. Samples were processed as described above for pull-down experiments.
Immunostaining and culture of MDCK cells. Rabbit podocalyxin cDNA (GenBank accession no. U35239) was PCR amplified with a 3' primer designed to result in a deletion of the four COOH-terminal amino acids (DTHL) or mutate the terminal leucine to glycine (tttgaattcttattcctcctcgtccag and tttgaattcttagccgtgcgtgtcttc) and a 5' primer (tttgaatccatgcgctccgcgttggcgctt). PCR products were subcloned and sequenced. The mutant intracellular domain region was excised with HincII and XhoI and inserted into a rabbit podocalyxin construct digested with HincII and XhoI to give a full-length mutant podocalyxin cDNA. Constructs were placed into pcDNA3 (Invitrogen) and sequenced to ensure that only the designed mutation was present and used to transfect MDCK cells with the FuGene reagent (Roche Molecular Biochemicals). Cells were grown in the presence of 800 µg/ml G418 (Life Technologies), and clones of stable transfectants were isolated by limiting dilution in 96-well plates.
Transfected MDCK cells were seeded at high density (105 cells/well) onto Transwell Clear membrane filters (0.4 µm pore size; Corning Costar, Cambridge, MA). The cells were allowed to grow to confluence to form a polarized monolayer. After being washed with PBS, the cells were fixed with 4% formaldehyde in PBS and permeabilized with 0.1% Triton X-100 in PBS. After being blocked for 1 h with 10% goat serum in PBS, the cells were incubated with primary antibodies diluted in 2% goat serum in PBS in a humidified chamber for 12-16 h (affinity-purified anti-mLin-7 at 1:100; anti-E-cadherin at 1:1,000; and anti-podocalyxin antibody 4B3 at 1:2). After being washed three times with 2% goat serum in PBS, the cells were incubated with appropriate secondary antibodies coupled to FITC (Jackson ImmunoResearch Laboratories), or Texas red (diluted at 1:500 in 2% goat serum in PBS; Molecular Probes, Eugene, OR) for 2 h in a humidified chamber. Membrane filters were cut from their plastic casing with a scalpel and mounted with ProLong antifade reagent (Molecular Probes). Confocal laser scanning microscopy was performed on a Nikon Diaphot 200 microscope paired with a Noran laser and InterVision software (Noran Instruments, Middleton, WI) at the Morphology and Image Analysis Core of the University of Michigan Diabetes Research and Training Center. Cryostat sections (2 µm) of rabbit renal cortex were fixed in methanol and blocked in 10% goat serum in PBS. Slides were incubated with the MAb 4B3 (1:1) and rabbit anti-NHERF-2 serum (1:200) described above or controls (MAb 9E10 or serum). Secondary antibodies were Texas red-conjugated horse anti-mouse IgG at 1:400 (Vector Laboratories) and an FITC-conjugated goat anti-rabbit IgG at 1:300 (Sigma). A Nikon Diaphot microscope and a Hamamatsu digital camera were used to obtain the dual-labeled immunofluorescence images.Measurement of transepithelial resistance and surface biotinylation of MDCK cells. MDCK cells (1.5 × 105 cells) were split and placed on 12-mm Transwell filters in calcium-free DMEM (Invitrogen) for 3 h. Media were changed to DMEM with calcium, and the cells were grown to confluence. The transepithelial resistance (TER) was measured (Millicell-ERS, Millipore) in culture media. The TER was calculated by subtracting the measured background TER of a blank filter and multiplying by the surface area of the filter per the manufacturer's instructions. For biotinylation experiments, cells were selectively biotinylated at either the apical or basolateral cell surface (5, 13). Briefly, membranes were washed on both sides with PBS containing 1 mM MgCl2 and 1.3 mM CaCl2 (PBS-CM) at 4°C and then incubated with freshly dissolved sulfo-NHS-LC-biotin (500 µg/ml; Pierce, Rockford, IL) added to the apical or basolateral surface for 30 min on ice. The biotinylation reaction was quenched by extensively washing with PBS-CM containing 50 mM NH4Cl. Filters were excised, and cells were lysed in 400 µl of RIPA extract buffer with protease inhibitors. Cell lysates contained between 0.52 and 0.63 µg/µl of protein. Two hundred microliters of the lysate were incubated overnight with 100 µl of streptavidin-agarose beads (Sigma). After centrifugation, the postbead lysate was removed. Beads were washed three times with PBS at 4°C. Proteins bound to the streptavidin-agarose beads were eluted by boiling in 80 µl of SDS sample buffer. Samples were prepared for SDS-PAGE as described above with 20 µl of lysate, streptavidin bead pull-down, or postbead lysate loaded per lane.
