|
|
||||||||
Departments of 1 Pediatrics and 2 Pathology and 3 Institute for Cancer Genetics, College of Physicians and Surgeons, Columbia University, New York, New York 10032
| |
ABSTRACT |
|---|
|
|
|---|
We recently cloned µ-protocadherin, a developmentally regulated cell adhesion molecule that contains an extracellular region with four cadherin-like ectodomains and a triply repeating mucin domain in its longer isoform. Expression of µ-protocadherin in L929 cells resulted in cellular aggregation, confirming its role in intercellular adhesion. We now identify the human µ-protocadherin ortholog and study its distribution in vivo and its targeting in polarized epithelia. Basic Local Alignment Search Tool searches and fluorescent in situ hybridization analysis on the basis of human-mouse synteny reveal that µ-protocadherin maps to 11p15.5, matching a previously identified gene called MUCDHL. At least three different splicing isoforms exist for MUCDHL that vary in expression in the fetal kidney. µ-Protocadherin is apically expressed along the brush border of the proximal convoluted tubule of the adult kidney. Transfection of truncated forms of µ-protocadherin into polarized Madin-Darby canine kidney cells reveals that the NH2 terminus is essential for targeting to the apical surface. These results suggest that although human µ-protocadherin may mediate a homotypic adhesive interaction, it may have additional functions in terminally differentiated epithelia.
cell adhesion; apical targeting
| |
INTRODUCTION |
|---|
|
|
|---|
DYNAMIC CHANGES IN CELL
ADHESION are requisite for the generation of the
three-dimensional structure of the kidney. Three consecutive branching
patterns utilizing lateral and bifid branches occur during
nephrogenesis (1). During the generation of a branch,
cells must escape the restrictions imposed on them by cell adhesion
molecules, the matrix, and the basement membrane and then proliferate.
However, despite this requirement for plasticity, cells still need to
maintain some adherence to one another. One class of cell adhesion
molecules found to be critical for these processes are the cadherins,
defined by their calcium-dependant homophilic cell adhesion properties.
Their cytoplasmic region binds
-catenin and is linked to the actin
cytoskeleton through
-catenin and actinin (30).
Several mechanisms exist regulating these adhesive interactions during nephrogenesis (see Ref. 9 for review). These include the rapid assembly of adheren junctions, an increase in the clustering of the adhesive complexes and/or an increase in their affinity, or an alteration in the turnover of the cell junction (14). Finally, differential expression of the cadherins can drive nephrogenesis by stimulating aggregation of subsets of cells expressing the same type of cadherin (4). The greater affinity of respective cadherins to each other likely facilitates rearrangements within a cluster of cells. This type of molecular rearrangement is termed "sorting" and is one mechanism of generation of a polar structure, as has been demonstrated within rhombomeres of the central nervous system (28).
We recently identified a novel cell adhesion molecule from the kidney termed µ-protocadherin (GenBank accession no. AF221952) (8). Several aspects of µ-protocadherin highlight its potential importance in the regulation of such dynamic interactions. Its cDNA encodes a novel integral membrane protein, which contains four cadherin-like ectodomains in its extracellular region, and a triply repeating mucin domain in its longest isoform. The latter domain is known to negatively regulate cadherin function in carcinoma cells (15). Alternatively, the mucin may also provide specificity for its adhesive interactions by binding to its sugar moiety. This is analogous to the selectin-binding carbohydrate determinants of the mucin domains on mucosal addressin cell adhesion molecule-1 that support the rolling of lymphocytes under shear (3). A shorter isoform lacks the mucin domain and is independently regulated in the kidney during the perinatal period (8). Expression of the long isoform in L929 cells results in cell-to-cell aggregation, confirming its role in intercellular adhesion (8).
We sought to identify the human µ-protocadherin ortholog and examine its expression in the developing kidney. Members of the cadherin superfamily are numerous and diverse (24). One identifying criterion distinguishing µ-protocadherin is the presence of the mucin repeats tandem to the cadherin ectodomains. Basic Local Alignment Search Tool (BLAST) search of the National Center for Biotechnology Information human database detected just one gene, termed MUCDHL, with a comparable extracellular domain. MUCDHL was identified within a 500-kb contig spanning the region between c-HRAS and MUC2 on chromosome 11p15.5 (20). Identical structural motifs between MUCDHL and µ-protocadherin, spanning the full length of the protein, provide strong evidence that MUCDHL is the human ortholog of µ-protocadherin. Confirmation that MUCDHL was the µ-protocadherin ortholog was made on the basis of rodent-human comparison using fluorescence in situ hybridization (FISH) analysis. Hybridization with a µ-protocadherin-derived mouse bacterial artificial chromosome (BAC) clone localized this gene to distal chromosome 7 band F4 of the mouse, which is syntenic to human 11p15.5.
Pairwise alignment of the human µ-protocadherin ortholog and expressed sequences in GenBank identified at least three alternatively spliced forms of human µ-protocadherin. The first two forms differ in the presence of the mucin domain, whereas the third isoform, interestingly, has a shortened 13th exon and lacks the mucin and transmembrane domain. Differential expression of these messages was noted in the kidney and liver by Northern blot analysis. Immunocytochemistry in the adult kidney demonstrated apical expression along the brush border of the proximal convoluted tubule. Localization of this protein to the apical surface can be further demonstrated on transfection of MUCDHL into polarized Madin-Darby canine kidney (MDCK) cells. The NH2 terminus is essential for this apical targeting. These results suggest that the compartmentalization of human µ-protocadherin to the apical surface may facilitate additional functions of terminally differentiated epithelia.
| |
METHODS |
|---|
|
|
|---|
Materials. Taq polymerase was obtained from Fisher Scientific (Suwanee, GA). Deoxynucleotide primers for PCRs were synthesized by Gene Link (Thornwood, NY). Tris base, glycerol, sodium chloride, and Triton X-100 were from Sigma (St. Louis, MO). Human multiple tissue Northern blots were obtained from Clontech (Palo Alto, CA). Transwell filters were purchased from Corning Costar (Cambridge MA). Paraformaldehyde was purchased from Electron Microscopy Sciences (Ft. Washington, PA). The GC-rich PCR system and Lipofectamine 2000 were purchased from Life Technologies (Rockville, MD)
Cell culture. MDCK cells were grown in DMEM/Ham's F-12 supplemented with FCS. Caco-2 cells were obtained from the American Type Culture Collection and grown in MEM with 2 mM L-glutamine, Earle's balanced salt solution adjusted to contain 1.5 g/l sodium bicarbonate, 0.1 mM nonessential amino acids, 1.0 mM sodium pyruvate, and 20% fetal bovine serum.
FISH analysis of mouse µ-protocadherin. A genomic BAC clone containing the µ-protocadherin gene was obtained by screening a mouse BAC library with the cytoplasmic region of mouse µ-protocadherin derived from GenBank accession no. W18538 (Research Genetics). It was further subcloned, and a 7.5-kb genomic fragment containing, in part, the 5'-regulatory region was obtained. This was used to hybridize to mouse metaphase chromosomes. Dual staining with FITC-labeled chromosome 7 paint confirmed the identity of the chromosome. Chromosomes were banded by the 4,6-diamidino-2-phenylindole counterstain.
Structural analysis of the human µ-protocadherin gene. BLAST analysis of the human database identified the human ortholog of µ-protocadherin (GenBank accession no. AF256874). The exon-intron structure was obtained by pairwise alignment of the human ortholog (AF256874) and mRNAs AF258676, AF276242, and AF258675 using the gap2 program with the GCG server.
Northern blot analysis of µ-protocadherin. Human fetal blot and multiple adult human tissue Northern blots were obtained from Clontech (Palo Alto, CA). The fetal kidney mRNA was derived from a pool of males and females aged 21-30 wk, fetal liver mRNA aged 18-24 wk, fetal lung aged 20-25 wk, and fetal brain aged 16-32 wk (Dr. Yonca Ilkbahar, Clontech Labs). It was hybridized with the cytoplasmic region of human µ-protocadherin (GenBank accession no. AI640262). The cytoplasmic insert was 32P labeled by a random primed reaction. A multiple blot containing mRNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (Clontech) was also hybridized, but no bands were detected and therefore the results were not illustrated.
Generation of antibodies. Rabbit polyclonal antibodies were generated against the cytoplasmic region of human µ-protocadherin. A sequence corresponding to amino acids 525-651 of NP_112554 was ligated into pGEX (Amersham Pharmacia, Piscataway, NJ) to create a glutathione S-transferase (GST)-fusion protein and transformed into BL21 Escherichia coli cells. The fusion protein was purified on an immobilized GST column (Pierce), and the amino acid sequence was verified by mass spectroscopy after trypsin digestion. Soluble fusion protein was injected into rabbits for generation of polyclonal antisera (Pocono Rabbit Farm & Laboratory, Canadensis, PA).
Immunoblot analysis.
Adult and fetal kidney tissue (Columbia University Cancer Center Tissue
Bank) was extracted with SDS-PAGE buffer containing
-mercaptoethanol. A preliminary Coomassie-stained gel was performed to equalize the amount of protein that was loaded on each lane (data
not shown). Rabbit antibody directed against a GST-fusion protein with
the cytoplasmic domain of human µ-protocadherin was generated and
used as the primary antibody. Preimmune serum was used as the negative
control. No staining was seen with the preimmune serum (data not shown).
Generation and transient transfection of µ-protocadherin isoforms. A PCR using GC-rich enzyme and expressed sequence tag (EST) AK-000384 as a template with the primer pair aattaaaagcttcagaccctcctgccaggtgacagccg and aattaacacgtggatgtaggagtcatcaccaccgggcg generated the full-length cDNA of the short isoform of µ-protocadherin. 3'-adenosine overhangs were added with Taq polymerase, and then the PCR product was cloned into the 3'-T overhang of a pcDNA3.1/V5-His TOPO targeting vector (Invitrogen, Carlsbad, CA). In a second construct, a stop codon was placed at the 3'-terminus to ensure correct termination of translation and cloned into the pcDNA5/FRT/V5-His TOPO targeting vector. The cloning of the mucin containing full-length rat isoform was previously described (8). PCR reactions utilizing the primer pairs aattaaccgcggaacccttcttccaggtgacagctg and aaatagcggccgcttagtgaaccgatgtcggtagtg, and aatctttccgcggtcatatcaggagtaggcgagctg and aattaagcggccgcacgtaagtgttgtctgcgactg containing KspI and NotI sites at their ends were used to generate NH2-terminal (lacking intracellular domain) or COOH-terminal (lacking the extracellular domain) forms of rat µ-protocadherin, respectively. They were then cloned into the KspI and NotI sites of the pHM6 cloning vector, which contains a 3'-His tag (Boehringer Mannheim). MDCK cells were seeded the day before onto Transwell filters such that they were 85-90% confluent at the time of transfection. MDCK cells were transfected utilizing Lipofectamine 2000 and then cultured for an additional 48-72 h for transient expression analysis. Under these experimental conditions, MDCK cells form a polarized monolayer, which was confirmed by measurement of their electrical resistance. Filters were then processed for immunocytochemistry.
Immunocytochemistry. The staining protocol was performed as previously described (8), with some minor modifications. Paraformaldehyde-fixed tissue sections (4-5 µm thick) were blocked with 100% FCS in PBS before the addition of primary antibody. A high-titer rabbit polyclonal serum directed against µ-protocadherin was diluted at 1:100 and incubated with sections for 1 h at room temperature. A pool of anti-pancytokeratin mouse monoclonal antibodies, AE1, AE3 (Chemicon), and KL1 (Immunotech), were utilized to identify collecting tubules and visualized after incubation with a rhodamine-conjugated secondary antibody. Monoclonal antibody to neutral endopeptidase was purchased from Coulter Immunology (Hialeah, FL). Caco-2 cells, which endogenously express µ-protocadherin, were seeded close to confluency and analyzed after 4 days by confocal microscopy. Expression of the truncated forms of µ-protocadherin in MDCK transfected cells was detected using an anti-His monoclonal antibody. Propidium iodide staining (25 µg/ml) was utilized to detect nuclei. Stained monolayers were mounted onto a glass coverslip in fluorescent mounting medium (DAKO) and viewed with an Axiovert 100 laser scanning confocal microscope (model LSM 410, Carl Zeiss). Excitation with an argon-krypton laser in the 488-, 568-, and 645-nm channels was used to visualize fluorescein, rhodamine, or propidium iodide, and Cy5-conjugated secondary antibodies, respectively. Images were collected as 1-µm-thick optical sections, and orthogonal sections were generated using Zeiss LSM-PC software. Final images were processed using Adobe Photoshop.
| |
RESULTS |
|---|
|
|
|---|
FISH.
To facilitate the study of the µ-protocadherin-mediated pathway and
its regulation, a mouse BAC clone containing the µ-protocadherin gene
was obtained. This was used as a first step to identify the human
ortholog of µ-protocadherin by FISH and mouse-human syntenic analysis. Metaphase spreads of mouse chromosomes were hybridized with a
rhodamine-labeled µ-protocadherin-derived mouse BAC clone (Fig. 1). Signal was seen on both
chromosome 7 orthologs on the most distal chromosome band F4. This was
confirmed by two-color FISH using a rhodamine-labeled
µ-protocadherin-derived mouse BAC clone and an FITC-labeled
chromosome paint probe derived from chromosome 7. Because many and
often diverse members constitute the protocadherin superfamily, mapping
of the mouse ortholog provided an important clue to the localization of
the human µ-protocadherin gene on the basis of human-mouse synteny.
Of possible interest for future studies, the distal end of mouse
chromosome 7 is syntenic to 11p15.5, an imprinted region that is often
subject to a loss of heterozygosity in Wilms tumors (6).
|
Comparison of the amino acid sequence of human and rat µ-protocadherin orthologs. BLAST search of the human database led initially to two ESTs with homology to rat µ-protocadherin. (GenBank accession nos. AK000384 and AK000226). These ESTs were subsequently shown to be derived from the MUCDHL gene (GenBank accession no. AF258674) (20). Overall, there was >60% identity, and >70% were positives between the rat and human proteins (data not shown). Regions of identity spanned the full length of the protein. Closer examination of the structural motifs present in the human protein provides strong evidence that it is the human ortholog of µ-protocadherin.
The consensus sequence for the µ-protocadherin cadherin ectodomains is shown in Fig. 2A. The amino acid alignment of the human and rat µ-protocadherin ectodomains is presented with rat FAT (16) and human protocadherin
-a2
for comparison (29). Blocked letters indicate identical
amino acid sequences. Dark and light shading indicate more conserved
and less conserved amino acid sequences, respectively.
Ectodomains 1-4 are indicated by
EC1-EC4, respectively. Numbering refers to the size of
the cadherin repeat. Presented in Fig. 2B is a dendogram
tree, indicating clustering of ectodomains by similarity. The
similarity tree of rat and human µ-protocadherin ectodomains reveals
that respective ectodomains are more similar to each other than to any
other cadherin ectodomains obtained by the BLAST search. A comparison
is made to its two most closely related ectodomains obtained by the
BLAST search, the rat ortholog of the Drosophila melanogaster
tumor suppressor FAT and the human protocadherin
-a2. These
results suggest that rat µ-protocadherin and the MUCDHL
gene are orthologous and may constitute a new subdivision within the
cadherin superfamily (19).
|
|
Expression analysis of human µ-protocadherin.
Tissue expression of human µ-protocadherin in fetal (Fig.
4A) and adult human tissue
(Fig. 4B) was analyzed by Northern blot. Blots were
hybridized with the cytoplasmic region of a homologous human mouse EST
clone (GenBank accession no. 2299669). Three forms are noted in the
developing kidney and liver. Interestingly, the longest isoform is
primarily expressed in the adult small intestine and colon, whereas in
the fetal liver, the strongest expression of the second message is
noted. These differences in isoform-specific expression may relate to
different stages of development. Although a third blot containing adult
kidney tissue was negative using the same probe (data not shown),
PCR-based analysis as well as the EST database reveals expression
derived from the adult kidney. Interestingly, only a single major
isoform is expressed in the adult small intestine and colon. Analysis
by Western blot of fetal and adult kidney was performed next
(Fig. 5). Rabbit antibody directed against a GST-fusion protein with the cytoplasmic domain of
human µ-protocadherin was generated and used as the primary antibody.
Preimmune serum was used as the negative control. No staining was seen
with the preimmune serum (data not shown). In both the fetal and adult
kidney, the rabbit polyclonal detected four forms ranging from 110 to
220 kd. These multiple forms may be the result of posttranslational
modifications and highlight the need to explore the possible different
functions of each isoform.
|
|
Apical distribution of µ-protocadherin in differentiated
epithelia.
Immunocytochemistry in adult kidney revealed µ-protocadherin is
expressed apically along the brush border of the proximal convoluted
tubule (green, Fig. 6A) and
excluded from cortical collecting ducts (red, Fig. 6A).
µ-Protocadherin expression in proximal tubules was confirmed by dual
staining with neutral endopeptidase (EC 3.4.24.11) a known brush-border
enzyme (Fig. 6C). Colocalization of these two proteins is
seen in Fig. 6D. Localization of this protein to the apical
surface can be further demonstrated on transfection of
MUCDHL into polarized MDCK cells. MDCK cells were plated
onto Transwell filters and allowed to grow until they formed a tightly polarized monolayer. Cells were fixed and stained with anti-zona occludens-1 (tight junction, blue) and anti-µ-protocadherin
antibodies (green), mounted in propidium iodide to detect nuclei, and
analyzed by confocal microscopy (Fig. 7,
A and B). The X-Z section
(bottom) confirms the µ-protocadherin staining to be
apical at or above the tight junction level (blue). This is in contrast
to caco-2 cells that have not yet formed such a tightly polarized
monolayer. Although some of the staining is apical, the majority is
still cytoplasmic. These results demonstrate that human
µ-protocadherin is compartmentalized to the apical surface as cells
develop a polarized state and suggest it may have additional functions
in terminally differentiated epithelia.
|
|
Extracellular domain required for targeting of µ-protocadherin to the apical surface. To analyze the sequences required for targeting of µ-protocadherin to the apical surface, truncated forms lacking the NH2 or COOH terminus were cloned into the pHM6 mammalian expression vector. All the forms contained the putative transmembrane domain for insertion into the membrane. A his tag on the COOH terminus of the fusion protein allowed for the identification of the protein. As illustrated in Fig. 7C, the mucin-containing isoform, similar to the shorter isoform in Fig. 7A, is directed to the apical surface. Because the former contains a His site at the COOH terminus, this demonstrates that the PDZ binding domain is not required in this system for targeting. Transfection of the truncated form lacking the COOH terminus was still capable of targeting to the apical surface (Fig. 7D). Deletion of the NH2 terminus, however, disrupted this targeting, and µ-protocadherin also localized to the lateral membrane (Fig. 7E). Thus the extracellular domain is required for targeting of µ-protocadherin to the apical surface.
| |
DISCUSSION |
|---|
|
|
|---|
The cadherin superfamily is composed primarily of six major
subfamilies distinguished on the basis of their genomic structure, protein domain composition, and phylogenetic analysis
(19). These include the classic or type-I cadherins,
atypical or type-II cadherins, and protocadherins and their mouse
counterparts, the cadherin-related neuronal receptors
(10), desmocollins, desmogleins, and flamingo
cadherins. In addition, isolated cadherin family members include
cadherin-13, -15, -16, -17, Dachsous, RET, FAT, MEGF1, and most
invertebrate cadherins. One unique identifying feature of
µ-protocadherin is the juxtaposition of a cadherin domain followed by
mucin repeats in its extracellular domain. This mucin-type region
structure is conserved between rat and human and contains a 31 amino acid motif that is repeated 3.5 times. As was experimentally
observed with the rat µ-protocadherin ortholog (8),
neural network predictions of mucin-type GalNAc O-glycosylation sites in human µ-protocadherin are that
they are heavily glycosylated (data not shown) (23). In
both the rat and the human forms, the mucin region is alternatively
spliced to generate a protein with an extracellular region consisting of just the cadherin ectodomains. In addition, the conservation of
domain structures between the human and rat forms extend through the
cytoplasmic region. After the extracellular domain, the human µ-protocadherin contains a single transmembrane region and a
cytoplasmic region containing four SH3 binding regions, as in the rat
µ-protocadherin gene. This is in contrast to that of human
-protocadherin, which contains six (29). The
cytoplasmic tyrosine kinase phosphorylation site is conserved across
the rat and human species. The cytoplasmic region of rat
µ-protocadherin terminates with a type I PDZ binding domain, similar
to the COOH-terminal end of rat fat protocadherin (22). Although conserved amino acids are present at the
COOH-terminal end of the human form, further experimentation is needed
to test whether it can mediate binding to a PDZ protein. Additional
evidence that we indeed identified the ortholog is on the basis of
mouse to human synteny and FISH analysis. A mouse BAC clone containing the µ-protocadherin gene localizes to mouse distal chromosome 7, which is syntenic to the human 11p15.5 region, the site of the
MUCDHL gene. Thus the previously described MUCDHL
gene is the human ortholog of µ-protocadherin and may represent a new subdivision within the cadherin superfamily.
A second unique feature of µ-protocadherin is its apical distribution in terminally differentiated epithelia. Structural information for apical sorting of the transmembrane neurotrophin receptors (p75) is localized to a juxtamembrane region of the extracellular domain that is rich in O-glycosylated serine/threonine residues (31), suggesting that the mucin repeats in µ-protocadherin may play a similar role. However, both the long and the short isoform of µ-protocadherin are targeted to the apical surface in polarized cells, suggesting that the mucin region is not required for targeting to the apical membrane. The NH2 terminus, however, is clearly essential, because a truncated form lacking it is targeted to the lateral membrane as well. Another potential sorting signal on µ-protocadherin is its PDZ binding domain at the COOH terminus. For example, the PDZ interacting domain of the cystic fibrosis transmembrane conductance regulator is required for functional expression in the apical plasma membrane (17). In contrast, the constructs reported here were fusion proteins with his tags masking the PDZ binding domain, revealing that the apical targeting was independent of such a signal. In a different mucin-like protein, endolyn, an N-glycan-dependent apical targeting signal in the lumenal domain, is responsible for direction to the apical surface of polarized epithelial cells, after which it is then processed to a novel biosynthetic pathway to lysosomes (11). Similarly, N-glycosylation sites located in the large extracellular loop of glycine transporter isoform-2 are involved in apical localization in polarized MDCK cells. (33). Thus future experiments will explore the potential role of the five N-glycosylation sites on the extracellular domain of µ-protocadherin in its apical targeting. It is of interest that the glycosyl phosphatidylinositol-linked T-cadherin is differentially targeted to the apical surface of the chick intestinal epithelium in vivo, suggesting the cadherin superfamily may have functional roles in addition to mediating cell-to-cell adhesion (13).
The multiplicity of µ-protocadherin isoforms suggests that this
protocadherin subfamily may have several functional roles. The longer
isoform (containing the mucin moiety) in rats was capable of mediating
aggregation in L cells (8). Similar to other
protocadherins, however, the aggregation was not as robust as that
reported for E-cadherin (24). Preliminary experiments with
the short isoform of human µ-protocadherin (lacking the mucin moiety)
reveal it can mediate sorting of expressing cells from nonexpressing
cells (data not shown). Because of the complex biological versatility of the sialomucins, a comparison between these two isoforms and their
kinetics of aggregation may be more revealing. Mucins, for instance,
have been shown to interfere with E-cadherin-mediated cell-to-cell
adhesion (15). It is therefore possible that the mucin
repeats on µ-protocadherin may regulate the adhesion mediated by the
cadherin ectodomains. In addition, however, their oligosaccharide side
chains, which protrude above the glycocalyx, can interact with ligands
on opposing cells and facilitate cell-to-cell adhesion (26,
27). The glycosylation status of the cadherins also has a
profound effect on the transduction of its signal into the cell. The
addition of a bisecting N-acetylglucosamine residue on
E-cadherin enhanced cell-to-cell aggregation, suppressing metastasis in
B16 melanoma cells (32). The molecular mechanism was the
downregulation of tyrosine phosphorylation on
-catenin, resulting in
decreased cell migration (12). Thus any functional
analysis of µ-protocadherin will likely require the identification of
its posttranslational modifications in vivo. The function of the third
form, which splices out the mucin and transmembrane domain to combine a
truncated fourth ectodomain to a unique 3'-end, requires further
investigation. The potential exists that this protein could be secreted
or, alternatively, could be attached to the membrane through a GPI
linkage, although there is no apparent recognition sequence for the
latter. Because both the probe for Northern blot analysis and the
fusion protein generated for the production of the polyclonal
antibodies were derived from the cytoplasmic sequences of the first two
isoforms, the expression pattern of the third isoform remains to be determined.
The functional role for µ-protocadherin in vivo in the adult kidney
is intriguing, because lateral expression of the molecule would more
likely facilitate an adhesive interaction. One possibility is that
while in an apical localization, the heavily negative sialated residues
could serve in part to orient cells within a complex and facilitate
aggregation through other cell adhesion molecules. µ-Protocadherin is
not the only cadherin that localizes to the apical membrane. For
example, in vivo, T-cadherin was detected on the apical cell surface of
the chick intestinal epithelium (13). T-cadherin is a
glycophosphoinositol-anchored protein noted to be found in specialized
cell membrane domains rich in signaling molecules, termed lipid rafts
(7). In vascular smooth muscle cells, T-cadherin was found
to be associated with signal transducing effector molecules, such as
SRC family kinases and G
s protein (21).
Other cadherin superfamily members implicated as signaling molecules
are the seven-transmembrane (7-TM) cadherins, such as starry
night and flamingo in Drosophila
(25) and the mammalian paralog human MEGF2
(18). 7-TM cadherins contain seven predicted
transmembrane domains with high homology to G-protein-coupled receptors
and thus could potentially regulate intracellular cAMP and cGMP levels.
µ-Protocadherin contains proline-rich regions in its cytoplasmic
domain that may interact with SH3 domains in nonreceptor tyrosine
kinases; therefore, a role for µ-protocadherin in cell signaling will
be explored.
A second cadherin molecule localizing to the apical membrane is human peptide transporter-1 (5). Human peptide transporter-1, which has an affinity for dipeptides, is associated with intestinal peptide transport and contains four cadherin-like domains in its extracellular region, similar to that seen in µ-protocadherin. The ability of a cadherin to directly function as a ligand-specific receptor is perhaps best illustrated by the protocadherin ret, which binds GDNF. Recent molecular modeling of the RET sequence again delineated four distinct NH2-terminal domains, each of ~110 residues, containing many of the consensus motifs of the cadherin fold (2). µ-Protocadherin that is expressed on the brush border of the proximal tubule, therefore, would be ideally situated to function as a ligand-specific receptor for a molecule filtered by the glomerulus.
Cadherins are critical for processes such as embryonic patterning, maintenance of tissue integrity, generation of three-dimensional structure, and control of cell growth. The human µ-protocadherin gene maps to 11p15.5, an imprinting region (6). This region also contains loss of heterozygosity regions in Wilms tumors and the locus of Beckwith-Wiedmann syndrome (a congenital anomaly consisting of somatic overgrowth, urogenital abnormalities, and a predisposition to development of tumors). The identification of the human ortholog of µ-protocadherin is the first step in studying its role in kidney development and disease.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Richard Friedman for help in bioinformatics of the µ-protocadherin sequence. We are also grateful to Qais Al-Awqati for a critical review of this manuscript.
| |
FOOTNOTES |
|---|
This work was funded by National Institute of Diabetes and Digestive and Kidney Diseases Grant 5-PO1-DK55388, a March of Dimes award, and the Spunk Fund (to M. Goldberg).
Address for reprint requests and other correspondence: M. Goldberg, BHS Rm. 724, Dept. of Pediatrics, College of Physicians and Surgeons, Columbia Univ., 3959 Broadway, New York, NY 10032 (E-mail: mg81{at}columbia.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
March 29, 2002;10.1152/ajprenal.00012.2002
Received 10 January 2002; accepted in final form 11 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Al-Awqati, Q,
and
Goldberg MR.
Architectural patterns in branching morphogenesis in the kidney.
Kidney Int
54:
1832-1842,
1998[Web of Science][Medline].
2.
Anders, J,
Kjar S,
and
Ibanez CF.
Molecular modeling of the extracellular domain of the RET receptor tyrosine kinase reveals multiple cadherin-like domains and a calcium-binding site.
J Biol Chem
276:
35808-35817,
2001
3.
Berg, EL,
McEvoy LM,
Berlin C,
Bargatze RF,
and
Butcher EC.
L-selectin-mediated lymphocyte rolling on MAdCAM-1.
Nature
366:
695-698,
1993[Medline].
4.
Choe, EA,
Patterson LT,
Brookhiser WT,
Mah S,
Kintner C,
and
Dressler GR.
Differential expression and function of cadherin-6 during renal epithelium development.
Development
125:
803-812,
1998[Abstract].
5.
Dantzig, AH,
Hoskins JA,
Tabas LB,
Bright S,
Shepard RL,
Jenkins IL,
Duckworth DC,
Sportsman JR,
Mackensen D,
Rosteck PR, Jr,
and
Skatrud PL.
Association of intestinal peptide transport with a protein related to the cadherin superfamily.
Science
264:
430-433,
1994
6.
Dao, D,
Walsh CP,
Yuan L,
Gorelov D,
Feng L,
Hensle T,
Nisen P,
Yamashiro DJ,
Bestor TH,
and
Tycko B.
Multipoint analysis of human chromosome 11p15/mouse distal chromosome 7: inclusion of H19/IGF2 in the minimal WT2 region, gene specificity of H19 silencing in Wilms' tumorigenesis and methylation hyper-dependence of H19 imprinting.
Hum Mol Genet
8:
1337-1352,
1999
7.
Doyle, DD,
Goings GE,
Upshaw-Earley J,
Page E,
Ranscht B,
and
Palfrey HC.
T-cadherin is a major glycophosphoinositol-anchored protein associated with noncaveolar detergent-insoluble domains of the cardiac sarcolemma.
J Biol Chem
273:
6937-6943,
1998
8.
Goldberg, M,
Peshkovsky C,
Shifteh A,
and
Al-Awqati Q.
µ-Protocadherin, a novel developmentally regulated protocadherin with mucin-like domains.
J Biol Chem
275:
24622-24629,
2000
9.
Gumbiner, BM.
Regulation of cadherin adhesive activity.
J Cell Biol
148:
399-404,
2000
10.
Hamada, S,
and
Yagi T.
The cadherin-related neuronal receptor family: a novel diversified cadherin family at the synapse.
Neurosci Res
41:
207-215,
2001[Web of Science][Medline].
11.
Ihrke, G,
Bruns JR,
Luzio JP,
and
Weisz OA.
Competing sorting signals guide endolyn along a novel route to lysosomes in MDCK cells.
EMBO J
20:
6256-6264,
2001[Web of Science][Medline].
12.
Kitada, T,
Miyoshi E,
Noda K,
Higashiyama S,
Ihara H,
Matsuura N,
Hayashi N,
Kawata S,
Matsuzawa Y,
and
Taniguchi N.
The addition of bisecting N-acetylglucosamine residues to E-cadherin down-regulates the tyrosine phosphorylation of beta-catenin.
J Biol Chem
276:
475-480,
2001
13.
Koller, E,
and
Ranscht B.
Differential targeting of T- and N-cadherin in polarized epithelial cells.
J Biol Chem
271:
30061-30067,
1996
14.
Le, TL,
Yap AS,
and
Stow JL.
Recycling of E-cadherin: a potential mechanism for regulating cadherin dynamics.
J Cell Biol
146:
219-232,
1999
15.
Ligtenberg, M,
Buijs JL,
Vos F,
and
Hilkens J.
Suppression of cellular aggregation by high levels of episialin.
Cancer Res
52:
2318-2324,
1992
16.
Mahoney, PA,
Weber U,
Onofrechuk P,
Biessmann H,
Bryant PJ,
and
Goodman CS.
The fat tumor suppressor gene in Drosophila encodes a novel member of the cadherin gene superfamily.
Cell
67:
853-868,
1991[Web of Science][Medline].
17.
Moyer, BD,
Duhaime M,
Shaw C,
Denton J,
Reynolds D,
Karlson KH,
Pfeiffer J,
Wang S,
Mickle JE,
Milewski M,
Cutting GR,
Guggino WB,
Li M,
and
Stanton BA.
The PDZ-interacting domain of cystic fibrosis transmembrane conductance regulator is required for functional expression in the apical plasma membrane.
J Biol Chem
275:
27069-27074,
2000
18.
Nakayama, M,
Nakajima D,
Nagase T,
Nomura N,
Seki N,
and
Ohara O.
Identification of high molecular-weight proteins with multiple EGF-like motifs by motif-trap screening.
Genomics
51:
27-34,
1998[Web of Science][Medline].
19.
Nollet, F,
Kools P,
and
van Roy F.
Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members.
J Mol Biol
299:
551-572,
2000[Web of Science][Medline].
20.
Paris, MJ,
and
Williams BR.
Characterization of a 500-kb contig spanning the region between c-Ha-Ras and MUC2 on chromosome 11p15.5.
Genomics
69:
196-202,
2000[Web of Science][Medline].
21.
Philippova, MP,
Bochkov VN,
Stambolsky DV,
Tkachuk VA,
and
Resink TJ.
T-cadherin and signal-transducing molecules co-localize in caveolin-rich membrane domains of vascular smooth muscle cells.
FEBS Lett
429:
207-210,
1998[Web of Science][Medline].
22.
Ponassi, M,
Jacques TS,
Ciani L,
and
ffrench-Constant C.
Expression of the rat homologue of the Drosophila fat tumour suppressor gene.
Mech Dev
80:
207-212,
1999[Web of Science][Medline].
23.
Gupta, R,
Birch H,
Rapacki K,
Brunak S,
and
Hansen JE.
O-GLYCBASE version 4.0: a revised database of O-glycosylated proteins.
Nucleic Acids Res
27:
370-372,
1999
24.
Sano, K,
Tanihara H,
Heimark RL,
Obata S,
Davidson M,
St John T,
Taketani S,
and
Suzuki S.
Protocadherins: a large family of cadherin-related molecules in central nervous system.
EMBO J
12:
2249-2256,
1993[Web of Science][Medline].
25.
Usui, T,
Shima Y,
Shimada Y,
Hirano S,
Burgess RW,
Schwarz TL,
Takeichi M,
and
Uemura T.
Flamingo, a seven-pass transmembrane cadherin, regulates planar cell polarity under the control of Frizzled.
Cell
98:
585-595,
1999[Web of Science][Medline].
26.
Van Klinken, BJ,
Dekker J,
Buller HA,
and
Einerhand A.
Mucin gene structure, and expression: protection vs. adhesion.
Am J Physiol Gastrointest Liver Physiol
269:
G613-G627,
1995
27.
Watt, SM,
Bühring H-J,
Rappold I,
Chan J Y-H,
Lee-Prudhoe J,
Jones T,
Zannettino ACW,
Simmons PJ,
Doyonnas R,
Sheer D,
and
Butler LH.
CD164, a novel sialomucin on CD34+ and erythroid subsets, is located on human chromosome 6q21.
Blood
92:
849-866,
1998
28.
Wizenmann, A,
and
Lumsden A.
Segregation of rhombomeres by differential chemoaffinity.
Mol Cell Neurosci
9:
448-459,
1997[Web of Science][Medline].
29.
Wu, Q,
and
Maniatis T.
A striking organization of a large family of human neural cadherin-like cell adhesion genes.
Cell
97:
779-790,
1999[Web of Science][Medline].
30.
Yap, AS,
Brieher WM,
and
Gumbiner BM.
Molecular and functional analysis of cadherin-based adherens junctions.
Annu Rev Cell Dev Biol
13:
119-146,
1997[Web of Science][Medline].
31.
Yeaman, C,
Le Gall AH,
Baldwin AN,
Monlauzeur L,
Le Bivic A,
and
Rodriguez-Boulan E.
The O-glycosylated stalk domain is required for apical sorting of neurotrophin receptors in polarized MDCK cells.
J Cell Biol
139:
929-940,
1997
32.
Yoshimura, M,
Ihara Y,
Matsuzawa Y,
and
Taniguchi N.
Aberrant glycosylation of E-cadherin enhances cell-cell binding to suppress metastasis.
J Biol Chem
271:
13811-13815,
1996
33.
Zafra, F,
and
Gimenez C.
Molecular determinants involved in the asymmetrical distribution of glycine transporters in polarized cells.
Biochem Soc Trans
29:
746-750,
2001[Web of Science][Medline].
This article has been cited by other articles:
![]() |
J. Jiang, D. Dean, R. C. Burghardt, and A. R. Parrish Disruption of Cadherin/Catenin Expression, Localization, and Interactions During HgCl2-Induced Nephrotoxicity Toxicol. Sci., July 1, 2004; 80(1): 170 - 182. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |