AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 283: F569-F577, 2002. First published March 19, 2002; doi:10.1152/ajprenal.00376.2001
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/F569    most recent
00376.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aizman, R.
Right arrow Articles by Garty, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aizman, R.
Right arrow Articles by Garty, H.
Vol. 283, Issue 3, F569-F577, September 2002

Generation and phenotypic analysis of CHIF knockout mice

Roman Aizman1,2,*, Carol Asher1,*, Maria Füzesi1, Hedva Latter1, Peter Lonai3, Steven J. D. Karlish1, and Haim Garty1

Departments of 1 Biological Chemistry and 3 Molecular Genetics, The Weizmann Institute of Science, Rehovot 76100, Israel; and 2 Department of Anatomy, Physiology and Health Education, Novosibirsk State Pedagogical University, Russian Federation


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Corticosteroid hormone-induced factor (CHIF) is a short epithelial-specific protein that is independently induced by aldosterone and a high-K+ diet. It is a member of the FXYD family of single-span transmembrane proteins that include phospholemman, Mat-8, and the gamma -subunit of Na+-K+-ATPase. A number of studies have suggested that these proteins are involved in the regulation of ion transport and, in particular, functionally interact with the Na+-K+-ATPase. The present study describes the characterization, targeted disruption, and phenotypic analysis of the mouse CHIF gene. The CHIF knockout mice are viable and not distinguishable from wild-type littermates under normal conditions. Under K+ loading, they have a twofold higher urine volume and an increased glomerular filtration rate. Similar but smaller effects are observed in mice fed a low-Na+ diet. Treating K+-loaded mice for 10 days with furosemide resulted in lethality in the knockout mice (17 of 39) but not in the wild-type group (1 of 39). The data are consistent with an effect of CHIF on the Na+-K+-ATPase that is specific to the outer and inner medullary duct, its major expression site.

FXYD proteins; sodium-potassium-adenosine-5'-triphosphatase; gamma -subunit; furosemide; corticosteroid hormone-induced factor; aldosterone


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CORTICOSTEROID HORMONE-INDUCED factor (CHIF) is a 6.5-kDa transmembrane protein cloned as an epithelial-specific, aldosterone-induced transcript (2, 6, 18, 23). It is a member of a new gene family termed after the invariant motif FXYD (19). The family consists of seven single-span membrane proteins, four of which have been reported to be involved in the regulation or mediation of ion transport. They are FXYD 1 (phospholemman) (15), FXYD 2 (the gamma -subunit of Na+-K+-ATPase) (12), FXYD 3 (Mat-8) (13), and FXYD 4 (CHIF) (2).

The following observations suggest that CHIF plays a role in renal and intestinal electrolyte homeostasis. First, both its mRNA and protein are specifically expressed in kidney collecting duct [cortical collecting duct < outer medullary collecting duct < inner medullary collecting duct (IMCD)] and in distal colon surface cells (top 20% of the crypt) (6, 18, 23). They cannot be detected in many other epithelial and nonepithelial tissues, including other segments of the kidney tubule and intestine, lung, stomach, uterus, mammary gland, salivary gland, heart, brain, muscle, liver, or skin. Second, CHIF appears to be independently upregulated by low-Na+ intake via changes in plasma aldosterone and by high-K+ intake, independently of aldosterone (6, 18, 23, 24).

The gamma -subunit of the Na+-K+-ATPase (FXYD 2) is the best-studied member of the above family. This 65-amino acid type I membrane protein associates with the alpha beta complex and is specifically expressed in the kidney (4, 12, 21). Functional effects of the gamma -subunit on pump kinetics have been demonstrated by either coexpressing it with alpha  and beta  in Xenopus laevis oocytes and transfected mammalian cells or neutralizing interactions in native kidney membranes using a specific anti-gamma antibody (1, 4, 16, 21, 22). Recently, it has been demonstrated that CHIF also interacts with the Na+-K+-ATPase. First, it was found to be localized in the basolateral membrane and it coprecipitated with the alpha -subunit under conditions that preserve active pump conformation (7, 18). Second, coexpressing CHIF with the alpha -subunit in X. laevis oocytes increased the Na+ affinity of the pump and decreased its apparent K+ affinity, due to an increased competition by Na+ at external binding sites (3). A phospholemman-like protein, too, was reported to interact with the alpha -subunit and to mediate its regulation by protein kinase C (PKC) in shark rectal gland (10). Thus it appears that, like gamma , CHIF and other FXYD proteins may function to modulate pump kinetics in different tissues and maintain active Na+ and K+ pumping rates under varying conditions in the cell (ATP, Na+, K+, phosphorylation, etc).

Comprehensive analysis of the role of CHIF and other FXYD proteins in body electrolyte homeostasis requires suitable animal models. The present study describes the generation and phenotypic analysis of a targeted null mutation of the CHIF gene. The mutants show two abnormalities: 1) an increased urine volume under Na+ deprivation and K+ loading and 2) lethality after a combination of high-K+ intake and furosemide injection. These observations are consistent with a role of CHIF in Na+ and K+ transport that is specific to the outer and inner medullary duct.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of a CHIF null mutant. Mice deficient in CHIF protein were generated by a targeted gene disruption. The CHIF gene was isolated by screening a mouse S129/SvJ phage genomic library with a rat cDNA probe. A ~20-kb clone was characterized by restriction mapping and partial sequencing. A 6.6-kb fragment that contains the whole transcribed region was fully sequenced and deposited in public databases under accession number AF362729. CHIF's coding sequence was disrupted by replacing a DNA fragment containing exons 3-5 (amino acids 1-33) with a neomycin (neo)-resistant cassette. The cassette was composed of neomycin phosphotransferase (accession no. U32991) flanked by 5'- and 3'-regulatory regions of mouse phosphoglycerate kinase (accession nos. X15339 and X15340, respectively). The insertion also eliminated a DraII site at position 4752, used for genotypic analysis. A herpes simplex virus thymidine kinase gene cassette was introduced in the 5'-end of the construct, resulting in homologous DNA arms of ~7 and ~1 kb.

Embryonic stem cells (R1) were transfected with linearized plasmid by electroporation and cultivated on a layer of mouse embryo fibroblasts on gelatin-coated plates. Selection was done with 200 µg/ml G418 plus 2 µM gancyclovir. G418- and gancyclovir-resistant clones were collected, further cultivated, and analyzed by Southern blotting (see below). Chimeric mice were generated by aggregation as described elsewhere (14). Morulas were obtained from MF1 mice, and the aggregates were transferred to the uterus of CD1 pseudopregnant females. Chimeric males were identified by coat color and bred with MF1 females. Germline transmission was detected by PCR and reconfirmed by Southern blotting of tail DNA. For PCR, an ~1,000-bp fragment was amplified using the primers AGATCTATAGATCTCTCGTGGG (within the 3'-region of the neo cassette) and CCTTCCTGCATTCCACC (nucleotides 5730-5746 of the CHIF gene, located outside the targeting construct). The amplified fragment was also sequenced to verify proper recombination. For Southern blotting, genomic DNA was digested with DraII and hybridized to a probe corresponding to nucleotides 5650-6099 of the CHIF gene (located outside the targeting construct). The predicted sizes of the hybridizing fragments in the original and disrupted genes are 1.5 and 3.2 kb, respectively. Disruption of CHIF was further analyzed by Northern and Western blotting (see below). Wild-type and homozygous littermates were used to establish matched colonies of +/+ and -/- mice used in physiological assays.

Northern and Western hybridizations. Mice were killed by cervical dislocation, and distal colons and kidneys were excised and rinsed in ice-cold PBS. Kidneys were dissected into cortex, medulla, and papilla, and microsomal membranes were prepared as described before (8). Distal colon surface cells (colonocytes) were isolated by a modification of the procedure described elsewhere (17). In brief, colonic tubes were flushed three times with 10 ml of ice-cold PBS+2 mM dithiothreitol (DTT) and inverted (lumen out). The inverted colons were tied at one end, filled with DMEM+10% FCS, 2 mM DTT, and 2 mM EDTA and then tied at the other end as well. The filled colons were suspended in 25 ml of the above DMEM-EDTA medium and incubated at 37°C for 40 min under shaking at 140 rpm. Colonocytes were collected from the medium by centrifugation and stored at -70°C. Colonic and kidney total RNA was extracted as described before (23). Northern hybridization was carried out using a [32P]-labeled cDNA probe prepared from a mouse CHIF expressed sequence tag (EST) clone (accession no. aa874059). For Western hybridization, a rabbit polyclonal antibody was raised against the synthetic peptide CKATPLIIPGSANT (amino acids 75-87 of the mouse protein) coupled to keyhole limpet hemocyanin through its NH2-terminal cysteine. Kidney microsomal membranes and colonocyte whole cell lysates were resolved on a 10% tricine gel, blotted with the above anti-sera (1:200), and overlaid with horseradish peroxidase-coupled goat-anti rabbit antibody.

Animal treatment and metabolic cage studies. Monitoring of water uptake and urine excretion was done in metabolic cages. A typical experiment consisted of two matched groups of 12-18 +/+ and -/- mice weighing 30-40 g with an equal number of males and females. Mice were placed in metabolic cages (3 mice/cage) and acclimated for 10 days before the experiment. They were first fed a regular diet (6.8 g K+/kg, 2.3 g Na+/kg, 1.65 g Cl-/kg), and the following measurements were performed daily: body weight, water and food intake, and urine volume. They were then fed either a high-KCl diet (94.1 g K+/kg, 2.3 g Na+/kg, 81.1 g Cl-/kg) or an Na+-deficient diet (2.5 g K+/kg, <0.01 g Na+/kg, 1.57 g Cl-/kg) and monitored for an additional 7-10 days. Experiments were conducted in conformity with the Guiding Principles for Research Involving Animals and Human Beings and were supervised by the Animal Welfare Committee of the Weizmann Institute. Urine and blood sera were analyzed for K+ and Na+ content, osmolality, and creatinine concentration. Electrolyte concentrations were measured by atomic absorption spectroscopy (Spectra-AA-50) and osmolarity with a vapor pressure osmometer (Wescor). Blood and urine creatinine levels were measured with a commercial kit (Sigma Diagnostics, St. Louis, MO) and used to calculate the glomerular filtration rates (GFR). Plasma aldosterone was determined using a radioimmunoassay kit (Coat-a-Count Aldosterone; DGP, Los Angeles, CA).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CHIF gene structure and the generation of knockout mice. CHIF has been cloned and sequenced before only from rats. The mouse mRNA and protein sequences were deduced by assembling 26 EST entries and resequencing one of them, which was found to be identical to one reported previously (19). Figure 1A depicts the predicted amino acid sequence of mouse CHIF. It shares 85% identity with the previously cloned rat protein and has the same membrane topology. The corresponding cDNA has no stop codon upstream of the first AUG. Hence, it may in principle represent a longer protein than the one depicted in Fig. 1A. However, its homology to phospholemman and the gamma -subunit of Na+-K+- ATPase, which were sequenced at the protein level (9, 15), makes this possibility unlikely.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   A: deduced amino acid sequence of mouse corticosteroid hormone-induced factor (CHIF). B: exon organization of the CHIF gene. The nucleotide position and amino acid sequence of each exon are listed in Table 1. C: structure of the targeting construct. tk, Thymidine kinase; neo, neomycin. D: Southern blot analysis of mouse CHIF. Genomic DNA was isolated from mouse tail and digested with EcoRI, SacI, PstI, and BamHI. Samples of cut and uncut DNA were resolved on 1% agarose and blotted with a probe corresponding to nucleotides 5073-6552 (exons 6-9).

A genomic ~20-kb CHIF clone was obtained by screening a mouse genomic library, and a 6.6-kb fragment that contains the whole transcribed region was fully sequenced. Exon-intron organization of this genomic sequence was determined by aligning it with the cDNA sequence and is depicted in Fig. 1B and Table 1. The two sequences were fully matched, and consensus splice donor/acceptor sites were found at each predicted exon-intron junction. Despite the very small size of CHIF mRNA (0.55 kb) and protein (88 amino acids), it is composed of 9 exons (Fig. 1B, Table 1). Similar multiexonic structures were reported for two other members of the FXYD family: phospholemman (5) and the gamma -subunit of Na+-K+-ATPase (11, 20). Lack of other similar CHIF sequences in the mouse genome was verified by Southern blotting. Genomic mouse DNA was digested with four different restriction enzymes and hybridized to a 2-kb probe that corresponds to most of the coding sequence. In all cases, the probe hybridized only to DNA fragments, the sizes of which are predicted by the cloned sequence (Fig. 1D).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Location and protein sequence of CHIF exons

The targeting construct used is illustrated in Fig. 1C. A 1.5-kb fragment corresponding to nucleotides 3195-4752 was replaced by a 1.9-kb neo gene. The replacement deleted exons 3-5, which code for the first 33 amino acids of CHIF, and eliminated a DraII site used for a genotypic analysis. Embryonic stem cells were transfected and selected, and chimeric mice were generated and bred by standard procedures summarized under MATERIALS AND METHODS. CHIF +/- mice were identified by Southern blotting of tail DNA and bred to produce -/- mice (Fig. 2A). Deletion of CHIF mRNA and protein was further confirmed by Northern and Western hybridizations (Fig. 2, B and C). In +/+ mice, the anti-CHIF antibody blotted an ~6.5-kDa protein present in kidney and distal colon. In agreement with previous studies (18), the abundance of this protein was strongly elevated by low-Na+ intake but not by a high-K+ diet (Fig. 2C). This 6.5-kDa band could not be detected in -/- mice under any of these conditions.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2.   A: Southern hybridization of DraII-digested genomic DNA from CHIF (+/-) × (+/-) offspring. The predicted sizes of the wild-type and neo-disrupted alleles are 1.5 and 3.2 kb, respectively. B: Northern blot hybridization of distal colon total RNA from low-Na+-fed mice with CHIF cDNA. C: Western blot hybridization of colonocytes and kidney medulla membranes with anti-CHIF antibody. Matched groups of mice were fed normal (C), high-K+ (HK), and low-Na+ (LN) diets for 2 wk. For each treatment, colonocytes were collected from 3 different mice and blotted with the anti-CHIF antibody. Arrows, positions of CHIF.

Phenotypic analysis of knockout mice. CHIF -/- mice were viable and fertile and could not be distinguished from +/+ or +/- littermates by visual inspection. Under normal conditions, they showed slightly higher water and food intake, but nevertheless were ~15% smaller than matched +/+ mice (Table 2). Because CHIF is primarily expressed in kidney and is regulated by salt intake, we have looked for phenotypes associated with kidney function under normal and electrolyte stress conditions. Figures 3 and 4 summarize an experiment in which matched groups of 12 +/+ and 12 -/- mice were studied, first under normal conditions and then during K+ loading. The high-KCl diet increased their K+ intake by ~13-fold, with no change in Na+ intake (Table 3). Under normal conditions, either no or small differences were observed between the two groups. K+ loading resulted in substantial differences in two parameters. The first was the volume of urine excreted, and the second was the GFR. The high-K+ diet increased urine output in both wild-type and knockout mice, but urine volume in -/- mice was up to twofold higher than in the matched +/+ group (Fig. 3). The higher urine excretion was matched by an increased water intake so that the ratio of water intake to excretion was not significantly different in +/+ and -/- mice (Fig. 4A). The fractional Na+ and K+ excreted in the urine were similar as well. Because GFR changed significantly during high-K+ treatment, we have also calculated the rates of water reabsorption and Na+ and K+ excretion as a fraction of GFR. As above, no significant difference has been noted between +/+ and -/- mice (Table 4). Also, no significant differences between +/+ and -/- mice were observed in plasma Na+ and K+ concentrations, aldosterone levels, and osmolality (Fig. 4B, Table 3).

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Mouse weight and food and water intake under normal conditions



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Matched groups of +/+ and -/- mice were monitored in metabolic cages. They were examined for 5 days under normal conditions and for another 10 days under K+ loading. Urine volumes (A) and glomerular filtration rates (B) (in ml · 100 g body wt-1 · h-1) are plotted as a function of time. Values are means ± SE of 12 mice (6 males, 6 females).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4.   A: H2O, K+, and Na+ excreted in the urine are expressed as a fraction of their intake. Values are means ± SD of measurements over a period of 5 days. B: plasma concentrations of Na+ and K+ and osmolality in +/+ and -/- mice under normal (C) and high-K+ rations (HK). Values are means ± SE of 12 mice under each condition.


                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Salt intake and plasma aldosterone in mice on different diets


                              
View this table:
[in this window]
[in a new window]
 
Table 4.   Fractional excretion/reabsorption rates in mice on different diets

Similar experiments were carried out in mice fed a low-Na+ diet. In these experiments, Na+ intake was reduced from 32-36 µeq · 100 g-1 · h-1 to practically zero, and K+ intake was reduced by about one-half (Table 3). This treatment also evoked an up to twofold difference in urine output between -/- and +/+ mice (Fig. 5). In this case, the difference was transient and not accompanied by profound differences in GFR. The excreted and plasma K+ and Na+ were similar as well (Fig. 6, Table 4). However, in -/- mice it appeared that under low-Na+ intake, plasma Na+ was significantly reduced (124 ± 2 vs. 137 ± 3 mM, P < 0.02).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Matched groups of +/+ and -/- mice were monitored for 5 days under normal conditions and for another 10 days under Na+ deprivation. Urine volumes and glomerular filtration rates are plotted as function of time. Values are means ± SE of 12 mice (6 males, 6 females).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   A: H2O and K+ excreted in the urine are expressed as the fraction of their intake. Na+ excretion is expressed in absolute units because Na+ intake under a low-Na+ diet (LNa) is virtually zero. Values are means ± SD of measurements in 12 mice over a period of 5 days. B: plasma concentrations of Na+, K+, and osmolality in +/+ and -/- mice under normal (C) and low-Na+ rations. Values are means ± SE of 12 mice under each condition.

The above data suggest that CHIF knockout mice show higher water intake and excretion under electrolyte stress. To further explore this issue, we have examined urine excretion rates during two other forms of diuresis. In the first, mice were given 6% sucrose in their drinking water and no solid food. This treatment evoked an ~10-fold increase in urine output, but no differences were observed between +/+ and -/- mice (Fig. 7A). In the second form, mice were fed a regular diet and furosemide (1.5 mg/ml) was included in their drinking water. The inhibition of NaCl absorption in the thick ascending limb of Henle led to a marked diuresis, and the excreted urine volume was transiently higher in CHIF -/- mice (Fig. 7B). Thus the observed increase in urine volume appears to be linked to modulations in ion transport. To further assess this issue, we examined the combined effect of K+ loading and furosemide. The combined stress was well tolerated by wild-type mice, and 38 of 39 survived a 10-day treatment. In the knockout group, substantial lethality was noted and 44% of them died during this period (Fig. 8). Effects of the above manipulations on plasma electrolytes and osmolarity are summarized in Table 5. As expected, the high-K+ intake elevated plasma K+ and the sucrose diet lowered plasma osmolarity. The combined stress of high K+ and furosemide resulted in hyperkalemia, which was more severe in the -/- mice and was probably the reason for lethality in these mice.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7.   Matched groups of 18 +/+ and -/- mice were first monitored under normal conditions and then treated as follows: received no food and had free access to water that contained 6% sucrose (A) or received normal food and furosemide in their drinking water (1.5 mg/ml; B).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8.   Matched groups each of 39 mice were fed high-K+ diets and received daily injections of furosemide (20 mg/kg). The no. of surviving mice is plotted as function of the treatment time.


                              
View this table:
[in this window]
[in a new window]
 
Table 5.   Plasma Na+, K+, and osmolarity after various treatments


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The present study describes the generation and phenotypic analysis of a targeted mutation of the CHIF gene. Sequencing of the mouse CHIF gene revealed the existence of nine exons, two of which transcribe a 5'-untranslated region. This is quite unexpected for a very small mRNA (0.55 kb) and protein (88 amino acids). However, a similar multiexonic structure has been reported for two other members of the FXYD family, phospholemman and the gamma -subunit of Na+-K+-ATPase (5, 11, 20). The obvious advantage of such genomic organization would be to enable expression of alternatively spliced products. Two gamma -splice variants, with different extracellular sequences, and localization along the nephron have indeed been reported (9, 16, 19). Phospholemman also appears to have several splice variants (5), which differ only in the 5'-untranslated region, and their expression could be differentially regulated. So far, alternatively spliced forms of CHIF have not been detected experimentally. EST entries that deviate from the consensus mRNA sequence have been deposited in public databases, but they do not appear to represent alternatively spliced forms of the above gene.

Deletion of the CHIF gene was done by standard methods and confirmed by Southern, Northern, and Western hybridizations. The homozygous mutants appeared normal in most parameters measured. The major phenotype observed is a larger volume of urine excretion (and water intake) under conditions of K+ loading or Na+ deprivation. Such an abnormality is consistent with the high abundance of CHIF in the IMCD, a major site in regulating water homeostasis. The fact that the phenotype is apparent during electrolyte stress but not when diuresis is evoked by excessive water intake suggests a secondary response mediated by alterations in Na+ and K+ transport. It has been recently demonstrated that CHIF interacts with the Na+-K+-ATPase and increases its affinity to cell Na+ while decreasing its apparent K+ affinity (3, 7). The last effect is due to an increased competition by Na+ at external K+ binding sites. One may therefore predict that the deletion of CHIF will affect pump kinetics and partly inhibit collecting duct K+ excretion and/or Na+ absorption. This may not directly affect electrolyte homeostasis because inhibition is only partial and probably well compensated for by the increased GFR and elevated transport rates in the more proximal nephron segments. The observed increase in water excretion may therefore reflect either the elevated GFR under K+ loading or a secondary response of the IMCD to the inhibited Na+/K+ transport. However, a defect in K+ secretion could be noted when K+ loading was combined with the inhibition of NaCl absorption by furosemide. Under these conditions, 44% of the -/- mice died within 10 days, and the rest were hyperkalemic relative to the +/+ mice. While this phenomenon demonstrates an essential role of CHIF under these stress conditions, its molecular mechanism is not obvious. In principle, it may reflect either an excessive volume depletion or inhibition of K+ excretion, which becomes lethal in the -/- mice. Plasma K+ and osmolarity measurements summarized in Table 5 indicate that the second possibility is the more likely one.


    ACKNOWLEDGEMENTS

We thank Ahuva Knyszynski and Tatyana Burakov for help in generating the knockout mice.


    FOOTNOTES

* R. Aizman and C. Asher contributed equally to this work.

This study was supported by research grants from the Minerva Foundation (H. Garty and S. J. D. Karlish) and the Crown Endowment Fund (to H. Garty).

Address for reprint requests and other correspondence: H. Garty, Dept. of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100 Israel (E-mail: h.garty{at}weizmann.ac.il).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

March 19, 2002;10.1152/ajprenal.00376.2001

Received 26 December 2001; accepted in final form 13 March 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Arystarkhova, E, Wetzel RK, Asinovski NK, and Sweadner KJ. The gamma subunit modulates Na+ and K+ affinity of the renal Na,K-ATPase. J Biol Chem 274: 33183-33185, 1999[Abstract/Free Full Text].

2.   Attali, B, Latter H, Rachamim N, and Garty H. A corticosteroid-induced gene expressing an "IsK-like" K+ channel activity in Xenopus oocytes. Proc Natl Acad Sci USA 92: 6092-6096, 1995[Abstract/Free Full Text].

3.   Béguin, P, Crambert G, Guennoun S, Garty H, Horisberger JD, and Geering K. CHIF, a member of the FXYD protein family, is a regulator of Na,K-ATPase distinct from the gamma subunit. EMBO J 20: 3993-4002, 2001[Web of Science][Medline].

4.   Beguin, P, Wang XY, Firsov D, Puoti A, Claeys D, Horisberger JD, and Geering K. The gamma subunit is a specific component of the Na,K-ATPase and modulates its transport function. EMBO J 16: 4250-4260, 1997[Web of Science][Medline].

5.   Bogaev, RC, Jia L, Kobayashi YM, Palmer CJ, Mounsey JP, Moorman JR, Jones LR, and Tucker AL. Gene structure and expression of phospholemman in mouse. Gene 271: 69-79, 2001[Web of Science][Medline].

6.   Capurro, C, Bonvalet JP, Escoubet B, Garty H, and Farman N. Cellular localization and regulation of CHIF in kidney and colon. Am J Physiol Cell Physiol 271: C753-C762, 1996[Abstract/Free Full Text].

7.  Garty H, Lindzen M, Scanzano R, Aizman R, Fuzesi M, Carradus M, Goldschleger R, Farman N, Blostein R, and Karlish SJD. A specific functional interaction between CHIF and Na,K-ATPase. Implication for regulation by FXYD. Am J Physiol Renal Physiol (April 16, 2002). 10.1152/ajprenal.00112.2002.

8.   Jorgensen, PL. Purification of Na+,K+-ATPase: enzyme sources, preparative problems, and preparation from mammalian kidney. Methods Enzymol 156: 29-43, 1988[Web of Science][Medline].

9.   Kuster, B, Shainskaya A, Pu HX, Goldshleger R, Blostein R, Mann M, and Karlish SJ. A new variant of the gamma subunit of renal Na,K-ATPase. Identification by mass spectrometry, antibody binding, and expression in cultured cells. J Biol Chem 275: 18441-18446, 2000[Abstract/Free Full Text].

10.   Mahmmoud, YA, Vorum H, and Cornelius F. Identification of a phospholemman-like protein from shark rectal glands. Evidence for indirect regulation of na,k-ATPase by protein kinase c via a novel member of the FXYDY family. J Biol Chem 275: 35969-35977, 2000[Abstract/Free Full Text].

11.   Meij, IC, Koenderink JB, van Bokhoven H, Assink KF, Tiel Groenestege W, de Pont JJ, Bindels RJ, Monnens LA, van Den Heuvel LP, and Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase gamma-subunit. Nat Genet 26: 265-266, 2000[Web of Science][Medline].

12.   Mercer, RW, Biemesderfer D, Bliss DP, Collins JH, and Forbush B. Molecular cloning and immunological characterization of the gamma polypeptide, a small protein associated with the Na,K-ATPase. J Cell Biol 121: 579-586, 1993[Abstract/Free Full Text].

13.   Morrison, BW, Moorman JR, Kowdley GC, Kobayashi YM, Jones LR, and Leder P. Mat-8, a novel phospholemman-like protein expressed in human breast tumors, induces a chloride conductance in Xenopus oocytes. J Biol Chem 270: 2176-2182, 1995[Abstract/Free Full Text].

14.   Nagy, A, and Rossant J. Production of completely ES cell derived fetuses. In: Gene Targeting: A Practical Approach, edited by Joyner AL.. Oxford, UK: Oxford University Press, 1993, p. 147-179.

15.   Palmer, CJ, Scott BT, and Jones LR. Purification and complete sequence determination of the major plasma membrane substrate for cAMP-dependent protein kinase and protein kinase C in myocardium. J Biol Chem 266: 11126-11130, 1991[Abstract/Free Full Text].

16.   Pu, HX, Cluzeaud F, Goldshleger R, Karlish SJD, Farman N, and Blostein R. Functional role and immunocytochemical localization of the gamma a and gamma b forms of the Na,K-ATPase gamma  subunit. J Biol Chem 276: 20370-20378, 2001[Abstract/Free Full Text].

17.   Schwartz, B, Avivi C, and Lamprecht SA. Isolation and characterization of normal and neoplastic colonic epithelial cell populations. Gastroenterology 100: 692-702, 1991[Web of Science][Medline].

18.   Shi, HK, Levy-Holzman R, Cluzeaud F, Farman N, and Garty H. Membrane topology and immunolocalization of CHIF in kidney and intestine. Am J Physiol Renal Physiol 280: F505-F515, 2001[Abstract/Free Full Text].

19.   Sweadner, KJ, and Rael E. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics 68: 41-56, 2000[Web of Science][Medline].

20.   Sweadner, KJ, Wetzel RK, and Arystarkhova E. Genomic organization of the human FXYD2 gene encoding the gamma subunit of the Na,K-ATPase. Biochem Biophys Res Commun 279: 196-201, 2000[Web of Science][Medline].

21.   Therien, AG, Goldshleger R, Karlish SJD, and Blostein R. Tissue-specific distribution and modulatory role of the gamma subunit of the Na,K-ATPase. J Biol Chem 272: 32628-32634, 1997[Abstract/Free Full Text].

22.   Therien, AG, Karlish SJ, and Blostein R. Expression and functional role of the gamma subunit of the Na, K-ATPase in mammalian cells. J Biol Chem 274: 12252-12256, 1999[Abstract/Free Full Text].

23.   Wald, H, Goldstein O, Asher C, Yagil Y, and Garty H. Aldosterone induction and epithelial distribution of CHIF. Am J Physiol Renal Fluid Electrolyte Physiol 271: F322-F329, 1996[Abstract/Free Full Text].

24.   Wald, H, Popovtzer MM, and Garty H. Differential regulation of CHIF expression by aldosterone and potassium. Am J Physiol Renal Physiol 272: F617-F623, 1997[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 283(3):F569-F577
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
I. Lubarski, S. J. D. Karlish, and H. Garty
Structural and functional interactions between FXYD5 and the Na+-K+-ATPase
Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1818 - F1826.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Q. Cai, M. Keck, M. R. McReynolds, J. D. Klein, K. Greer, K. Sharma, J. B. Hoying, J. M. Sands, and H. L. Brooks
Effects of water restriction on gene expression in mouse renal medulla: identification of 3betaHSD4 as a collecting duct protein
Am J Physiol Renal Physiol, July 1, 2006; 291(1): F218 - F224.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. Geering
FXYD proteins: new regulators of Na-K-ATPase
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F241 - F250.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. M C Connell and E. Davies
The new biology of aldosterone
J. Endocrinol., July 1, 2005; 186(1): 1 - 20.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Qi, I. Whitt, A. Mehta, J. Jin, M. Zhao, R. C. Harris, A. B. Fogo, and M. D. Breyer
Serial determination of glomerular filtration rate in conscious mice using FITC-inulin clearance
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F590 - F596.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/F569    most recent
00376.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aizman, R.
Right arrow Articles by Garty, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aizman, R.
Right arrow Articles by Garty, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online