The stability of podocalyxin at the apical surface of MDCK cells was determined by biotinylation of the apical surface of confluent MDCK cell monolayers, followed by selective immunoprecipitation of apically expressed podocalyxin (see the time points in Fig. 8). After biotinylation was performed as outlined above, the apical surface was washed with PBS-CM, and culture media were replaced. At the times indicated, the media were removed, the apical surface was washed with PBS-CM, and 300 µl of MAb 4B3 were then placed on the apical surface for 20 min. Filters were then washed with PBS-CM to remove unbound antibody, and monolayers were excised and lysed in PBS with 0.1% Triton X-100 with Complete protease inhibitor. Lysates were incubated with 40 µl of protein G beads/well to bind the MAb 4B3/podocalyxin complexes, and immunoprecipitation was completed as described above. Samples were prepared for Western blot analysis, and detection was performed with either streptavidin-horseradish peroxidase or MAb 4B3. Densitometry was captured using an EDAS 120 system (Kodak) and analyzed with Kodak 1D software V.3.5.3. Statistical analysis of TER and densimetric data was performed by ANOVA with post hoc comparisons using the Statview software program (Abacus Concepts, Berkeley, CA).| |
RESULTS |
|---|
|
|
|---|
Screening of a rabbit glomerular cDNA library with podocalyxin
COOH-terminal peptide probe.
To find potential proteins that interact with the COOH-terminal amino
acids of podocalyxin, we screened a cDNA library made from isolated
rabbit glomeruli. The probe for expression screening was an
NH2-terminal biotinylated peptide that contained the
COOH-terminal 20 amino acids of rabbit podocalyxin. Approximately
600,000 plaque-forming units were screened, and 7 positive clones were
obtained and purified (Fig.
1B). All of the clones
overlapped and were unique. We obtained full-length cDNA by screening
this library with a rabbit NHERF-2 cDNA clone. The 1,648-bp cDNA
contains a predicted 948-bp open reading frame coding for a 316-amino
acid protein (GenBank accession no. AF358433). Analysis of the amino
acid sequence with the SMART program predicted two PDZ domains (Fig.
1A) with 64% amino acid identity (22). This
amino acid sequence showed 81% overall identity with human NHERF-2
(GenBank accession no. AAC63061) by BLAST analysis (1).
NHERF-2 (also known as E3KARP) is a linker protein containing two PDZ
domains and a COOH-terminal ezrin-binding domain that is known to have
multiple splice isoforms (18, 23, 34). The isoform of
NHERF-2 we cloned has an open reading frame of 316 amino acids and
lacks amino acids 265-285 of the 337- amino acid human NHERF-2
sequence. Comparison of our amino acid sequence and human NHERF-2
missing amino acids 265-285 showed 93% overall identity. This is
the same region that undergoes alternative splicing in SRY-interacting
protein-1, a 326-amino acid splice variant of NHERF-2
(18). Notably, the common overlapping region of all the
clones obtained by expression screening contained the sequence coding
for the second PDZ domain of NHERF-2, and none of these clones coded
for the complete first PDZ domain (Fig. 1B). Thus we
conclude that our screening detected an interaction of the second PDZ
domain of NHERF-2 with the podocalyxin peptide probe.
|
Podocalyxin peptide interacts with both PDZ domains of NHERF-2.
We then produced and purified GST fusion proteins of the full-length
NHERF-2, the PDZ-1 domain, and the PDZ-2 domain of NHERF-2 (Fig.
1C). These fusion proteins underwent SDS-PAGE and were
transferred to nitrocellulose membranes. To determine the domain(s) of
NHERF-2 with which podocalyxin interacts, biotinylated peptides were
used to probe these membranes by Far-Western blot analysis (Fig.
2). The podocalyxin peptide bound to GST
fusion proteins containing the first or second PDZ domain of NHERF-2,
as well as binding to full-length NHERF-2. No binding was seen in lanes
of a control GST fusion protein or a control GST fusion protein
containing the fourth PDZ of MAGI-1 (Fig. 2A). Control
biotinylated peptide showed no binding (Fig. 2C). Thus the
podocalyxin peptide probe is capable of binding to either PDZ domain of
NHERF-2 by Far-Western blot analysis.
|
The interaction of podocalyxin peptide and NHERF-2 requires the
COOH-terminal leucine of podocalyxin.
To test whether the interaction of podocalyxin and NHERF-2 occurs via
the podocalyxin COOH-terminal DTHL motif, we probed the NHERF-2 GST
fusion protein blots with a podocalyxin biotinylated peptide missing
the COOH-terminal leucine. This mutant peptide was unable to bind to
the NHERF-2 GST fusion protein (Fig. 2B). To determine
whether the podocalyxin peptide could affinity purify NHERF-2 from
rabbit glomeruli, we performed pull-down experiments of rabbit GE in
RIPA extract buffer using immobilized biotinylated peptides. A rabbit
polyclonal rabbit anti-human NHERF-2 was used to detect rabbit NHERF-2,
which appears as a 38-kDa band on a Western blot (Fig.
3A). The podocalyxin
biotinylated peptide was able to pull down NHERF-2 from GE (Fig.
3A) and bind to a band at the appropriate size of NHERF-2 on
Far-Western blots (Fig. 2A). The control peptide and the
podocalyxin peptide missing the COOH-terminal leucine did not pull down
NHERF-2 or bind to any proteins on Far-Western blots (Figs. 2,
B and C, and 3A). The results
of the experiments shown in Figs. 2 and 3 indicate that the COOH
terminus of podocalyxin can bind to both PDZ domains of NHERF-2 in
vitro and that the interaction of NHERF-2 and podocalyxin requires the
COOH-terminal leucine of podocalyxin.
|
Podocalyxin interacts with NHERF-2 in vivo. To determine whether the interaction of podocalyxin and NHERF-2 occurs in vivo, we performed immunoprecipitation experiments. The anti-podocalyxin MAb 4B3 was used to immunoprecipitate podocalyxin from GE in PBS extract buffer (Fig. 3B). To detect coprecipitated NHERF-2, we used a chicken IgY against amino acids 53-316 of rabbit NHERF that binds to a 38-kDa NHERF-2 band on Western blots of GE and that can be blocked by incubation with NHERF-2 GST fusion protein (Fig. 3C). MAb 4B3 (Fig. 3B, top) coprecipitated NHERF-2 with podocalyxin from rabbit GE. No NHERF-2 was coprecipitated with the control MAb. The coprecipitation of these proteins from GE strongly supports the suggestion that podocalyxin and NHERF-2 interact in vivo.
Affinity purification of podocalyxin from glomerular extract with
NHERF-2 GST fusion proteins and inhibition of the interaction of
NHERF-2 and podocalyxin by podocalyxin COOH-terminal peptide.
The experiments shown thus far demonstrate that both PDZ-1 and PDZ-2
can interact with a podocalyxin biotinylated peptide and that
podocalyxin and NHERF-2 interact in glomerular extracts. To test
whether the PDZ domains of NHERF-2 can independently interact with
podocalyxin protein produced in vivo, we performed pull-down experiments of rabbit GE in PBS extract buffer with GST fusion proteins. The GST fusion proteins were bound to glutathione-agarose beads and incubated with GE overnight. After the beads were washed, samples were prepared for Western blot analysis with MAb 4B3 to detect
podocalyxin pull down by the fusion proteins. Both the PDZ-1 and PDZ-2
GST fusion proteins independently pulled down podocalyxin from GE (Fig.
4A). In these experiments, the
PDZ-1 fusion protein was able to pull down podocalyxin slightly more efficiently than the PDZ-2 fusion protein. The most efficient pull down
was seen with the full-length NHERF-2 fusion protein. To show that the
interaction of the NHERF-2 fusion protein with podocalyxin was
dependent on the COOH terminus of podocalyxin, we used podocalyxin
peptides to try to block the interaction. Podocalyxin peptide was able
to inhibit the interaction of podocalyxin with full-length NHERF-2
fusion protein (Fig. 4B). The mutant podocalyxin peptide
missing the COOH-terminal leucine showed minimal ability to block the
interaction of NHERF-2 fusion protein with podocalyxin (Fig.
4B), consistent with the results by Far-Western blot
analysis and pull-down experiments (Figs. 2B and
3A).
|
Colocalization of NHERF-2 and podocalyxin in the glomerulus in
vivo.
In the kidney, podocalyxin is expressed on the apical surface of the
podocytes and to a lesser extent on the luminal surface of the vascular
endothelium. The isolated rabbit glomeruli used to make the cDNA
library that was screened and the glomerular extracts used in the
experiments above had some contamination with renal tubular elements.
To determine whether NHERF-2 expression in the kidney colocalizes with
glomerular podocalyxin expression, dual-labeled immunofluorescence of
rabbit kidney cortex with antibodies to NHERF-2 and podocalyxin was
performed. Indirect immunofluorescence of rabbit kidney with MAb 4B3
(Texas red-conjugated secondary antibody) showed strong staining of the
glomeruli with some staining of the peritubular capillaries (Fig.
5A). The same section stained with rabbit anti-NHERF-2 serum (FITC-conjugated secondary antibody) showed strong staining of the glomeruli with some vascular staining of
the interstitium (Fig. 5B), similar to that described in rat renal cortex (31). The merged image of podocalyxin (red)
and NHERF-2 (green) showed intense orange staining of the peripheral capillary loops (Fig. 5C, arrows), consistent with
colocalization of podocalyxin and NHERF-2 in the podocyte and in
peritubular capillaries. That podocalyxin and NHERF-2 colocalize at the
apical membrane of the podocyte cannot be determined at the resolution of immunofluorescent microscopy. Staining with control antibodies are
shown (Fig. 5, D-F).
|
Role of PDZ interaction motif in apical localization of podocalyxin
in MDCK cells.
Podocalyxin is localized to the apical surface of the podocyte and the
luminal surface of vascular endothelial cells in vivo. To determine the
role of the COOH-terminal PDZ interaction motif in the membrane
localization of podocalyxin, MDCK cell lines expressing podocalyxin,
podocalyxin missing the COOH-terminal DTHL motif, or podocalyxin
containing a COOH-terminal leucine-to-glycine mutation were made.
Stable transfectants were allowed to grow on permeable membrane
supports to form polarized monolayers. Confocal microscopy of MDCK
cells expressing podocalyxin stained with antibody 4B3 showed intense
apical labeling when these cells were colabeled with the adherens
junction marker E-cadherin or the basolateral marker mLin-7 (Fig.
6, A and B). In
contrast, mutant podocalyxin, either missing the COOH-terminal DTHL
motif or containing a COOH-terminal leucine-to-glycine mutation, was
distributed in the cytoplasm as well as the apical membrane (Fig. 6,
C-F). The experiments shown are
representative of two independent clones for each construct.
|
|
|
PDZ interaction motif is not required to modify TER of MDCK
monolayers.
The expression of podocalyxin by monolayers of MDCK cells has been
previously shown to modify the tight junctional structure and reduce
TER (29). This effect was shown to be dependent on the
presence of the highly sialylated extracellular domain of podocalyxin.
To determine whether the modification of TER in MDCK monolayers by
podocalyxin requires an intact PDZ interaction motif, the TER of stably
transfected MDCK monolayers was measured (Fig. 9). Consistent with what has been
previously reported, the stable expression of podocalyxin lowered the
TER of MDCK monolayers compared with the control cell line. In
addition, MDCK monolayers with stable expression of mutant podocalyxin
(missing an intact PDZ interaction motif) also had a lower TER than the
control cell line. This suggests that an intact PDZ interaction motif
is not required for podocalyxin to modify the TER of MDCK cell
monolayers. However, monolayers expressing wild-type podocalyxin showed
a trend toward slightly lower TER compared with the monolayers
expressing podocalyxin with a nonfunctional PDZ interaction motif at
most time points (Fig. 9).
|
| |
DISCUSSION |
|---|
|
|
|---|
The COOH-terminal DTHL motif of podocalyxin was expected to interact with a PDZ domain containing protein based on the strong sequence similarity of this motif to the PDZ interaction domains of other transmembrane proteins (25). The expression cloning of NHERF-2 was mediated by an interaction of the peptide probe with the second PDZ of NHERF-2 on the basis of the overlapping sequence of the expression clones. The finding that both PDZ domains of NHERF-2 interact with the PDZ interaction motif of podocalyxin was unexpected because these PDZ domains are not highly conserved (64% amino acid identity). Dual PDZ interaction has not been reported for transmembrane proteins interacting with NHERF-2 (23). Despite our demonstration of an interaction of podocalyxin with the first PDZ domain of NHERF-2, we did not obtain any clones containing the first PDZ domain by expression screening. We have previously had difficulty cloning 5' transcripts from the library that we used, and the failure to expression clone PDZ-1-containing cDNAs may have been due to the relatively low number of phage plaques screened (600,000) or relative lack of complete cDNAs in the library (12).
The interaction of podocalyxin with both PDZ domains of NHERF-2 shows similarities to the interaction of NHERF with the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is a transmembrane chloride channel localized on the apical surface of epithelial cells. CFTR contains a COOH-terminal PDZ interaction motif (DTRL) that has been proposed to interact with the first PDZ domain of NHERF (7, 32). Recently, however, it has been demonstrated that both PDZ domains of NHERF can interact with the COOH terminus of CFTR (9, 19). This binding can occur in a bivalent fashion, and the binding of NHERF to CFTR has been shown to regulate chloride channel activity (19). In our experiments, we did find more podocalyxin binding to the full-length NHERF-2 than to either PDZ domain alone (Figs. 2 and 4). This may reflect NHERF-2 simultaneously binding two podocalyxin molecules. However, the interaction of NHERF PDZ domains and its ligands is sensitive to the sequence adjacent to the putative PDZ domains (19), and the increased binding of podocalyxin to full-length NHERF-2 relative to PDZ-1 or PDZ-2 alone may be due to the influence of the regions flanking the PDZ domains.
The interaction of NHERF-2 and podocalyxin requires an intact
podocalyxin COOH terminus (DTHL). Podocalyxin expressed in MDCK cells
is localized to the apical surface (Figs. 6 and 7) (29), and mutant podocalyxin lacking this interaction motif shows a decrease
in apical expression and an increase in cytoplasmic expression in MDCK
cells (Figs. 6 and 7). This could be due to mistargeting of
podocalyxin; however, no podocalyxin was detected at the basolateral surface in wild-type or mutant cell lines (Figs. 6 and 7). Podocalyxin is heavily glycosylated (~50% of its apparent molecular weight), and
podocalyxin produced by the wild-type and mutant cells migrates at the
same molecular weight on SDS-PAGE. This would suggest that the PDZ
interaction motif is not required for the bulk of the posttranslational
processing of podocalyxin. Our confocal data suggest that the intact
COOH terminus of podocalyxin is required for the efficient expression
of podocalyxin at the apical membrane (Fig. 6). This could involve an
interaction with a PDZ domain-containing protein in the delivery or
retention of podocalyxin at the apical surface. Our data are consistent
with the hypothesis that this motif acts to improve the retention of
podocalyxin at the apical surface (Fig. 8). This is similar to the
reported role of a COOH-terminal PDZ binding motif (ETHL) in the
retention of the
-aminobutyric acid transporter at the basolateral
cell surface or the role of the COOH-terminal DTRL motif in the
retention of CFTR at the apical cell surface (16, 17).
Unfortunately, we could not determine whether this activity required
the interaction of podocalyxin with NHERF-2 because the antibodies we
used in our studies were unable to detect endogenous NHERF-2 in MDCK cells.
Podocalyxin has been shown to modify the distribution of junctional proteins in MDCK cells and reduce the transepithelial resistance MDCK monolayers (29). This effect is abolished by the removal of sialic acid from the extracellular domain of podocalyxin. In our studies, the stable expression of podocalyxin on the apical surface of MDCK cell monolayers significantly reduced TER. The reduction of TER was not dependent on a functional PDZ interaction motif because monolayers expressing podocalyxin missing the DTHL motif or with the key terminal leucine mutated also had significant reductions in TER. The effect of podocalyxin on the TER of MDCK monolayers did tend to be somewhat less for cell lines expressing podocalyxin with a mutated/missing PDZ interaction motif than for wild-type podocalyxin. This may be due to the decrease in apical membrane stability of these mutants, or, alternatively, the presence of the podocalyxin PDZ interaction motif may augment the effect of the sialylated extracellular domain of podocalyxin on TER.
Podocalyxin is distributed on the apical surface of podocyte foot processes and the luminal surface of capillary endothelial cells. The anionic extracellular domain of podocalyxin is constantly exposed to moving fluid (glomerular ultrafiltrate or blood) containing potentially interacting cationic molecules. The maintenance of the distribution of podocalyxin on the cell surface may require a mechanism to anchor podocalyxin and prevent redistribution toward the direction of flow. NHERF-2 contains an ezrin-binding domain that can link NHERF-2 to the cytoskeleton via ezrin (28). The epithelial brush-border Na+/H+ exchanger (NHE3) binds the second PDZ domain of NHERF-2, and this interaction has been shown to link NHE3 to the cytoskeleton in a complex containing NHE3, NHERF-2, and ezrin. The precise ezrin-binding domain of NHERF-2 has not been determined but appears to require the COOH-terminal 23 amino acids (34). For the related protein, NHERF, the COOH-terminal 30 amino acids are sufficient to bind to ezrin (20, 33), and the homologous region in NHERF-2 may be required for ezrin binding. The rabbit NHERF-2 isoform we cloned contains the region homologous to the COOH-terminal 52 amino acids of human NHERF-2, and we speculate that the interaction of podocalyxin and NHERF-2 may function to link podocalyxin to the actin cytoskeleton via ezrin.
Since the initial submission of this paper, Takeda et al. (30) have reported that rat podocalyxin is linked to the actin cytoskeleton via its interaction with NHERF-2 and that NHERF-2 and podocalyxin colocalize in podocytes by immunofluorescence and immunoelectron microscopy, consistent with our findings. In their studies, they found that rat podocalyxin interacted with only the second PDZ of NHERF-2 and not with the first. However, the construct they used to study podocalyxin-NHERF-2 interaction differed in the size of the 5' PDZ-1-flanking region and had a highly charged epitope tag (DYKDDDDK) flanking this region. The regions flanking the PDZ domains are critical to the binding of NHERF proteins to their ligands (Ref. 19 and D. Kershaw, unpublished observations), and this may account for the differences in the characterization of podocalyxin-NHERF-2 binding.
| |
ACKNOWLEDGEMENTS |
|---|
We thank C. Chris Yun for providing the rabbit anti-NHERF antibody, Benjamin Margolis for MAb 9E10 and the MAGI-1 GST fusion protein, Meera Goyal and Lisa Riggs for technical assistance, and the University of Michigan Diabetes Research and Training Center Morphology and Image Analysis Core (5P60-DK-20572) for assistance with confocal microscopy.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants 2P50-DK-39255 and DK-58270 (to D. B. Kershaw).
Address for reprint requests and other correspondence: D. Kershaw, Pediatric Nephrology, 1560 MSRBII, Box 0676, 1150 W. Medical Center Dr., Ann Arbor, MI 48109-0676 (E-mail: dkershaw{at}umich.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published January 8, 2001;10.1152/ajprenal.00131.2001
Received 26 April 2001; accepted in final form 2 January 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Altschul, SF,
Gish W,
Miller W,
Myers EW,
and
Lipman DJ.
Basic local alignment search tool.
J Mol Biol
215:
403-410,
1990.
2.
Dekan, G,
Gabel C,
and
Farquhar MG.
Sulfate contributes to the negative charge of podocalyxin, the major sialoglycoprotein of the glomerular filtration slits.
Proc Natl Acad Sci USA
88:
5398-5402,
1991.
3.
Dekan, G,
Miettinen A,
Schnabel E,
and
Farquhar MG.
Binding of monoclonal antibodies to glomerular endothelium, slit membranes, and epithelium after in vivo injection. Localization of antigens and bound IgGs by immunoelectron microscopy.
Am J Pathol
137:
913-927,
1990.
4.
Fanning, AS,
and
Anderson JM.
Protein modules as organizers of membrane structure.
Curr Opin Cell Biol
11:
432-439,
1999.
5.
Gottardi, CJ,
Dunbar LA,
and
Caplan MJ.
Biotinylation and assessment of membrane polarity: caveats and methodological concerns.
Am J Physiol Renal Fluid Electrolyte Physiol
268:
F285-F295,
1995.
6.
Guan, KL,
and
Dixon JE.
Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal Biochem
192:
262-267,
1991.
7.
Hall, RA,
Ostedgaard LS,
Premont RT,
Blitzer JT,
Rahman N,
Welsh MJ,
and
Lefkowitz RJ.
A C-terminal motif found in the beta2-adrenergic receptor, P2Y1 receptor and cystic fibrosis transmembrane conductance regulator determines binding to the Na+/H+ exchanger regulatory factor family of PDZ proteins.
Proc Natl Acad Sci USA
95:
8496-8501,
1998.
8.
Harlow, E,
and
Lane D.
Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1988.
9.
Karthikeyan, S,
Leung T,
and
Ladias JA.
Structural basis of the Na+/H+ exchanger regulatory factor PDZ1 interaction with the carboxyl-terminal region of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem
276:
19683-19686,
2001.
10.
Kerjaschki, D,
Sharkey DJ,
and
Farquhar MG.
Identification and characterization of podocalyxin
the major sialoprotein of the renal glomerular epithelial cell.
J Cell Biol
98:
1591-1596,
1984.
11.
Kershaw, DB,
Beck SG,
Wharram BL,
Wiggins JE,
Goyal M,
Thomas PE,
and
Wiggins RC.
Molecular cloning and characterization of human podocalyxin-like protein. Orthologous relationship to rabbit PCLP1 and rat podocalyxin.
J Biol Chem
272:
15708-15714,
1997.
12.
Kershaw, DB,
Thomas PE,
Wharram BL,
Goyal M,
Wiggins JE,
Whiteside CI,
and
Wiggins RC.
Molecular cloning, expression, and characterization of podocalyxin-like protein 1 from rabbit as a transmembrane protein of glomerular podocytes and vascular endothelium.
J Biol Chem
270:
29439-29446,
1995.
13.
Marmorstein, A,
Le Bivic A,
and
Rodriguez-Boulan E.
Cell surface biotinylation techniques and determination of protein polarity.
In: Cell Biology: A Laboratory Handbook (2nd ed.), edited by Celis JE.. San Diego, CA: Academic, 1998, p. 341-350.
14.
McNagny, KM,
Pettersson I,
Rossi F,
Flamme I,
Shevchenko A,
Mann M,
and
Graf T.
Thrombomucin, a novel cell surface protein that defines thrombocytes and multipotent hematopoietic progenitors.
J Cell Biol
138:
1395-1407,
1997.
15.
Miettinen, A,
Solin ML,
Reivinen J,
Juvonen E,
Vaisanen R,
and
Holthofer H.
Podocalyxin in rat platelets and megakaryocytes.
Am J Pathol
154:
813-822,
1999.
16.
Milewski, M,
Mickle J,
Forrest J,
Stafford D,
Moyer B,
Cheng J,
Guggino W,
Stanton B,
and
Cutting G.
A PDZ-binding motif is essential but not sufficient to localize the C terminus of CFTR to the apical membrane.
J Cell Sci
114:
719-726,
2001.
17.
Perego, C,
Vanoni C,
Villa A,
Longhi R,
Kaech SM,
Frohli E,
Hajnal A,
Kim SK,
and
Pietrini G.
PDZ-mediated interactions retain the epithelial GABA transporter on the basolateral surface of polarized epithelial cells.
Embo J
18:
2384-2393,
1999.
18.
Poulat, F,
Barbara PS,
Desclozeaux M,
Soullier S,
Moniot B,
Bonneaud N,
Boizet B,
and
Berta P.
The human testis determining factor SRY binds a nuclear factor containing PDZ protein interaction domains.
J Biol Chem
272:
7167-7172,
1997.
19.
Raghuram, V,
Mak DD,
and
Foskett JK.
Regulation of cystic fibrosis transmembrane conductance regulator single-channel gating by bivalent PDZ-domain-mediated interaction.
Proc Natl Acad Sci USA
98:
1300-1305,
2001.
20.
Reczek, D,
and
Bretscher A.
The carboxyl-terminal region of EBP50 binds to a site in the amino-terminal domain of ezrin that is masked in the dormant molecule.
J Biol Chem
273:
18452-18458,
1998.
21.
Schnabel, E,
Dekan G,
Miettinen A,
and
Farquhar MG.
Biogenesis of podocalyxin
the major glomerular sialoglycoprotein
in the newborn rat kidney.
Eur J Cell Biol
48:
313-326,
1989.
22.
Schultz, J,
Copley RR,
Doerks T,
Ponting CP,
and
Bork P.
SMART: a web-based tool for the study of genetically mobile domains.
Nucleic Acids Res
28:
231-234,
2000.
23.
Shenolikar, S,
and
Weinman EJ.
NHERF: targeting and trafficking membrane proteins.
Am J Physiol Renal Physiol
280:
F389-F395,
2001.
24.
Smith, DB,
and
Johnson KS.
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:
31-40,
1988.
25.
Songyang, Z,
Fanning AS,
Fu C,
Xu J,
Marfatia SM,
Chishti AH,
Crompton A,
Chan AC,
Anderson JM,
and
Cantley LC.
Recognition of unique carboxyl-terminal motifs by distinct PDZ domains.
Science
275:
73-77,
1997.
26.
Sparks, AB,
Hoffman NG,
McConnell SJ,
Fowlkes DM,
and
Kay BK.
Cloning of ligand targets: systematic isolation of SH3 domain-containing proteins.
Nat Biotechnol
14:
741-744,
1996.
27.
Straight, SW,
Karnak D,
Borg JP,
Kamberov E,
Dare H,
Margolis B,
and
Wade JB.
mLin-7 is localized to the basolateral surface of renal epithelia via its NH2 terminus.
Am J Physiol Renal Physiol
278:
F464-F475,
2000.
28.
Sun, F,
Hug MJ,
Lewarchik CM,
Yun CH,
Bradbury NA,
and
Frizzell RA.
E3KARP mediates the association of ezrin and protein kinase A with the cystic fibrosis transmembrane conductance regulator in airway cells.
J Biol Chem
275:
29539-29546,
2000.
29.
Takeda, T,
Go WY,
Orlando RA,
and
Farquhar MG.
Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in Madin-Darby canine kidney cells.
Mol Biol Cell
11:
3219-3232,
2000.
30.
Takeda, T,
McQuistan T,
Orlando RA,
and
Farquhar MG.
Loss of glomerular foot processes is associated with uncoupling of podocalyxin from the actin cytoskeleton.
J Clin Invest
108:
289-301,
2001.
31.
Wade, JB,
Welling PA,
Donowitz M,
Shenolikar S,
and
Weinman EJ.
Differential renal distribution of NHERF isoforms and their colocalization with NHE3, ezrin, and ROMK.
Am J Physiol Cell Physiol
280:
C192-C198,
2001.
32.
Wang, S,
Raab RW,
Schatz PJ,
Guggino WB,
and
Li M.
Peptide binding consensus of the NHE-RF-PDZ1 domain matches the C-terminal sequence of cystic fibrosis transmembrane conductance regulator (CFTR).
FEBS Lett
427:
103-108,
1998.
33.
Weinman, EJ,
Steplock D,
Donowitz M,
and
Shenolikar S.
NHERF associations with sodium-hydrogen exchanger isoform 3 (NHE3) and ezrin are essential for cAMP-mediated phosphorylation and inhibition of NHE3.
Biochemistry
39:
6123-6129,
2000.
34.
Yun, CH,
Lamprecht G,
Forster DV,
and
Sidor A.
NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ezrin.
J Biol Chem
273:
25856-25863,
1998.
This article has been cited by other articles:
![]() |
J. S. Nielsen and K. M. McNagny The Role of Podocalyxin in Health and Disease J. Am. Soc. Nephrol., August 1, 2009; 20(8): 1669 - 1676. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Overgaard, K. M. Sanzone, K. S. Spiczka, D. R. Sheff, A. Sandra, and C. Yeaman Deciliation Is Associated with Dramatic Remodeling of Epithelial Cell Junctions and Surface Domains Mol. Biol. Cell, January 1, 2009; 20(1): 102 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Nielsen and K. M. McNagny Novel functions of the CD34 family J. Cell Sci., November 15, 2008; 121(22): 3683 - 3692. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Donowitz and X. Li Regulatory Binding Partners and Complexes of NHE3 Physiol Rev, July 1, 2007; 87(3): 825 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Yu, J.-Y. Chen, Y.-Y. Lin, K.-F. Shen, W.-L. Lin, C.-L. Chien, M. B.A. ter Beest, and T.-S. Jou A Bipartite Signal Regulates the Faithful Delivery of Apical Domain Marker Podocalyxin/Gp135 Mol. Biol. Cell, May 1, 2007; 18(5): 1710 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Harita, N. Miyauchi, T. Karasawa, K. Suzuki, G. D. Han, H. Koike, T. Igarashi, F. Shimizu, and H. Kawachi Altered expression of junctional adhesion molecule 4 in injured podocytes Am J Physiol Renal Physiol, February 1, 2006; 290(2): F335 - F344. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Cheng, Y.-Y. Lin, C.-Y. Yu, J.-Y. Chen, K.-F. Shen, W.-L. Lin, H.-K. Liao, Y.-J. Chen, C.-H. Liu, V. F. Pang, et al. Molecular Identification of Canine Podocalyxin-Like Protein 1 as a Renal Tubulogenic Regulator J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1612 - 1622. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Meder, A. Shevchenko, K. Simons, and J. Fullekrug Gp135/podocalyxin and NHERF-2 participate in the formation of a preapical domain during polarization of MDCK cells J. Cell Biol., January 17, 2005; 168(2): 303 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shenolikar, J. W. Voltz, R. Cunningham, and E. J. Weinman Regulation of Ion Transport by the NHERF Family of PDZ Proteins Physiology, December 1, 2004; 19(6): 362 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schmieder, M. Nagai, R. A. Orlando, T. Takeda, and M. G. Farquhar Podocalyxin Activates RhoA and Induces Actin Reorganization through NHERF1 and Ezrin in MDCK Cells J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2289 - 2298. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Wade, J. Liu, R. A. Coleman, R. Cunningham, D. A. Steplock, W. Lee-Kwon, T. L. Pallone, S. Shenolikar, and E. J. Weinman Localization and interaction of NHERF isoforms in the renal proximal tubule of the mouse Am J Physiol Cell Physiol, December 1, 2003; 285(6): C1494 - C1503. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |